Myeloid-derived suppressor cells (MDSC) represent a heterogeneous population of immature myeloid cells. These cells accumulate to a great extent in cancer patients and play a major role in regulating immune responses in cancer. MDSC suppress T cell activation and proliferation as well as function of natural killer (NK) cells. Ample evidence links these cells with tumor progression and outcome of the disease in cancer patients. The accumulation of relatively immature and pathologically activated myeloid-derived suppressor cells (MDSC) with potent immunosuppressive activity is common in tumors. MDSC have the ability to support tumor progression by promoting tumor cell survival, angiogenesis, invasion of healthy tissue by tumor cells, and metastases. There is now ample evidence of the association of accumulation of immune suppressive MDSC with negative clinical outcomes in various cancers. MDSC have been implicated in resistance to anticancer therapies, including kinase inhibitors, chemotherapy, and immune therapy.
Provided herein is a method of decreasing MDSCs in a subject in need thereof. The method includes inhibiting, decreasing, deleting, or downregulating FATP2.
In another aspect, a method of decreasing the immune-suppressive activity of PMN-MDSCs in a subject in need thereof is provided. The method includes inhibiting, decreasing, deleting, or downregulating FATP2.
In yet another aspect, a method of treating cancer in a subject in need thereof is provided. The method includes inhibiting, decreasing, deleting, or downregulating FATP2.
In another aspect, method of decreasing arachidonic acid or arachidonic acid-containing phospholipids in a subject in need thereof comprising inhibiting, decreasing, deleting, or downregulating FATP2.
In yet another aspect, a method of decreasing PGE2 synthesis in a subject in need thereof is provided. The method includes inhibiting, decreasing, deleting, or downregulating FATP2.
In one embodiment, the method includes administering a FATP2 inhibitor to a subject. In another embodiment, the inhibitor is lipofermata or grassofermata. In another embodiment, the method further includes administering a checkpoint inhibitor to the subject. In another embodiment, the subject has cancer.
Other aspects and advantages of these compositions and methods are described further in the following detailed description of the preferred embodiments thereof.
As disclosed herein, methods and compositions are described which are useful in treatment of cancer in a mammalian subject. As disclosed herein it is demonstrated that up-regulation of fatty acid transporter 2 (FATP2) is associated exclusively with PMN-MDSC; FATP2 contributes to uptake of arachidonic acid (AA) and synthesis of PGE2, which mediate PMN-MDSC suppression; deletion of FATP2 abrogated suppressive activity of PMN-MDSC and had potent antitumor effect; and targeting of FATP2 has activity as a single agent and is more potent in combination with checkpoint inhibitors.
Polymorphonuclear myeloid derived suppressor cells (PMN-MDSC) are pathologically activated neutrophils that are critically important for the regulation of immune responses in cancer. They contribute to the failure of cancer therapies and are associated with poor clinical outcomes. Despite the recent advances in understanding of the PMN-MDSC biology, the mechanisms responsible for pathological activation of neutrophils are not well defined, which limits selective targeting of these cells. Here, we report that mouse and human PMN-MDSC exclusively up-regulate fatty acid transporter protein 2 (FATP2). Over-expression of FATP2 in PMN-MDSC was controlled by GM-CSF, through the activation of STAT5 transcription factor. Deletion of FATP2 abrogated the suppressive activity of PMN-MDSC. The main mechanism of FATP2 mediated suppressive activity involved uptake of arachidonic acid (AA) and synthesis of prostaglandin E2 (PGE2). The selective pharmacological inhibition of FATP2 abrogated the activity of PMN-MDSC and substantially delayed tumor progression. In combination with check-point inhibitors, inhibition of FATP2 blocked tumor progression in mice. Thus, FATP2 mediates acquisition of immune suppressive activity by PMN-MDSC and represents a new target to selectively inhibit the functions of PMN-MDSC and improve the effect of cancer therapy.
MDSC have been divided in two large sub-populations, monocytic myeloid-derived suppressor cells (M-MDSC) and polymorphonuclear myeloid-derived suppressor cells (PMN-MDSC). About 20-30% of MDSC consists of monocytic cells, i.e., M-MDSC, and are generally associated with high activity of Arginase-1 and iNOS. Two different phenotypes (CD11b+ CD14− CD15− and CD33+ or CD11b+ CD14+ CD33+ and HLA-DRlo) are used to characterize these M-MDSC cells depending on the type of cancer.
The second population, i.e., PMN-MDSC, are comprised of granulocytic cells and are usually associated with high level of ROS production. PMN-MDSC represent the major population of MDSC (about 60-80%) and represent the most abundant population of MDSC in most types of cancer. PMN-MDSC are phenotypically and morphologically similar to neutrophils (PMN) and share the CD11b+CD14−CD15+/CD66b+ phenotype. The may also be characterized as CD33+. PMN-MDSC are important regulators of immune responses in cancer and have been directly implicated in promotion of tumor progression.
Unless defined otherwise in this specification, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the fields of biology, biotechnology and molecular biology and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application. The definitions herein are provided for clarity only and are not intended to limit the claimed invention.
“Patient” or “subject” as used herein means a mammalian animal, including a human, a veterinary or farm animal, a domestic animal or pet, and animals normally used for clinical research. In one embodiment, the subject of these methods and compositions is a human.
The term “fatty acid transporter 2”, “FATP2”, also termed Very long-chain acyl-CoA synthetase, as used herein refers to fatty acid transport protein 2, encoded by the SLC27A2 gene, or isoforms thereof. The amino acid sequence of FATP2 is known in the art (UniProtKB-O14975) and set forth below:
The nucleic acid sequence for the gene encoding FATP2 (gene name SLC27A2) can be found in databases such as GenBank: KJ893197.1. It should be understood that the term FATP2 can also represent the protein in various species, and with conservative changes in the amino acid or encoding sequences, or with other naturally occurring modifications that may vary among species and between members of the same species, as well as naturally occurring mutations thereof.
The term “cancer” or “tumor” as used herein refers to, without limitation, refers to or describes the physiological condition in mammals that is typically characterized by unregulated cell growth. Cancer as used herein is meant any form of cancer, including hematological cancers, e.g., leukemia, lymphoma, myeloma, bone marrow cancer, and epithelial cancers, including, without limitation, breast cancer, lung cancer, prostate cancer, colorectal cancer, brain cancer, endometrial cancer, esophageal cancer, stomach cancer, bladder cancer, kidney cancer, pancreatic cancer, cervical cancer, head and neck cancer, ovarian cancer, melanoma, leukemia, myeloma, lymphoma, glioma, Non-Hodgkin's lymphoma, leukemia, multiple myeloma and multidrug resistant cancer. In one embodiment, the cancer is lymphoma. In another embodiment, the cancer is carcinoma. In another embodiment, the cancer is myeloma.
A “tumor” is an abnormal mass of tissue that results from excessive cell division that is uncontrolled and progressive, and is also referred to as a neoplasm. The term “tumor,” as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
As used herein, the term “treatment of cancer” or “treating cancer” can be described by a number of different parameters including, but not limited to, reduction in the size of a tumor in an animal having cancer, reduction in the growth or proliferation of a tumor in an animal having cancer, preventing, inhibiting, or reducing the extent of metastasis, and/or extending the survival of an animal having cancer compared to control.
By “isoform” or “multiple molecular form” is meant an alternative expression product or variant of a single gene in a given species, including forms generated by alternative splicing, single nucleotide polymorphisms, alternative promoter usage, alternative translation initiation small genetic differences between alleles of the same gene, and posttranslational modifications (PTMs) of these sequences.
