Genetically modified plants and their applications in phytoremediation

Information

  • Patent Application
  • 20090155911
  • Publication Number
    20090155911
  • Date Filed
    March 18, 2005
    20 years ago
  • Date Published
    June 18, 2009
    16 years ago
Abstract
Genetically modified plants able to accumulate heavy metals in shoots and methods of removing and possibly recovering said heavy metals, using said genetically modified plants. Said genetically modified plants include more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn<2+>/Co<2+>/Cd<2+>/Pb<2+> subclass and that they overexpress said P1B-type ATPase.
Description

The instant invention relates generally to the field of phytoremediation. More particularly the invention relates to genetically modified plants able to accumulate heavy metals in shoots and to methods of removing and possibly recovering said heavy metals, using said genetically modified plants.


Numerous ecological and health problems are associated with environmental contamination. Heavy metals contamination of soils is a particular hazard, due to the almost indefinite environmental persistence of metals. While some heavy metals are naturally present in soil, heavy metal contamination is often the result of human activities. Contamination of the environment with heavy metals has increased drastically due to industrialization: mining, smelting, intensive agriculture, sludge dumping, energy and fuel production, electroplating and fuel exhaust contribute to contaminating the soil with heavy metals.


The soils contaminated with heavy metals inhibit normal plant growth and cause contamination of foodstuffs. Many heavy metals are very toxic to human health and carcinogenic at low concentrations. Therefore removal of heavy metals from the environment is crucial.


Currently, the most common methods for dealing with this problem remain removal and burial of the contaminated soil or the isolation of the contaminated area. However, such methods are extremely expensive.


One relatively new option for decontaminating soil is phytoremediation, which uses plants to scavenge organic and inorganic contaminants from the soil.


Phytoremediation may be divided into phytoextraction, rhizofiltration and phytostabilization:

    • Phytoextraction is a method using contaminant-accumulating plants to extract said contaminants from soil into the harvestable parts of the plants;
    • Rhizofiltration is a method using plant roots to remove contaminants from polluted aqueous streams; and
    • Phytostabilization is the stabilization of contaminants such as toxic metals in soils to prevent their entry into ground water, also with plants.


However, usually most plants are unable to grow in soil containing high levels of heavy metals.


Certain plants have been found to accumulate nickel, cobalt, copper, lead, zinc, cadmium and selenium. Accumulators of nickel are by far the most common amongst the hyper accumulators discovered to date. The more rarely absorbed heavy metals include manganese, cadmium and lead, with lead being particularly hard to absorb as well as being very difficult to translocate from plant roots into plant stems after it is absorbed.


Therefore, there is a need for plants being able to grow in soils containing high concentrations of heavy metals. To confer heavy metal resistance to plants, it has been proposed to use the properties of heavy metal-transporting P-type ATPase and more specifically the P1B-ATPases which are known to be heavy metal transporters.


The P1B-ATPases are transporters that use the energy liberated in the exergonic ATP hydrolysis reaction to translocate positively charged substrates across membranes (Inesi, 1985). P1B-ATPases are found in all living organisms, from archaea to humans and are thought to transport soft metal cations. They are referred to as HMAs (Axelsen and Palmgren, 2001; Williams et al., 2000) or CPx-type ATPases (Solioz and Vulpe, 1996; Rensing et al., 1997; Williams et al., 2000).


In the yeast Saccharomyces cerevisiae, only 2 P1B-ATPases have been found (Catty et al., 1997), CCC2 and PCA1, both participating in copper transport (Fu et al., 1995; Bassett Jr et al., 1996; Ran et al., 1994).


In Arabidopsis thaliana, seven P1B-ATPases were previously identified (Axelsen and Palmgren, 2001) but the recent genome release revealed an eighth gene belonging to the HMAs group (P-type ATPase database; http://biobase.dk/˜axe/Patbase.html).


The recent completion of two draft sequences of the rice (Oryza saliva) genome shows a similar number of enzymes within this group. Compared with other eukaryotes, which only possess one or two P1B-ATPases, the parallel expansion of the number of HMAs in Arabidopsis and Oryza suggests that these enzymes play important roles in the overall movements of metals in plants.


In both species, these eight proteins have been classified in 6 clusters, based on full-length sequence alignments and intron positions (Baxter et al., 2003). In Arabidopsis, the two first clusters (HMA1, HMA2-4, respectively) are possible Zn/Cd/Co/Pb ATPases; the four others have a potential role in Cu/Ag transport. The first two characterised enzymes are members of this last subgroup. AtHMA7 (RAN1) has been identified as a copper transporter to ethylene receptors (Hirayama et al., 1999; Woeste and Kieber, 2000). Recently AtHMA6 (PAA1) has been characterised as a Cu transporter, participating in the translocation of this metal to chloroplastic copper proteins (Shikanai et al., 2003). Also, all eukaryotic HMAs characterised so far belong to this Cu/Ag subgroup.


Despite many members of the Zn/Cd/Co/Pb subgroup being known (Rensing et al., 1998; Hou and Mitra, 2003; Lebrun et al., 1994a and 1994b; Tsai et al., 2002), the first characterization of one homologue in plants has only just been published (Mills et al., 2003). These Authors showed that AtHMA4 induced an increased tolerance to Cd in wild-type Saccharomyces cerevisiae and restored Zn resistance of the Escherichia coli zntA mutant, which is highly sensitive to this metal. As predicted, AtHMA4 was unable to restore copper tolerance in the copA mutant context.


Therefore, it has been proposed to use the properties of these trans-porters in view to essentially increase resistance of plants to heavy metals:

    • European Patent Application 1 136 558 proposes plants including sequences encoding one or more heterologous heavy metal transport and/or sequestration proteins of various prokaryotic or eukaryotic origins. The metal transport proteins are, for instance, membrane proteins such as P-type ATPases and preferably a bacterial P-type ATPase, such as cadmium ATPase. It is specified that such plants have improved heavy metal tolerance and possibly heavy metal accumulation; however, as regards the use of cadmium ATPase modified plant, the increased resistance of the plant to cadmium is the only characteristic pointed out.
    • The PCT International Application WO 02/081707 discloses plant transformants with enhanced heavy metal resistance and decreased-uptake of heavy metals. The P-type ATPase used to transform the plants is the ZntA, that is a P-type ATPase of E. coli, which pumps Pb(II)/Cd(II)/Zn(II) across the plasma membrane. More specifically it is considered, in said PCT International Application that biologically active ZntA-like heavy metal pumping ATPases include zinc-transporting ATPase (NC000913), zinc-transporting ATPase (NC002655), heavy metal-transporting ATPase (NC 003 198), P-type ATPase family (NC003197), cation transporting P-type ATPase from Mycobacterium leprae (GenBank #Z46257) and many others may be used. ZntA-transgenic plants and for instance ZntA-transgenic Arabidopsis plants are described; said plants showed enhanced resistance to lead and cadmium and the content of lead and cadmium was lower than in a wild-type plant. Therefore such transformed plants can grow in an environment contaminated with heavy metals; thus, said technique can be useful for generating crop plants with decreased uptake of harmful heavy metals. This is confirmed by the article in the name of LEE J. et al. (Plant Physiol., 2003), Inventors of said PCT International Application, which confirm that a bacterial heavy metal pump, ZntA, can be expressed in Arabidopsis, resulting in increased resistance to Pb(II) and Cd(II) and reduced heavy metal contents in the shoots of the transgenic plants. Therefore, both documents show that it is feasible to develop plants, i.e., transgenic ZntA Arabidopsis plants, with enhanced resistance and reduced uptake of heavy metals. They conclude that if ZntA can be introduced into crop plants, the resulting plants would be safer because they would contain less heavy metal in their shoots.


Therefore, the aim of the transgenic plants described in these two documents is not phytoremediation; thus the transgenic plants proposed in said documents cannot be used for phytoremediation and more specifically for phytoextraction, as defined here above.

    • Mills R. F et al, (Plant J., 2003, precited) showed that AtHMA4, a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass induced an increased tolerance to Cd in wild-type Saccharomyces cerevisiae and restored Zn resistance of the Escherichia coli zntA mutant, which is highly sensitive to this metal. Even though they consider that there is considerable interest in metal transport in plants because of the implications for phytoremediation, it is only shown, in said document, that AtHMA4 is mainly expressed in roots of Arabidopsis and that it could function in planta as a detoxification system in epidermal root cells, existing at the plasma membrane to pump excess metals such as Zn or Cd into the rhizosphere. Therefore, they propose to use plants containing AtHMA4 for rhizofiltration.


It emerges from the foregoing that none of the disclosed methods proposes an efficient phytoremediation system for removal of heavy metals from soil, i.e., a method using the phytoextraction process, which is particularly adapted to heavy metal removal from soil. Indeed, the prior disclosed methods have focused on the selection of plants that have a lower uptake of heavy metals than the wild-type, and that maintain healthy growth even in an environment contaminated with heavy metals and not on phytoremediation by phytoextraction.


Moreover, despite ever increasing interest and research in the field, several problems associated with phytoremediation remain. For instance, many metal-accumulating plants are unable to translocate a substantial proportion of the metal they acquire from their roots to other tissues.


Therefore, there is a need for plants able to extract heavy metals in harvestable parts thereof, in view to propose a cost-effective phytoremediation of heavy metals by phytoextraction.


The Inventors have found that, unexpectedly, plants overexpressing at least one P1B-ATPase of the subfamily or subclass of the Zn2+/Co2+/Cd2+/Pb2+ trans-porters are good candidates for their use in a method of phytoremediation using the phytoextraction process, knowing that such genetically modified plants translocate efficiently the heavy metals in the shoots.


Therefore, in one aspect of the invention, genetically modified plants are provided which are able to accumulate heavy metals and translocate them to the shoots and more specifically to the stems and the leaves.


The preferred embodiments of this aspect of the invention include genetically modified plants, characterized in that they include one or more than one copy of a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass and that they overexpress said P1B-type ATPase. No need to say that “include one or more than one copy of a sequence encoding a P1B-type ATPase” means that said genetically modified plants include at least one additional copy of the sequence encoding said ATPase. In a preferred embodiment, the plants are homozygous, and therefore contain an even number of copies of the added sequence (at least two). As described in the examples below, the homozygous plants can be obtained by self-crossing of transformed plants.


