Patent Application
20090155911
The instant invention relates generally to the field of phytoremediation. More particularly the invention relates to genetically modified plants able to accumulate heavy metals in shoots and to methods of removing and possibly recovering said heavy metals, using said genetically modified plants.
Numerous ecological and health problems are associated with environmental contamination. Heavy metals contamination of soils is a particular hazard, due to the almost indefinite environmental persistence of metals. While some heavy metals are naturally present in soil, heavy metal contamination is often the result of human activities. Contamination of the environment with heavy metals has increased drastically due to industrialization: mining, smelting, intensive agriculture, sludge dumping, energy and fuel production, electroplating and fuel exhaust contribute to contaminating the soil with heavy metals.
The soils contaminated with heavy metals inhibit normal plant growth and cause contamination of foodstuffs. Many heavy metals are very toxic to human health and carcinogenic at low concentrations. Therefore removal of heavy metals from the environment is crucial.
Currently, the most common methods for dealing with this problem remain removal and burial of the contaminated soil or the isolation of the contaminated area. However, such methods are extremely expensive.
One relatively new option for decontaminating soil is phytoremediation, which uses plants to scavenge organic and inorganic contaminants from the soil.
Phytoremediation may be divided into phytoextraction, rhizofiltration and phytostabilization:
However, usually most plants are unable to grow in soil containing high levels of heavy metals.
Certain plants have been found to accumulate nickel, cobalt, copper, lead, zinc, cadmium and selenium. Accumulators of nickel are by far the most common amongst the hyper accumulators discovered to date. The more rarely absorbed heavy metals include manganese, cadmium and lead, with lead being particularly hard to absorb as well as being very difficult to translocate from plant roots into plant stems after it is absorbed.
Therefore, there is a need for plants being able to grow in soils containing high concentrations of heavy metals. To confer heavy metal resistance to plants, it has been proposed to use the properties of heavy metal-transporting P-type ATPase and more specifically the P1B-ATPases which are known to be heavy metal transporters.
The P1B-ATPases are transporters that use the energy liberated in the exergonic ATP hydrolysis reaction to translocate positively charged substrates across membranes (Inesi, 1985). P1B-ATPases are found in all living organisms, from archaea to humans and are thought to transport soft metal cations. They are referred to as HMAs (Axelsen and Palmgren, 2001; Williams et al., 2000) or CPx-type ATPases (Solioz and Vulpe, 1996; Rensing et al., 1997; Williams et al., 2000).
In the yeast Saccharomyces cerevisiae, only 2 P1B-ATPases have been found (Catty et al., 1997), CCC2 and PCA1, both participating in copper transport (Fu et al., 1995; Bassett Jr et al., 1996; Ran et al., 1994).
In Arabidopsis thaliana, seven P1B-ATPases were previously identified (Axelsen and Palmgren, 2001) but the recent genome release revealed an eighth gene belonging to the HMAs group (P-type ATPase database; http://biobase.dk/˜axe/Patbase.html).
The recent completion of two draft sequences of the rice (Oryza saliva) genome shows a similar number of enzymes within this group. Compared with other eukaryotes, which only possess one or two P1B-ATPases, the parallel expansion of the number of HMAs in Arabidopsis and Oryza suggests that these enzymes play important roles in the overall movements of metals in plants.
In both species, these eight proteins have been classified in 6 clusters, based on full-length sequence alignments and intron positions (Baxter et al., 2003). In Arabidopsis, the two first clusters (HMA1, HMA2-4, respectively) are possible Zn/Cd/Co/Pb ATPases; the four others have a potential role in Cu/Ag transport. The first two characterised enzymes are members of this last subgroup. AtHMA7 (RAN1) has been identified as a copper transporter to ethylene receptors (Hirayama et al., 1999; Woeste and Kieber, 2000). Recently AtHMA6 (PAA1) has been characterised as a Cu transporter, participating in the translocation of this metal to chloroplastic copper proteins (Shikanai et al., 2003). Also, all eukaryotic HMAs characterised so far belong to this Cu/Ag subgroup.
Despite many members of the Zn/Cd/Co/Pb subgroup being known (Rensing et al., 1998; Hou and Mitra, 2003; Lebrun et al., 1994a and 1994b; Tsai et al., 2002), the first characterization of one homologue in plants has only just been published (Mills et al., 2003). These Authors showed that AtHMA4 induced an increased tolerance to Cd in wild-type Saccharomyces cerevisiae and restored Zn resistance of the Escherichia coli zntA mutant, which is highly sensitive to this metal. As predicted, AtHMA4 was unable to restore copper tolerance in the copA mutant context.