The term “myeloid-derived suppressor cells” or “MDSCs” refers to cells of myeloid origin that are undergo expansion in a cancer-related context and have been described as having certain immune-suppressive functions. MDSC comprise two major subsets termed polymorphonuclear (PMN) and monocytic (M)-MDSC, also PMN-MDSC and M-MDSC, respectively. PMN-MDSC and M-MDSC are phenotypically and morphologically distinct, but share some overlapping functional characteristics and biochemical traits. In certain embodiments, PMN-MDSCs and M-MDSCs are identified or separated using markers including, for example, CD11b, CD14, CD15, CD66, HLA-DR, CD33. In human peripheral blood, for example, PMN-MDSC can be identified as CD11b+ CD14− CD15+ or CD11b+ CD14− CD66b+ and M-MDSC as CD11b+ CD14+HLA-DR−/loCD15−. In certain embodiments, lectin-type oxidized LDL receptor 1 (LOX-1) is used as a marker to identify PMN-MDSCs in a sample. In certain embodiments, LOX-1 expression distinguishes PMN-MDSCs from, for example, neutrophils or PM-LCs in a sample. In some embodiments, PMN-MDSCs are identified based on the expression or level of expression of certain genes that make up a gene signature, which may include one or more of HLA-DPA1, HLA-DRA, EBI2, OLR1 THBS1, CD36, MMD, ASGR1, CD69, HLA-DRB3, CD74, RPSA, HLA-DQA1, CD86, PTGER2, ITGB5, CD79B, CD79A, IL10RA, PLXNB2, ITGB1, PLAUR, CD247, SCARB2, CD1D, GPBAR1, CLEC1B, TFRC, ITGB3, CD300C, ITGA22B and CXCR5. In certain embodiments, MDSCs are identified based on expression of one or more of MYCN, CSF3, IL3, TGFβ1, TNF, LDL, RAF1, APP, IL6 PDGFBB, EPO, CD40LG, Nek, IL13, AGT, IL1β, ERBB2, MAP2K1, VEGFα, CSF1, FLI1, or Fin, CD15, CD66b or CD33. Suitable markers and functional assays for identifying or distinguishing MDSC subsets are described in the art (See, for example, Bronte, V. et al. Recommendations for myeloid-derived suppressor cell nomenclature and characterization standards. Nat. Commun. 7: 12150 (2016), which is incorporated herein by reference).
As used herein for the described methods and compositions, the term “antibody” refers to an intact immunoglobulin having two light and two heavy chains or fragments thereof capable of binding to a biomarker protein or a fragment of a biomarker protein. Thus, a single isolated antibody or an antigen-binding fragment thereof may be a monoclonal antibody, a synthetic antibody, a recombinant antibody, a chimeric antibody, a humanized antibody, a human antibody, or a bi-specific antibody or multi-specific construct that can bind two or more target biomarkers.
The term “antibody fragment” as used herein for the described methods and compositions refers to less than an intact antibody structure having antigen-binding ability. Such fragments, include, without limitation, an isolated single antibody chain or an scFv fragment, which is a recombinant molecule in which the variable regions of light and heavy immunoglobulin chains encoding antigen-binding domains are engineered into a single polypeptide. Other scFV constructs include diabodies, i.e., paired scFvs or non-covalent dimers of scFvs that bind to one another through complementary regions to form bivalent molecules. Still other scFV constructs include complementary scFvs produced as a single chain (tandem scFvs) or bispecific tandem scFvs.
Other antibody fragments include an FIT construct, a Fab construct, an Fc construct, a light chain or heavy chain variable or complementarity determining region (CDR) sequence, etc. Still other antibody fragments include monovalent or bivalent minibodies (miniaturized monoclonal antibodies) which are monoclonal antibodies from which the domains non-essential to function have been removed. In one embodiment, a minibody is composed of a single-chain molecule containing one VL, one VH antigen-binding domain, and one or two constant “effector” domains. These elements are connected by linker domains. In still another embodiment, the antibody fragments useful in the methods and compositions herein are “unibodies”, which are IgG4 molecules from with the hinge region has been removed.
The antibodies of the instant invention may also be conjugated/linked to other components. For example, the antibodies may be operably linked (e.g., covalently linked, optionally, through a linker) to at least one cell penetrating peptide, detectable agent, imaging agent, or contrast agent. The antibodies of the instant invention may also comprise at least one purification tag (e.g., a His-tag). In a particular embodiment, the antibody is conjugated to a cell penetrating peptide.
Arachidonic acid is an unsaturated, essential fatty acid. It is found in animal and human fat as well as in the liver, brain, and glandular organs, and is a constituent of animal phosphatides. It is formed by the synthesis from dietary linoleic acid and is a precursor in the biosynthesis of prostaglandins, thromboxanes, and leukotrienes. The COX-2 enzyme catalyzes conversion of arachidonic acid to different prostaglandins such as prostaglandin E2 (PGE2).
The terms “analog”, “modification” and “derivative” refer to biologically active derivatives of the reference molecule that retain desired activity as described herein. In general, the term “analog” refers to compounds having a native polypeptide sequence and structure with one or more amino acid additions, substitutions (generally conservative in nature) and/or deletions, relative to the native molecule, so long as the modifications do not destroy activity and which are “substantially homologous” to the reference molecule as defined herein. Preferably, the analog, modification or derivative has at least the same desired activity as the native molecule, although not necessarily at the same level. The terms also encompass purposeful mutations that are made to the reference molecule. Particularly preferred modifications include substitutions that are conservative in nature, i.e., those substitutions that take place within a family of amino acids that are related in their side chains. Specifically, amino acids are generally divided into four families: acidic, basic, non-polar and uncharged polar. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. For example, it is reasonably predictable that an isolated replacement of leucine with isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid, will not have a major effect on the biological activity. For example, the molecule of interest may include up to about 5-20 conservative or non-conservative amino acid substitutions, so long as the desired function of the molecule remains intact. One of skill in the art can readily determine regions of the molecule of interest that can tolerate change by reference to Hopp/Woods and Kyte Doolittle plots, well known in the art.
One skilled in the art may readily reproduce the compositions and methods described herein by use of the amino acid sequences of the biomarkers and other molecular forms, which are publicly available from conventional sources.
Throughout this specification, the words “comprise”, “comprises”, and “comprising” are to be interpreted inclusively rather than exclusively. The words “consist”, “consisting”, and its variants, are to be interpreted exclusively, rather than inclusively. It should be understood that while various embodiments in the specification are presented using “comprising” language, under various circumstances, a related embodiment is also be described using “consisting of” or “consisting essentially of” language.
The term “a” or “an”, refers to one or more, for example, “a biomarker,” is understood to represent one or more biomarkers. As such, the terms “a” (or “an”), “one or more,” and “at least one” are used interchangeably herein.
As used herein, the term “about” means a variability of 10% from the reference given, unless otherwise specified.
Provided herein are methods and compositions for, inter alia, treating cancer in a subject in need thereof. In one embodiment, the method includes administering an effective amount of an agent that inhibits, decreases, deletes, or downregulates FATP2 in the subject. In another aspect, a method of decreasing MDSCs in a subject in need thereof is provided which includes inhibiting, decreasing, deleting, or downregulating FATP2 in the subject. In yet another aspect, a method of decreasing the immune-suppressive activity of PMN-MDSCs in a subject in need thereof is provided which includes inhibiting, decreasing, deleting, or downregulating FATP2 in the subject. Such agents are described herein.
Inhibitors of FATP2 have been implicated for having potential therapeutic applicability for the prevention and resolution of diseases involving fatty acid uptake and metabolism including but not limited to obesity, Type 2 Diabetes, metabolic syndrome, cardiovascular disease, and non-alcoholic fatty liver disease. However, it is believed that the instant disclosure is the first to provide evidence for the use of these compounds in the reduction of MDSC and treatment of cancer.
The methods described herein utilize compositions which include agents which inhibit, decrease, delete, or downregulate FATP2 in the subject. In some embodiments, such agents are known in the art. In one embodiment, the agent which inhibits FATP2 is 5′-bromo-5-phenyl-spiro[3H-1,3,4-thiadiazole-2,3′-indoline]-2′-one), referred to herein as lipofermata. In another embodiment, the agent which inhibits FATP2 is 2-benzyl-3-(4-chlorophenyl)-5-(4-nitrophenyl)pyrazolo[1,5-a]pyrimidin-7(4H)-one, referred to herein as grassofermata. See, Black et al, Fatty Acid Transport Proteins: Targeting FATP2 as a Gatekeeper Involved in the Transport of Exogenous Fatty Acids, Medchemcomm. 2016 Apr. 1; 7(4): 612-622, which is incorporated herein by reference. Other compounds known to inhibit FATP2 are known in the art and include those described in U.S. Pat. No. 8,263,640B2 and U.S. Pat. No. 8,431,582, which are incorporated herein by reference.
Another inhibitor of FATP2 useful herein is (5E)-5-((3-bromo-4-hydroxy-5-methoxyphenyl)methylene)-3-(3-chlorophenyl)-2-thioxothiazolidin-4-one, also called CB2. See, Sandoval et al, Identification and characterization of small compound inhibitors of human FATP2, Biochem Pharmacol. 2010 Apr. 1; 79(7): 990, which is incorporated herein by reference.