According to the invention, said P1B-type ATPase is preferably of eukaryotic origin, and more preferably from a higher plant. In a preferred embodiment, said P1B-type ATPase is selected amongst HMA1, HMA2, HMA3 and HMA4. When the wild-type plant to be genetically modified for phytoremediation possesses HMA gene(s), additional copies of at least one of said endogenous gene(s) is (are) preferably introduced into said plant genome, in order of overexpress said endogenous gene(s). Alternatively, for example in case the wild-type plant is defective for the P1B-type ATPase, the expression of which is desired in said plant for achieving phytoremediation of heavy metals, said P1B-type ATPase can be selected from the group consisting of heavy metal ATPase HMA1 to HMA4 of Arabidopsis thaliana (i.e., AtHMA1, AtHMA2, AtHMA3 and AtHMA4), whatever the ecotype, or from another plant species. The corresponding sequences of Arabidopsis thaliana are available on the following websites: http://mips.gsf.de or http://biobase.dk/˜axe/Patbase.html.


The nucleic sequences which may advantageously be used are the ones of Arabidopsis thaliana:

    • ecotype Ws (Wassilewskija): AY054390 (AtHMA2), AY434729 or AY055217 (AtHMA3), AF412407 (AtHMA4));
    • ecotype Columbia: NM119890 (AtHMA1), NM119157 or AY434728 (AtHMA2), NM119158 or AY434730 (AtHMA3), NM127468 or AJ297264 (AtHMA4);
    • ecotype Landsberg: AJ400906 (AtHMA1).


However, the invention includes also the use of corresponding sequences of other wild ecotypes of Arabidopsis thaliana. The skilled artisan may easily retrieve said equivalent sequences to the ones specified hereabove (AtHMA1-4) by appropriate alignment with said sequences.


According to another embodiment of the invention, said genetically modified plant includes one or more than one copy of at least two different sequences encoding two different P1B-type ATPases of the Zn2+/Co2+/Cd2+/Pb2+ subclass. According to this embodiment, the genetically modified plant preferably overexpresses at least both HMA3 and HMA4.


According to yet another embodiment of the invention, said genetically modified plant includes one or more than one copy of a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass and at least another sequence selected among sequences encoding (I) an enzyme involved in metal chelation (for example, phytochelatin synthase, glutathion synthetase or gamma-glutamylcystein synthase) or (2) another metal transporter such as YCF1 or other ABC transporters.


Said AtHMA sequence can be inserted in an appropriate vector, said AtHMA sequence being operably linked to and under the regulatory control of a plant-expressible transcription and translation regulatory sequence, such as a plant specific promoter and more preferably the CaMV35S promoter, and said vector is introduced in the selected plants with known methods. Said vector is advantageously an Agrobacterium plant shuttle vector.


Preferably said vector may be introduced in plants, such vector allowing the transformation of plants with the Agrobacterium tumefaciens technology. Transformed plants can then be self-crossed for obtaining homozygous stable lines.


According to the invention, the plants to be used are selected in the group consisting of Brassica juncea, Poplar, Nicotiana tabacum.


The instant invention also relates to a recombinant vector able to transform plants, characterized in that said vector includes one or more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass (heavy metal pumping ATPases) in view that said transformed plants overexpress at least one of said P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass. The ATPase encoded by the sequence introduced in a vector according to the invention is chosen so that it is able to translocate heavy metals to the shoots of a plant when expressed in said plant. Hence, ZntA is not an appropriate ATPase for use according to the invention. Examples of ATPases that can be advantageously used are eukaryotic P1B-ATPases HMA1, HMA2, HMA3 and HMA4, especially those originating from plants close to the plants that are used for phytoremediation.


Advantageously, said coding sequences are operably linked to and under the regulatory control of a plant-expressible transcription and translation regulatory sequence, such as a plant specific promoter.


In a particular embodiment, the recombinant vector according to the invention comprises a first sequence encoding HMA3, and a second sequence encoding HMA4. As described in Example 3 below, these two ATPases act synergistically to accumulate heavy metals—especially Co, Pb and Cd—in the shoot. The invention thus also relates to a set of recombinant vectors as described above, comprising at least a first vector encoding HMA3, and a second vector encoding HMA4.


The invention also relates to plant cells or plants transformed by said vector or set of vectors.


The instant invention also relates to a method of producing genetically modified plants which overexpress at least a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass, comprising:

    • preparing at least a recombinant vector as defined here above, i.e., comprising one or more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn2+ Co2+/Cd2+/Pb2+ subclass, operably linked to and under the regulatory control of a plant-expressible transcription and translation regulatory sequence and
    • introducing said recombinant vector into a plant cell or plant tissue to produce a genetically modified plant cell or a genetically modified plant tissue.


An additional step of self-crossing may be performed to obtain homozygous lines.


In another aspect of the invention, the genetically modified plants as described above are used for extracting heavy metals from the environment (i.e., soil, water, etc., in particular a contaminated soil). Advantageously, plants overexpressing both HMA3 and HMA4 are used for phytoextraction of Co, Cd or Pb from an environment contaminated with said metal(s). Therefore, the instant invention also relates to a method of phytoremediation of heavy metals from soil, characterized in that it includes:

    • a step of planting genetically modified plants as described here above, in an area containing soil contaminated with at least one heavy metal and
    • collecting and removing plant tissues from said genetically modified plants at appropriate time intervals.


The preferred embodiments of this aspect of the invention involve the extraction of at least one of the following heavy metals: Zn, Co, Cd or Pb, from soil. When plants overexpressing both HMA3 and HMA4 are used, it is noted that the synergistic effect of this co-expression is achieved for Co, Cd and Pb, but that the remediation capacity of said plant concerning Zn is not significantly improved by the overexpression of HMA3.


The entire plant might be removed after it has been allowed to grow on metal-containing environment (i.e., soil, water, etc.), thereby incorporating those metals into its tissues. However, in many of the preferred embodiments, it may be taken advantage of the ability of said genetically modified plants as described here above to sequester substantial proportions of its accumulated metal in stems and leaf tissues.


Thus, said genetically modified plants are planted in contaminated soil and allowed to grow and scavenge the cited metals from the soil.


Then, at appropriate time intervals, the metal containing tissues and more preferably leaves and possibly branches are removed from the plant, allowing the remaining plant tissues to survive.


The collected plant tissues are removed from the growing area and properly disposed, so that the metal containing tissues are not allowed to reassimilate in the soil.


In another embodiment of the instant invention, said heavy metals may be extracted in the Mn+ state from said plant tissues by known methods.


In yet another embodiment of the instant invention, said heavy metals are extracted from ashes obtained after having burnt the collected metal containing tissues, said metal being in the M0 state.


The burning operation is made under controlled environmental process.


The heavy metals, obtained in a M0 state, may be, advantageously, directly recycled.


The Table below establishes the correspondences between the sequence numbers as they appear in the sequence listing and the name of the various sequences.
















Designation
SEQ ID









Rev6HMA4
SEQ ID NO: 1



Rev5HMA4
SEQ ID NO: 2



Rev4HMA4
SEQ ID NO: 3



Rev3HMA4
SEQ ID NO: 4



Rev2HMA4
SEQ ID NO: 5



Rev1HMA4
SEQ ID NO: 6



1HMA4
SEQ ID NO: 7



Rev14HMA4
SEQ ID NO: 8



TopoFV1for
SEQ ID NO: 9



TopoFV1rev
SEQ ID NO: 22



HMA4For230
SEQ ID NO: 10



Rev2bisHMA4
SEQ ID NO: 11



Actin8F
SEQ ID NO: 12



Actin8R
SEQ ID NO: 13



Rev18HMA4
SEQ ID NO: 14



10HMA4
SEQ ID NO: 15



Rev8HMA4
SEQ ID NO: 16



22HMA4
SEQ ID NO: 17



ΔHisStopHMA4
SEQ ID NO: 18



HMA4D401Afor
SEQ ID NO: 19



HMA4D401Arev
SEQ ID NO: 20



9HMA4
SEQ ID NO: 21













In addition to the preceding arrangements, the invention also comprises other arrangements which will emerge from the description which follows, which refers to exemplary embodiments of the method which is the subject matter of the present invention as well as to the appended drawings, in which:



FIG. 1: Nucleic and amino acid sequences of AtHMA4 from the Ws ecotype (accession number AF412407). The grey highlighted characters correspond to the 5′ UTR. The N-terminal heavy metal motif, the numerous cysteine doublets and the His stretch are boxed; the highly conserved sites are underlined. The amino acid sequence deleted in the alternative spliced form is black highlighted. The position of the stop insertion for the Athma4ΔHis form and its GFP fusion is indicated by the solid black vertical arrow while the empty one corresponds to the GFP fusion position of AtHMA4 and Athma4as.



FIG. 2: Evidence for the existence of an alternative spliced form of the cDNA of AtHMA4 in the Ws ecotype, absent in Ler and Col-0 ecotypes. RT were carried out with 4 μg total leaf RNA.



FIG. 3: A: Western blot analysis of the microsomal fractions of the different transformant strains expressing the chimeric constructions and AtHMA4 without fusioned EGFP. 50 μg protein was loaded on 8% SDS-PAGE for each fraction. The resolved proteins were electrotransferred on nitrocellulose membrane and revealed with anti-EGFP horseradish peroxidase antibodies. B: Confocal microscopy observations of yeast cells expressing AtHMA4::EGFP. Top, transmission image; bottom, EGFP fluorescence image.



FIG. 4: A: AtHMA4, but not Athma4D401A, Athma4as and Athma4ΔHis, confers an increased tolerance to Cd and is able to functionally substitute the ycf1 mutant strain of S. cerevisiae. The various strains were grown on solid SC minimal medium, supplemented with CdCl2 at the indicated concentrations. Plates were incubated at 30° C. for 4 days. Upper part (wild-type): pYES2 only-, AtHMA4-, Athma4D401A-, Athma4as- and Athma4ΔHis-transformants of the wild-type strain BY4741. Bottom part: same as upper part, except that the constructs are expressed in the ycf1 mutant strain (ycf1 YCF1 indicated a complementation of the mutant strain ycf1 by pYES2-YCF1). B: Metal tolerance conferred by AtHMA4 does not implicate a gluthathione S-conjugated form of Cd. The different strains were grown on solid SC minimal medium without (control) or supplemented with 70 μM CdCl2 and 5 mM BSO during 4 days at 30° C.



