Patent Application
20250151721
The present disclosure concerns mosquito attractant compositions and methods of using the same.
Mosquitoes serve as vectors for the spread of several diseases that severely impact the health of humans, pets, and livestock. For example, the mosquito is the principal vector responsible for the spread of several viruses pathogenic to humans, including dengue, Zika and yellow fever viruses. Dengue fever is a major public health problem in tropical regions worldwide. The World Health Organization estimates that 51 million infections with the dengue fever occur annually and 2.5-3 billion people are at risk in the 100 countries where dengue fever occurs. There has been a dramatic rise in the number of cases of dengue hemorrhagic fever in Asia, and recently dengue fever has been introduced into Central and South America.
Most mosquito species are generalist biters, but a few have evolved to specialize in biting humans and thus have become dangerously efficient vectors of human disease. Specialist females rely heavily on their sense of smell to discriminate among hosts and strongly prefer human odor over the odor of non-human animals. Vertebrate odors are complex blends of tens to hundreds of compounds that overlap extensively in chemical composition. Human odor in particular is not known to contain any unique odorants, and mosquitoes likely rely on multi-component blends for attraction and discrimination.
A globally invasive form of the mosquito Aedes aegypti is one such mosquito that has evolved to specialize in biting humans. Host-seeking Aedes aegypti females identify humans by smell, strongly preferring human odor over the odor of non-human animals. Exactly how they discriminate, however, is unclear. This presents significant challenges in sensory coding mosquito vector control strategies seek to manage the population of mosquitoes to reduce their damage to human health, economies and enjoyment, and to halt the transmission cycle of mosquito-borne diseases. Mosquito control is a vital public-health practice throughout the world and particularly in the tropics where the spread of diseases, such as malaria, by mosquitoes is especially prevalent.
Many measures have been tried for mosquito control, including the elimination of breeding places, exclusion via window screens and mosquito nets, biological control with parasites such as fungi and nematodes, chemical control with mosquito killing agents, such as pesticides, or control through the action of predators, such as fish, copepods, dragonfly nymphs and adults, and some species of lizards.
In order to allow for the successful control of mosquitoes, for example, when using methods having a direct effect, such as when using chemical or biological agents, it is first necessary to attract mosquitoes so that they are brought into proximity or contact with the relevant agent and, in some cases, to induce the mosquitoes to consume a sufficient amount of that agent in order for it to take effect. To this end, various chemical compounds and formulations have been developed which have a mosquito attractant effect. These compounds and formulations are often combined with mosquito trapping devices, which are designed to lure and retain (e.g. by killing) the mosquito.
Nevertheless, the mosquito attractant formulations known in the art have several limitations. In particular, compounds and formulations known in the art are found to have only a limited attractant effect, which may diminish rapidly over time.
Moreover, known mosquito control agents, such as chemical and biological control agents, often suffer from poor efficacy due to difficulties in ensuring an adequate level of consumption of such agents by the target organism. Thus, there exists a significant need for improved methods for attracting mosquitoes to control their location and to entice them to lethal traps or compounds.
There is a continuing need in the art for compositions and methods for monitoring, affecting the behavior of, and/or controlling mosquito populations, particularly those with a preference for humans.
The following figures are included to illustrate certain aspects of the present disclosure and should not be viewed as exclusive embodiments. The subject matter disclosed is capable of considerable modifications, alterations, combinations, and equivalents in form and function, as will occur to those skilled in the art and having the benefit of this disclosure.
Provided herein are mosquito attractant compositions that mimic the neural activity evoked by human odor in the mosquito brain and differentiation humans from other vertebrate animals. In an embodiment, the formulation comprises a first component capable of activating a broadly-tuned glomerulus of a mosquito, a second component capable of activating a human-sensitive glomerulus of the mosquito, and a solvent. In some embodiments, the first component is 1-hexanol. In some embodiments, the second component is a long chain aldehyde.
According to the disclosure human odor is particularly enriched for the ketones sulcatone, and geranylacetone. Human odour also stands out for its high relative abundance of the long-chain aldehyde decanal (10 carbons) and low relative abundance of the short-chain aldehydes hexanal and heptanal (6 and 7 carbons) as compared to other animal odors. Interestingly, the two ketones and decanal are the respective breakdown products of squalene and sapienic acid, unique components of human sebum that may play a role in skin protection and could provide other potential odorant compounds. Thus, in an embodiment the attractant compositions of the disclosure include one or more of a long-chain aldehyde. In some embodiments, the long-chain aldehyde is decanal. In some embodiments, the attractant composition further comprises sulcatone and/or geranyl acetone.
The present disclosure also provides methods for controlling malaria and dengue virus transmission as well as other diseases that are transmitted using mosquitos as vectors, comprising the step of applying a composition described herein in an area where the mosquitoes are to be controlled. In specific embodiments, the mosquitoes comprise Anopheles and/or Aedes mosquitoes. In more specific embodiments, the Anopheles mosquitoes comprise Anopheles gambiae mosquitoes. In other embodiments, the Aedes mosquitoes comprise Aedes aegypti mosquitoes.
In another aspect, the disclosure provides a mosquito trap comprising a trapping chamber or adhesive, and a composition comprising 1-hexanol, an aldehyde component of one or more aldehydes, and a solvent, the composition positioned to attract the mosquito.
So that the present disclosure may be better understood, certain terms are first defined.
As used herein, “weight percent,” “wt-%,” “percent by weight,” “% by weight,” and variations thereof refer to the concentration of a substance as the weight of that substance divided by the total weight of the composition and multiplied by 100. It is understood that, as used here, “percent,” “%,” and the like are intended to be synonymous with “weight percent,” “wt-%,” etc.
As used herein, the term “about” refers to variation in the numerical quantity that can occur, for example, through typical measuring and liquid handling procedures used for making concentrates or use solutions in the real world; through inadvertent error in these procedures; through differences in the manufacture, source, or purity of the ingredients used to make the compositions or carry out the methods; and the like. The term “about” also encompasses amounts that differ due to different equilibrium conditions for a composition resulting from an initial mixture. Whether or not modified by the term “about”, the claims include equivalents to the quantities.
It should be noted that, as used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to a composition containing “a compound” includes a composition having two or more compounds. It should also be noted that the term “or” is generally employed in its sense including “and/or” unless the content clearly dictates otherwise.
“Mosquito” as used herein encompasses any type of mosquito (e.g., Anopheles, Aedes, Ochlerotatus, and Culex), including but not limited to Tiger mosquitoes, Aedes aborigines, Aedes Aegypti, Aedes albopictus, Aedes cantator, Aedes sierrensis, Aedes sollicitans, Aedes squamigeer, Aedes sticticus, Aedes vexans, Anopheles quadrimaculatus, Culex pipiens, Culex quinquefaxciatus, and Ochlerotatus triseriatus.