In a particular embodiment, the inhibitor is a small molecule inhibitor of FATP2. In a particular embodiment, the inhibitor is an inhibitory nucleic acid molecule (e.g., antisense, siRNA, shRNA, etc.) or a vector encoding the same. In a certain embodiments, the inhibitor is an antibody or antibody fragment that is immunologically specific for FATP2. (e.g., a neutralizing antibody).
In certain embodiments, an agent that inhibits, decreases, deletes, or downregulates FATP2 is administered in combination with a composition that inhibits fat absorption (e.g. Xenical (orlistat)).
As used herein, the term “small molecule” refers to a substance or compound that has a relatively low molecular weight (e.g., less than 2,000). Typically, small molecules are organic, but are not proteins, polypeptides, or nucleic acids.
The phrase “small, interfering RNA (siRNA)” refers to a short (typically less than 30 nucleotides long, particularly 12-30 or 20-25 nucleotides in length) double stranded RNA molecule. Typically, the siRNA modulates the expression of a gene to which the siRNA is targeted. Methods of identifying and synthesizing siRNA molecules are known in the art (see, e.g., Ausubel et al. (2006) Current Protocols in Molecular Biology, John Wiley and Sons, Inc). As used herein, the term siRNA may include short hairpin RNA molecules (shRNA). Typically, shRNA molecules consist of short complementary sequences separated by a small loop sequence wherein one of the sequences is complimentary to the gene target. shRNA molecules are typically processed into an siRNA within the cell by endonucleases. Exemplary modifications to siRNA molecules are provided in U.S. Application Publication No. 20050032733. Expression vectors for the expression of siRNA molecules preferably employ a strong promoter which may be constitutive or regulated. Such promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA polymerase promoter, and the RNA polymerase III promoters U6 and H1 (see, e.g., Myslinski et al. (2001) Nucl. Acids Res., 29:2502 09).
“Antisense nucleic acid molecules” or “antisense oligonucleotides” include nucleic acid molecules (e.g., single stranded molecules) which are targeted (complementary) to a chosen sequence (e.g., to translation initiation sites and/or splice sites) to inhibit the expression of a protein of interest. Such antisense molecules are typically between about 15 and about 50 nucleotides in length, more particularly between about 15 and about 30 nucleotides, and often span the translational start site of mRNA molecules. Antisense constructs may also be generated which contain the entire sequence of the target nucleic acid molecule in reverse orientation. Antisense oligonucleotides targeted to any known nucleotide sequence can be prepared by oligonucleotide synthesis according to standard methods.
As used herein, the term “immunologically specific” refers to proteins/polypeptides, particularly antibodies, that bind to one or more epitopes of a protein or compound of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
A “cell-penetrating peptide” refers to a peptide which can transduce another peptide, protein, or nucleic acid into a cell in vitro and/or in vivo—i.e., it facilitates the cellular uptake of molecules. Examples of cell penetrating peptides include, without limitation, Tat peptides, penetratin, transportan, and the like.
The term “therapeutically effective amount” or “effective amount” refers to an amount agent that when administered alone or in combination with an additional therapeutic agent to a cell, tissue, or subject is effective to prevent or ameliorate the tumor-associated disease condition or the progression of the disease, e.g., metastasis. A therapeutically effective dose further refers to that amount of the compound sufficient to result reduction, prevention or inhibition of metastasis. For example, when in vivo administration of an agent is employed, normal dosage amounts may vary from about 10 ng/kg to up to 100 mg/kg of subject body weight or more per dosage or per day, preferably about 1 μg/kg to 50 mg/kg, optionally about 100 μg/kg to 20 mg/kg, 500 μg/kg to 10 mg/kg, or 1 mg/kg to 10 mg/kg, depending upon the route of administration.
A reduction or inhibition of cancer can be measured relative to the incidence observed in the absence of the treatment and, in further testing, inhibits tumor growth. The tumor inhibition can be quantified using any convenient method of measurement. Tumor growth can be reduced by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or greater.
Other therapeutic benefits or beneficial effects provided by the methods described herein may be objective or subjective, transient, temporary, or long-term improvement in the condition or pathology, or a reduction in onset, severity, duration or frequency of an adverse symptom associated with or caused by cell proliferation or a cellular hyperproliferative disorder such as a neoplasia, tumor or cancer, or metastasis. A satisfactory clinical endpoint of a treatment method in accordance with the invention is achieved, for example, when there is an incremental or a partial reduction in severity, duration or frequency of one or more associated pathologies, adverse symptoms or complications, or inhibition or reversal of one or more of the physiological, biochemical or cellular manifestations or characteristics of cell proliferation or a cellular hyperproliferative disorder such as a neoplasia, tumor or cancer, or metastasis. A therapeutic benefit or improvement therefore be a cure, such as destruction of target proliferating cells (e.g., neoplasia, tumor or cancer, or metastasis) or ablation of one or more, most or all pathologies, adverse symptoms or complications associated with or caused by cell proliferation or the cellular hyperproliferative disorder such as a neoplasia, tumor or cancer, or metastasis. However, a therapeutic benefit or improvement need not be a cure or complete destruction of all target proliferating cells (e.g., neoplasia, tumor or cancer, or metastasis) or ablation of all pathologies, adverse symptoms or complications associated with or caused by cell proliferation or the cellular hyperproliferative disorder such as a neoplasia, tumor or cancer, or metastasis. For example, partial destruction of a tumor or cancer cell mass, or a stabilization of the tumor or cancer mass, size or cell numbers by inhibiting progression or worsening of the tumor or cancer, can reduce mortality and prolong lifespan even if only for a few days, weeks or months, even though a portion or the bulk of the tumor or cancer mass, size or cells remain.
Also provided herein are methods of decreasing arachidonic acid (AA) or arachidonic acid-containing phospholipids in a subject in need thereof by administering an inhibitor of FATP2. AA is metabolized to PGE2 (amongst other prostaglandins) which promotes PMN-MDSC generation and suppression. In another embodiment, a method is provided where PGE synthesis is decreased by administering a FATP2 inhibitor.
Also provided herein are methods and compositions that include one or more agents which inhibits FATP2 in combination with one or more additional therapeutic agent(s). Such compositions include all inhibitors of FATP2 including, without limitation, peptides, nucleic acid molecules, small molecule compounds, antibodies and derivatives thereof. Also provided herein are pharmaceutical compositions that include FATP2 inhibitors optionally in combination with one or more additional therapeutic agent(s).
In some embodiments, the additional therapeutic agent is an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-CTLA-4 antibody, an anti-CD28 antibody, an anti-TIGIT antibody, an anti-LAGS antibody, an anti-TIM3 antibody, an anti-GITR antibody, an anti-4-1BB antibody, or an anti-OX-40 antibody. In some embodiments, the additional therapeutic agent is an anti-TIGIT antibody. In some embodiments; the additional therapeutic agent is an anti-LAG-3 antibody selected from the group consisting of: BMS-986016 and LAG525. In some embodiments, the additional therapeutic agent is an anti-OX-40 antibody selected from: MEDI6469, MEDI0562, and MOXR0916. In some embodiments, the additional therapeutic agent is the anti-4-1BB antibody PF-05082566.
The present disclosure provides compositions and methods that include blockade of immune checkpoints. Immune checkpoints are molecules in the immune system that either turn up a signal (e.g., co-stimulatory molecules) or turn down a signal. Inhibitory checkpoint molecules that may be targeted by immune checkpoint blockade include adenosine A2A receptor (AZAR), B7-H3 (also known as CD276); B and T lymphocyte attenuator (BTLA), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4, also known as CD152), indoleamine 2,3-dioxygenase (IDO), killer-cell immunoglobulin (KIR), lymphocyte activation gene-3 (LAGS), programmed death 1 (PD-1), T-cell immunoglobulin domain and mucin domain 3 (TIM-3) and V-domain Ig suppressor of T cell activation (VISTA). In particular, the immune checkpoint inhibitors target the PD-1 axis and/or CTLA-4.
The immune checkpoint inhibitors may be drugs such as small molecules, recombinant forms of ligand or receptors, or, in particular, are antibodies, such as human antibodies (e.g., International Patent Publication WO2015016718; Pardoll, Nat Rev Cancer, 12(4): 252-64, 2012; both incorporated herein by reference). Known inhibitors of the immune checkpoint proteins or analogs thereof may be used, in particular chimerized, humanized or human forms of antibodies may be used. As the skilled person will know, alternative and/or equivalent names may be in use for certain antibodies mentioned in the present disclosure. Such alternative and/or equivalent names are interchangeable in the context of the present invention. For example, it is known that lambrolizumab is also known under the alternative and equivalent names MK-3475 and pembrolizumab.