FIG. 5: Expression of AtHMA4 or AtHMA4::EGFP, but not Athma4ΔHis, induces a functional substitution of ycf1 in the presence of Pb. The strains were grown on solid SC minimal medium without (control or supplemented with 20 mM Pb(CH3COO)2 (conditions and strains were the same as in FIG. 4).



FIG. 6: AtHMA4 confers a slightly enhanced tolerance to Zn and was able to partially substitute the zrc1 strain. Strains and culture conditions were the same as in FIG. 4. ZnSO4, 7H2O was added to the medium at the indicated concentrations.



FIG. 7: Cd content of a 48 h culture of pYES2-only (WT) or AtHMA4- (WT AtHMA4) transformant of the wild-type; YCF1- (ycf1 YCF1) or AtHMA4- (ycf1 AtHMA4) transformant of the mutant ycf1 strain. Error bars represent the SE from five independent experiments.



FIG. 8: Expression profile of AtHMA4 (and Athma4as) determined by RT-PCR on RNA extracted from various tissues. The results of RT-PCR are presented after 27 and 30 cycles to better visualise the expression of the alternative spliced form (Athma4as, fragment of 350 bp size).



FIG. 9: A: Exon/intron map of AtHMA4 including the 5′UTR and position of the T-DNA insertion of the Rm396 mutant. The asterisk on the ninth exon (including the 5′UTR) indicates the position of the deletion in the alternative spliced form of the cDNA (Athma4as). The arrows indicate the different primers used to control the existence of a transcript by RT-PCR, using RNA extracts from Rm396 and Ws. B: The T-DNA insertional Rm396 line is a true K.-O. mutant for AtHMA4. The RT-PCR was carried out on RNA with different primer pairs, specific to AtHMA4. Upper: oligonucleotides 1 (1HMA4: SEQ ID NO:7) and 2 (Rev6HMA4: SEQ ID NO: 1); middle: 1 and 3 (Rev18HMA4: SEQ ID NO:14); lower: 4 (10HMA4: SEQ ID NO:15) and 5 (Rev8HMA4: SEQ ID NO:16).



FIG. 10: Expression profile of GUS activity in plants. a: roots; b: root slice; c: plantlet; d: stem and cauline leaf; e: stamens.



FIG. 11: AtHMA4 expression is up-regulated by Zn treatment. A: RT-PCR amplification on total RNA. B: GUS staining on root system. The inset corresponds to a binocular observation of a 1 mM Zn-treated root. Plants were grown hydroponically and treated for 24 h with ZnSO4 at the indicated concentrations.



FIG. 12: The overexpression of AtHMA4 confers an increased tolerance to metals. A: Overexpression of AtHMA4 determined by RT-PCR carried out with RNA extracted from leaves. B: Zn content of leaves from wild-type (Col-0) or overexpressing (35S-AtHMA4) plants hydroponically grown during 8 days on standard nutrient solution (Zn 3 μM), determined by ICP measurements. C: Root length of vertically grown plantlets. The photography of plates are realised 15 days after germination. D: The graph represents the results of one representative experiment of 3 with one of the two lines analyzed in detail. Values are mean of measurements of 75-100 roots, and error bars represent SEM (P<0.005).





It should be clearly understood, however, that these examples are given solely by way of illustration of the subject of the invention and do not in any manner constitute a limitation thereto.


EXAMPLE 1
Materials and Methods

Plant Material, Culture Media, and Extraction and Measurement of Total RNA.


Plants were grown in a controlled-environment (8 h photoperiod of 300 μmol.m−1s−1, 22° C. and 70% relative humidity), in Murashige and Skoog medium which consisted of a ½ strength (MS/2) nutrient solution (Murashige and Skoog, 1962), plus 1% (w/v) sucrose, and 0.7% (w/v) Bacto agar to produce a solid medium. Germination of surface-sterilized seeds of Arabidopsis thaliana, ecotypes Wassiliewskija (Ws), Columbia (Col-0) and Landsberg erecta (Ler) occurred on the solid medium. After 2 weeks, the young plants were placed on sand, saturated with the same nutrient solution, for an additional 3 weeks period and finally transferred to a hydroponic culture system. When plants were treated with different metals (in vitro or hydroponically), they were supplied at various concentrations as indicated in the figure legends, in addition to that in the nutrient solution.


Total RNA was extracted from various tissues (root, leaf, stem, cauline leaf, flower and silique) according to Verwoerd et al. (1989), and the RNA concentration determined using UV absorption at 260 nm (BioPhotometer, Eppendorf, Hamburg, Germany).


Cloning of the cDNA of AtHMA4


Two successive 5′ RACE-PCR were performed (5′ RACE System, GibcoBRL®, Carlsbad, Calif.) according to the manufacturer's instructions. In the first cycle of RACE, the cDNA was amplified with the gene specific oligonucleotide primer Rev6HMA4 (5′-GACCAATATGTTGATGTCGATCC-3′) (SEQ ID NO:1) situated in the 2nd predicted exon. The two successive semi-nested PCR were carried out using the Expand High-Fidelity System (Roche, Mannheim, Germany) with the primers Rev5HMA4 (GGCAATTTGGCAAGAATCGGATAG-3′) (SEQ ID NO:2) and Rev4HMA4 (5′-GCGGCAACTGCTGCCACGGCGAGCC-3′) (SEQ ID NO:3), respectively. Reaction conditions were 3 min at 94° C., and then 35 cycles for 30 sec at 94° C., 30 sec at 53° C. or 67° C., 1 min at 68° C. The last cycle was followed by an extended elongation step of 5 min at 68° C. The amplification fragments were cloned in pGEM-T® Easy vector (Promega, Madison, Wis.). The second round of 5′ RACE was performed as described above. The different primers used were Rev3HMA4 (5′-CTTCTTCACTTTCTTTTTCTCTTCTCTTC-3) (SEQ ID NO:4) for the cDNA amplification, Rev2HMA4 (5′-GTAGCAAAAGGAAGAAGCCGATG-3′) (SEQ ID NO:5) and Rev1HMA4 (5′-CTGGTTTGGTGCGATCAGATAAAGG-3′) (SEQ ID NO:6) were used in the two successive semi-nested PCR, with annealing temperature of 55° C. and 58° C., respectively.


First-strand full-size cDNA synthesis was performed with the ThermoScript™ RT-PCR system (Invitrogen™, Carlsbad, Calif.) according to the manufacturer's instructions using 4 μg of total leaf RNA and an oligo (dT)20 primer. PCR was then carried out with Platinum® Pfx (Invitrogen™) with primers corresponding to the 5′-UTR and 3′ end of the predicted coding sequence present in the BAC clone (5′-end primer 1HMA4 (5′-CACTTCTCTCAACCTTTATCTGAT-3′) (SEQ ID NO:7) and 3′-end primer Rev14HMA4 (5′-GTTATTCAATCAATCTCCATCAAG-3′) (SEQ ID NO:8)). The PCR reaction conditions were as described above, except the hybridization temperature (50° C.) and the final elongation step (10 min). The amplification fragment of 3.6 kb was directly cloned in the pCR®-XL-TOPO vector (Invitrogen™). The same procedure was used for the cloning of the cDNA of the alternative spliced form (AtHMA4as).


Obtaining of AtHMA4 Overexpressing Lines


After digestion by EcoRV, the CaMV35S cassette was subcloned in the EcoRV/StuI sites of the pGreen0179 binary vector. A SmaI site was added at the 3′-end of AtHMA4 by cloning the reverse-complement primer pairs TopoFV1for (SEQ ID NO:9)/rev (SEQ ID NO:22) in the NotI site of the pCR®-XL-TOPO vector. The cDNA of AtHMA4 was then extracted by BamHI/SmaI digestion and cloned at the same sites in the pGreen-CaMV35S vector. This construction was introduced by electroporation in AGL1 cells of A. tumefaciens. The agrotransformation of plants was carried out by the floral dip method (Clough and Bent, 1998). The transformant plants were selected on solid medium supplemented with hygromycin B 30 μg/ml.


DNA Fragment Resolution


The DNA fragments were electrophoresed on 1% (w/v) agarose gels prepared in TAE buffer in the presence of ethidium bromide (Sambrook et al., 1989). The DNA was visualised under UV light using a GeneGenius GG-X apparatus (Syngene, Cambridge, UK). Extraction and purification of DNA fragments were obtained with the NucleoSpin® Extract kit (Macherey-Nagel, Düren, Germany).


Sequencing


The “BigDyes” method (PE Biosystems, Foster City, Calif.) was used with a Perkin Elmer ABI Prism 310 sequencer.