The term “substantially free” may refer to any component that the composition of the disclosure or a method incorporating the composition lacks or mostly lacks. When referring to “substantially free” it is intended that the component is not intentionally added to compositions of the disclosure. Use of the term “substantially free” of a component allows for trace amounts of that component to be included in compositions of the disclosure because they are present in another component. However, it is recognized that only trace or de minimus amounts of a component will be allowed when the composition is said to be “substantially free” of that component. Moreover, the term if a composition is said to be “substantially free” of a component, if the component is present in trace or de minimus amounts it is understood that it will not affect the effectiveness of the composition. It is understood that if an ingredient is not expressly included herein or its possible inclusion is not stated herein, the disclosure composition may be substantially free of that ingredient. Likewise, the express inclusion of an ingredient allows for its express exclusion thereby allowing a composition to be substantially free of that expressly stated ingredient.
As used herein, the term “alkyl” or “alkyl groups” refers to saturated hydrocarbons having one or more carbon atoms, including straight-chain alkyl groups (e.g., methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.), cyclic alkyl groups (or “cycloalkyl” or “alicyclic” or “carbocyclic” groups) (e.g., cyclopropyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, etc.), branched-chain alkyl groups (e.g., isopropyl, tert-butyl, sec-butyl, isobutyl, etc.), and alkyl-substituted alkyl groups (e.g., alkyl-substituted cycloalkyl groups and cycloalkyl-substituted alkyl groups).
Unless otherwise specified, the term “alkyl” includes both “unsubstituted alkyls” and “substituted alkyls.” As used herein, the term “substituted alkyls” refers to alkyl groups having substituents replacing one or more hydrogens on one or more carbons of the hydrocarbon backbone. Such substituents may include, for example, alkenyl, alkynyl, halogeno, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, cyano, amino (including alkyl amino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonates, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclic, alkylaryl, or aromatic (including heteroaromatic) groups.
In some embodiments, substituted alkyls can include a heterocyclic group. As used herein, the term “heterocyclic group” includes closed ring structures analogous to carbocyclic groups in which one or more of the carbon atoms in the ring is an element other than carbon, for example, nitrogen, sulfur or oxygen. Heterocyclic groups may be saturated or unsaturated. Exemplary heterocyclic groups include, but are not limited to, aziridine, ethylene oxide (epoxides, oxiranes), thiirane (episulfides), dioxirane, azetidine, oxetane, thietane, dioxetane, dithietane, dithiete, azolidine, pyrrolidine, pyrroline, oxolane, dihydrofuran, and furan.
As used herein, references to the compounds hexanal, heptanal, octanal, nonanal, decanal, and undecanal will be understood to refer the linear (i.e. non-branched) aldehydes, which may alternatively be referred to as n-octanal, n-nonanal and n-decanal, respectively.
Disclosed herein are mosquito attractant compositions that mimic human odor in the mosquito brain. These compositions may be formulated as mosquito attractants as well as repellents. The disclosed methods may be employed to attract and trap mosquitoes, as a method of mosquito control. The pattern of activity recorded in the mosquito brain when exposed to human odor can further be used to develop additional mosquito attractants and repellents.
It is known that host-seeking mosquitoes are most attracted to a blend of compounds with characteristic ratios, rather than single compounds. However, it is difficult to rationally design mosquito attractants that are composed of a blend of compounds, since the number of combinations of compounds is virtually infinite, and not all compounds are detected by mosquitoes and therefore contribute to the host-seeking behavior.
The present disclosure solves this problem by utilizing the pattern of neural activity in the brain of mosquitoes when exposed to human and animal odor. It was observed that Aedes aegypti mosquitoes strongly prefer human odor over animal odor. Genetic reagents and imaging methods to record neural activity in the olfactory center of mosquito brain were developed. It was found that human odor has unique and robust representation in the mosquito brain, compared to animal odor. Two components of human odor (long-chain aldehydes decanal and undecanal) help generate the unique representation of human odor. A synthetic binary blend that mimics human odor in the mosquito brain was formulated. It was demonstrated with wind-tunnel experiments that this blend is attractive to mosquitoes and evokes strong hostseeking behavior. It may be effective as a mosquito attractant in the field.
In an embodiment, the mosquito attractant that mimics human odor in the mosquito brain has the following recipe:
In some embodiments, the mosquito attractant has components that activate 2 key sets of neurons in the mosquito brain. One having skill in the art would understand from the present disclosure that the information disclosed herein may be used to develop additional mosquito attractants (activate both sets of neurons) and repellents (inhibit one or both sets of neurons). It is possible to add other compounds to enhance activation of the odorant receptor (OR) pathway or activate the ionotropic receptor (IR) pathway to evoke more robust host-seeking behavior. Thus, the composition is not limited to the formulation presented in Table 1.
The mosquito attractant formulations include an aldehyde component enriched in long chain linear fatty aldehydes that mimic human odor. These include aldehydes with a C8 to C11 carbon chain length, including but not limited to octanal, nonanal, decanal and/or undecanal. In an embodiment the composition includes lesser amounts or are substantially free of hexanal and heptanal. The total aldehyde component includes 50 wt. % or more of one or more C8 to C11 carbon chain aldehydes which mimic human odors as compared to C6 and/or C7 aldehydes which mimic the odors of other vertebrate animals such as quail, rat, guinea pig, sheep, or dog. in further embodiments, the aldehyde component comprises at least decanal and/or undecanal. In a preferred embodiment the composition is free of terpenes such as limonene and pinene typically associated with nectar odors.
The compositions may further include a ketone component which is typically enriched in human odors including one or more of sulcatone and/or geranylacetone.
The composition may comprise a blend of compounds. When more than one compound is used, the compounds may be present in effective ratios. For example, the compounds may be present in a ratio similar to that found in nature, as described herein. For example, the composition may comprise a blend of sulcatone, geranylacetone, decanal and undecanal in weight ratios that mimic those of typical human odor. Using more than one compound may extend the range of effective dosages and/or may reduce the amount of total attractant or of a specific attractant effective to attract and/or arrest mosquitoes.
The composition may be provided in a concentrated form (i.e., in a form that requires dilution prior to use, or which is diluted upon delivery to the site of use) or in a dilute form that is suitable for use in the methods without dilution.
The Examples include detail as to how one would go about determining the dose-response of attractant by particular species of mosquitoes as a function concentration. Thus, using the teachings provided herein, it is well within the ability of one skilled in the art to determine an effective concentration for use in the methods of the disclosure.