Therefore, it has been proposed to use the properties of these trans-porters in view to essentially increase resistance of plants to heavy metals:
Therefore, the aim of the transgenic plants described in these two documents is not phytoremediation; thus the transgenic plants proposed in said documents cannot be used for phytoremediation and more specifically for phytoextraction, as defined here above.
It emerges from the foregoing that none of the disclosed methods proposes an efficient phytoremediation system for removal of heavy metals from soil, i.e., a method using the phytoextraction process, which is particularly adapted to heavy metal removal from soil. Indeed, the prior disclosed methods have focused on the selection of plants that have a lower uptake of heavy metals than the wild-type, and that maintain healthy growth even in an environment contaminated with heavy metals and not on phytoremediation by phytoextraction.
Moreover, despite ever increasing interest and research in the field, several problems associated with phytoremediation remain. For instance, many metal-accumulating plants are unable to translocate a substantial proportion of the metal they acquire from their roots to other tissues.
Therefore, there is a need for plants able to extract heavy metals in harvestable parts thereof, in view to propose a cost-effective phytoremediation of heavy metals by phytoextraction.
The Inventors have found that, unexpectedly, plants overexpressing at least one P1B-ATPase of the subfamily or subclass of the Zn2+/Co2+/Cd2+/Pb2+ trans-porters are good candidates for their use in a method of phytoremediation using the phytoextraction process, knowing that such genetically modified plants translocate efficiently the heavy metals in the shoots.
Therefore, in one aspect of the invention, genetically modified plants are provided which are able to accumulate heavy metals and translocate them to the shoots and more specifically to the stems and the leaves.
The preferred embodiments of this aspect of the invention include genetically modified plants, characterized in that they include one or more than one copy of a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass and that they overexpress said P1B-type ATPase. No need to say that “include one or more than one copy of a sequence encoding a P1B-type ATPase” means that said genetically modified plants include at least one additional copy of the sequence encoding said ATPase. In a preferred embodiment, the plants are homozygous, and therefore contain an even number of copies of the added sequence (at least two). As described in the examples below, the homozygous plants can be obtained by self-crossing of transformed plants.
According to the invention, said P1B-type ATPase is preferably of eukaryotic origin, and more preferably from a higher plant. In a preferred embodiment, said P1B-type ATPase is selected amongst HMA1, HMA2, HMA3 and HMA4. When the wild-type plant to be genetically modified for phytoremediation possesses HMA gene(s), additional copies of at least one of said endogenous gene(s) is (are) preferably introduced into said plant genome, in order of overexpress said endogenous gene(s). Alternatively, for example in case the wild-type plant is defective for the P1B-type ATPase, the expression of which is desired in said plant for achieving phytoremediation of heavy metals, said P1B-type ATPase can be selected from the group consisting of heavy metal ATPase HMA1 to HMA4 of Arabidopsis thaliana (i.e., AtHMA1, AtHMA2, AtHMA3 and AtHMA4), whatever the ecotype, or from another plant species. The corresponding sequences of Arabidopsis thaliana are available on the following websites: http://mips.gsf.de or http://biobase.dk/˜axe/Patbase.html.
The nucleic sequences which may advantageously be used are the ones of Arabidopsis thaliana:
However, the invention includes also the use of corresponding sequences of other wild ecotypes of Arabidopsis thaliana. The skilled artisan may easily retrieve said equivalent sequences to the ones specified hereabove (AtHMA1-4) by appropriate alignment with said sequences.
According to another embodiment of the invention, said genetically modified plant includes one or more than one copy of at least two different sequences encoding two different P1B-type ATPases of the Zn2+/Co2+/Cd2+/Pb2+ subclass. According to this embodiment, the genetically modified plant preferably overexpresses at least both HMA3 and HMA4.
According to yet another embodiment of the invention, said genetically modified plant includes one or more than one copy of a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass and at least another sequence selected among sequences encoding (I) an enzyme involved in metal chelation (for example, phytochelatin synthase, glutathion synthetase or gamma-glutamylcystein synthase) or (2) another metal transporter such as YCF1 or other ABC transporters.
Said AtHMA sequence can be inserted in an appropriate vector, said AtHMA sequence being operably linked to and under the regulatory control of a plant-expressible transcription and translation regulatory sequence, such as a plant specific promoter and more preferably the CaMV35S promoter, and said vector is introduced in the selected plants with known methods. Said vector is advantageously an Agrobacterium plant shuttle vector.
Preferably said vector may be introduced in plants, such vector allowing the transformation of plants with the Agrobacterium tumefaciens technology. Transformed plants can then be self-crossed for obtaining homozygous stable lines.
According to the invention, the plants to be used are selected in the group consisting of Brassica juncea, Poplar, Nicotiana tabacum.