Expression Analysis of AtHMA4

    • RT-PCR. Total RNA extractions and first-strand cDNA synthesis were carried out as described above. The same amount of RNA (4 μg) from all the organs analysed was used for RT-PCR with an oligo(dT)20 primer. Primers HMA4For230 (5′-CGCAGCTTGCAATTACTGGGTATCAAGTGTTGAAAG-3′) (SEQ ID NO:10) and Rev2bisHMA4 (5′-CATCTAAAACATTCCCTAGCTGTTCTTGAGC-3′) (SEQ ID NO:11) were used for PCR performed in the same conditions as described above, except the hybridization temperature (65° C.) and the number of cycles (26 cycles), which was chosen to be in the mid-log phase of amplification yield. As a control, PCR of actin8 gene was carried out on the same cDNA samples using the primers Actin8F (5′-GTGGTCGTACAACCGGTATTGTGTTGGACTCTGGTG-3′) (SEQ ID NO:12) and Actin8R (5′-ACGCTGTAACCGGAAAGTTTCTCACATAGTGCACAAATGAC-3′) (SEQ ID NO:13). These primers were added to the PCR reaction tubes 5 cycles later. The experiment was repeated 3 times on independently isolated material. Three RT-PCR were carried out, to control the Rm396 mutant line, with primer pairs located upstream, on both sides and downstream relative to the T-DNA insertion position. The RT was carried out with the gene specific primer Rev6HMA4 (SEQ ID NO:1) for the first one; the first strand cDNA was used in PCR reaction with the primers 1HMA4 (SEQ ID NO:7) and Rev6HMA4 (SEQ ID NO:1). The PCR reactions for the other two were performed with oligo(dT)20 cDNA using primer pairs 1HMA4 (SEQ ID NO:7)/Rev18HMA4 (5′-GCCTTTTGTGGAGCTAAGCTC-3′) (SEQ ID NO:14) and 10HMA4/Rev8HMA4 (5′-ATGGAGGCAGCAGCAGTTGTGTTCC-3′ (SEQ ID NO:15)/5′-GGGACAACCACTGACTAACACAAC-3′ (SEQ ID NO:16)), respectively. PCR of the actin8 gene was carried out on the same cDNA samples as described above.
    • GUS activity. Plants or organs at different stage of their development were examined for GUS activity according to the procedure described by Jefferson et al., 1987. The samples were immersed in the GUS staining solution (50 mM NaPO4, pH 7.0, 0.01% (w/v) Triton-X100, 1 mM K3Fe(CN)6, 1 mM K4Fe(CN)6 and 1 mg.ml−1 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc)), vacuum-infiltrated and incubated at 37° C. for 6 hours. Pigments were then washed out by incubation of stained sample in 2-3 changes of 70% (v/v) ethanol at 60° C. for 2 h. Plantlet roots were desiccated by successive ethanol baths of rising concentrations, for 30 min each and then fixed in resin, before transverse sections were cut.


Yeast Strains, Growth Conditions and Transformation


The S. cerevisiae reference strain BY4741 (MATα; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0), and mutant strains Δycf1 (like BY4741 except YDR135c::kanMX4), Δzcr1 (like BY4741 except YMR243c::kanMX4) and Δcot1 (strain BY4742: MATα; his3Δ1; leu2Δ0; lys2Δ0; ura3Δ0; YOR316c::kanMX4) were provided from Euroscarf (Frankfurt, Germany). All yeast strains were grown in YPD medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose). Synthetic complete (SC) minimal medium lacking uracil was used for the selection and maintenance of yeast strains transformed with plasmid (0.67% (w/v) yeast nitrogen base, 0.19% (w/v) drop-out without uracil, 2% (w/v) dextrose) (all products from Sigma, St Louis, Mo.).


AtHMA4 and the alternative spliced form (Athma4as) were cloned into the NotI site of the yeast expression vector pYES2 under a galactose-inducible promoter. A truncated version of AtHMA4 lacking the C-terminal His11 stretch was constructed. A PCR, using the PfuUltra™ (Stratagene®, Cedar Creek, Tex.), was carried out with the primers:


22HMA4: (5′-GAGAGTGTTGGAGACTGCAAGTCTGGTCATTGCCAGAAG-3′) (SEQ ID NO:17) and


ΔHisStopHMA4: (SEQ ID NO:18) (5′-AAGGAAAAAAGCGGCCGCAAAAGGAAAATTAGCTGCATAACTCTTTTGCATA AC-3′). This 860 bp fragment, digested by BsgI and NotI, was cloned in place of the same fragment in the full-size cDNA. This cDNA was then digested by EagI and cloned in pYES2 into the NotI site. These 3 cDNA were also cloned in the same vector in frame with the EGFP gene in 3′. For these clonings, the AtHMA4 and Athma4as cDNA were first digested by DraIII at the 3′ end of the genes, the end being blunted by S1 nuclease treatment. Then the fragments were excised from the pCR®-XL-TOPO vector by EcoRI digestion and finally cloned into the EcoRI and SmaI sites of the pYES2-GFP vector, in frame with the EGFP gene. Also, to create the Athma4ΔHis::EGFP fusion, a PCR amplification was carried out on the cDNA of AtHMA4 with the primers 22HMA4 (SEQ ID NO:17) and ΔHisHMA4 (5′-AAGGAAAAAAGCGGCCGCAAAAGGAAAACCCGGGGCTGCATAACTCTTTTGCAT AAC-3′) (SEQ ID NO:18) which delete the His coding fragment and create a SmaI site. The amplification fragment was cloned in place of the corresponding fragment in the native cDNA into the BsgI and NotI sites. The cDNA of Athma4ΔHis was then cloned into the EcoRI and SmaI sites of the pYES2-GFP vector. By sequencing, the fusions were controlled for the 3 constructions. The Δycf1 mutant strain was complemented by a YCF1::EGFP fusion cloned into the SacI and NotI sites of the pYES2 vector. A site-directed mutagenesis was carried out using the QuickChange® II XL Site-directed Mutagenesis Kit (Stratagene®) on the AtHMA4::EGFP construct in pYES2 as a template with the primers pairs:


HMA4D401Afor: (SEQ ID NO:19) (5′-GATCAAGATTGTTGCTTTCGCTAAAACTGGGACTATTACAAGAGG-3′) and


HMA4D401Arev: (SEQ ID NO:20) (5′-CCTCTTGTAATAGTCCCAGTTTTAGCGAAAGCAACAATCTTGATC-3′) to create a mutant where the aspartate-401 residues from the conserved domain DKTGT was replaced by an alanine, giving the mutant Athma4D401A::GFP.


The yeast strains were transformed with pYES2 alone or with AtHMA4-, Athma4D401A-; Athma4as-, Athma4ΔHis-; AtHMA4::GFP-, Athma4D401A::GFP-, Athma4as::GFP- or Athma4ΔHis::GFP-pYES2, according to the manufacturer instructions (Invitrogen™).


Assays for Metal Tolerance of Yeast


Yeast cells were first pre-cultured overnight at 30° C. in SC minimal medium without uracil (2% (w/v) raffinose instead of dextrose), then transferred to the induction medium at an O.D.600nm=0.4 for 24 h (in same minimal medium except that 1% (w/v) raffinose and 2% (w/v) galactose were added). For solid media, 2% (w/v) agar was added. The different metal solutions were added to the liquid or solid media at the concentrations indicated in the figure legends. For the drop-tests on solid media, 2 μL of the yeast cultures at O.D.600nm=2.0 were spread (1.6 104 cells) and three 10-fold serial dilutions were made. Plates were incubated at 30° C. for 4 days. For the liquid cultures, yeast cells were diluted to O.D.600nm=0.4 and grown at late log phase.


GFP Fluorescence Observations by Confocal Microscopy


The different transformant yeast strains were observed for GFP fluorescence using a confocal laser scanning microscope (CLSM, Fluoview Olympus, France) fitted with a krypton/argon laser. Fluorescence excitation was achieved with a dichroic filter (488 nm) and recording performed at 510-550 nm. Observations were carried out with an objective lens (UplanApo) at a magnification of ×100/1.35 na, under oil immersion.


Measurement of Metal Content of Yeast Cells


Yeast cells were grown in the same conditions as described for metal tolerance assays. After 48 h of growth in 15 mL of induction medium supplemented with heavy metals, the OD600nm was determined. The cells were collected by centrifugation, then washed three times with 10 mM EDTA, pH 7.5, and finally with water. The washed pellet was dried overnight at 80° C. and then mixed with nitric acid for mineralization using a MARS X microwave apparatus (CEM, Matthews, N.C.). Finally, heavy metals contents were determined using an ICP-AES Vista MPX apparatus (Varian, San Diego, Calif.).


Preparation of Soluble and Microsomal Protein Fractions


An overnight pre-culture of transformed yeast was carried out in 3 mL of SC-URA minimal medium at 30° C., 270 rpm. Cells were harvested by centrifugation (5 min, 6,000 rpm), diluted at 0.4 OD600nm in 50 mL induction medium, and were grown for further 24 h. All further procedures were carried out at 4° C. Yeast cells were harvested by centrifugation (10 min at 7,000 g), and suspended in 20 mL TEK buffer (50 mM Tris HCl pH 7.5, 1 mM EDTA, 100 mM KCl). After centrifugation for 10 min at 7,000 g, the pellet was suspended in 2 mL TES buffer (50 mM Tris HCl pH 7.5, 1 mM EDTA, 0.6 M sorbitol, 1% (w/v) BSA, 2 mM β-mercaptoethanol, 10 mM Na2SO4, and a “Complete” protease inhibitor cocktail (Roche Diagnostics)). Cells were then broken by vigorous mixing with acid-washed glass beads (425-600 μm, Sigma). The glass beads were washed four times with TES buffer, the washing fractions pooled and then centrifuged for 15 min at 8,000 rpm. Then, the supernatant was ultracentrifuged for 45 min at 100,000 g and the microsomal fraction was suspended in 500 μl TEG buffer (50 mM Tris HCl pH 7.5, 1 mM EDTA, 30% (v/v) glycerol). Protein concentrations were measured with the Bradford method (Sigma).


SDS-PAGE and Immunoblotting


Protein samples (50 μg) were rapidly thawed and mixed with denaturing buffer (¼; v/v) containing 20 mM Tris HCl pH 8.0, 2% SDS (w/v), 10% β-mercaptoethanol (v/v), 20% glycerol (v/v), and bromophenol blue. Samples were heated at 60° C. for 30 min, cooled, and then loaded on a 8% SDS-PAGE. After electrotransfer of the proteins onto a nitrocellulose membrane (BioRad, Hercules, Calif.), the blot was incubated with a primary monoclonal antibody raised against the EGFP diluted to 1/1000 (v/v) (Clontech, Palo Alto, Calif.). Revelation was obtained with a secondary horseradish peroxidase antibody diluted to 1/5000 (v/v) (Sigma) and the SuperSignal® West Pico Chemiluminescent Substrate (Pierce, Rockford, Ill.). All steps were performed according to the manufacturer's instructions.


EXAMPLE 2
Results

Cloning and Sequence Analysis of AtHMA4 from the Ws Ecotype.