For example, the methods of the disclosure, which optionally may be carried out using the compositions of the disclosure, may employ final concentrations of at least about 1 ng, at least about 10 ng, at least about 100 ng, at least about 0.001 mg, at least about 0.01 mg, or at least about 0.1 mg with respect to a single compound or the total of two or more compounds. The composition may comprise less than about 1 mg, less than about 0.1 mg, less than about 0.01 mg, less than about 0.001 mg, less than about 100 ng, or less than about 10 ng of total compound. The methods may employ compounds in a concentration of from about 1 ng to about 100 ng of total compound. The methods may employ final concentrations of compound at the target of at least about 0.03 ng/ml, at least about 0.3 ng/mL, at least about 3.0 ng/ml, or at least about 30 ng/mL. The methods may employ compound in a final concentration of at the target of less than about 300 ng/mL, less than about 30 ng/ml, or less than about 3.0 ng/mL. The methods may employ compound such that the final concentration of compound at the target is about 0.03 to about 3.33 ng/mL.
The skilled person will understand that references herein to a mosquito attractant effect (or to formulations capable of mosquito attraction, mosquito lures or bait, and the like) will refer to an ability to alter the behavior of one or more mosquitoes such that their direction of travel is altered by movement thereto.
For example, such a mosquito attractant effect may be characterized by an increase in the propensity of a sample of mosquitoes to travel in a direction as affected by the presence of the substance(s) (e.g. the formulation, such as the formulation of the first aspect of the invention) having that effect.
Such an increase may be qualitative (e.g. an observation of a general change in mosquito behavior) or, in particular, may be quantitative (i.e. measurable). In such circumstances, such an effect may be characterized by at least a 10% (e.g. at least a 20%, such as at least a 30% or, particularly at least a 50% or, more particularly, at least a 100%) increase in the propensity of a sample of mosquitoes to adjust the direction of travel thereto.
Alternatively, the skilled person will be aware of various means by which such effects may be assessed (e.g. measured) by experiments performed in a controlled setting, such as may be described in more detail herein. For example, such experiments may assess the increased bias of mosquitoes to travel towards (e.g. along a predefined pathway towards) and/or land upon the substance the substance having the mosquito attractant effect. In such circumstances, such an effect may be characterized by at least a 10% (e.g. at least a 20%, such as at least a 30% or, particularly at least a 50%) increase in said bias.
The attractant composition may be in any suitable form, including but not limited to liquid, gas, or solid forms or shapes known in the art such as pellets, particles, beads, tablets, sticks, pucks, briquettes, pellets, beads, spheres, granules, micro-granules, extrudates, cylinders, ingot, and the like. In some embodiments, the composition may be provided in a quick-release composition, an extended release composition, or a combination thereof.
The compositions may also include additional components or agents, such as additional functional ingredients. The functional materials provide desired properties and functionalities to the compositions. For the purpose of this application, the term “functional materials” includes a material that when dispersed or dissolved in a use and/or concentrate solution, such as an aqueous solution, provides a beneficial property in a particular use. Some particular examples of functional materials are discussed in more detail below, although the particular materials discussed are given by way of example only, and a broad variety of other functional materials may be used.
The compositions of the disclosure may comprise the attractant compounds encapsulated within, deposited on, or dissolved in a carrier. As used herein, a carrier may comprise a solid, liquid, or gas, or combination thereof. Suitable carriers are known by those of skill in the art. For example, liquid carriers may include, but are not limited to, water, media, paraffin oil, glycerol, or other solution. In other embodiments, a water-soluble solvent, such as alcohols and polyols, can be used as a carrier. These solvents may be used alone or with water. Some examples of suitable alcohols include methanol, ethanol, propanol, butanol, and the like, as well as mixtures thereof. Some examples of polyols include glycerol, ethylene glycol, propylene glycol, diethylene glycol, and the like, as well as mixtures thereof. The carrier selected can depend on a variety of factors, including, but not limited to the desired functional properties of the compositions, and/or the Intended use of the compositions.
In some embodiments, the compositions are not meant to be diluted, but are rather ready to use solutions. In some embodiments, the compositions can include at least about 80 wt %, at least about 85 wt %, at least about 90 wt %, or at least about 95 wt % of a carrier. It is to be understood that all ranges and values between these ranges and values are included in the present compositions.
In certain embodiments, the formulation is provided in conjunction with a suitable solid or semi-solid carrier. Suitable solid carriers may include, but are not limited to, biodegradable polymers, talcs, attapulgites, diatomites, fullers earth, montmorillonites, vermiculites, synthetics (such as Hi-Sil or Cab-O-Sil), aluminum silicates, apatites, bentonites, limestones, calcium sulfate, kaolinities, micas, perlites, pyrophyllites, silica, tripolites, and botanicals (such as corn cob grits or soybean flour), and variations thereof that will be apparent to those skilled in the art.
The solid carrier can be a macromer, including, but not limited to, ethylenically unsaturated derivatives of poly(ethylene oxide) (PEG) (e.g., PEG tetraacrylate), polyethylene glycol (PEG), polyvinyl alcohol (PVA), poly (vinylpyrrolidone) (PVP), poly (ethyloxazoline) (PEOX), poly (amino acids), polysaccharides, proteins, and combinations thereof. Carriers may also include plaster.
Polysaccharide solid supports include, but are not limited to, alginate, hyaluronic acid, chondroitin sulfate, dextran, dextran sulfate, heparin, heparin sulfate, heparin sulfate, chitosan, gellan gum, xanthan gum, guar gum, water soluble cellulose derivatives, carrageenan, and combinations thereof.
Protein solid supports include, but are not limited to, gelatin, collagen, albumin, and combinations thereof.
In more particular embodiments, the suitable solid or semi-solid carrier is: a wax, wax-like, gel or gel like material; an absorbent solid material or material capable of having the formulation adsorbed thereon; or a solid matrix capable of having the formulation contained therein.
For example, in particular embodiments, the formulation is provided in conjunction with a wax or wax-like carrier (e.g. a wax), particularly wherein the formulation is evenly distributed throughout the wax or wax-like carrier. Particular wax-like carriers that may be mentioned include paraffin (which may be referred to as paraffin wax).
Alternatively, the formulation may be provided in conjunction with an absorbent solid material, such as in a form wherein said formulation is absorbed in (i.e. impregnated in) said solid.
For example, the formulation may be absorbed in an absorbent paper or paper-like material, or a fabric material (e.g. a fabric constructed from natural fibers, such as a cotton fabric).
Further, in embodiments wherein the formulation is provided in conjunction with an absorbent solid material, such conjunctions of materials may be prepared by absorbing said formulation into said solid material. Such conjunctions of absorbent solid material and formulations (e.g. formulations of the first aspect of the invention) may be provided by absorbing the formulation into the solid material, particularly where the formulation comprises a suitable (e.g. volatile) solvent and, following absorption, said solvent is allowed to evaporate to result in an absorbed formulation comprising a lower amount of (or essentially none of) that solvent.
Alternatively, the formulation may be adsorbed on a solid material and/or contained within a solid matrix of a solid material.