The instant invention also relates to a recombinant vector able to transform plants, characterized in that said vector includes one or more than one copy of at least a sequence encoding a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass (heavy metal pumping ATPases) in view that said transformed plants overexpress at least one of said P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass. The ATPase encoded by the sequence introduced in a vector according to the invention is chosen so that it is able to translocate heavy metals to the shoots of a plant when expressed in said plant. Hence, ZntA is not an appropriate ATPase for use according to the invention. Examples of ATPases that can be advantageously used are eukaryotic P1B-ATPases HMA1, HMA2, HMA3 and HMA4, especially those originating from plants close to the plants that are used for phytoremediation.
Advantageously, said coding sequences are operably linked to and under the regulatory control of a plant-expressible transcription and translation regulatory sequence, such as a plant specific promoter.
In a particular embodiment, the recombinant vector according to the invention comprises a first sequence encoding HMA3, and a second sequence encoding HMA4. As described in Example 3 below, these two ATPases act synergistically to accumulate heavy metals—especially Co, Pb and Cd—in the shoot. The invention thus also relates to a set of recombinant vectors as described above, comprising at least a first vector encoding HMA3, and a second vector encoding HMA4.
The invention also relates to plant cells or plants transformed by said vector or set of vectors.
The instant invention also relates to a method of producing genetically modified plants which overexpress at least a P1B-type ATPase of the Zn2+/Co2+/Cd2+/Pb2+ subclass, comprising:
An additional step of self-crossing may be performed to obtain homozygous lines.
In another aspect of the invention, the genetically modified plants as described above are used for extracting heavy metals from the environment (i.e., soil, water, etc., in particular a contaminated soil). Advantageously, plants overexpressing both HMA3 and HMA4 are used for phytoextraction of Co, Cd or Pb from an environment contaminated with said metal(s). Therefore, the instant invention also relates to a method of phytoremediation of heavy metals from soil, characterized in that it includes:
The preferred embodiments of this aspect of the invention involve the extraction of at least one of the following heavy metals: Zn, Co, Cd or Pb, from soil. When plants overexpressing both HMA3 and HMA4 are used, it is noted that the synergistic effect of this co-expression is achieved for Co, Cd and Pb, but that the remediation capacity of said plant concerning Zn is not significantly improved by the overexpression of HMA3.
The entire plant might be removed after it has been allowed to grow on metal-containing environment (i.e., soil, water, etc.), thereby incorporating those metals into its tissues. However, in many of the preferred embodiments, it may be taken advantage of the ability of said genetically modified plants as described here above to sequester substantial proportions of its accumulated metal in stems and leaf tissues.
Thus, said genetically modified plants are planted in contaminated soil and allowed to grow and scavenge the cited metals from the soil.
Then, at appropriate time intervals, the metal containing tissues and more preferably leaves and possibly branches are removed from the plant, allowing the remaining plant tissues to survive.
The collected plant tissues are removed from the growing area and properly disposed, so that the metal containing tissues are not allowed to reassimilate in the soil.
In another embodiment of the instant invention, said heavy metals may be extracted in the Mn+ state from said plant tissues by known methods.
In yet another embodiment of the instant invention, said heavy metals are extracted from ashes obtained after having burnt the collected metal containing tissues, said metal being in the M0 state.
The burning operation is made under controlled environmental process.
The heavy metals, obtained in a M0 state, may be, advantageously, directly recycled.
The Table below establishes the correspondences between the sequence numbers as they appear in the sequence listing and the name of the various sequences.
In addition to the preceding arrangements, the invention also comprises other arrangements which will emerge from the description which follows, which refers to exemplary embodiments of the method which is the subject matter of the present invention as well as to the appended drawings, in which:
It should be clearly understood, however, that these examples are given solely by way of illustration of the subject of the invention and do not in any manner constitute a limitation thereto.
Plant Material, Culture Media, and Extraction and Measurement of Total RNA.
Plants were grown in a controlled-environment (8 h photoperiod of 300 μmol.m−1s−1, 22° C. and 70% relative humidity), in Murashige and Skoog medium which consisted of a ½ strength (MS/2) nutrient solution (Murashige and Skoog, 1962), plus 1% (w/v) sucrose, and 0.7% (w/v) Bacto agar to produce a solid medium. Germination of surface-sterilized seeds of Arabidopsis thaliana, ecotypes Wassiliewskija (Ws), Columbia (Col-0) and Landsberg erecta (Ler) occurred on the solid medium. After 2 weeks, the young plants were placed on sand, saturated with the same nutrient solution, for an additional 3 weeks period and finally transferred to a hydroponic culture system. When plants were treated with different metals (in vitro or hydroponically), they were supplied at various concentrations as indicated in the figure legends, in addition to that in the nutrient solution.