A study was conducted on the Wassiliewskija ecotype (Ws) since a T-DNA insertional mutant of AtHMA4 was identified in the INRA Versailles collection. It was first determined whether the predicted ATG in the BAC clone AC002392 corresponded to the one in Ws. Two successive 5′ RACE-PCR on total RNA extracted from plant tissues were performed (see Example 1). In the first one, the cDNA was obtained with a reverse primer designed in the second predicted exon. By two successive semi-nested PCR, two amplification products were resolved, with 516 bp and 488 bp sizes, respectively. By sequencing, it was verified that these fragments correspond to AtHMA4. The second round of 5′RACE, using primers corresponding to the new found sequence, did not enable another upstream transcription fragment to be obtained indicating that the 5′ end of the mRNA of AtHMA4 was determined. In addition to the coding sequence predicted from the genomic DNA of Columbia (Col-0) ecotype, a 99 bp 5′-UTR was found. The full-length cDNA (3618 bp) was then obtained by a two steps RT-PCR in a unique fragment, cloned in the pCR®-XL-TOPO vector and sequenced (Genbank accession number AF412407) (FIG. 1). Some nucleic acid differences with respect to the sequence of the BAC clone from Col-0 were observed. The ecotypic differences between Ws and Col-0 were controlled by various independent PCR on genomic DNA and cDNA. Finally, four base changes were detected, resulting in amino acid differences (H vs. Q in position 537; K vs. R in 805; N vs. T in 970 and K vs. T in 1056).


Several RT-PCR experiments pointed to an alternative spliced form of the cDNA of AtHMA4 (FIG. 2). With the same pair of primers, two amplification fragments were obtained with a size of about 450 bp and 350 bp, respectively. These two fragments were cloned and sequenced (442 and 358 bp), both corresponding to AtHMA4. To exclude any problem during the reverse transcription reaction, such as a stable hairpin loop of the mRNA, various conditions were tested (different reverse transcriptases and/or reverse primers more or less closely located downstream of the alternative splicing part of the gene). In all conditions tested, the spliced product was obtained in which a 84 bp fragment, between positions 1652 and 1735 of the nucleic sequence, was absent (FIG. 1, bases in square brackets and highlighted amino acids). The canonical limits of intron (5′-begin GT, 3′-end AG) were present at both sides of this fragment but different software for exon/intron prediction (GeneFinder, GeneScan) did not indicate this sequence as a potential intron. In the spliced form of the transcript the reading frame was conserved. Using RT-PCR, the full-size cDNA corresponding to this spliced form was amplified, cloned in the pCR®-XL-TOPO vector, and called Athma4as. Such spliced form of the cDNA was never observed with RNA extracted from the Landsberg erecta or Columbia ecotypes (FIG. 2), although the nucleic acid sequences around the splicing sites were identical for Col-0 and Ws.


AtHMA4 Expression in Yeast


AtHMA4, Athma4D401A and both truncated forms, Athma4as and Athma4ΔHis, were subcloned in the pYES2 vector and expressed in the Saccharomyces cerevisiae wild-type yeast strain, BY4741.


AtHMA4::GFP Localization


To localise AtHMA4, a C-ter fusion of the different forms were also cloned in the pYES2 vector and expressed in the wild-type yeast strain BY4741. By Western blot using anti-EGFP horseradish peroxidase antibodies, the expression of the different chimeric proteins were controlled (FIG. 3A). The fusion proteins were observed in the microsomal fraction. Only one hybridization band which is in the range of the theoretical molecular masses of the fusion proteins (150-155 kDa) was found. No signal was observed with the microsomal fraction when the empty vector pYES2 was used, nor with AtHMA4 without EGFP, or in the soluble fraction. Under confocal microscopy, AtHMA4::EGFP appeared as a punctuated staining, typical of vesicles containing membrane proteins from the late Golgi apparatus, a pattern similar to the one described for CCC2 from S. cerevisiae and Candida albicans, respectively (Yuan et al., 1997; Weissman et al., 2002) (FIG. 3B). A similar pattern was observed with the 3 other forms of Athma4::EGFP. In contrast, cells transformed with EGFP alone presented a diffused cytoplasmic fluorescence.


Cd Tolerance


Drop-test experiments showed that the expression of AtHMA4 was able to increase the tolerance up to 150 μM Cd (FIG. 4A). In contrast, expression of the mutant forms Athma4as and Athma4ΔHis did not change the wild-type phenotype (FIG. 4A). As previously reported, the ycf1 strain was extremely sensitive to Cd (FIG. 4A) (Li et al., 1996; Mason and Michaelis, 2002). When the ycf1 strain was transformed with AtHMA4, the tolerance to Cd was restored to the level of the wild-type (FIG. 4A). This result shows that AtHMA4 functionally complements the ycf1 defective strain. The two truncated forms Athma4as and Athma4ΔHis were unable to complement the ycf1 mutant strain (FIG. 4A). To test whether increased tolerance to Cd and ycf1 phenotypic complementation was due to transport or solely to a chelation phenomenon, a D401A mutant of AtHMA4 (Athma4D401A) was generated. Asp-401 belongs to the strictly conserved motif in all P-ATPases, DKTGT, and is predicted to be the invariant residue phosphorylated in the activated enzyme. Thus the transport function must be impaired in the Athma4D401A mutant. Indeed, this mutant did not present any increased tolerance to Cd nor complementation of the ycf1 mutant strain (FIG. 4A). This experiment clearly demonstrates that the detoxification process of yeast cells by AtHMA4 is grounded to a transport function. Liquid culture experiments carried out in the same range of cadmium concentrations used in drop-tests confirmed the results obtained on plates. Similar experiments were carried out at 70 μM cadmium but in the presence of 5 mM buthionine sulfoximine (BSO), a known inhibitor of the γ-glutamylcysteine synthase (Griffith and Meister, 1979). In this case, the ycf1 strain growth was completely inhibited while wild-type-pYES2 and ycf1-YCF1 strains grew slightly (FIG. 4B). Interestingly, the strain expressing AtHMA4 grew at the same rate in the presence or absence of BSO (FIG. 4B). This result shows that, contrary to YCF1, AtHMA4 does not need a glutathione S-conjugated form of the metal to detoxify Cd.


AtHMA4 expression in the yeast S. cerevisiae induces an increased tolerance to Cd (FIG. 4A) as previously described by Mills et al. (2003). In the presence of 150 μM Cd, the growth of the wild-type strain was rapidly impaired, whereas AtHMA 4-transformants were still able to grow. It was no more the case when Asp-401 was replaced by Ala in AtHMA4. Asp-401 belongs to the phosphorylation consensus domain DKTGT and such mutation impairs for the transport function of P-type ATPases (Moller et al., 1996). As expected, AtHMA4D401A does no longer confer an increased tolerance to Cd nor a phenotypic complementation of the ycf1 mutant strain. This observation invalidates a chelation-based detoxification process and demonstrates a strong coupling between metal tolerance conferred by AtHMA4 and hydrolysis. In S. cerevisiae yeast cells, the importance of YCF1 in the Cd detoxification process has been clearly demonstrated (Li et al., 1997). This protein, a member of the ATP-binding cassette family, is involved in the transport of glutathione S-conjugated Cd to the vacuole. In accordance with this activity is that the sensitivity of the ycf1 mutant strain to Cd is strongly enhanced. Interestingly, the instant experiments demonstrate that AtHMA4 expression was able to neutralise the extrasensitivity to Cd of the defective strain. As expected, in the presence of cadmium and BSO, an inhibitor of γ-glutamylcysteine synthase (Griffith and Meister, 1979), the growth of the wild-type yeast was largely inhibited while the ycf1 defective strain did not grow (FIG. 4B). In both strains, AtHMA4 expression restored the growth capability, demonstrating that AtHMA4 was able to preserve the yeast cells from Cd poisoning in a non GS2-conjugated form.


Pb/Zn/Co Tolerance


Similar experiments to those described in the previous section were performed with the 3 other metals (Pb, Zn and Co) that AtHMA4 was predicted to transport. FIG. 5 presents the results obtained in the presence of Pb acetate supplied in solid medium. For AtHMA4-transformants and vector-only transformants, the same capabilities of resistance were observed, up to a concentration of about 20 mM Pb. As recently published by Song et al. (2003), it was also observed that the ycf1 mutant strain was highly sensitive to Pb. When AtHMA4 was expressed in the ycf1 mutant context, it was able to partially restore the growth capability of the mutant strain while the empty vector was not able to (FIG. 5).


A series of drop-test experiments was also carried out in presence of a range of Zn concentrations (FIG. 6). AtHMA4-transformants were slightly more resistant to Zn, up to a concentration of 25 mM, than the wild-type strain. Such increased tolerance was not observed for strains expressing Athma4as and Athma4ΔHis. Interestingly, AtHMA4 was also able to rescue zrc1, a deletion mutant of the zinc vacuolar transporter belonging to the CDF family. As already described, this mutant strain was extremely sensitive to Zn (MacDiarmid et al., 2003). AtHMA4-transformants of this strain, but not Athma4as nor Athma4ΔHis ones, exhibited a wild-type resistance to Zn.


While AtHMA4 was able to confer a tolerance to Cd, Pb and Zn concentrations, such a phenomenon was not observed in the presence of Co. The cot1 mutant, defective for the corresponding CDF vacuolar transporter, is known to be very sensitive to Co (Conklin et al., 1992). However, AtHMA4 expression in this mutant strain was unable to restore the Co tolerance.


Other metals were also screened (Ag, Cu, Ni and Fe) but no change in tolerance to these metals was observed when AtHMA4 was expressed, which is in agreement with predictions (Argüello, 2003).


Recently, it has been reported that YCF1 also participates in resistance to Pb toxicity (Song et al., 2003). While AtHMA4 expressed in the S. cerevisiae wild-type strain did not enhance Pb resistance, it was able to restore Pb tolerance in the ycf1 strain (FIG. 5). The instant experiments are the first demonstration of a plant P1B-ATPase conferring Pb detoxification properties. Among P1B-ATPases, only ZntA from E. coli was demonstrated to confer a tolerance to Pb (Rensing et al., 1997 and 1998). Until now, NtCBP4, which belongs to the cyclic nucleotide-gated ion channel (CNGC) family, was the only example of a plant transporter involved in Pb tolerance. The overexpression of this transporter induces Pb accumulation and hypersensitivity (Arazi and al., 1999). In contrast to this hypersensitivity response, a truncated form, deleted from the C-terminal part, induced an improved tolerance to Pb (Sunkar et al., 2000). The Arabidopsis homologue of this tobacco protein, AtCNGC1, exhibited a similar function (Sunkar et al., 2000).


