Patent Application
20080070279
Prepare GK-1, GK-2 and GK-3. Prepare cecropin A1 and buforin II as control.
Sequence of cecropin A1 (see Morishima, I., etc, Comp. Biochem. Physiol., 1990, B 95 (3), 551-554):
Sequence of buforin II (see Park, C. B., Biochem. Biophys. Res. Commun. 1996, 218 (1), 408-413):
Presented below are examples of the solid phase synthesis of these peptides. The peptide synthesizer was purchased from ABI, USA. After cleaving with high concentration TFA, the peptide was purified by reverse-phase column. The purified peptide was then analyzed by MS. The procedures in detail are provided as follows:
The Pioneer Peptide Synthesis System performs solid-phase synthesis, in which peptide chains are assembled on a solid support from the C-terminus, one amino acid at a time, elongating the chain toward the N-termius. Calculate the amount of support (Fmoc-Arg(Pbf)-PEG-PS, purchased from ABI, loading factor 0.19 mmole/g) needed for the synthesis. Weigh the support and transfer it to the column. Removal of the Fmoc (9-fluroenyl-methyloxycarbonyl) protecting group from the terminal amine or the resin is accomplished by treating the resin with 20% solution of piperidine in N,N-Dimethylformamide (DMF).The required volume of the 20% solution of piperidine in DMF is calculated automatically on the scale of the reaction being run. The resin is then washed with DMF. The 9-fluroenyl-methyloxycarbonyl (Fmoc) protected amino acid was dissolved in
O-(7-Azabenzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium exafluorophosphate (HATU)/diisopropylethylamine (DIPEA). The solution was recycled through the column for 30 minutes. The resin is then washed with DMF. Repeat the steps from removal to coupling till the end of synthesis. (see Pioneer Peptide Synthesiser User's manual for details).
The resulting peptides were cleaved as follows:
After reaction, the resin was removed, to which was added B type cleavage cocktail (88% TFA, phenol, 5% water, 2% TIPS), continue to reaction for about 2 hours at room temperature. Filtering, and to the filtrate was added 10-fold volume of pre-cold absolute ether. The precipitate was collected by centrifugation at 4000 rpm for 10 minutes, and dried at room temperature.
As shown in
(1) 734.8×4=2939.2, 2939.2−4=2935.2
(2) 979.1×3=2937.3, 2937.3−3=2934.3
(3) 1468×2=2936, 2936−2=2934
The calculated MW of GK-2 is 2934. The theory value calculated from the peptide sequence is 2932.74. The peptide prepared proved to be the designed GK-2 antimicrobial peptide. The certified antimicrobial peptide is stored for further use. Antimicrobial peptide GK-1, GK-3 and natural antimicrobial peptides cecropin A1 and buforin II were prepared similarly to the preparation of GK-2 antimicrobial peptide.
The bacterial expression vector pGEX-4T1 is used for bacterial expression in this example (Amersham Pharmcia Biotech). Antimicrobial peptide gene GK-1 was designed and. synthesized and cloned into pGEX-4T1, then the expression vector containing GK-1 was transformed into E. coli JM109, GST-GK-1 fusion protein was expressed by IPTG inducing, GK-1 was obtained after cleavaging by thrombin.
ATP, IPTG, T4 polynucleotide kinase, T4DNA ligase, Klenow Fragment, Restriction endonucleases are products of BIOLAB except for special indication. The agarose gel DNA extraction kit is product of shanghai sangon, primers for PCR amplification were synthesized by shanghai sangon. Thrombin cleavage kit from sigma.
With respect to the methods of DNA separation, purification, PCR reaction, enzyme cleavage, plasmid transformation, fragment collection, link reaction etc. are referred to Molecular Cloning: A Laboratory Manual (edited by Joe Sambrook, David Russell, Cold Spring Harbor Lab (CSHL) Press, 2001.). E.coli JM109 was cultured in LB liquid or solid medium.