Total RNA was extracted from various tissues (root, leaf, stem, cauline leaf, flower and silique) according to Verwoerd et al. (1989), and the RNA concentration determined using UV absorption at 260 nm (BioPhotometer, Eppendorf, Hamburg, Germany).
Cloning of the cDNA of AtHMA4
Two successive 5′ RACE-PCR were performed (5′ RACE System, GibcoBRL®, Carlsbad, Calif.) according to the manufacturer's instructions. In the first cycle of RACE, the cDNA was amplified with the gene specific oligonucleotide primer Rev6HMA4 (5′-GACCAATATGTTGATGTCGATCC-3′) (SEQ ID NO:1) situated in the 2nd predicted exon. The two successive semi-nested PCR were carried out using the Expand High-Fidelity System (Roche, Mannheim, Germany) with the primers Rev5HMA4 (GGCAATTTGGCAAGAATCGGATAG-3′) (SEQ ID NO:2) and Rev4HMA4 (5′-GCGGCAACTGCTGCCACGGCGAGCC-3′) (SEQ ID NO:3), respectively. Reaction conditions were 3 min at 94° C., and then 35 cycles for 30 sec at 94° C., 30 sec at 53° C. or 67° C., 1 min at 68° C. The last cycle was followed by an extended elongation step of 5 min at 68° C. The amplification fragments were cloned in pGEM-T® Easy vector (Promega, Madison, Wis.). The second round of 5′ RACE was performed as described above. The different primers used were Rev3HMA4 (5′-CTTCTTCACTTTCTTTTTCTCTTCTCTTC-3) (SEQ ID NO:4) for the cDNA amplification, Rev2HMA4 (5′-GTAGCAAAAGGAAGAAGCCGATG-3′) (SEQ ID NO:5) and Rev1HMA4 (5′-CTGGTTTGGTGCGATCAGATAAAGG-3′) (SEQ ID NO:6) were used in the two successive semi-nested PCR, with annealing temperature of 55° C. and 58° C., respectively.
First-strand full-size cDNA synthesis was performed with the ThermoScript™ RT-PCR system (Invitrogen™, Carlsbad, Calif.) according to the manufacturer's instructions using 4 μg of total leaf RNA and an oligo (dT)20 primer. PCR was then carried out with Platinum® Pfx (Invitrogen™) with primers corresponding to the 5′-UTR and 3′ end of the predicted coding sequence present in the BAC clone (5′-end primer 1HMA4 (5′-CACTTCTCTCAACCTTTATCTGAT-3′) (SEQ ID NO:7) and 3′-end primer Rev14HMA4 (5′-GTTATTCAATCAATCTCCATCAAG-3′) (SEQ ID NO:8)). The PCR reaction conditions were as described above, except the hybridization temperature (50° C.) and the final elongation step (10 min). The amplification fragment of 3.6 kb was directly cloned in the pCR®-XL-TOPO vector (Invitrogen™). The same procedure was used for the cloning of the cDNA of the alternative spliced form (AtHMA4as).
Obtaining of AtHMA4 Overexpressing Lines
After digestion by EcoRV, the CaMV35S cassette was subcloned in the EcoRV/StuI sites of the pGreen0179 binary vector. A SmaI site was added at the 3′-end of AtHMA4 by cloning the reverse-complement primer pairs TopoFV1for (SEQ ID NO:9)/rev (SEQ ID NO:22) in the NotI site of the pCR®-XL-TOPO vector. The cDNA of AtHMA4 was then extracted by BamHI/SmaI digestion and cloned at the same sites in the pGreen-CaMV35S vector. This construction was introduced by electroporation in AGL1 cells of A. tumefaciens. The agrotransformation of plants was carried out by the floral dip method (Clough and Bent, 1998). The transformant plants were selected on solid medium supplemented with hygromycin B 30 μg/ml.
DNA Fragment Resolution
The DNA fragments were electrophoresed on 1% (w/v) agarose gels prepared in TAE buffer in the presence of ethidium bromide (Sambrook et al., 1989). The DNA was visualised under UV light using a GeneGenius GG-X apparatus (Syngene, Cambridge, UK). Extraction and purification of DNA fragments were obtained with the NucleoSpin® Extract kit (Macherey-Nagel, Düren, Germany).
Sequencing
The “BigDyes” method (PE Biosystems, Foster City, Calif.) was used with a Perkin Elmer ABI Prism 310 sequencer.