It is contemplated that any of the immune checkpoint inhibitors that are known in the art to stimulate immune responses may be used. This includes inhibitors that directly or indirectly stimulate or enhance antigen-specific T-lymphocytes. These immune checkpoint inhibitors include, without limitation, agents targeting immune checkpoint proteins and pathways involving PD-L2, LAG3, BTLA, B7H4 and TIM3. For example, LAG3 inhibitors known in the art include soluble LAG3 (IMP321, or LAG3-Ig disclosed in WO2009044273) as well as mouse or humanized antibodies blocking human LAG3 (e.g., IMP701 disclosed in WO2008132601), or fully human antibodies blocking human LAG3 (such as disclosed in EP 2320940). Another example is provided by the use of blocking agents towards BTLA, including without limitation antibodies blocking human BTLA interaction with its ligand (such as 4C7 disclosed in WO2011014438). Yet another example is provided by the use of agents neutralizing B7H4 including without limitation antibodies to human B7H4 (disclosed in WO 2013025779, and in WO2013067492) or soluble recombinant forms of B7H4 (such as disclosed in US20120177645). Yet another example is provided by agents neutralizing B7-H3, including without limitation antibodies neutralizing human B7-H3 (e.g. MGA271 disclosed as BRCA84D and derivatives in US 20120294796). Yet another example is provided by agents targeting TIM3, including without limitation antibodies targeting human TIM3 (e.g. as disclosed in WO 2013006490 A2 or the anti-human TIM3, blocking antibody F38-2E2 disclosed by Jones et al., J Exp Med. 2008; 205(12):2763-79).
In addition, more than one immune checkpoint inhibitor (e.g., anti-PD-1 antibody and anti-CTLA-4 antibody) may be used in combination with the FATP2 inhibitor. For example, p53 gene therapy and immune checkpoint inhibitors (e.g., anti-MR antibody and/or anti-PD-1 antibody) can be administered to enhance innate anti-tumor immunity followed by IL24 gene therapy and immune checkpoint inhibitors (e.g., anti-PD-1 antibody) to induce adaptive anti-tumor immune responses.
Provided herein is a method for treating or delaying progression of cancer in an individual comprising administering to the individual an effective amount of a PD-1 axis binding antagonist in combination with a FATP2 inhibitor. For example, a PD-1 axis binding antagonist includes a PD-1 binding antagonist, a PDL1 binding antagonist and a PDL2 binding antagonist. Alternative names for “PD-1” include CD279 and SLEB2. Alternative names for “PDL1” include B7-H1, B7-4, CD274, and B7-H. Alternative names for “PDL2” include B7-DC, Btdc, and CD273. In some embodiments, PD-1, PDL1, and PDL2 are human PD-1, PDL1 and PDL2.
In some embodiments, the PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its ligand binding partners. In a specific aspect, the PD-1 ligand binding partners are PDL1 and/or PDL2. In another embodiment, a PDL1 binding antagonist is a molecule that inhibits the binding of PDL1 to its binding partners. In a specific aspect, PDL1 binding partners are PD-1 and/or B7-1. In another embodiment, the PDL2 binding antagonist is a molecule that inhibits the binding of PDL2 to its binding partners. In a specific aspect, a PDL2 binding partner is PD-1. The antagonist may be an antibody, an antigen binding fragment thereof, an immunoadhesion, a fusion protein, or oligopeptide. Exemplary antibodies are described in U.S. Pat. Nos. 8,735,553, 8,354,509, and 8,008,449, all incorporated herein by reference. Other PD-1 axis antagonists for use in the methods provided herein are known in the art such as described in U.S. Patent Application No. US20140294898, US2014022021, and US20110008369, all incorporated herein by reference.
In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody). In some embodiments, the anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and CT-011. In some embodiments, the PD-1 binding antagonist is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PDL1 or PDL2 fused to a constant region (e.g., an Fc region of an immunoglobulin sequence). In some embodiments, the PD-1 binding antagonist is AMP-224. Nivolumab, also known as MDX-1106-04, MDX-1106, ONO-4538, BMS-936558, and OPDIVO is an anti-PD-1 antibody described in WO2006/121168. Pembrolizumab, also known as MK-3475, Merck 3475, lambrolizumab, KEYTRUDA, and SCH-900475, is an anti-PD-1 antibody described in WO2009/114335. CT-011, also known as hBAT or hBAT-1, is an anti-PD-1 antibody described in WO2009/101611. AMP-224, also known as B7-DCIg, is a PDL2-Fc fusion soluble receptor described in WO2010/027827 and WO2011/066342. Additional PD-1 binding antagonists include Pidilizumab, also known as CT-011, MEDI0680, also known as AMP-514, and REGN2810.
In some aspects, the immune checkpoint inhibitor is a PD-L1 antagonist such as Durvalumab, also known as MEDI4736, atezolizumab, also known as MPDL3280A, or avelumab, also known as MSB00010118C. In certain aspects, the immune checkpoint inhibitor is a PD-L2 antagonist such as rHIgM12B7. In some aspects, the immune checkpoint inhibitor is a LAG-3 antagonist such as, but not limited to, IMP321, and BMS-986016. The immune checkpoint inhibitor may be an adenosine A2a receptor (A2aR) antagonist such as PBF-509.
Another immune checkpoint that can be targeted in the methods provided herein is the cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), also known as CD152. The complete cDNA sequence of human CTLA-4 has the Genbank accession number L15006, CTLA-4 is found on the surface of T cells and acts as an “off” switch when bound to CD80 or CD86 on the surface of antigen-presenting cells. CTLA4 is a member of the immunoglobulin superfamily that is expressed on the surface of Helper T cells and transmits an inhibitory signal to T cells. CTLA4 is similar to the T-cell co-stimulatory protein, CD28, and both molecules bind to CD80 and CD86, also called B7-1 and B7-2 respectively, on antigen-presenting cells. CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may be important to their function. T cell activation through the T cell receptor and CD28 leads to increased expression of CTLA-4, an inhibitory receptor for B7 molecules.
In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide.
Anti-human-CTLA-4 antibodies (or VH and/or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art recognized anti-CTLA-4 antibodies can be used. For example, the anti-CTLA-4 antibodies disclosed in: U.S. Pat. No. 8,119,129, WO 01/14424, WO 98/42752; WO 00/37504 (CP675,206, also known as tremelimumab; formerly ticilimumab), U.S. Pat. No. 6,207,156; Hurwitz et al. (1998) Proc Natl Acad Sci USA 95(17): 10067-10071; Camacho et al. (2004) J Clin Oncology 22(145): Abstract No. 2505 (antibody CP-675206); and Mokyr et al. (1998) Cancer Res 58:5301-5304 can be used in the methods disclosed herein. The teachings of each of the aforementioned publications are hereby incorporated by reference. Antibodies that compete with any of these art-recognized antibodies for binding to CTLA-4 also can be used. For example, a humanized CTLA-4 antibody is described in International Patent Application No. WO2001014424, WO2000037504, and U.S. Pat. No. 8,017,114; all incorporated herein by reference.
An exemplary anti-CTLA-4 antibody is ipilimumab (also known as 10D1, MDX-010, MDX-101, and Yervoy) or antigen binding fragments and variants thereof (see, e.g., WO 01/14424). In other embodiments, the antibody comprises the heavy and light chain CDRs or VRs of ipilimumab. Accordingly, in one embodiment, the antibody comprises the CDR1, CDR2, and CDR3 domains of the VH region of ipilimumab, and the CDR1, CDR2 and CDR3 domains of the VL region of ipilimumab. In another embodiment, the antibody competes for binding with and/or binds to the same epitope on CTLA-4 as the above-mentioned antibodies. In another embodiment, the antibody has at least about 90% variable region amino acid sequence identity with the above-mentioned antibodies (e.g., at least about 90%, 95%, or 99% variable region identity with ipilimumab).
Other molecules for modulating CTLA-4 include CTLA-4 ligands and receptors such as described in U.S. Pat. Nos. 5,844,905, 5,885,796 and International Patent Application Nos. WO1995001994 and WO1998042752; all incorporated herein by reference, and immunoadhesions such as described in U.S. Pat. No. 8,329,867, incorporated herein by reference.