We use E.coli bias coden design GK-1 gene sequence, the sequence as following: For cloning the mature protein, the 5′ primer containing the BamHI (GGATCC) restriction site, The 3′ primer containing the stop coden (TAG), the sequence contain 78 bp.
The sequence of GK-1 gene was synthesized by DNA synthesizer. A DNA segment was amplified by PCR reaction. A pair of primers were P1: 5′ -CCTAGGTTTACCT-3′P2: 3′-CCGCCTGCTGAA-5′. PCR reaction was as following: 94° C., 30 seconds; 45° C., 45 seconds; 72° C., 30 seconds; 30 cycles. The PCR product was cleaved by BamHI after it reacted with Klenow fragment. The fragment collected by agarose gel DNA extraction kit (procedure see the kit). The recycled fragment linked with pGEX-4T1 vector which was cleaved by BamHI and Smal, the recombinant plasmid transformed E.coli JM109, then transformants identified by Smal. The fusion protein GST-GK-1 was induced to be expressed by IPTG. The fusion protein was purified by GST affinity column, and GK-1 antimicrobial peptide was obtained after it cleaved by thrombin. For the procedure, please see the kit.
GK-1 polypeptide sequence:
GK-1 gene sequence:
GGATCCAAATGGAAACTGTTTAAAAAAATTGGCATTGGCCGCCTGCTGA
Expression of Antimicrobial Peptide GK-1 Gene in Yeast ATP, IPTG, T4 polynucleotide kinase, T4DNA ligase, Kienow Fragment, Restriction Endonucleases are products of BIOLAB except for special indication. The agarose gel DNA extraction kit is product of shanghai sangon, primers for PCR amplification were synthesized by shanghai sangon. Thrombin cleavage kit is available from sigma.
The DNA sequence of GK-1 gene which was cleaved by BamHI jinked with the DNA sequence of GST, then the linked gene was cloned into pBluescriptSKII (from Stratagene company, USA). Recombinant plasmid was transformed into E. coli DH5α(from CMCC, Wuhan, P.R.C ). The plasmid was identified by DNA sequencing. The plasmid was cleaved by EcoRI and XhoI, then linked to yeast expression vector pPIC9. pPIC9 is used for yeast expression in this example (from invitrogen). The expression vector containing GK-1 was then transformed into KM71 (from Invitrogen company, USA), GST-GK-1 fusion protein was induced to be expressed by methyl alcohol, and GK-1 was obtained after cleavage by thrombin.
With respect to the methods of DNA separation, purification, PCR reaction, enzyme cleavage, plasmid transformation, fragment collection, ligase reaction etc. are referred to Molecular Cloning: A Laboratory Manual (edited by Joe Sambrook, David Russell, Cold Spring Harbor Lab (CSHL) Press, 2001). KM71 was cultured in BMGY liquid or solid medium. When GST-GK-1 fusion protein was expressed, BMMY medium was used. BMMY medium supplied methyl alcohol to 1% every 24 hours.
We use yeast bias coden design GK-1 and GST gene sequence, the sequence as follows: For cloning the mature protein, the 5′ primer containing the BamHI (GGATCC) restriction site, The 3′ primer containing the stop coden (TAG) and EcoRI (GAATCC) restriction site, the sequence contain 84 bp. Additional a XhoI (CTCGAG) restriction site at 5′-terminal of the GST was supplied.
Preparation of the sequence of GK-1 gene: the sequence of GK-1 gene was synthesized by DNA synthesizer. Amplify a DNA segment by PCR reaction. A pair of primer were P3: 5° CCTAGGTTTACCT3′ and P4: 5′ AAGTCGTCCGCC 3′. PCR reaction is performed as follows: 94° C., 30 seconds; 45° C., 45 seconds; 72° C., 30 seconds; 35 cycles.
Preparation of the sequence of GST gene: designed a pair of primers, the sequences were as follows:
Amplify the GST gene segment of pGEX-4T1 vector by PCR reaction with P5 and P6. PCR reaction is performed as follows: 94° C., 30 seconds; 45° C., 45 seconds; 72° C., 30 seconds; 30 cycles.