Expression Analysis of AtHMA4
Yeast Strains, Growth Conditions and Transformation
The S. cerevisiae reference strain BY4741 (MATα; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0), and mutant strains Δycf1 (like BY4741 except YDR135c::kanMX4), Δzcr1 (like BY4741 except YMR243c::kanMX4) and Δcot1 (strain BY4742: MATα; his3Δ1; leu2Δ0; lys2Δ0; ura3Δ0; YOR316c::kanMX4) were provided from Euroscarf (Frankfurt, Germany). All yeast strains were grown in YPD medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose). Synthetic complete (SC) minimal medium lacking uracil was used for the selection and maintenance of yeast strains transformed with plasmid (0.67% (w/v) yeast nitrogen base, 0.19% (w/v) drop-out without uracil, 2% (w/v) dextrose) (all products from Sigma, St Louis, Mo.).
AtHMA4 and the alternative spliced form (Athma4as) were cloned into the NotI site of the yeast expression vector pYES2 under a galactose-inducible promoter. A truncated version of AtHMA4 lacking the C-terminal His11 stretch was constructed. A PCR, using the PfuUltra™ (Stratagene®, Cedar Creek, Tex.), was carried out with the primers:
22HMA4: (5′-GAGAGTGTTGGAGACTGCAAGTCTGGTCATTGCCAGAAG-3′) (SEQ ID NO:17) and
ΔHisStopHMA4: (SEQ ID NO:18) (5′-AAGGAAAAAAGCGGCCGCAAAAGGAAAATTAGCTGCATAACTCTTTTGCATA AC-3′). This 860 bp fragment, digested by BsgI and NotI, was cloned in place of the same fragment in the full-size cDNA. This cDNA was then digested by EagI and cloned in pYES2 into the NotI site. These 3 cDNA were also cloned in the same vector in frame with the EGFP gene in 3′. For these clonings, the AtHMA4 and Athma4as cDNA were first digested by DraIII at the 3′ end of the genes, the end being blunted by S1 nuclease treatment. Then the fragments were excised from the pCR®-XL-TOPO vector by EcoRI digestion and finally cloned into the EcoRI and SmaI sites of the pYES2-GFP vector, in frame with the EGFP gene. Also, to create the Athma4ΔHis::EGFP fusion, a PCR amplification was carried out on the cDNA of AtHMA4 with the primers 22HMA4 (SEQ ID NO:17) and ΔHisHMA4 (5′-AAGGAAAAAAGCGGCCGCAAAAGGAAAACCCGGGGCTGCATAACTCTTTTGCAT AAC-3′) (SEQ ID NO:18) which delete the His coding fragment and create a SmaI site. The amplification fragment was cloned in place of the corresponding fragment in the native cDNA into the BsgI and NotI sites. The cDNA of Athma4ΔHis was then cloned into the EcoRI and SmaI sites of the pYES2-GFP vector. By sequencing, the fusions were controlled for the 3 constructions. The Δycf1 mutant strain was complemented by a YCF1::EGFP fusion cloned into the SacI and NotI sites of the pYES2 vector. A site-directed mutagenesis was carried out using the QuickChange® II XL Site-directed Mutagenesis Kit (Stratagene®) on the AtHMA4::EGFP construct in pYES2 as a template with the primers pairs:
HMA4D401Afor: (SEQ ID NO:19) (5′-GATCAAGATTGTTGCTTTCGCTAAAACTGGGACTATTACAAGAGG-3′) and
HMA4D401Arev: (SEQ ID NO:20) (5′-CCTCTTGTAATAGTCCCAGTTTTAGCGAAAGCAACAATCTTGATC-3′) to create a mutant where the aspartate-401 residues from the conserved domain DKTGT was replaced by an alanine, giving the mutant Athma4D401A::GFP.
The yeast strains were transformed with pYES2 alone or with AtHMA4-, Athma4D401A-; Athma4as-, Athma4ΔHis-; AtHMA4::GFP-, Athma4D401A::GFP-, Athma4as::GFP- or Athma4ΔHis::GFP-pYES2, according to the manufacturer instructions (Invitrogen™).
Assays for Metal Tolerance of Yeast
Yeast cells were first pre-cultured overnight at 30° C. in SC minimal medium without uracil (2% (w/v) raffinose instead of dextrose), then transferred to the induction medium at an O.D.600nm=0.4 for 24 h (in same minimal medium except that 1% (w/v) raffinose and 2% (w/v) galactose were added). For solid media, 2% (w/v) agar was added. The different metal solutions were added to the liquid or solid media at the concentrations indicated in the figure legends. For the drop-tests on solid media, 2 μL of the yeast cultures at O.D.600nm=2.0 were spread (1.6 104 cells) and three 10-fold serial dilutions were made. Plates were incubated at 30° C. for 4 days. For the liquid cultures, yeast cells were diluted to O.D.600nm=0.4 and grown at late log phase.