Besides Cd and Pb, AtHMA4 also confers an increased Zn tolerance (up to 25 mM) and a partial complementation of the defective mutant strain zrc1 (FIG. 6). This last observation is in contradiction with previous results from Mills et al. (2003) who failed to observe any change in Zn resistance for this yeast strain transformed with AtHMA4. On the other hand, these authors observed a functional complementation of zntA, an E. coli strain defective for the Zn/Cd P-type ATPase efflux pump. The different experimental procedures and/or the range of Zn concentrations used could explain these discrepancies.


Finally, the ability of AtHMA4 to confer Co tolerance was investigated. AtHMA4 was found unable to induce an increased tolerance nor to restore growth of the yeast defective mutant cot1 (a Co transporter belonging to the CDF family; Conklin et al., 1992). Among the CPx-ATPases, CadA from Bacillus subtilis confers a moderate tolerance to Co (Gaballa and Helmann, 2003). It is worthy to note that CadA possesses in its N-terminal part the CxxC motif, which could be the binding site of Co, while such a motif is absent in AtHMA4.


Cadmium Accumulation (Detoxification Process in Yeast)


After a 48 h period in the presence of 40 or 80 μM Cd, the Cd contents in the wild-type strain and the complemented strains were determined by ICP-AES. The level of Cd accumulated by the yeast was found to be approximately similar for the pYES2-only transformants and the pYES2-YCF1-complemented ycf1 (FIG. 7). When AtHMA4 was expressed in the wild-type strain, the Cd content was drastically diminished compared to the level found in pYES2-only transformants (a fall of 50 and 62% of the Cd content for yeast grown in the presence of 40 and 80 μM Cd, respectively). When AtHMA4 was introduced into the ycf1 context, the fall in Cd content of the yeast cells was even more pronounced (80 and 83% compared to ycf1, for yeast grown in the presence of 40 and 80 μM Cd respectively).


To limit Cd toxicity, AtHMA4 could participate in i) Cd efflux processes at the yeast plasma membrane ii) Cd transport to the vacuole iii) Cd chelation aim to the large polyhistidine motif at the C-terminal part of the protein. The results obtained with either AtHMA4D401A and the spliced form of AtHMA4 let us to turn down this last hypothesis. Indeed, a simple chelation process seems unlikely since these forms of the protein exhibit the polyhistidine stretch but failed to modify yeast Cd tolerance and content. The deletion in the alternative spliced form is located in the central part of the protein corresponding to the large cytosolic loop, near the strongly conserved motifs MLTGDN and GDGVNDAP. This last motif is part of the putative hinge domain (Scarborough, 2000; Xu et al., 2002). Such deletion of 28 residues probably induces large perturbations in the conformational changes occurring during the catalytic process. All these results suggest that AtHMA4 is involved in an active process of Cd translocation. A Cd transport to the vacuole, mimetic to YCF1 function, would lead to an equal or even increased Cd content in the yeast cells expressing AtHMA4, relative to the wild-type strain. On the contrary, the determination of metal content indicated a drastic decrease in the Cd content in AtHMA4-transformed yeast cells compared to that in the wild-type or YCF1-transformed strains (FIG. 7). These results strongly argue for a role of AtHMA4 in Cd efflux from the yeast cell.


The decrease in the Cd content of yeast strains expressing AtHMA4 suggests a plasma membrane location of the protein which would allow an efflux of the toxic towards the external medium. However, fluorescence imaging of the AtHMA4::EGFP did not detect high levels of the protein at the plasma membrane nor at the vacuolar membrane (FIG. 3B). The punctuated staining pattern observed appears typical of vesicles from the late Golgi which traffic to the plasma membrane, as previously described (Yuan et al, 1997; Nothwehr et al., 2000; Weissman et al., 2002). Thus, we propose that AtHMA4 participates in Cd loading in late Golgi vesicles driving Cd efflux at the yeast plasma membrane.


Finally, the AtHMA4ΔHis form of the protein was found non functional in metal tolerance experiments, suggesting that the polyhistidine motif is essential in the binding and/or translocation of metal. In Haemophilus, the His-rich domain in the N-ter part of the Cu,Zn superoxide dismutase has been shown to initially bind the metals to be delivered to the active site (Battistoni et al. (2001). The polyhistidine stretch at the C-terminal part of AtHMA4 could play a similar role of “self chaperone”.


Tissue-Specific Expression of AtHMA4 in Arabidopsis


The level of expression of AtHMA4 in various organs of Ws ecotype was investigated by RT-PCR with part of the ACTIN8 gene as a control. A 442 bp fragment in the full version of the cDNA and a 358 bp product in the case of the Athma4as transcript were amplified. The AtHMA4 transcript was detected in all tissues analysed with higher expression levels in roots, stems and flowers (FIG. 8). Expression of Athma4as was observed in all organs studied though to a lesser extent compared to AtHMA4.


T-DNA Insertional Mutant Study


In the line Rm396, a T-DNA is inserted in the 3rd intron (FIG. 9A). Southern hybridization with a probe corresponding to a fragment of the GUS gene showed that this insertion was unique; PCR analysis, using primers designed on AtHMA4 (9HMA4: 5′-CCATTAAAAGGCCTAGGATCGACATC-3′ (SEQ ID NO:21)) and the T-DNA, demonstrated that the mutant line Rm396 was homozygote for the insertion. The absence of an AtHMA4 transcript was controlled by RT-PCR, using 3 different oligonucleotide pairs positioned upstream, downstream and on both sides of the insertion, respectively. As expected, on wild-type Ws RNA extract, two amplification fragments of 708 bp and 574 bp were observed using 1HMA4 (SEQ ID NO:7)/Rev18HMA4 (SEQ ID NO:14) and 10HMA4 (SEQ ID NO:15)/Rev8HMA4 (SEQ ID NO:16) primer pairs, respectively. These fragments were absent when Rm396 RNA extract were used (FIG. 9B, middle and lower parts). The deletion of 7 of 9 coding exons of the AtHMA4 gene in the Rm396 line makes it likely that AtHMA4 is non functional in this mutant.


GUS Expression Under Standard Conditions


Interestingly, the Rm396 mutant presents a translational fusion of the GUS gene with the two first exons of AtHMA4. FIG. 9B (upper part) shows a RT-PCR using a primer pair located upstream of the insertion. In this case, the reverse transcription reaction was realised with the gene specific primer Rev6HMA4 (SEQ ID NO:1). An amplification fragment was observed with Ws and Rm396RNA, confirming the existence of a transcript corresponding to the first two exons of AtHMA4 and the GUS gene. This fusion allows detection of GUS activity under the control of the AtHMA4 promoter. GUS staining was observed in roots, around the phloem and xylem vessels, whatever the state of development of the plant (from 4 days after germination until 8 weeks-old plant) (FIG. 10a). At the level of the roots, GUS expression was particularly intense in pericycle and cambium cells (FIG. 10b). A GUS staining was also observed in the vascular tissues, under the shoot apical meristem, in the stamens and at the bases of cauline leaves (FIG. 10c-e). These results are in good agreement with those obtained by RT-PCR (FIG. 8).


GUS Expression in the Presence of Metals


When plants were exposed for 24 h to Zn concentrations up to 1 mM, a rise in the expression level of AtHMA4 was observed in the roots (FIG. 11A). Such an up-regulation of the expression level of AtHMA4 by Zn has been reported by Mills et al. (2003) using RT-PCR with RNA extracts from the Col-0 ecotype. Depending on the Zn concentration applied, a change in the GUS staining intensity and pattern was observed (FIG. 11B). Strikingly, when plants were grown at a high Zn concentration (1 mM), the GUS staining was strictly limited to the elongation zone of the roots (FIG. 11C). In contrast with Zn, Cd and Pb did not change the expression profile whatever the concentrations used, as probed by RT-PCR and GUS staining (data not shown). These last results disagree with a down-regulation of the expression of AtHMA4 by Cd described in Col-0 (Mills et al., 2003).


Rm396 Phenotypic Characterization


Since Rm396 was characterized as a knock-out mutant for AtHMA4, it was searched for a phenotype associated with metal uptake or metal toxicity. Young plants of Ws ecotype and line Rm396 were grown in vitro in the presence of a range of metal concentrations from starvation to toxicity (Cd, Zn, Co, Pb, Cu, Ni, Fe). No significant differences were observed in germination levels and plant development between the wild-type and the mutant line whatever the metals studied (data not shown). Additionally, the analysis of phenotypic characters linked to Cd toxicity (decrease in fresh weight, leaf chlorosis and Cd accumulation in roots and leaves) gave no significant differences between the wild-type and the Rm396 line.


AtHMA4 Expression in Arabidopsis


By RT-PCR, it has been shown that AtHMA4 is expressed in all major tissues in the Ws ecotype (FIG. 8), in accordance with observations in the Col-0 ecotype. The expression pattern of AtHMA4 was studied in details by GUS staining, using the T-DNA insertional mutant from the INRA Versailles collection. GUS staining was mostly observed in roots in the region of the pericycle and cambium cells (FIG. 10). GUS staining was also associated with vascular tissues located near the shoot apical meristem, the stamens and at the bases of cauline leaves. Such localization strongly suggests that AtHMA4 could be involved in substrate transfer to or from the vascular tissues.


The presence of an alternative spliced form of the AtHMA4 transcript, specific to the Ws ecotype, leading to a 84 bp deletion and keeping the reading frame (FIG. 2) was observed. This is the first observation of an alternative splicing for a transcript of a plant transporter. By RT-PCR, this alternative spliced form was found at a lower amount than the full-size one in all tissues studied. Several animal genes have been identified that have tissue or developmental stage-specific alternative splicing (for a review see Green, 1991). In the case of the P1B-ATPases, and notably both human genes ATP7A (Menkes protein) and ATP7B (Wilson protein), they have been found in different alternative spliced forms which could account for the different subcellular distributions of these two proteins (Yang et al., 1997; Qi and Byers, 1998). In contrast, in plants, alternative splicing has been rarely documented but some results indicate that it has an important role. Rubisco activase represents one of the best-known examples in which alternative splicing allows a fine-tuning of the light regulation of the enzyme (Wernecke et al., 1989). A second example is the FCA transcript alternative splicing which is involved in flowering regulation (Macknight et al., 1997 and 2002). Despite different treatments and experiments have been conducted with a variety of heavy metals, we failed to observe a regulation of this alternative spliced form in planta and a functional role in yeast strains. However, the view cannot be excluded that this truncated protein plays a physiological role apart metal detoxification.