For example, the formulation may be adsorbed and/or contained within a plurality of solid beads, such as suitable plastic beads. Particular plastic bead-based carrier systems that may be used include that marketed by Biogents® as the BG-Lure® system/carriage. As described herein, formulations of the invention may be suitable for use in attracting mosquitoes, such as those mosquitoes known to act as vectors for the transmission of diseases, such as malaria, in humans.
The compositions may also include a thickening agent. Thickening agents can be added to the compositions to reduce the misting of the compositions. Thickening agents suitable for use in the present compositions include, but are not limited to, xanthan gum, guar gum, polyethylene oxide, polyvinyl pyrrolidone, polyvinyl alcohol, clay thickener, bentonite, carboxyl methyl ether cellulose, kaolin, soy protein and mixtures thereof. When a thickening agent is included in the compositions, the thickening agent may constitute between about 0.01 wt % and about 1.0 wt %, about 0.05 wt % and about 0.5 wt %, or about 0.1 wt % of the compositions.
The compositions may also include an additional ingredient selected from an essential oil, 2-phenyl ethyl propionate, a residual insecticide (viz. an insecticide that is efficacious even after drying), and mixtures thereof. The compositions may also include an additional insecticide, for example, a reduced risk pesticide as classified by the Environmental Protective Agency. Reduced risk pesticides include pesticides with characteristics such as very low toxicity to humans and non-target organisms, including fish and birds, low risk of ground water contamination or runoff, and low potential for pesticide resistance. Exemplary active ingredients for reduced risk pesticides include but are not limited to, castor oil, cedar oil, cinnamon and cinnamon oil, citric acid, citronella and citronella oil, cloves and clove oil, corn gluten meal, corn oil, cottonseed oil, dried blood, eugenol, garlic and garlic oil, geraniol, geranium oil, lauryl sulfate, lemon grass oil, linseed oil, malic acid, mint and mint oil, peppermint and peppermint oil, 2-phenethyl propionate (2-phenyethyl propionate), potassium sorbate, putrescent whole egg solids, rosemary and rosemary oil, sesame and sesame oil, sodium chloride, sodium lauryl sulfate, soybean oil, thyme and thyme oil, white pepper, zinc metal strips, and combinations thereof.
In certain examples, a preservative can optionally be included in a mosquito attractant composition to prevent degradation of the composition. In certain examples, the preservative can also, or alternatively, be a biocide which prevents the growth of bacteria and fungi. Suitable preservatives can include one or more of 1,2-benzisothiazolin-3-one (“BIT”), benzoic acid, benzoate salts, hydroxy benzoate salts, nitrate, nitrite salts, propionic acid, propionate salts, sorbic acid, and sorbate salts. Other suitable preservatives are known in the art.
For example, in particular embodiments that may be mentioned, the formulation further comprises one or more (e.g. one) component that is an antioxidant. Particular antioxidant compounds that may be mentioned include butylated hydroxytoluene (BHT), which is also known as dibutyl hydroxytoluene.
A fragrance can optionally be included in certain examples. As can be appreciated however, in certain examples, a mosquito attractant composition can be odorless when formed from odorless components. For example, a mosquito attractant composition formed of gellan gum, glycerol, and water can be odorless to humans as each of the components in the composition are odorless to humans. Odorless compositions may be preferred for increased consumer acceptance.
The compositions may also optionally include humectants such as glycerol to slow evaporation and maintain wetness of the compositions after application. When a humectant is included in the compositions, the humectant may constitute between about 0.5% and about 10% by weight of the compositions.
The compositions may also optionally include a foaming agent. When a foaming agent is included in the compositions, the foaming agent may constitute between about 1% and about 10% by weight of the pesticide composition. In other embodiments, the compositions do not include a foaming agent.
In some embodiments, the compositions may comprise, or the methods may employ, either within the formulation or in a formulation separate from the composition, a classical attractant, a toxicant, or mosquito growth regulators (e.g., growth inhibitors). It is specifically envisioned that growth regulators can be horizontally transferred to mosquito eggs or larvae at other locales, e.g., by transfer to adjacent water containers through skip-oviposition.
Toxicants may include, but are not limited to, larvacides, adulticides, and pesticides such as DDT. Additional components may include, but are not limited to, pesticides, insecticides, herbicides, fungicides, nematicides, acaricides, bactericides, rodenticides, miticides, algicides, germicides, repellents, nutrients, and combinations thereof. Specific examples of insecticides include, but are not limited to, a botanical, a carbamate, a microbial, a dithiocarbamate, an imidazolinone, an organophosphate, an organochlorine, a benzoylurea, an oxadiazine, a spinosyn, a triazine, a carboxamide, a tetronic acid derivative, a triazolinone, a neonicotinoid, a pyrethroid, a pyrethrin, and a combination thereof. Specific examples of herbicides include, without limitation, a urea, a sulfonyl urea, a phenylurea, a pyrazole, a dinitroaniline, a benzoic acid, an amide, a diphenylether, an imidazole, an aminotriazole, a pyridazine, an amide, a sulfonamide, a uracil, a benzothiadiazinone, a phenol, and a combination thereof. Specific examples of fungicides include, without limitation, a dithiocarbamate, a phenylamide, a benzimidazole, a substituted benzene, a strobilurin, a carboxamide, a hydroxypyrimidine, a anilopyrimidine, a phenylpyrrole, a sterol demethylation inhibitor, a triazole, and a combination thereof. Specific examples of acaricides or miticides include, without limitation, rosemary oil, thymol, spirodiclogen, cyflumetofen, pyridaben, diafenthiuron, etoxazole, spirodiclofen, acequinocyl, bifenazate, and a combination thereof.
In other embodiments, the disclosure provides methods of attracting at least one mosquito to a target. The methods may comprise applying a composition, to the target. As used herein, “target” is a surface, site, or container known in the art. A container may contain a fluid such as water.
The methods of the disclosure may be carried out by applying attractant supernatants, compounds, or compositions as described herein to a target article or site to which mosquitoes are to be attracted. In some embodiments, the applying step is carried out by applying the attractant composition, optionally in sterile form, or utilizing attractant compounds as described herein.
The methods and compositions can be implemented as a mosquito trap. Such a trap may include (i) a trapping chamber or adhesive and (ii) an attractant positioned to attract mosquitoes to the trapping chamber or adhesive, wherein an attractant as described herein is utilized as the attractant. Any suitable trap configuration can be used, including, but not limited to, those described in U.S. Pat. Nos. 7,434,351; 6,718,687; 6,481,152; 4,282,673; 3,997,999; and variations thereof that will be apparent to those skilled in the art.