GFP Fluorescence Observations by Confocal Microscopy
The different transformant yeast strains were observed for GFP fluorescence using a confocal laser scanning microscope (CLSM, Fluoview Olympus, France) fitted with a krypton/argon laser. Fluorescence excitation was achieved with a dichroic filter (488 nm) and recording performed at 510-550 nm. Observations were carried out with an objective lens (UplanApo) at a magnification of ×100/1.35 na, under oil immersion.
Measurement of Metal Content of Yeast Cells
Yeast cells were grown in the same conditions as described for metal tolerance assays. After 48 h of growth in 15 mL of induction medium supplemented with heavy metals, the OD600nm was determined. The cells were collected by centrifugation, then washed three times with 10 mM EDTA, pH 7.5, and finally with water. The washed pellet was dried overnight at 80° C. and then mixed with nitric acid for mineralization using a MARS X microwave apparatus (CEM, Matthews, N.C.). Finally, heavy metals contents were determined using an ICP-AES Vista MPX apparatus (Varian, San Diego, Calif.).
Preparation of Soluble and Microsomal Protein Fractions
An overnight pre-culture of transformed yeast was carried out in 3 mL of SC-URA minimal medium at 30° C., 270 rpm. Cells were harvested by centrifugation (5 min, 6,000 rpm), diluted at 0.4 OD600nm in 50 mL induction medium, and were grown for further 24 h. All further procedures were carried out at 4° C. Yeast cells were harvested by centrifugation (10 min at 7,000 g), and suspended in 20 mL TEK buffer (50 mM Tris HCl pH 7.5, 1 mM EDTA, 100 mM KCl). After centrifugation for 10 min at 7,000 g, the pellet was suspended in 2 mL TES buffer (50 mM Tris HCl pH 7.5, 1 mM EDTA, 0.6 M sorbitol, 1% (w/v) BSA, 2 mM β-mercaptoethanol, 10 mM Na2SO4, and a “Complete” protease inhibitor cocktail (Roche Diagnostics)). Cells were then broken by vigorous mixing with acid-washed glass beads (425-600 μm, Sigma). The glass beads were washed four times with TES buffer, the washing fractions pooled and then centrifuged for 15 min at 8,000 rpm. Then, the supernatant was ultracentrifuged for 45 min at 100,000 g and the microsomal fraction was suspended in 500 μl TEG buffer (50 mM Tris HCl pH 7.5, 1 mM EDTA, 30% (v/v) glycerol). Protein concentrations were measured with the Bradford method (Sigma).
SDS-PAGE and Immunoblotting
Protein samples (50 μg) were rapidly thawed and mixed with denaturing buffer (¼; v/v) containing 20 mM Tris HCl pH 8.0, 2% SDS (w/v), 10% β-mercaptoethanol (v/v), 20% glycerol (v/v), and bromophenol blue. Samples were heated at 60° C. for 30 min, cooled, and then loaded on a 8% SDS-PAGE. After electrotransfer of the proteins onto a nitrocellulose membrane (BioRad, Hercules, Calif.), the blot was incubated with a primary monoclonal antibody raised against the EGFP diluted to 1/1000 (v/v) (Clontech, Palo Alto, Calif.). Revelation was obtained with a secondary horseradish peroxidase antibody diluted to 1/5000 (v/v) (Sigma) and the SuperSignal® West Pico Chemiluminescent Substrate (Pierce, Rockford, Ill.). All steps were performed according to the manufacturer's instructions.
Cloning and Sequence Analysis of AtHMA4 from the Ws Ecotype.
A study was conducted on the Wassiliewskija ecotype (Ws) since a T-DNA insertional mutant of AtHMA4 was identified in the INRA Versailles collection. It was first determined whether the predicted ATG in the BAC clone AC002392 corresponded to the one in Ws. Two successive 5′ RACE-PCR on total RNA extracted from plant tissues were performed (see Example 1). In the first one, the cDNA was obtained with a reverse primer designed in the second predicted exon. By two successive semi-nested PCR, two amplification products were resolved, with 516 bp and 488 bp sizes, respectively. By sequencing, it was verified that these fragments correspond to AtHMA4. The second round of 5′RACE, using primers corresponding to the new found sequence, did not enable another upstream transcription fragment to be obtained indicating that the 5′ end of the mRNA of AtHMA4 was determined. In addition to the coding sequence predicted from the genomic DNA of Columbia (Col-0) ecotype, a 99 bp 5′-UTR was found. The full-length cDNA (3618 bp) was then obtained by a two steps RT-PCR in a unique fragment, cloned in the pCR®-XL-TOPO vector and sequenced (Genbank accession number AF412407) (
Several RT-PCR experiments pointed to an alternative spliced form of the cDNA of AtHMA4 (
AtHMA4 Expression in Yeast
AtHMA4, Athma4D401A and both truncated forms, Athma4as and Athma4ΔHis, were subcloned in the pYES2 vector and expressed in the Saccharomyces cerevisiae wild-type yeast strain, BY4741.