Since AtHMA4 is a putative Zn/Cd/Pb/Co transporter, the effects of such metals on its expression level and patterning were analysed using RT-PCR experiments and GUS staining. AtHMA44 expression was up-regulated in roots by Zn for a concentration range up to 1 mM (FIG. 11), in accordance with RT-PCR experiments in the present study and Mills et al. (2003). At the higher Zn concentration (1 mM), a strong GUS staining was observed but restricted to the root elongation region. Strikingly, RT-PCR and GUS staining experiments did not indicate any regulation of AtHMA4 expression by Cd or Pb, which is in contrast to previous results from Mills et al. (2003). The known differences in Cd tolerance between Ws and Col-0 ecotypes, and in the expression profiles found in Ws and Col-0, may be involved in these divergent observations. Furthermore, these studies were conducted with different salts of Cd (CdCl2 in this work vs. CdSO4 in other work), and the associated anion may create the different results.


A defective mutant of AtHMA4 does not exhibit any specific phenotype under normal or metal excess conditions and such an absence of phenotype could result from the presence of other transporters, belonging to the same (such as AtHMA2 and AtHMA3) or to other protein families, and supporting redundant functions. This is illustrated in the yeast since some AtHMA4 properties were only observed in a mutant context.


Overexpression of AtHMA4


To test the role of AtHMA4 in Arabidopsis, plants ectopically overexpressing this gene were generated. The AtHMA4 cDNA was cloned under the strong constitutive CaMV35S promoter and introduced in Arabidopsis through Agrobacterium tumefaciens-mediated transformation. Two independent lines with elevated AtHMA4 mRNA levels (FIG. 12A) carrying single T-DNA insertion were selected and self-crossed to obtain stable homozygous lines. The Zn content of shoot from overexpressing plants, hydroponically grown on nutrient solution. (3 μM Zn) was measured by ICP-AES. AtHMA4 leaves from overexpressing plants accumulated 61% more Zn than the control (FIG. 12B). Both overexpressing lines displayed Cd and Zn increased tolerance as assayed by root growth measurements (FIGS. 12C and D). On control solid medium (Zn 3 μM), root lengths of the overexpressing plants were not statistically different from the one of the wild-type. However, on media containing high Zn concentrations (50, 200 μM) or Cd (10, 40 μM), the root lengths from overexpressing lines were greater by 35, 154, 43 and 123% compared to wild-type roots, respectively.


Despite it was failed to find a phenotype for the knock-out mutant, overexpression of AtHMA4 in planta lead to an increased tolerance to Zn and Cd (FIG. 12 D), as already observed in the yeast. This increased tolerance was particularly obvious at the level of the root development during a Zn or Cd treatment (as an example, the root was two times longer for the overexpressing lines in comparison to the wild-type plants in presence of Cd 40 μM). When grown in control conditions, the overexpressing lines did not present longer roots, but the Zn content was 61% higher than the one of the wild-type.


Altogether these observations strongly suggest that AtHMA4 participates in the loading of heavy metal in the xylem, allowing their translocation to the shoot.


The same may be observed for AtHMA 1-3:


EXAMPLE 3
Coupling of HMA3 and HMA4

AtHMA3 belongs to the same P1B sub-group of ATPases as AtHMA4. This enzyme is not present in all the wild-type Arabidosis thaliana ecotypes. In particular, AtHMA3 is expressed in the Wassilewskija ecotype, whereas it is absent in the Columbia ecotype.


By expressing this enzyme heterologously in yeast, the inventors have shown that AtHMA3 transports cadmium, cobalt and lead, but probably not zinc. AtHMA3 is localized at the vacuole and carries out sequestration of metals in this organite, in yeast (Gravot et al, FEBS Lett. 2004).


In plants, AtHMA3 is also localised at the vacuole membrane, and detoxifies cells by sequestrating toxic metals in the vacuole. In genetically engineered plants that overexpress both HMA3 and HMA4, these two enzymes act synergistically: HMA4 enhances translocation of heavy metals from the roots to the upper parts of the plant, whereas HMA3 favours vacuolar sequestration. As a result, the plants tolerate toxic concentration of heavy metals during a longer period, hence enabling a stronger extraction of said metals from contaminated soils.


LITERATURE CITED



  • Arazi T, Sunkar R, Kaplan B and Fromm H (1999) A tobacco plasma membrane calmodulin-binding transporter confers Ni2+ tolerance and Pb2+ hypersensitivity in transgenic plants. Plant J 20:171-182

  • Argüello J M (2003) Identification of ion-selectivity determinants in heavy-metal transport P1B-type ATPase. J Membrane Biol 195:93-108

  • Axelsen K B, Palmgren M G (2001) Inventory of the superfamily of P-type ion pumps in Arabidopsis. Plant Physiol 126:696-706

  • Bassett Jr D E, Boguski M S and Hieter P (1996) Yeast genes and human disease. Nature 379:589-590

  • Battistoni A, Pacello F, Mazzetti A P, Capo C, Kroll J S, Langford P R, Sansone A, Donnarumma G, Valenti P and Rotilio G (2001) A histidine-rich metal binding domain at the N terminus of Cu,Zn-superoxide dismutases from pathogenic bacteria. J Biol Chem 276:30315-30325

  • Baxter I, Tchieu J, Sussman M R, Boutry M, Palmgren M G, Gribskov M, Harper J F and Axelsen K B (2003) Genomic comparison of P-type ATPase ion pumps in Arabidopsis and rice. Plant Physiol 132:618-628

  • Catty P, de Kerchove d'Exaerde A and Goffeau A (1997) The complete inventory of the yeast Saccharomyces cerevisiae P-type transport ATPases. FEBS Lett 409:325-332

  • Clemens S (2001) Molecular mechanisms of plant metal tolerance and homeostasis. Planta 212:475-486

  • Clough S J and Bent A F (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735-743

  • Conklin D S, McMaster J A, Culbertson M R and Kung C (1992) COT1, a gene involved in cobalt accumulation in Saccharomyces cerevisiae. Mol Cell Biol 12:3678-3688

  • Gravot, A., A. Lieutaud, et al. (2004). “AtHMA3, a plant P1B-ATPase, functions as a Cd/Pb transporter in yeast.” FEBS Lett 561(1-3): 22-8.

  • Fu D, Beeler T J and Dunn T M (1995) Sequence, mapping and disruption of CCC2, a gene that cross-complements the Ca(2+)-sensitive phenotype of csg1 mutants and encodes a P-type ATPase belonging to the Cu(2+)-ATPase subfamily. Yeast 11:283-292

  • Gaballa A and Helmann J D (2003) Bacillus subtilis CPx-type ATPases: characterization of Cd, Zn, Co and Cu efflux systems. Biometals 16:497-505

  • Green M R (1991) Biochemical mechanisms of constitutive and regulated pre-mRNA splicing. Annu Rev Cell Biol 7:559-599

  • Griffith O W and Meister A (1979) Potent and specific inhibition of gluthatione synthesis by buthionine sulfoximine (S-n-butylhomocysteine sulphoximine). J Biol Chem 254:7558-7560

  • Hirayama T, Kieber J J, Hirayama N, Kogan M, Guzman P, Nourizadeh S, Alonso J M, Dailey W and Dancis A (1999) RESPONSIVE-TO-ANTAGONISTI, a Menkes/Wilson disease-related copper transporter, is required for ethylene signaling in Arabidopsis. Cell 97:383-93

  • Hou Z and Mitra B (2003) The metal specificity and selectivity of ZntA from Escherichia coli using the acylphosphate intermediate. J Biol Chem 278:28455-28461

  • Inesi G (1985) Mechanism of calcium transport. Annu. Rev. Physiol 47:573-601

  • Jefferson R A, Kavanagh T A and Bevan M W (1987) GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901-3907

  • Lebrun M, Audurier A and Cossart P (1994a) Plasmid-borne cadmium resistance genes in Listeria monocytogenes are similar to cadA and cadC of Staphylococcus aureus and are inducible by cadmium. J Bacteriol 176:3040-3048

  • Lebrun M, Audurier A and Cossart P (1994b) Plasmid-borne cadmium resistance genes in Listeria monocytogenes are present on Tn5422, a novel transposon closely related to Tn917. J Bacteriol 176:3049-3061

  • Lee J. et al., Plant Phsyiol., 2003, 133, 589-596

  • Li Z S, Szczypka M, Lu Y P, Thiele D J and Rea P A (1996) The yeast cadmium factor protein (YCF1) is a vacuolar glutathione S-conjugate pump. J Biol Chem 271:6509-6517

  • Li Z S, Lu Y P, Zhen R G, Szczypka M, Thiele D J and Rea P A (1997) A new pathway for vacuolar cadmium sequestration in Saccharomyces cerevisiae: YCF1-catalyzed transport of bis(glutathionato)cadmium. Proc Natl Acad Sci USA 94:42-47

  • MacDiarmid C W, Milanick M A and Eide D J (2003) Induction of the ZRC1 metal tolerance gene in zinc-limited yeast confers resistance to zinc shock. J Biol Chem 278:15065-15072

  • Macknight R, Bancroft I, Page T, Lister C, Schmidt R, Love K, Westphal L, Murphy G, Sherson S, Cobbett C and Dean C (1997) FCA, a gene controlling flowering time in Arabidopsis, encodes a protein containing RNA-binding domains. Cell 89:737-745

  • Macknight R, Duroux M, Laurie R, Dijkwel P, Simpson G and Dean C (2002) Functional-significance of the alternative transcript processing of the Arabidopsis floral promoter FCA. Plant Cell 14:877-888