Also provided herein are methods and compositions that include one or more agents which inhibits FATP2 in combination with a CSF-1/1R binding agent or inhibitor (e.g. an anti-CSF1 or anti-CSF1R antibody), where the combination is used to treat a cancer, e.g., a cancer described herein, e.g., a solid tumor. In certain embodiments, the CSF-1/1R binding agent is a CSF-1R tyrosine kinase inhibitor, 4-((2-(((1R,2R)-2-hydroxycyclohexyl)amino)benzo[d]thiazol-6-yl)oxy)-N-met-hylpicolinamide (Compound A15), or a compound disclosed in PCT Publication No. WO 2005/073224. In certain embodiments, the CSF-1/1R binding agent is an M-CSF inhibitor, Compound A33, or a binding agent to CSF-1 disclosed in PCT Publication No. WO 2004/045532 or PCT Publication No WO 2005/068503 including RX 1 or 5H4 (e.g., an antibody molecule or Fab fragment against M-CSF). In certain embodiments, the CSF-1/1R binding agent is 4-(2-((1R, 2R)-2-hydroxycyclohexylamino)benzothiazol-6-yloxy)-N-methylpicolinamide, or BLZ-945. 4-(2-((1R, 2R)-2-hydroxycyclohexylamino)benzothiazol-6-yloxy)-N-methylpicolinamide is disclosed as example 157 at page 117 of PCT Publication No. WO 2007/121484. In certain embodiments, the CSF-1/1R binding agent is pexidartinib (CAS Registry Number 1029044-16-3). Pexidrtinib is also known as PLX3397 or 5-((5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)methyl)-N-((6-(trifluoromet-hyl)pyridin-3-yl)methyl)pyridin-2-amine. Pexidartinib is a small-molecule receptor tyrosine kinase (RTK) inhibitor of KIT, CSF1R and FLT3. In certain embodiments, the CSF-1/1R binding agent is emactuzumab. Emactuzumab is also known as RG7155 or R05509554. Emactuzumab is a humanized IgG1 mAb targeting CSF1R. In certain embodiments, the CSF-1/1R binding agent is FPA008. FPA008 is a humanized mAb that inhibits CSF1R.
Various routes of administration are useful in these methods. In one embodiment, the composition is delivered to the tumor site itself. In another embodiment, the composition is administered IV.
Pharmaceutical compositions may be formulated for any appropriate route of administration. For example, compositions may be formulated for intravenous, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisteral, intraperitoneal, intranasal, or aerosol administration. In some embodiments, pharmaceutical compositions are formulated for direct delivery to the tumor (intratumoral) or to the tumor environment. In another embodiment, pharmaceutical compositions are formulated for delivery to the lymph nodes.
Pharmaceutical compositions may be in the form of liquid solutions or suspensions (as, for example, for intravenous administration, for oral administration, etc.). Alternatively, pharmaceutical compositions may be in solid form (e.g., in the form of tablets or capsules, for example for oral administration). In some embodiments, pharmaceutical compositions may be in the form of powders, drops, aerosols, etc. Methods and agents well known in the art for making formulations are described, for example, in “Remington's Pharmaceutical Sciences,” Mack Publishing Company, Easton, Pa. Formulations may, for example, contain excipients, diluents such as sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
In another aspect, a pharmaceutical composition comprises the FATP2 inhibitor(s) described above optionally in combination with a checkpoint inhibitor in a pharmaceutically acceptable carrier or excipient in an effective amount to reduce, inhibit, retain or suppress growth of MDSC and/or the PMN-MDSC population. In yet another aspect, a pharmaceutical composition comprises the FATP2 inhibitor(s) described above optionally in combination with a checkpoint inhibitor in a pharmaceutically acceptable carrier or excipient in an effective amount to reduce, inhibit, retain or suppress tumor growth or treat cancer. In one aspect, the pharmaceutical composition contains, e.g., about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, to about 90% of the antagonist or inhibitors in combination with a pharmaceutical carrier or excipient.
By “pharmaceutically acceptable carrier or excipient” is meant a solid and/or liquid carrier, in in dry or liquid form and pharmaceutically acceptable. The compositions are typically sterile solutions or suspensions. Examples of excipients which may be combined with the antagonist or inhibitor include, without limitation, solid carriers, liquid carriers, adjuvants, amino acids (glycine, glutamine, asparagine, arginine, lysine), antioxidants (ascorbic acid, sodium sulfite or sodium hydrogen-sulfite), binders (gum tragacanth, acacia, starch, gelatin, polyglycolic acid, polylactic acid, poly-d,l-lactide/glycolide, polyoxaethylene, polyoxapropylene, polyacrylamides, polymaleic acid, polymaleic esters, polymaleic amides, polyacrylic acid, polyacrylic esters, polyvinylalcohols, polyvinylesters, polyvinylethers, polyvinylimidazole, polyvinylpyrrolidon, or chitosan), buffers (borate, bicarbonate, Tris-HCl, citrates, phosphates or other organic acids), bulking agents (mannitol or glycine), carbohydrates (such as glucose, mannose, or dextrins), clarifiers, coatings (gelatin, wax, shellac, sugar or other biological degradable polymers), coloring agents, complexing agents (caffeine, polyvinylpyrrolidone, β-cyclodextrin or hydroxypropyl-β-cyclodextrin), compression aids, diluents, disintegrants, dyes, emulsifiers, emollients, encapsulating materials, fillers, flavoring agents (peppermint or oil of wintergreen or fruit flavor), glidants, granulating agents, lubricants, metal chelators (ethylenediamine tetraacetic acid (EDTA)), osmo-regulators, pH adjustors, preservatives (benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid, hydrogen peroxide, chlorobutanol, phenol or thimerosal), solubilizers, sorbents, stabilizers, sterilizer, suspending agent, sweeteners (mannitol, sorbitol, sucrose, glucose, mannose, dextrins, lactose or aspartame), surfactants, syrup, thickening agents, tonicity enhancing agents (sodium or potassium chloride) or viscosity regulators. See, the excipients in “Handbook of Pharmaceutical Excipients”, 5th Edition, Eds.: Rowe, Sheskey, and Owen, APhA Publications (Washington, D.C.), 2005 and U.S. Pat. No. 7,078,053, which are incorporated herein by reference. The selection of the particular excipient is dependent on the nature of the compound selected and the particular form of administration desired.
Solid carriers include, without limitation, starch, lactose, dicalcium phosphate, microcrystalline cellulose, sucrose and kaolin, calcium carbonate, sodium carbonate, bicarbonate, lactose, calcium phosphate, gelatin, magnesium stearate, stearic acid, or talc. Fluid carriers without limitation, water, e.g., sterile water, Ringer's solution, isotonic sodium chloride solution, neutral buffered saline, saline mixed with serum albumin, organic solvents (such as ethanol, glycerol, propylene glycol, liquid polyethylene glycol, dimethylsulfoxide (DMSO)), oils (vegetable oils such as fractionated coconut oil, arachis oil, corn oil, peanut oil, and sesame oil; oily esters such as ethyl oleate and isopropyl myristate; and any bland fixed oil including synthetic mono- or diglycerides), fats, fatty acids (include, without limitation, oleic acid find use in the preparation of injectables), cellulose derivatives such as sodium carboxymethyl cellulose, and/or surfactants.
In one embodiment, the effective amount of the inhibitors is within the range of 1 mg/kg body weight to 100 mg/kg body weight in humans including all integers or fractional amounts within the range. In certain embodiments, the effective amount is at least 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 mg/kg body weight, including all integers or fractional amounts within the range. In one embodiment, the above amounts represent a single dose. In another embodiment, the above amounts define an amount delivered to the subject per day. In another embodiment, the above amounts define an amount delivered to the subject per day in multiple doses. In still other embodiments, these amounts represent the amount delivered to the subject over more than a single day.
In another embodiment, the pharmaceutical composition includes a FATP2 inhibitor and a chemotherapeutic. Alternatively, the active compound is formulated with a chemotherapeutic for treatment of the cancers described herein. In one embodiment, the chemotherapeutic is selected from among those described above. Alternatively, the composition is formulated with another effective compound or reagent for treatment of the cancers described herein, such as an antibiotic or bactericide, a surfactant, or other reagent commonly used in formulation of anti-cancer compositions.
The forms of the pharmaceutical compositions may be liquid, solid or a suspension or semi-solid and designed for use with a desired administrative route, such as those described herein. The doses and dosage regimens are adjusted for the particular cancer, and the stage of the cancer, physical status of the subject. Such doses may range from about 1 to about 100 mg/kg subject body weight of the antagonist or inhibitor, as discussed above and include dosage regimens designed to administer the effective amount in smaller repeated doses.