AtHMA4::GFP Localization
To localise AtHMA4, a C-ter fusion of the different forms were also cloned in the pYES2 vector and expressed in the wild-type yeast strain BY4741. By Western blot using anti-EGFP horseradish peroxidase antibodies, the expression of the different chimeric proteins were controlled (
Cd Tolerance
Drop-test experiments showed that the expression of AtHMA4 was able to increase the tolerance up to 150 μM Cd (
AtHMA4 expression in the yeast S. cerevisiae induces an increased tolerance to Cd (
Pb/Zn/Co Tolerance
Similar experiments to those described in the previous section were performed with the 3 other metals (Pb, Zn and Co) that AtHMA4 was predicted to transport.
A series of drop-test experiments was also carried out in presence of a range of Zn concentrations (
While AtHMA4 was able to confer a tolerance to Cd, Pb and Zn concentrations, such a phenomenon was not observed in the presence of Co. The cot1 mutant, defective for the corresponding CDF vacuolar transporter, is known to be very sensitive to Co (Conklin et al., 1992). However, AtHMA4 expression in this mutant strain was unable to restore the Co tolerance.
Other metals were also screened (Ag, Cu, Ni and Fe) but no change in tolerance to these metals was observed when AtHMA4 was expressed, which is in agreement with predictions (Argüello, 2003).
Recently, it has been reported that YCF1 also participates in resistance to Pb toxicity (Song et al., 2003). While AtHMA4 expressed in the S. cerevisiae wild-type strain did not enhance Pb resistance, it was able to restore Pb tolerance in the ycf1 strain (
Besides Cd and Pb, AtHMA4 also confers an increased Zn tolerance (up to 25 mM) and a partial complementation of the defective mutant strain zrc1 (
Finally, the ability of AtHMA4 to confer Co tolerance was investigated. AtHMA4 was found unable to induce an increased tolerance nor to restore growth of the yeast defective mutant cot1 (a Co transporter belonging to the CDF family; Conklin et al., 1992). Among the CPx-ATPases, CadA from Bacillus subtilis confers a moderate tolerance to Co (Gaballa and Helmann, 2003). It is worthy to note that CadA possesses in its N-terminal part the CxxC motif, which could be the binding site of Co, while such a motif is absent in AtHMA4.
Cadmium Accumulation (Detoxification Process in Yeast)
After a 48 h period in the presence of 40 or 80 μM Cd, the Cd contents in the wild-type strain and the complemented strains were determined by ICP-AES. The level of Cd accumulated by the yeast was found to be approximately similar for the pYES2-only transformants and the pYES2-YCF1-complemented ycf1 (
To limit Cd toxicity, AtHMA4 could participate in i) Cd efflux processes at the yeast plasma membrane ii) Cd transport to the vacuole iii) Cd chelation aim to the large polyhistidine motif at the C-terminal part of the protein. The results obtained with either AtHMA4D401A and the spliced form of AtHMA4 let us to turn down this last hypothesis. Indeed, a simple chelation process seems unlikely since these forms of the protein exhibit the polyhistidine stretch but failed to modify yeast Cd tolerance and content. The deletion in the alternative spliced form is located in the central part of the protein corresponding to the large cytosolic loop, near the strongly conserved motifs MLTGDN and GDGVNDAP. This last motif is part of the putative hinge domain (Scarborough, 2000; Xu et al., 2002). Such deletion of 28 residues probably induces large perturbations in the conformational changes occurring during the catalytic process. All these results suggest that AtHMA4 is involved in an active process of Cd translocation. A Cd transport to the vacuole, mimetic to YCF1 function, would lead to an equal or even increased Cd content in the yeast cells expressing AtHMA4, relative to the wild-type strain. On the contrary, the determination of metal content indicated a drastic decrease in the Cd content in AtHMA4-transformed yeast cells compared to that in the wild-type or YCF1-transformed strains (
The decrease in the Cd content of yeast strains expressing AtHMA4 suggests a plasma membrane location of the protein which would allow an efflux of the toxic towards the external medium. However, fluorescence imaging of the AtHMA4::EGFP did not detect high levels of the protein at the plasma membrane nor at the vacuolar membrane (
Finally, the AtHMA4ΔHis form of the protein was found non functional in metal tolerance experiments, suggesting that the polyhistidine motif is essential in the binding and/or translocation of metal. In Haemophilus, the His-rich domain in the N-ter part of the Cu,Zn superoxide dismutase has been shown to initially bind the metals to be delivered to the active site (Battistoni et al. (2001). The polyhistidine stretch at the C-terminal part of AtHMA4 could play a similar role of “self chaperone”.