  • Mason D L and Michaelis S (2002) Requirement of the N-terminal extension for vacuolar trafficking and transport activity of yeast Ycf1p, an ATP-binding cassette transporter. Mol Biol Cell 13:4443-4455

  • Mills R F, Krijger G C, Baccarini P J, Hall J L and Williams L E (2003) Functional expression of AtHMA4, a P1B-type ATPase of the Zn/Co/Cd/Pb subclass. Plant J 35:164-176

  • Moller J V, Juul B and LeMaire M (1996) Structural organization, ion transport, and energy transduction of P-type ATPases. Biochim Biophys Acta 1286:1-51

  • Murashige T and Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15:473-497

  • Nothwehr S F, Ha S-A and Bruinsma P (2000) Sorting of yeast membrane proteins into an endosome-to-Golgi pathway involves direct interaction of their cytosolic domains with Vps35p. J Cell Biol 151:297-310

  • Qi M and Byers P H (1998) Constitutive skipping of alternatively spliced exon 10 in the ATP7A gene abolishes Golgi localization of the Menkes protein and produces the occipital horn syndrome. Hum Mol Genet 7:465-469

  • Ran M R, Kirchrath L and Hollenberg C P (1994) A putative P-type Cu(2+)transporting ATPase gene on chromosome II of Saccharomyces cerevisiae. Yeast 10:1217-1225

  • Rensing C, Mitra B and Rosen B P (1997) The zntA gene of Escherichia coli encodes a Zn (II)translocating P-type ATPase. Proc Natl Acad Sci USA 94:14326-14331

  • Rensing C, Sun Y, Mitra B and Rosen B P (1998) Pb(II)-translocating P-type ATPases. J Biol Chem 273:32614-32617

  • Sambrook J, Fritsch E F and Maniatis T (1989) Molecular cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

  • Scarborough G E (2000) Crystallisation, structure and dynamics of the proton-translocating P-type ATPase. J Exp Biol 203:147-154

  • Shikanai T, Müller-Moulé P, Munekage Y, Niyogi K K and Pilon M (2003) PAA1, a P-type ATPase of Arabidopsis, functions in copper transport in chloroplasts. Plant Cell 15:1333-1346.

  • Solioz M and Vulpe C (1996) CPx-type ATPases: a class of P-type ATPases that pump heavy metals. Trends Biochem Sci 21:237-241

  • Song W-Y, Sohn E J, Martinoia E, Lee Y J, Yang Y-Y, Jasinski M, Forestier C, Hwang I and Lee Y (2003) Engineering tolerance and accumulation of lead and cadmium in transgenic plants. Nature Biotechnol 21:914-919

  • Sunkar R, Kaplan B, Bouché N, Arazi T, Dolev D, Talke I N, Maathuis F J, Sanders D, Bouchez D and Fromm H (2000) Expression of a truncated tobacco NtCBP4 channel in transgenic plants and disruption of the homologous Arabidopsis CNGC1 gene confer Pb2+ tolerance. Plant J 24:533-542

  • Tsai K-J, Lin Y-F, Wong M D, Yang H H-C, Fu H-L and Rosen B P (2002) Membrane topology of the pl258 CadA Cd(II)/Pb(II)/Zn(II)-translocating P-type ATPase. J Bioenerg Biomembr 34:147-156

  • Verwoerd T C, Dekker B M and Hoekema (1989) A small-scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Res 17:2362

  • Weissman Z, Shemer R and Kornitzer D (2002) Deletion of the copper transporter CaCCC2 reveals two distinct pathways for iron acquisition in Candida albicans. Mol Microbiol 44:1551-1560

  • Werneke J M, Chatfield J M and Ogren W L (1989) Alternative mRNA splicing generates the two ribulosebisphosphate carboxylase oxygenase activase polypeptides in spinach and Arabidopsis. Plant Cell 1:815-825

  • Williams L E, Pittman J K and Hall J L (2000) Emerging mechanisms for heavy metal transport in plants. Biochim Biophys Acta 1465:104-126

  • Woeste K E and Kieber J J (2000) A strong loss-of-function mutation in RAN1 results in constitutive activation of the ethylene response pathway as well as a rosette-lethal phenotype. Plant Cell. 12:443-55.

  • Xu C, Rice W J, He W and Stokes D L (2002) A structural model for the catalytic cycle of Ca2+-ATPase. J Mol Biol 316:201-211

  • Yang X-L, Miura N, Kawarada Y, Terada K, Petrukhin K, Gilliam T and Sugiyama T (1997) Two forms of Wilson disease protein produced by alternative splicing are localized in distinct cellular compartments. Biochem J 326:897-902

  • Yuan D S, Dancis A and Klausner R D (1997) Restriction of copper export in Saccharomyces cerevisiae to a late Golgi or post-Golgi compartment in the secretory pathway. J Biol Chem 272:25787-25793


Claims
  • 1. Genetically modified plants, characterized in that they include more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass and that they overexpress said P1B-type ATPase.
  • 2. Genetically modified plants according to claim 1, characterized in that said P1B-type ATPase is selected from the group consisting of heavy metal ATPase HMA1, HMA2, HMA3 and HMA4 of Arabidopsis thaliana.
  • 3. Genetically modified plants according to claim 1, characterized in that said genetically modified plants include more than one copy of at least two different sequences encoding two different P1B-type ATPases of the Zn2+/Co2+/Cd2+/Pb2+ subclass.
  • 4. Genetically modified plants according to claim 1, characterized in that they include more than one copy of a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass and at least another sequence selected among sequences encoding (1) an enzyme involved in metal chelation (phytochelatin synthase, glutathion synthetase or gamma-glutamylcystein synthase) or (2) another metal transporter such as YCF1 or other ABC transporters.
  • 5. Recombinant vector able to transform plants, characterized in that said vector includes more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass.
  • 6. Recombinant vector according to claim 5, characterized in that said coding sequences are operably linked to and under the regulatory control of a plant-expressible transcription and translation regulatory sequence, such as a plant specific promoter.
  • 7. Genetically modified plants, characterized in that they are transformed with a recombinant vector according to claim 5.
  • 8. Plant cells characterized in that they are transformed with a recombinant vector according to claim 5.
  • 9. Method of producing genetically modified plants according to claim 1 which overexpress at least a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass, said method comprising: preparing a recombinant vector according to claims 5 or 6, comprising more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass, operably linked to and under the regulatory control of a plant-expressible transcription and translation regulatory sequence andintroducing said recombinant vector into a plant cell or plant tissue to produce a genetically modified plant cell or a genetically modified plant tissue.
  • 10. Method of phytoremediation of heavy metals from soil, characterized in that it includes: a step of planting genetically modified plants according to claim 1, in an area containing soil contaminated with at least one heavy metal andcollecting and removing plant tissues from said genetically modified plants at appropriate time intervals.
  • 11. Method of phytoremediation according to claim 10, characterized in that it involves the extraction of one of the following heavy metals: Zn, Co, Cd or Pb, from soil.
  • 12. Method of phytoremediation according to claim 10, characterized in that the entire plant might be removed after it is allowed to grow on metal-containing soil incorporating those metals into its tissues.
  • 13. Method of phytoremediation according to claim 10, characterized in that at appropriate time intervals, the metal containing tissues and more preferably leaves and possibly branches are removed from the plant, allowing the remaining plant tissues to survive.
  • 14. Method of phytoremediation according to claim 13, characterized in that the collected plant tissues are removed from the growing area and properly disposed, so that the metal containing tissues are not allowed to reassimilate in the soil.
  • 15. Method of phytoremediation according to claim 13, characterized in that said heavy metals may be extracted, in the Mn+ state, from said plant tissues.
  • 16. Method of phytoremediation according to claim 13, characterized in that said heavy metals are extracted from ashes obtained after having burnt the collected metal containing tissues, said metal being in the M0 state.
  • 17. Genetically modified plants, as defined in claim 1, characterized in that said plants are selected in the group consisting of Brassica juncea, Poplar, Nicotiana tabacum.
  • 18. A method for phytoextracting Zn, Co, Cd or Pb, from a contaminated environment comprising planting a genetically modified plant according to claim 1.
  • 19. A method for phytoextraction of Co, Cd or Pb, from a contaminated environment comprising planting a genetically modified plant according to claim 7 in the contaminated environment.
  • 20. Method of producing genetically modified plants according to claim 1 which plants overexpress at least a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass, said method comprising: preparing at least one recombinant vector(s) according to claim 10, comprising one or more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass, operably linked to and under the regulatory control of a plant-expressible transcription and translation regulatory sequence andintroducing said at least one recombinant vector(s) into a plant cell or plant tissue to produce a genetically modified plant cell or a genetically modified plant tissue.
  • 21. A method of phytoremediation of heavy metals from soil, comprising: planting genetically modified plants according to claim 1, in an area containing soil contaminated with at least one heavy metal andcollecting and removing plant tissues from said genetically modified plants at appropriate time intervals.
  • 22. The method of phytoremediation according to claim 21, wherein the method involves the extraction of at least one of the following heavy metals: Zn, Co, Cd or Pb, from soil.
  • 23. The method of phytoremediation according to claim 21 wherein the entire plant is removed after it has been allowed to grow on metal-containing soil.
  • 24. The method of phytoremediation according to claim 21, wherein at appropriate time intervals, metal containing tissues are removed from the plant, said plant being left alive.
  • 25. The method of claim 24, wherein leaves and optionally branches are removed.
  • 26. The method of phytoremediation according to claim 24, wherein the collected plant tissues are removed from the growing area and properly disposed, so that the metal containing tissues are not allowed to reassimilate in the soil.
  • 27. The method phytoremediation according to claim 24, wherein said heavy metals are extracted, in the Mn+ state, from said plant tissues.
  • 28. The method of phytoremediation according to claim 24 wherein said heavy metals are extracted from ashes obtained after having burnt the collected metal containing tissues, said metal being in the M0 state.
Priority Claims (1)
Number Date Country Kind
PCT/IB04/01271 Mar 2004 IB international
PCT Information
Filing Document Filing Date Country Kind 371c Date
PCT/IB05/00961 3/18/2005 WO 00 10/7/2008