Polymorphonuclear myeloid derived suppressor cells (PMN-MDSC) are pathologically activated neutrophils that accumulate in many diseases. These cells are critically important for the regulation of immune responses in cancer, promotion of tumor progression, and metastases, and their presence correlates with poor prognosis and negative response to immunotherapy1-4. Despite the fact that neutrophils and PMN-MDSC share same origin and the same differentiation pathways, PMN-MDSC have distinct genomic and biochemical features and are immunosuppressive2. The mechanisms responsible for pathological activation of neutrophils are not well defined, which limits selective targeting of these cells. Here, we report a specific role of the fatty acid (FA) transport protein 2 (FATP2) in regulation of PMN-MDSC function.
The invention is now described with reference to the following examples. These examples are provided for the purpose of illustration only. The compositions, experimental protocols and methods disclosed and/or claimed herein can be made and executed without undue experimentation in light of the present disclosure. The protocols and methods described in the examples are not considered to be limitations on the scope of the claimed invention. Rather this specification should be construed to encompass any and all variations that become evident as a result of the teaching provided herein. One of skill in the art will understand that changes or variations can be made in the disclosed embodiments of the examples, and expected similar results can be obtained. For example, the substitutions of reagents that are chemically or physiologically related for the reagents described herein are anticipated to produce the same or similar results. All such similar substitutes and modifications are apparent to those skilled in the art and fall within the scope of the invention.
Samples of peripheral blood and tumor tissues were collected from patients at Helen F. Graham Cancer Center and University of Pennsylvania. The study was approved by Institutional Review Boards of the Christiana Care Health System at the Helen F. Graham Cancer Center, and The Wistar Institutional Review Board. All patients signed IRB approved consent forms. Samples were collected at Helen F. Graham Cancer Center from 6 patients with previously untreated stage II-IV non-small cell lung cancer (NSCLC), 11 patients with stage III-IV head and neck cancer and 5 patients with stage III-IV breast cancer. This cohort includes 12 females and 10 males, aged 48-74 years. Peripheral blood was also collected from 9 healthy volunteers after obtaining informed consent.
Animal experiments were approved by The Wistar Institute Animal Care and Use Committee. Balb/c or C57BL/6 mice (female, 6-8 week old) were obtained from Charles River, OT-I TCR-transgenic mice (C57Bl/6-Tg(TCRaTCRb)1100mjb) (female, 6-8 week old), B6.12951-Cd36tm1Mfe/J, B6.Cg-Msr1tm1Csk/J, 129S-Slc27a2tm1Kds/J were purchased from Jackson Laboratory. C57Bl/6-Slc27a2tm1Kds/J were generated by backcrossing 129S-Slc27a2tm1Kds/J with wild type C57Bl/6 for ten generations. B6.129S6-Stat5btm1Mam Stat5atm2Mam/Mmjax were crossed with B6.Cg-Tg(S100A8-cre,-EGFP) 1Ilw/J, obtained from Jackson Laboratory. RET melanoma were obtained from Dr. Umansky (German Cancer Center, Heidelberg, Germany). Sc127a4fl/fl were obtained from Dr. Stremmel (University of Heidelberg, Germany) and crossed with B6.Cg-Tg(S100A8-cre,-EGFP) 1Ilw/J (Jackson Laboratory). In mouse tumor models maximal tumor size approved by IACUC was 2 cm in larger diameter. In none of the experiments were these limits exceeded. Sample size calculation was performed in advance. Studies were not blinded. In treatment experiments, mice were randomized prior to start of therapy to different groups based on equal tumor size.
Mice were generated at CRISPR/Cas9 Mouse Targeting Core of University of Pennsylvania, using the CRISPR/Cas9 system as described31. Conditional knock-out mice (CKO Sc127a2fl/fl) were generated using CRISPR-Cas9 genome-editing system, at CRISPR Cas9 Mouse Targeting Core of University of Pennsylvania by flanking Exon 1 with loxp sites, as described31. The sequences for the gRNAs and repair templates used are as follows:
Sc127a2fl/fl mice were then crossed with B6.Cg-Tg(S100A8-cre,-EGFP) 1Ilw/J (Jackson Laboratory) to obtain mice with targeted deletion of FATP2.
Tumor cell lines: EL4 (lymphoma), LLC (Lewis Lung Carcinoma), CT26 (colon carcinoma), TC-1 (HPV16 E6/E7 expressing tumor cell line) were obtained from ATCC and F244 (sarcoma) was kindly provided by Dr. R. Schreiber (Washington University, St. Lois, Mo.). All cells were maintained in DMEM medium supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich, St. Louis, Mo.) at 37° C., 5% CO2. Tumor cells were injected subcutaneously (s.c.) at 5×105 cells per mouse. Tumor cell lines were obtained from ATCC and were tested for Mycoplasma contamination by using Universal Mycoplasma detection kit (ATCC) every 3 months. SIINFEKL and EGSRNQDWL peptides were obtained from American Peptide Company (Vista, Calif.).
Tumor explant supernatants (TES) were prepared from excised non-ulcerated EL4 tumors ˜1.5 cm in diameter. A small tumor piece (5-10 mm2) was harvested, minced into pieces <3 mm in diameter and resuspended in complete RPMI without extra cytokines. After 16-18 hours of incubation at 37° C. with 5% CO2, the cell-free supernatant was collected using 0.22 μm filters (EMD Millipore) and kept at −80° C.
Cells were incubated with FC-block (BD Biosciences) for 10 min and surface staining was performed at 4° C. for 15 min. Cells were run on LSRII flow cytometer (BD Biosciences) and data were analyzed by FlowJo (Tristar). For lipid staining by flow cytometry, cells were re-suspended in 500 μl of Bodipy 493/503 at 0.25 μg/ml in PBS. Cells were stained for 15 min at room temperature in the dark, then washed twice, re-suspended in PBS and run immediately on LSRII. For lipid staining by confocal microscopy, cells were washed twice with PBS, resuspended in complete RPMI and 50,000 cells were seeded on poly-L-lysine cellware 12 MM round coverslips (Corning) for 45 min at 37° C. Cells were fixed and permeabilized with Fixation & Permeabilization Buffers (BD Biosciences) for 15 min at RT, washed twice with wash buffer (BD Biosciences) and then stained with BODIPY for 15 min at RT. Cells were washed and incubated with DAPI and mounted on slides using Prolong Gold antifade reagent (Life Technology). The cells were imaged with a Leica TCS SP5 laser scanning confocal microscope (Leica Microsystems).
Single-cell suspensions were prepared from spleen and followed by red blood cell removal using ammonium chloride lysis buffer. Single-cell suspensions from tumor tissues were prepared using Mouse Tumor Dissociation Kit according to the manufacturer's recommendation (Miltenyi). CD8+ T cells were isolated from spleen and lymph nodes by using EasySep Mouse CD8+ T Cell Enrichment Kit (STEMCELL), following manufacturer's instructions.
Single cells suspensions from spleen and tumors were prepared as described above. Then cells were stained and sorted on BD FACS Aria BD (Biosciences). PMN-MDSC)(CD45+ CD11b+Ly6G+Ly6Clo and M-MDSC (CD45+ CD11b+Ly6G−Ly6Chi) were plated in U-bottom 96-well plates (3 replicates) in RPMI with 10% FBS and co-cultured at different ratios with splenocytes from Pmel or OT-1 transgenic mice in the presence of cognate peptides: OT-1 (SIINFEKL; 0.1 ng/ml), Pmel (EGSRNQDWL; 0.1 μg/ml). After 48 h, cells were incubated with [3H]-thymidine (PerkinElmer) for 16-18 h. Proliferation was measured by using TopCount NXT instrument (PerkinElmer).
Lymph nodes (LNs) were obtained from TB mice and digested for 30 min at 37° C. with collagenase A (0.5 mg/ml; Sigma Aldrich), Dnase I (0.2 mg/ml, Roche), diluted in HBSS with Ca2+/Mg2+ and 20 mM EDTA (Invitrogen) was added 5 min at room temperature to stop the reaction. CD8+ T cells were isolated from LNs of TB mice using EasySep Mouse CD8+ T Cell Enrichment Kit (STEMCELL) and stimulated with anti CD3 and anti CD28 antibodies (BD Biosciences) for 24 h and IFNγ was analyzed by ELISpot (Mabtech), accordingly to manufacturer's instructions. T cell proliferation was evaluated by flow cytometry using CSFE (BioLegend). Antigen specific CD8 T cell response was evaluated in single cell suspension obtained from LNs of TC1 (HPV16 E6/E7 expressing tumor cells) TB mice by flow cytometry using MHC tetramer (H-2db HPV 16 E7-RAHYNIVTF), obtained from D. Weiner (Wistar Institute, Philadelphia, USA).