The mosquito attractant compositions disclosed herein can beneficially be used in combination with a wide variety of insect trapping devices to attract and remove insects, such as mosquitoes, from a space, such as a room in a residence or building. In certain examples, the mosquito attractant composition is effective enough that the devices preferably do not incorporate a CO.sub.2 generating means or emitter as an additional mosquito attractant the insect trapping device does not rely on a mechanism, such as electric fan, to induce an airflow over the mosquito attractant composition to enhance evaporation. The insect trapping devices may attract mosquitoes as well as other flying or crawling insects, such as flies, moths and gnats, for example. In this sense, the insect trapping device may be a broad-spectrum insect trap. In certain examples, the insect trapping devices can be enhanced by incorporating one or more broad spectrum one or more lights. The mosquito attractant compositions can help attract insects to an insect trapping device which permanently traps and removes the mosquitoes and other insects. A wide variety of insect trapping devices are generally known in the art and suitable for use with the compositions described herein. Some non-limiting examples are disclosed in U.S. Pat. Nos. 6,108,965; 7,191,560; PCT Patent App. No. WO 2014/134,371; PCT Patent App. No. WO 2015/081,033; and PCT Patent App. No. WO 2015/164,849, each of which is incorporated herein by reference.
Insect trapping devices may generally share a number of similar features. For example, insect trapping devices can include one or more attraction mechanisms to attract insects to the device. Examples of such insect attraction mechanisms can include a mosquito attractant composition such as the compositions disclosed herein as well as heat, light, and/or food. In certain embodiments, the insect trapping device is an electrical device, meaning it utilizes electricity to power one or more elements such as a light or heating element. Once an insect is attracted to an insect trapping device, one or more trapping mechanisms can prevent an insect from leaving the device. For example, an insect may be trapped on an adhesive sheet, enter into a chamber that is difficult to exit, or be killed (for example by electrocution).
In certain examples, an exemplary insect trapping device comprises a base unit and a disposable insect trapping portion, such as either a disposable cartridge or a disposable insert which may be inserted into a shell. The disposable cartridge and the disposable insert each further comprise a mosquito attractant composition. In certain embodiments, the insect trapping portion comprises a housing having one or more openings for receiving a flying or crawling insect and a mosquito attractant composition such as a composition disposed therein. In such examples, insects can be attracted by the composition and can be trapped within the housing by the adhesive portion. Suitable quantities of a mosquito attractant composition for an insect trapping device can vary from about 1 gram to about 50 grams in certain examples, from about 5 grams to about 40 grams in certain examples, and from about 10 grams to about 30 grams in certain examples. In certain examples, a gelled mosquito attractant composition can be formed by disposing a hot, liquid mosquito attractant composition within an insect trapping device, or a portion thereof such as a cartridge or insert, and allowing the composition to cool and form a gel. As can be appreciated, certain optional features can be included in various examples to further improve an insect trapping device.
In certain examples, the disposable cartridge and the disposable insert comprise an adhesive portion for trapping insects, which may be in the form of an adhesive sheet. The adhesive portion may comprise a substrate having an adhesive composition coated thereon. In certain such examples, the adhesive portion can divide the housing into a front enclosure and a rear enclosure. A mosquito attractant composition can be included in one, or both, of such enclosures to attract insects. The enclosures can have one or more openings to allow insects to enter. Alternatively, in certain examples, insects can be mechanically trapped within the housing through a substantially one-way opening.
Additionally, or alternatively, an insect trapping device can include additional features to attract insects. For example, in certain examples, an insect trapping device can include one or more lights to attract a variety of insects. In certain such examples, the lights can comprise a plurality of light emitting diodes (“LEDs”) and can emit light at a spectrum attractive to insects such as a substantially blue light and/or ultraviolet light. In such examples, a suitable power source such as batteries, solar panels, or connections to wired power sources or the like can be included. For example, prongs for an AC power outlet can be included in certain examples. Certain insect trapping devices can also emit heat to attractant insects. As can be appreciated, heat can be generated through an electric heating element, a chemical reaction or the like.
In certain examples, an insect trapping device can be formed of multiple parts. For example, in certain examples, an insect trapping device comprises a plug-in unit that may engage an electrical wall outlet and a disposable insect trapping cartridge. In such examples, a plug-in unit may provide structural stability, lighting, and heating elements while an insect trapping cartridge comprises a mosquito attractant composition and an adhesive portion to capture mosquitoes and other insects. In certain examples, the insect trapping device can emit heat or activate the one or more lighting elements when the insect trapping cartridge is inserted into the plug-in unit. The cartridge comprising the adhesive portion and the mosquito attractant composition may be removed from the plug-in unit and disposed of when the mosquito attractant composition is exhausted and/or when the adhesive portion is filled with insects. The spent cartridge is then replaced by a fresh, new cartridge. A kit including the plug-in unit and the insect trapping cartridge can be sold together with further replaceable insect trapping cartridges sold separately. In certain examples, the insect trapping device can be a single, disposable, item and can be sold without a separate plug-in unit.
It is understood that any numerical range recited herein includes all values from the lower value to the upper value. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this application. All U.S. patents cited herein are incorporated by reference herein in their entirety. The present disclosure is explained in greater detail in the Examples set forth below.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents are considered to be within the scope of this disclosure and covered by the claims appended hereto. The contents of all references, patents, and patent applications cited throughout this application are hereby incorporated by reference. The disclosure is further illustrated by the following examples, which should not be construed as further limiting.
A globally invasive form of the mosquito Aedes aegypti specializes in biting humans, making it an efficient disease vector1. Host-seeking females strongly prefer human odour over the odour of non-human animals2,3, but exactly how they distinguish the two is not known. Vertebrate odours are complex blends of volatile chemicals with many shared components4-7, making discrimination an interesting sensory coding challenge. Here we show that human and animal odour blends evoke activity in distinct combinations of olfactory glomeruli within the Aedes aegypti antennal lobe. One glomerulus in particular is strongly activated by human odour but responds weakly, or not at all, to animal odour. This ‘human-sensitive’ glomerulus is selectively tuned to the long-chain aldehydes decanal and undecanal, which we show are consistently enriched in human odour and which likely originate from unique human skin lipids. Using synthetic blends, we further demonstrate that signalling in the human-sensitive glomerulus significantly enhances long-range host-seeking behaviour in a wind tunnel, recapitulating preference for human over animal odour. Our work suggests that animal brains may distill complex odour stimuli of innate biological relevance into simple neural codes and reveals novel targets for the design of next-generation mosquito-control strategies.
The discrimination of odour cues is a challenging problem faced by animals in nature. Decades of olfactory research have revealed the principles by which animals may identify individual compounds or simple mixtures—using combinatorial codes for flexible, learned behaviours8-11 or labelled lines for hard-wired, innate responses12-15. However, most natural odours are blends of tens to hundreds of compounds4,16,17. How animals evolve to efficiently recognize these more complex stimuli, especially those with important innate meaning, is poorly understood18-21.