Link the PCR products to plasmid: GK-1 PCR products is cleaved by BamHI/EcoRI after reacting with Klenow fragment. The fragment was collected by agarose gel DNA extraction kit (see the kit manual for details). The recycled fragment was linked with pBluescriptSKII vector which was cleaved by XhoI/EcoRI and GST PCR products which were cleaved by BamHI/XhoI. E. coli DH5α. was transformed by the recombinant plasmid. The transformants were identified by antibiotic resistance test, restriction endonucleases etc, and then was identified further by DNA sequencing and cleaved by XhoI/EcoRI. The expression plasmid pPIC9-gst-gk1 was constructed by linking the plasmid to pPIC9 vector which was cleaved by XhoI/EcoRI. The recombinant plasmid transformed E. coli DH5α. Scan transformants by Ampicillin resistance test. Prepare the KM71 competent cell (Clare J J, et al., Gene, 1991, 105:205-212). Then transported (1.5KV, 22.5 uF) the recombinant plasmid pPIC9-gst-gk1 cleaved with SacI into KM71 cell. Spreaded the electroporated yeast onto YPD plate, scanned for the fusion protein positive clone after being cultured two days at 30° C.
The fusion protein GST-GK-1 was induced to be expressed by methanol in transformant. The fusion protein was purified by GST affinity column and obtained GK-1 antimicrobial peptide after cleavage with thrombin. See the kit manual for details.
GST-GK-1 fusion protein sequence:
GST-GK-1 gene sequence:
All strains used in the following examples were purchased from NICPBP.
To assay the MIC of three peptides GK-1, GK-2 and GK-3 of the present invention, 96-well microtiter plate was used, cecropin A1 and buforin II as control.
The minimum inhibitory concentrations (MIC) of the invention peptides were determined using methods described below:
The strain was recovered, inoculated into sloped medium, and grown overnight at 37° C. Typical clone selected were grown overnight at 37° C. in LB culture, diluted in the same medium to give concentrations of about 104-105 CFU/ml. The broth dilutions were set up in a 96-well microtiter plate by putting 100 μl of LB-S in every well. Added diluted peptide to every well (10 μl per well), cultured overnight at 37° C. The next day, the plates were scored for growth in the wells, and the MIC determined (In Yup Park et al.; FEBS Letters; 437(1998) 258-262). Results were summarized in table 1.
When the ratio of the growth concentration for the bacteria with antimicrobial peptides to that for the bacteria without antimicrobial peptides is greater than 90%, the concentration of antimicrobial peptides is the minimum inhibitory concentration (The minimum inhibitory concentration (MIC) is defined as the minimal concentration when the growth of bacteria is significantly inhibited).
Staphylococcus
aureaus
Bacillus subtilis
Bacillus pumilus
Micrococcus
lysoleikticus
Micrococcus lutea
Escherichia coli
Klebsiella
pneumonia
B Subacute
Pseudomonas
aeruginosa
Candida albicans
Saccharomyces
cerevisiae
Lower MIC value means higher antimicrobial activity.
Design and synthesis functional analogs of invention peptides: GK-19 (deletion derivative) and GK-20 (cyclization derivative). Synthesis is performed on Pioneer Peptide Synthesiser. See Pioneer Peptide Synthesiser User's manual for details; After purification by reverse-phase column (see Example 1), the analogs were then subjected to MIC test (see Example 4). Results were summarized in Table 2. Sequences of GK-19 (deletion derivative) and GK-20 (cyclization derivative):
Staphylococcus aureaus CMCC26003
Bacillus subtilis DB430
Bacillus pumilus CMCC63202
Micrococcus lysoleikticus S1.634
Micrococcus lutea CMCC28001
Escherichia coli ATCC8099
Klebsiella pneumoniae CMCC46117
Pseudomonas aeruginosa
Candida albicans ATCC10231
Saccharomyces cerevisiae ATCC9736
Lower MIC value means higher antimicrobial activity.