PMN-MDSC and PMN were isolated by centrifugation over a double density gradient Histopaque (Sigma) (1.077 to collect PBMC and 1.119 to collect PMN) followed by labeling with CD15-PE mAb (BD Biosciences) and then separated using anti-PE beads and MACS column (Miltenyi). Tissues were first digested with human tumor dissociation kit (Miltenyi) and then red blood cell lysed. Cells were then culture in RPMI (Biosource International) supplemented with 10% FBS, 5 mM glutamine, 25 mM HEPES, 50 μM β-mercaptoethanol and 1% antibiotics (Invitrogen). For isolation of Lox1+ PMN from peripheral blood, whole blood was enriched for PMNs using MACSxpress® Neutrophil Isolation Kit (Miltenyi) following the protocol provided by the manufacturer. Cells were then labeled with anti-Lox1-PE mAb (Biolegend) and then separated using anti-PE beads and MACS column (Miltenyi).
RNA was extracted using Total RNA Kit according to manufacturer's instructions. DNase digestion was performed cDNA was generated with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, Calif., USA). qRT-PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems) in 96- or 384 well plates. Plates were read with ABI 7900 (Applied Biosystems).
RNA-seq data was aligned using bowtie232 against mm10 version of the mouse genome and RSEM v1.2.12 software33 was used to estimate raw read counts using Ensemble v84 gene information. DESeq234 was used to estimate significance of differential expression between sample groups. Overall gene expression changes were considered significant if passed false discovery rate FDR<5% threshold. Significant genes affected at least 2 fold were analyzed for enrichment of upstream regulators using QIAGEN's Ingenuity® Pathway Analysis software (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity, “Upstream Analysis” option). Only regulators with significantly enriched p<0.005 targets (at least 20) with significantly predicted activation state (activation z-score |Z|>2) were considered.
Cells were lysed in RIPA buffer (Sigma-Aldrich) in presence of protease inhibitor cocktail (Sigma-Aldrich), sonicated and stored at −80° C. Whole cell lysates were prepared and subjected to 10% SDS-PAGE and transferred to PVDF membrane. The membranes were probed overnight at 4° C. with the antibodies specific for FATP2 (SLC27A2) (ThermoFisher), ACTIN, GAPDH, STAT5 (Cell Signaling Technology). Membranes were washed and incubated for 1 h at room temperature with secondary antibody conjugated with peroxidase.
Mouse neutrophils were generated from enriched bone marrow hematopoietic progenitor cells (HPCs) with 20 ng/ml of GM-CSF. Briefly, HPCs were isolated from mouse BM by using Lineage depletion kit (Miltenyi), according to manufacturer's instructions. Cells were seeded at 25000 cell/ml in 24 well plates and GM-CSF (20 ng/ml), 20% v/v TES or arachidonic acid (10 μM) were added at day 0 and day 3. At day 5, Ly6G positive neutrophils were isolated by using anti-Ly6G biotin (Miltenyi) and streptavidin beads (Miltenyi), according to manufacturer's instructions.
HPCs were isolated from mouse BM by using Lineage depletion kit (Miltenyi), according to manufacturer's instructions. HPC were resuspended in serum-free medium (SFM) containing lentiviral vectors followed by centrifugation of the plate at 1000 rpm for 20 min at 25° C. Fresh media supplemented with GM-CSF (20 ng/ml) was then added and cells were seeded at 25000 cell/ml in 24 well plates. At day 3, GM-CSF and 20% v/v TES were added to the culture. At day 5, cells were collected, stained with PE conjugated anti mouse Ly6G, APC conjugated anti mouse Ly6C and BV421 conjugated anti-mouse CD11b, and GFP− and GFP+Ly6G+ cells were sorted on BD FACS Melody (BD Biosciences). GFP− and GFP+Ly6G+ cells were seeded at 2.000.000 cells/ml in presence of GM-CSF and TES and incubated for further 24 hours. Pellets and supernatants were collected for further analysis. PGE2 concentration in supernatants was measured by using PGE2 ELISA KIT (Invitrogen), according to manufacturer's instructions.
Splenic PMN-MDSC from WT and FATP2 KO LLC TB mice were cultured in complete media (RPMI+10% FBS) with 100 nM of d11AA (Cayman Chemicals), conjugated to 10% fatty acid-free BSA (Sigma Aldrich), and 10 ng/ml of GM-CSF. After 16-18 h, supernatants and cellular pellets were collected and stored at −80c. Lipids (including PGE2 and PGE2d11) were analyzed by LC-MS; the amounts of PGE2 in the supernatants were measured by ELISA.
Immunofluorescence staining of CD8 was performed on frozen mouse tumor tissue sections. Rat monoclonal anti-mouse CD8a primary antibody (BD Pharmingen™) and Alexa Fluor 594 goat anti-rat IgG (H+L) secondary antibody (Invitrogen) were used for the staining. Cell nuclei were stained with DAPI. Imaging was performed using a Leica TCS SP5 confocal microscope. Sixteen frames acquired with a 63× objective lens were used to calculate the cell number per mm2.
Metabolic rates were determined using the Seahorse XFe24 and XFe96 Flux Analyzers (Agilent Technologies) following the manufacturer's protocol. Briefly, the microplate was coated with 22.4 μg/ml Cell-Tak (Fisher) using 200 mM sodium bicarbonate. 400,000 cells were seeded per well immediately after isolation in 50 μl and 80 μl of unbuffered RPMI (Sigma-Aldrich) for the XF24 and XF96 analyzers, respectively. The microplate was incubated for 30 min at 37° C. to allow the cells to settle into a monolayer. Unbuffered RPMI was gently added to the wells without disturbing the monolayer to bring the assay volume to 675 μl and 1800 for the XFe24 and XFe96 analyzer, respectively. The basal oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) was measured, in addition to rate changes upon treatment with 5 μM oligomycin (Sigma-Aldrich), 1 μM FCCP (Sigma-Aldrich), and 0.75 μM rotenone and 1 μM antimycin A (Sigma-Aldrich).
Chromatin immunoprecipitation (ChIP) assays were performed as described previously35. Briefly, PBMC cells were treated or not with GM-CSF 10 ng/ml and 100 ng/ml for 20 min. Cells then were fixed in 1% formaldehyde for 10 min. DNAs were sonicated to obtain 200- to 400-bp DNA fragments on a Diagenode Bioruptor according to the manufacturer's protocol. The following antibodies were used for ChIP assays: anti-rabbit IgG (Santa Cruz Biotechnology), anti-Phospho-STAT5 alpha (Tyr694) Antibody (6H5L15) Rabbit Monoclonal (Invitrogen). PCR data were normalized to input values that were quantified in parallel for each experiment.
5×105 tumor cells were injected s.c. into mice, which formed tumors with a 1.5-cm diameter within 2-3 weeks of injection. Lipofermata was administrated s.c. at dose of 2 mg/kg twice per day. As a control, mice were treated with vehicle alone (DMSO+30% v/v Kolliphor). Treatments with lipofermata started 8-10 days after tumors injections. CSF1R antibody (BioXcell, 300 μg/mouse) was administered every other day starting next day after tumor injection and continued until the mice were sacrificed. PD-1 antibody (clone RMP1-14, BioXcell, 200 μg/mouse) was administered twice a week started 10-12 days after tumor injection. CTLA4-IgG2a (BioXcell, 200 μg/mouse) was administered at day 7 and day 11.
Lipids were extracted by Folch procedure with slight modifications, under nitrogen atmosphere, at all steps. LC/ESI-MS analysis of lipids was performed on a Dionex HPLC system (utilizing the Chromeleon software), consisting of a Dionex UltiMate 3000 mobile phase pump, equipped with an UltiMate 3000 degassing unit and UltiMate 3000 autosampler (sampler chamber temperature was set at 4° C.). The Dionex HPLC system was coupled to an Orbitrap Fusion Lumos mass spectrometer (ThermoFisher Scientific) or to a hybrid quadrupole-orbitrap mass spectrometer, Q-Exactive (ThermoFisher, Inc., San Jose, Calif.) with the Xcalibur operating system. The instrument was operated in negative and positive ion modes (at a voltage differential of −3.5-5.0 kV, source temperature was maintained at 150° C.). Phospholipids (PLs) MS and MS/MS analysis was performed on an Orbitrap Fusion Lumos mass spectrometer. MS and MS/MS analysis of free fatty acids (FFA) and TAG/CE was performed on a Q-Exactive hybrid-quadrupole-orbitrap mass spectrometer (ThermoFisher, Inc. San Jose, Calif.). MS lipid standards were from Avanti Polar Lipids (Alabaster, Ala.) and from Cayman Chemical Company (Ann Arbor, Mich.). Analysis of LC-MS data was performed using the software package Compound Discoverer™ (ThemoFisher Scientific).