Tissue-Specific Expression of AtHMA4 in Arabidopsis
The level of expression of AtHMA4 in various organs of Ws ecotype was investigated by RT-PCR with part of the ACTIN8 gene as a control. A 442 bp fragment in the full version of the cDNA and a 358 bp product in the case of the Athma4as transcript were amplified. The AtHMA4 transcript was detected in all tissues analysed with higher expression levels in roots, stems and flowers (
T-DNA Insertional Mutant Study
In the line Rm396, a T-DNA is inserted in the 3rd intron (
GUS Expression Under Standard Conditions
Interestingly, the Rm396 mutant presents a translational fusion of the GUS gene with the two first exons of AtHMA4.
GUS Expression in the Presence of Metals
When plants were exposed for 24 h to Zn concentrations up to 1 mM, a rise in the expression level of AtHMA4 was observed in the roots (
Rm396 Phenotypic Characterization
Since Rm396 was characterized as a knock-out mutant for AtHMA4, it was searched for a phenotype associated with metal uptake or metal toxicity. Young plants of Ws ecotype and line Rm396 were grown in vitro in the presence of a range of metal concentrations from starvation to toxicity (Cd, Zn, Co, Pb, Cu, Ni, Fe). No significant differences were observed in germination levels and plant development between the wild-type and the mutant line whatever the metals studied (data not shown). Additionally, the analysis of phenotypic characters linked to Cd toxicity (decrease in fresh weight, leaf chlorosis and Cd accumulation in roots and leaves) gave no significant differences between the wild-type and the Rm396 line.
AtHMA4 Expression in Arabidopsis
By RT-PCR, it has been shown that AtHMA4 is expressed in all major tissues in the Ws ecotype (
The presence of an alternative spliced form of the AtHMA4 transcript, specific to the Ws ecotype, leading to a 84 bp deletion and keeping the reading frame (
Since AtHMA4 is a putative Zn/Cd/Pb/Co transporter, the effects of such metals on its expression level and patterning were analysed using RT-PCR experiments and GUS staining. AtHMA44 expression was up-regulated in roots by Zn for a concentration range up to 1 mM (
A defective mutant of AtHMA4 does not exhibit any specific phenotype under normal or metal excess conditions and such an absence of phenotype could result from the presence of other transporters, belonging to the same (such as AtHMA2 and AtHMA3) or to other protein families, and supporting redundant functions. This is illustrated in the yeast since some AtHMA4 properties were only observed in a mutant context.
Overexpression of AtHMA4
To test the role of AtHMA4 in Arabidopsis, plants ectopically overexpressing this gene were generated. The AtHMA4 cDNA was cloned under the strong constitutive CaMV35S promoter and introduced in Arabidopsis through Agrobacterium tumefaciens-mediated transformation. Two independent lines with elevated AtHMA4 mRNA levels (
Despite it was failed to find a phenotype for the knock-out mutant, overexpression of AtHMA4 in planta lead to an increased tolerance to Zn and Cd (
Altogether these observations strongly suggest that AtHMA4 participates in the loading of heavy metal in the xylem, allowing their translocation to the shoot.
The same may be observed for AtHMA 1-3:
AtHMA3 belongs to the same P1B sub-group of ATPases as AtHMA4. This enzyme is not present in all the wild-type Arabidosis thaliana ecotypes. In particular, AtHMA3 is expressed in the Wassilewskija ecotype, whereas it is absent in the Columbia ecotype.
By expressing this enzyme heterologously in yeast, the inventors have shown that AtHMA3 transports cadmium, cobalt and lead, but probably not zinc. AtHMA3 is localized at the vacuole and carries out sequestration of metals in this organite, in yeast (Gravot et al, FEBS Lett. 2004).
In plants, AtHMA3 is also localised at the vacuole membrane, and detoxifies cells by sequestrating toxic metals in the vacuole. In genetically engineered plants that overexpress both HMA3 and HMA4, these two enzymes act synergistically: HMA4 enhances translocation of heavy metals from the roots to the upper parts of the plant, whereas HMA3 favours vacuolar sequestration. As a result, the plants tolerate toxic concentration of heavy metals during a longer period, hence enabling a stronger extraction of said metals from contaminated soils.
| Number | Date | Country | Kind |
|---|---|---|---|
| PCT/IB04/01271 | Mar 2004 | IB | international |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/IB05/00961 | 3/18/2005 | WO | 00 | 10/7/2008 |