This experiment was to detect the hemolytic activity of the antimicrobial peptides. The references were Cecropin A1 and buforinil, which were solid-phase peptide synthesized by our company. Blood sample was normal human blood.
The test step was shown below:
Human red blood cells was washed by PBS(PBS:35 Mm phosphate buffer/0.15 m NaCl, pH 7.0). Suck 100 μl 8% red blood cells suspension to 96-well plate, add 100 μl antimicrobial peptide (including cecropin A1, buforinl, GK-1, GK-2, GK-3) to each well, then incubated at 37° C., after 1 hour, 1500 rpm centrifuged for 5 minutes. Suck 100 μl 4% red blood cells suspension to new 96-well plate, detect the hematoglobin releasing under 414 nm by microplate reader. The negative control was PBS, the positive control was TritonX-100. The result was summarized in table 3:
The number of hemolytic rate in table 3 was smaller, the hemolytic activity of antimicrobial peptide was lower.
The test was to detect the toxicity to animal of antimicrobial peptides including GK-1, GK-2, GK-3, provided by the invention. The references were Cecropin A1 and buforinil, which were solid-phase peptide synthesized by our company.
60 Kunming mouse, half was female, half was male, weight was 33.5±0.25 g. The dosage of antimicrobial peptide was 1 mg/kg, intramuscular injecting one time per day, consecutive 7 days. We observed the reaction of the mouse under the maximum dosage. The result of the test demonstrated that the mice were normal and no abnormal reaction after 7 days intramuscular injection. It can be concluded that the antimicrobial peptides provided by the invention have no toxicity.
The infection model was Staphylococcus aureus infection in the Kunming mouse. The test step was shown below:
S. aureus CMCC26003 was cultured overnight, with moderate agitation, in Veal Infusion broth (Difco) and diluted in broth containing 5% hog gastric mucin (Difco). Male Kunming mice weighing approximately 20 grams were infected intraperitoneally with 106-107 viable cells. There were 3 mice in each treatment group. Antimicrobial peptide GK-1 was administered intravenously (in 0.1 ml 5% dextrose for injection), within 10 minutes of infection. Vancomycin was administered subcutaneously.
aureus infection in mice
As shown in Table 4, GK-1 protected 100% of the infected mice when administered at a dosage of 0.25 mg/kg intravenously. Vancomycin was 100% effective only at the dosage of 4.5 mg/kg. All of the untreated mice died in less than 24 hours.
This example demonstrated that antimicrobial peptide provided by the invention was effective against S. aureus infection in an acute infection model in mice using a highly virulent challenge dose of bacteria.
To determine the inhibitory activity of the peptides against tumor cells, a MTT calorimetric assay was performed. Fifty percent inhibitory concentrations of the antimicrobial peptides against tumor cells and normal fibroblasts were determined. Tumor cell K562 (human chronic myeloid leukemia cell), Bcap-37 (human breast cancer cell), QGY-7703 (human hepatocellular carcinoma cell), LOVO colon cancer cell, and mouse NIH-3T3 fibroblast were selected. These cells were provided by the College of Life Sciences, Fudan University. Cells were grown in RPMI-1640, containing 10% inactivated calf serum. Cells were transferred into the 96-well plate at 2*104 cells/well, and 150 μl was added in each well. After the 96-well plate were incubated overnight at 37° C. in 5% carbon dioxide, 20 μ1 diluted peptide solution was added to each well, then incubated for 3 days, 20 μl MTT solution was added to each well, and incubated at 37° C. for 4 hours, 40 μl, 002M HCl solution containing 20% SDS was added to each well to solve the purple crystal, and incubated overnight at 37° C. The absorbance at 570 nm was determined.
The results show that the antimicrobial peptides of GK-1, GK-2 and GK-3 all have antitumor activities, and the effect of GK-3 is the best.
| Number | Date | Country | Kind |
|---|---|---|---|
| 02136766.3 | Sep 2002 | CN | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CN03/00522 | 7/1/2003 | WO | 00 | 3/23/2006 |