The FATP2 gene was amplified from the pCMV6-Kan/Neo-FATP2 plasmid (Origene, Cat #MC206275) using the following primers: FATP2_For_XmaI (GGTGGTCCCGGGCCTATGCTGCCAGTGCTCTACAC) (SEQ ID NO: 6) and FATP2_Rev_SalI (GGTGGTGTCGACTCAGAGCTTCAGAGTTTTAT) (SEQ ID NO: 7). The amplified PCR product was then digested with XmaI/SalI and cloned into a SIV-based self-inactivating lentiviral transfer vector downstream of GFP (pGAE-CMV-GFP-P2A-FATP2-Wpre). The transfer vector pGAE-CMV-GFP-Wpre, the packaging plasmid pAd-SIV3+, and the vesicular stomatitis virus envelope G protein (VSV-G) pseudotyping vector from Indiana serotype (pVSV.GIND), have been previously described36,37.
Statistical analysis was performed using unpaired two-tailed Student's t-test with significance determined at 0.05. Estimation of variation within each group of data was performed and variance was similar between groups that were compared. Animal experiments were not blinded. Tumor growth was evaluated using two-way Anova test with Bonferroni correction for multiple comparisons.
The data that support the findings of this study are available from the corresponding author upon reasonable request. RNAseq data are deposited to GEO data repository, accession number GSE126885.
FATP2 is Selectively Overexpressed by PMN-MDSC and Controls their Suppressive Activity
We evaluated total lipid levels in CD11b+Ly6CloLy6G+ PMN-MDSC from spleens of tumor-bearing (TB) mice and neutrophils (PMN) with the same phenotype from spleens of tumor-free mice in transplantable models of EL-4 lymphoma, LLC lung carcinoma, and CT26 colon carcinoma as well as genetically engineered model (GEM) of pancreatic cancer (KPC). PMN-MDSC in all tested models showed substantially higher amounts of lipids than control PMN (
Previous studies demonstrated that lipid accumulation in DCs was mediated by up-regulation of scavenger receptor CD2048-10. However, whereas the accumulation of lipids was abrogated in CD204 deficient (Msr1−/−) DCs, it was not affected in PMN (
Next, we asked whether FATP2 might regulate the functionality of PMN-MDSC. To this end, we analyzed the function of PMN-MDSC isolated from slc27a2−/− mice. These mice were originally generated on SV129 background. Therefore, we established a syngeneic sarcoma (F244) in slc27a2−/− and WT mice. Tumors were spontaneously rejected in FATP2 KO mice (
Since the functionality of PMN-MDSC depends on tumor burden, we compared PMN-MDSC from WT and FATP2 KO TB mice depleted of CD8 T cells, which allow for the analysis of mice with the same tumor size. In both, spleens and tumors of FATP2 KO mice, PMN-MDSC lost the ability to suppress antigen-specific CD8+ T cell responses (
Expression of slc27a4, which encodes FATP4 was slightly up-regulated in PMN-MDSC (
Whole genome RNAseq was performed on spleen PMN-MDSC isolated from WT and FATP2 KO TB mice. Deletion of FATP2 resulted in significant changes in 1119 genes (FRD<5%, at least 2-fold) with 37 genes showing dramatic changes of at least 5-fold (
We then investigated the role of FATP2 in regulating lipid accumulation by PMN-MDSC. Experiments were performed with PMN-MDSC isolated from WT and FATP2 KO LLC TB mice with depleted CD8+ T cells. LC-MS analysis revealed a lower total amount of TG in FATP2 KO spleen PMN-MDSC than in WT PMN-MDSC and especially TG containing C20:4 AA (
We next employed a method of stable isotope labeling using deuterated AA, (AAd11) and high mass accuracy/high resolution LC-MS with MS/MS fragmentation analysis to directly trace uptake of exogenously added AAd11 by PMN-MDSC from WT and FATP2 KO LLC TB mice. We detected significantly lower amounts of AAd11, as well as labeled PGE2d11 in FATP2 KO PMN-MDSC compared to WT PMN-MDSC (
Next, we asked whether lack of FATP2 affected metabolic activity of PMN-MDSC. Spleen PMN-MDSC deficient in FATP2 did not show changes in OXPHOS (
AA is a key precursor of PGE2, which was implicated in the suppressive activity of MDSC in cancer18-21 and PMN-MDSC from neonates22. We therefore sought to investigate whether FATP2 regulates the suppressive functions of PMN-MDSC through the accumulation of AA and the subsequent production and release of PGE2. Using LC/MS (FIG. HA) and ELISA (
To test whether AA could drive the accumulation of suppressive PMN, we generated PMN from HPC in the presence of GM-CSF and AA and found that addition of AA favored the expansion of PMN-MDSC (
Slc27a2 promoter has a binding site for the transcription factor STAT5 (http://jaspar.genereg.net). STAT5 can be activated by GM-CSF, which plays a critical role in myelopoiesis and expansion of MDSC23. To explore whether GM-CSF might control slc27a2 expression through STAT5 activation we treated PMN isolated from BM of tumor free mice with GM-CSF for 2 hrs. As expected, it caused a dose-dependent activation of STAT5 (pSTAT5) (
PMN-MDSC isolated from the blood of patients with head and neck, lung, or breast cancers accumulated more lipids than PMN from healthy donors (
Using LS/MS lipidomics we identified a substantially higher amount of total TG (
Next, we sought to determine the impact of the pharmacological inhibition of FATP2 on tumor growth. To inhibit FATP2 in TB mice, we used 5′-bromo-5-phenyl-spiro[3H-1,3,4-thiadiazole-2,3′-indoline]-2′-one, (lipofermata). This is a selective FATP2 inhibitor15,25. Lipofermata at the range of concentrations corresponding to the dose used in vivo (0.2 mg/ml) did not affect proliferation of EL-4 and LLC tumor cells in vitro (
We asked whether lipofermata could provide additional therapeutic benefit if combined with checkpoint inhibitors. Treatment of LLC bearing mice with lipofermata or CTLA4 alone had an antitumor effect. However, neither blocked tumor progression. In contrast, combination of CTLA4 antibody with lipofermata caused potent antitumor effect with 4 out of 5 mice rejecting tumors (
Our study has identified FATP2 as a critical regulator of the immune suppressive function of PMN-MDSC, which mediates its effect via regulation of the accumulation of AA and subsequent synthesis of PGE2. These findings are consistent with the results demonstrating that production of PGE2 support tumor growth and immune escape27. Previous reports established the potential role of COX2 inhibitors in blockade of MDSC expansion in mouse tumor models28,18,29,30. However, prolonged systemic use of COX2 inhibitors is associated with substantial hematologic, cardiovascular and gastrointestinal toxicities. Selective targeting of FATP2 in PMN-MDSC offers the opportunity to inhibit PGE2 only in pathologically activated neutrophils and mostly within the tumor site, where expression of FATP2 is the highest. It is also possible that blockade of local release of PGE2 at the contact between PMN-MDSC and T cells in peripheral lymphoid organs can improve immune responses without systemic effects of PGE2 inhibition.
Oncoimmunology 6, e1344804, doi:10.1080/2162402X.2017.1344804 (2017).
The following information is provided for sequences containing free text under numeric identifier <223>.
Each and every patent, patent application, and any document listed herein, and the sequence of any publicly available nucleic acid and/or peptide sequence cited throughout the disclosure, is/are expressly incorporated herein by reference in their entireties. U.S. Provisional Patent Application No. 62/808,787, filed Feb. 21, 2019, and U.S. Provisional Patent Application No. 62/830,506, filed Apr. 7, 2019, are incorporated by reference in their entireties. The sequence listing filed herewith labeled “WST181PCT_ST25.txt” and the sequences and text therein are incorporated by reference. Embodiments and variations of this invention other than those specifically disclosed above may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims include such embodiments and equivalent variations.
This invention was made with government support under grant numbers CA R01CA165065 and AI110485 awarded by the National Institutes of Health. The government has certain rights in the invention.
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/US2020/019180 | 2/21/2020 | WO | 00 |
Number | Date | Country | |
---|---|---|---|
62830506 | Apr 2019 | US | |
62808787 | Feb 2019 | US |