This problem is particularly relevant for Aedes aegypti mosquitoes, which have recently evolved to specialize in biting humans and thus become the primary worldwide vectors of human arboviral disease1,22. Females can detect vertebrate animals using the carbon dioxide in breath and other general cues such as body heat, humidity, and visual contrast23. However, they rely heavily on body odour for discrimination among species24 and show a robust preference for human odour over the odour of non-human animals2,3 (hereafter ‘animals’) (
Mosquitoes detect most volatile chemical cues using receptors expressed in thousands of olfactory sensory neurons scattered across the antennae and maxillary palps27. Neurons that express the same complement of ligand-specific receptors are believed to send axons to a single olfactory glomerulus within the antennal lobe of the brain28 (
We used CRISPR/Cas9 to generate knock-in mosquitoes that express the calcium indicator GCaMP6f under the endogenous control of the orco locus30 (
We next collected natural odours and developed methods to faithfully deliver these stimuli to mosquitoes during imaging. We sampled odour from humans (n=8), rats (n=2), guinea pigs (n=2), quail (n=2), sheep wool (n=1), dog hair (n=4), and two nectar-related stimuli that mosquitoes find attractive—milkweed flowers32 and honey29 (
With these new tools and odour samples in hand, we set out to characterize the response of Orco+ glomeruli to human and animal odours. There are several ways in which the activity of key glomeruli might help female mosquitoes discriminate, including increased sensitivity to human odour, exclusive activation by human odour, or more-complex patterns (
Three glomeruli dominated responses at low and middle doses (
The preference of Ae. aegypti for humans over animals is robust to within-group variation, with most humans being preferred over most animals (
The neural response to human odour must be traceable to chemical features of human odour blends. Human blends contain an array of common volatile compounds that originate from skin secretions, the skin microbiome, or their interaction4. They differ consistently from animal blends in the relative abundance of at least two or three components, but quantitative, cross-species comparisons are rare and usually focus on a single compound3,6,7,37,38. We therefore lack a clear picture of the relative ratios and other chemical features mosquitoes may use to discriminate.
To help fill this gap, we analysed the composition of the human, animal, and nectar-related odour samples used for imaging, plus 8 new human samples (
Despite the overlap in blend components, human and animal samples differed consistently in blend ratios, leading to clear separation in a principal components analysis (PCA) (
The unscaled PCA gives the most weight to abundant compounds. When we extended our analysis to minor components via compound-specific comparisons (
To connect the unique pattern of neural activity evoked by human odour (
Decanal, undecanal, and the combo stimulus that contained them all evoked strong and prolonged activity in H (
The strong response of the H glomerulus to physiological concentrations of decanal and undecanal in human odour (
As hypothesized, the H glomerulus responded selectively to long-chain aldehydes (
The A glomerulus was strongly activated by four compounds found in our host odour blends (
Human odour evoked consistent activity in both B and H glomeruli, while animal odour evoked strong activity in B, but no activity or only weak activity in H (
When combined with the mosquito activator carbon dioxide, the binary blend evoked a characteristic plume-tracking behaviour similar to that evoked by a human-worn sock but rarely observed in response to a solvent control45 (
Animal survival and reproduction often depend on the ability to discriminate among complex odour blends without prior experience. Here we investigate the innate preference of Ae. aegypti mosquitoes for human odour, offering insight into how such discrimination is achieved at the neural level. We show that human odour is enriched in long-chain aldehydes and that these aldehydes generate strong and prolonged activity in a selectively tuned olfactory glomerulus within the mosquito brain. Activation of this glomerulus alongside a second, broadly tuned glomerulus drives robust host seeking, resulting in a binary signal with the potential to explain preference for human over animal odour at long range. The simplicity of this pattern belies the complexity of the underlying stimuli and suggests that sparse coding may be a general feature of innate olfactory responses, even to multi-component blends18,19.
While we have shown that activation of H enhances host-seeking, current knowledge and genetic tools do not yet allow us to conduct the converse experiment—to silence H and measure the extent to which it is required for host-seeking and preference. We expect H will be required for robust discrimination between humans and animals in at least some contexts. After all, H represents the most prominent human-biased signal in the OR/Orco pathway, which is itself required for such behaviour29. Nevertheless, other Orco+ glomeruli may contribute, including those that respond only at high odour concentrations (
Our work also sheds light on the compounds mosquitoes may be using to discriminate among hosts. Most people associate human body odour with sweat, but the odorants we found to be important for host discrimination are likely derived from sebum (
The use of live non-human animals and non-human animal hair in olfactometer trials and odour extractions was approved and monitored by the Princeton University Institutional Animal Care and Use Committee (protocol #1999-17 for live guinea pigs and rats; #2113-17 for live quail; #2136F-19 for animal hair). The participation of human subjects in this research was approved by the Princeton University Institutional Review Board (protocol #8170 for olfactometer trials, #10173 for odour extractions). All human subjects gave their informed consent to participate in work carried out at Princeton University. Human-blood feeding conducted for mosquito colony maintenance did not meet the definition of human subjects research, as determined by the Princeton University IRB (Non Human-Subjects Research Determination #6870).
All mosquitoes used in this research were reared at 26° C., 75% RH on a 14:10 light/dark cycle. Larvae were hatched in deoxygenated water and fed Tetramin Tropical Tablets (Pet Mountain, 16110M). Pupae were transferred to plastic-bucket or bugdorm cages, and adults were provided access to 10% sucrose solution ad libitum. Females were allowed to blood-feed on a human arm prior to egg collection. The Orlando (ORL) laboratory strain was used for both host-preference-behaviour testing, wind-tunnel experiments, and the generation of the orco-T2A-QF2-QUAS-GCaMP6f and QUAS-GCaMP7s transgenic strain. Imaging was conducted in orco-T2A-QF2-QUAS-GCaMP 6f heterozygote females or the female offspring of a cross between brp-T2A-QF2w55 and QUAS-jGCaMP7s strains.
We tested the host preference of mated, non-blood-fed, 7-14 day old females that had been housed overnight with access to water only (no sucrose). We used a two-port olfactometer for choice and no-choice tests involving live hosts (
We used a beta-binomial mixed generalized linear model (R56 package glmmTMB57) to model the probability of an individual mosquito choosing human versus each animal species in two-choice tests while accounting for overdispersion caused by trial-to-trial variation. Animal host species was included as a fixed factor, and date and individual human as random factors. We then extracted the model-estimated mean probability of choosing human with 95% confidence intervals (R package emmeans58) and converted this probability (p) to a preference index (PI=2p−1) for data visualization. For no-choice trials, we used the same type of model to estimate the probability of responding to the given host, with host species included as a fixed factor and date as a random factor. The R function cld was used for pairwise comparison of least-square means.
We used CRISPR-mediated homologous recombination (as described30) to knock in the QF2 transcription factor55,59,60 followed by the QUAS promoter (9 copies) and GCaMP6f61 coding sequence into the endogenous orco (AAEL005776) locus of the Ae. aegypti genome. We designed an sgRNA targeting the last exon of orco (GTCACCTACTTCATGGTGTTGG, PAM sequence underlined), generated template DNA by primer annealing with the NEBNext High-Fidelity polymerase (NEB, M0541S), and carried out in vitro transcription using the HiScribe T7 Kit (NEB, E2040S) by incubating at 37° C. for 8 hours. We purified the transcription products using RNAse-free SPRI beads (Agencourt RNAclean XP, Beckman-Coulter A63987) and eluted them in Ambion nuclease-free water (Life Technologies, AM9937). We constructed the T2A-QF2-9×QUAS-GCaMP6f-3XP 3-dsRed donor plasmid (
Brain. Brain immunostaining was carried out as previously described60. Heads of 7-10 day old mated mosquitoes were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, 15713-S) for 3 hours at 4° C. Brains were dissected in PBS and blocked in normal goat serum (2%, Fisher Scientific, 005-000-121) for 2 days at 4° C. We then incubated brains in primary antibody solution for 2-3 days, followed by secondary antibody solution for another 2-3 days at 4° C. Brains were mounted in Vectashield (Vector, H-1000) with the anterior or posterior side facing the objective. Confocal stacks were taken with a 20× or 40× oil lens with an XY resolution of 1024×1024 and Z-step size of 1 μm. Primary antibodies: rabbit anti-GFP (1:10,000 dilution, ThermoFisher, A-11122) and mouse nc82 (1:50 dilution, DHSB, AB_2314866). Secondary antibodies: goat-anti-rabbit Alexa 488 (1:500 dilution, ThermoFisher, A27034SAMPLE), goat-anti-mouse CF680 (1:500 dilution, Biotium, 20065-1) and goat-anti-mouse Cy3 (1:500 dilution, Jackson ImmunoResearch, 115-165-062). We also dissected and stained the brains of 7-10 day old females whose sensory appendages had been removed with sharp forceps or micro-knives 5 days earlier.
We removed the antenna, maxillary palp, or proboscis of 7-10 day old female mosquitoes with sharp forceps. We then dipped them in pure ethanol for ˜15 sec and mounted them on slides in pure glycerol for direct confocal imaging.
We manually traced and reconstructed glomeruli according to the atlas in an early neuroanatomical study35 using the TrakEM2 package63 in ImageJ64, with two modifications: (1) We could not reliably identify 5 glomeruli in the original atlas (CD1-4, PD7). (2) We and others51,65 have found that a large portion of the anterior AL, previously termed the Johnston's organ centre35 (JOC), is innervated by Orco+axons, consistent with recent work in Anopheles gambiae31. We therefore divided the JOC into 9 glomeruli based on nc82 neuropil staining, noting that the glomerular boundaries in this region were less clear than in other parts of the AL. Together with the ˜50 glomeruli from the original atlas, we find a total of ˜60 glomeruli. This number is similar to the ˜65 total glomeruli reported in a second recent study that used nc82 staining in transgenic mosquitoes51. However, a third recent study that employed both nc82 and phalloidin staining reported ˜80 glomeruli, with the extra glomeruli falling within the former JOC region65. We consider our number (˜60) to be a conservative estimate, but acknowledge that consensus has not yet been reached, and estimates may change in future. When describing the orientation of the AL in text and figures (e.g.
We used pBac-mediated transposition according to a previously published method67 to generate a QUAS-jGCaMP7s-T2A-tdTomato effector strain that could be used in concert with a pan-neuronal driver55 to image from all glomeruli (Extended Data
We designed a two-photon microscope that incorporates both resonant scanning69 and remote focusing70,71 to achieve rapid, volumetric, in vivo neural imaging. Remote focusing allows rapid switching of the imaging plane by moving a small, lightweight mirror located upstream in the imaging path. This alternative focusing method does not involve mechanical movements near the specimen, thereby avoiding specimen agitation and permitting axial scan speeds faster than those associated with traditional piezo-objective units. In diagnostic tests, transition times for switching between two planes were less than 6 ms. The combination of an 8 kHz resonant scanner and remote focusing resulted in volumetric-stack-imaging speeds of 512 pixels×512 lines×10 planes at 3 Hz.
The microscope uses a pulsed (80 MHz) Ti: Sapphire laser (Coherent Chameleon Vision II) tuned to 920 nm, with laser intensity rapidly controlled on the us timescale with a pockel cell (Conoptics 350-80-LA-02 KD*P). The beam entering the microscope is first sent through a half-wave plate (Thorlabs AHWP10M-980), a polarizing beam splitter cube (Thorlabs PBS252), and a quarter-wave plate (Thorlabs AQWP10M-980) before entering the remote objective (Olympus UPLFLN40×). It is then reflected on a 7 mm mirror (Thorlabs PF03-03-P01) mounted on a voice coil (Equipment Solutions LFA2004). The beam then crosses the remote objective and the quarter-wave plate in reverse direction before being reflected by the polarizing beam splitter cube. It then enters a non-magnifying relay telescope made of two identical achromatic lenses (Thorlabs AC254-150-B) that brings it to the scanning unit located in a plane conjugated to the remote focus objective back aperture. The scanning unit includes an 8 kHz resonant scanner (Cambridge Technologies CRS8) for the fast axis and a 6 mm galvanometer scanner (Cambridge Technologies 6215H). The beam then travels through the 150 mm scan lens (Thorlabs AC508-150-B) and a 200 mm tube lens (2 identical lenses, Thorlabs AC508-400-B) to reach the imaging objective (Olympus LUMPLFL 40× Water, NA 0.8), whose back aperture is conjugated to the scanning unit. The distance between the scan lens and the tube lens is precisely set to be the sum of their respective focal lengths, a condition that minimizes optical aberrations when using remote focusing70,71. The microscope's field of view is 550 μm in diameter.
The quantity of glass present in the optical path of this microscope generates significant group-delay dispersion, for which the laser internal pre-compensator cannot fully compensate. This results in lower fluorescence excitation. We therefore added another compensator made of a pair of SF10 prisms (Newport 06SF10), through which the beam passes before entering the microscope. We adjusted the distance between prisms to roughly maximize the fluorescence signal, then relied on the laser internal pre-compensation unit for fine maximization.
The fluorescence signal is separated from the laser path by a dichroic mirror (Semrock FF670-SDiO1) and detected by GaAsP photomultipliers (PMT; Hamamatsu H10770PA-40) after successively passing through a multiphoton short-pass emission filter (Semrock FF01-720sp), a dichroic mirror (Semrock FF555-Dio3), and a band-pass filter (Semrock FF02-525/40-25 for the green channel; Semrock FF01-593/40-25 for the red channel). The PMT output signals are amplified (Edmund Optics 59-179) and digitized (National Instrument PXIe-7961R FlexRIO). The microscope is controlled by the ScanImage (Vidrio) software using additional analogue output units (PXIe-6341, National Instruments) for the laser-power control, the scanners control, and the voice-coil control.
Mosquito preparation.
We custom-designed a mosquito holder with a 3D-printed plastic frame and thin stainless-steel plate (
We used the ScanImage72 package in Matlab to control the microscope and acquire images. For each individual, we chose either the right or left antennal lobe (AL) and recorded movies of odour-evoked activity (starting 7-30 sec before and continuing 20-60 sec after synthetic-odorant puffs; ˜30 sec before, ˜140 sec after puffs of complex extract). The movies covered the entire AL in Z-stacks that were 4 μm apart at 128×128 pixel resolution (22 stacks total, green channel only for the orco-T2A-QF2-QUAS-GCaMP 6f strain; 28 stacks, green and red channels for the brp>jGCaMP7s strain). The resulting voxel size was approximately 0.9×0.8×4 μm3, and the volumetric imaging rate was 3.76 Hz for the orco-T2A-QF2-QUAS-GCaMP 6f strain and 2.95 Hz for the brp>jGCaMP7s strain. We increased the laser power exponentially with depth (ranging from 7.5 to 10 mW) to account for light decay and scattering in deeper tissues. Laser power as measured at the sample plane was 10 mW. After recording odour-evoked activity, we acquired 30-40 high-resolution structural volumes at high laser power to aid registration and downstream analysis. For this, we imaged the AL in 120-180 z-stacks, 1 μm apart, at 256×256 pixel resolution.
We selected reference odorants based on a preliminary imaging data set comprising the glomerular responses to 60 candidate odorants (n=2 mosquitoes). After extracting glomerular signals, we obtained a (glomerulus×odorant) matrix A of mean odorant responses. We then employed the ConvexCone algorithm (see below) to select c=1, . . . , N columns (corresponding to odorants) from A into a series of matrices C1, . . . , CN and measured the respective norm error ∥A−Cc×c∥. This norm error decreased quickly with increasing c (
We first performed 3D motion correction on each volumetric movie of odour-evoked activity using the NoRMCorre package73. For the orco-T2A-QF2-QUAS-GCaMP6f strain, images in the green channel were used for motion correction; for the brp>jGCaMP7s strain, the red channel was used. We then used the warp function in the Computational Morphometry Toolkit (CMTK, http://nitrc.org/projects/cmtk) to correct for potential motion and brain deformation between movies from the same brain. We created the two-photon AL template by iteratively registering and averaging the ALs from 13 high-quality brains with the CMTK warp and avg_adm functions. We registered each AL to the two-photon template, again using the CMTK warp function, so all brains were aligned in the same coordinates and had similar shape (
An odour-response recording Ri contains a 3D volume for each time point: it is a tensor with three spatial dimensions (x=128, y=128, z=24) and one time dimension: Ri=(1:x, 1:y, 1:z, 1:t). For each time point tp, we performed spatial smoothing of Ri(:, :, :, tp) with a 3D Gaussian kernel. We used a moving-average filter for temporal smoothing along the time dimension of Ri. A mask M covering the AL served to cut out the background by element-wise multiplication with each Ri. Due to elevated baseline calcium levels within the AL area, we could obtain a mask by simple Otsu thresholding of an average volume for the pre-stimulus interval. For each AL, we extracted functional clusters, i.e. clusters of voxels with correlated activity in R=[R1, . . . , RN_odours]. These clusters can be interpreted as glomeruli, especially if they have a spatial-functional match in another AL. For functional clustering, we employed a non-negative matrix-decomposition scheme solved with the ConvexCone algorithm74 that has a track record of successful application to imaging data from different species. Briefly, R is reshaped to a matrix A with m=x*y*z rows (voxel vectors) and n=odours*time columns (time series vectors). We then decompose A into a matrix of the c most relevant time series C∈A and their spatial mappings in X, such that ∥A−CX∥Fr is minimized subject to a non-negativity constraint on X. In practice, this is carried out on a rank k=50 representation of A obtained by SVD.
The continuous-valued and non-negative X acts as a fuzzy cluster membership indicator, locating the time series signals from C in space and also encoding cluster overlap due to signal mixtures, i.e. a voxel can ‘belong’ to several clusters to different degrees. For creating the 3D AL map visualizations (
We matched glomeruli across brains if they were similar in both odour-response properties and relative position, allowing for a certain degree of physiological and anatomical variation (
Global optimization of d leads to a complete assignment of all glomeruli from S to all glomeruli from T. However, due to missing (glomeruli that were not detected) or additional clusters (overclustering or non-glomerular clusters) in either brain, not all glomeruli may have a meaningful match. We thus employed the Hungarian algorithm to compute all glomerulus matches that are feasible under functional and spatial constraints:
These constraints specify the criteria we demand for an acceptable match (in terms of response similarity and spatial distance), while the optimal assignment under these constraints is left to the algorithm. Whenever the constraints led to infeasible matches, the respective subject AL glomeruli were excluded from further analysis.
We also pursued the alternative strategy of constructing a common odour-response space for all mosquito brains, allowing us to visualize distances between odour responses in a way that is unaffected by parameter settings (such as the number of clusters) or possible matching errors of the glomerulus-matching approach (
The three target glomeruli could be reliably identified across brains based on position and responses to key reference odorants. Human-sensitive glomerulus H was located in the anterior AL, adjacent to a landmark non-Orco glomerulus in our two-photon images (unlabeled area surrounded by Orco+ glomeruli;
We used area under df/f curves as a metric for neural activity. For single-odorant stimuli, which evoked single df/f peaks, we defined the peak boundaries by first locating the max (for activation) or min (for inhibition) points in the df/f curve and then extending from the max/min point until df/f dropped to background levels. For natural odour extracts, which sometimes evoked multiple peaks, we integrated df/f values from desorption of the focusing trap to the end of neural recording (0 to 140 sec). To account for variation in responsiveness across brains, we normalized area values for single odorants by the response of glomerulus H to decanal (at whatever concentration was used in the given experiment), and we normalized area values for natural odour extracts by the strongest response evoked in a given brain by any odour extract used in the experiment (min-max normalization, where min is zero). We used the paraView software to render the neural responses into 3D plots78.
Extraction from Human Volunteers.
We modified a previously published protocol for human-body headspace odour extraction79. Subjects were asked to bathe using an unscented soap 3 days before odour collection and then avoid the use of all soaps, skin products, swimming pools, and hot tubs thereafter. Subjects were also asked to avoid all water baths/showers, spicy food, and alcohol for 24 hours before collection. At the time of extraction, subjects lay nude inside a custom-made 80″×48″ Teflon FEP bag with 4 ports on each side (
Extraction from Non-Human Animals, Plants, and Honey.
We collected headspace odour from quail, guinea pigs, rats, and milkweed flowers using custom-designed glass extraction chambers (
Animal waste was sometimes present in the odour-extraction chambers for guinea pig, rat, and quail and thus may have contributed to the corresponding odour samples and to the list of animal-enriched compounds17,44 (e.g. p-cresol and dimethyl sulfone in
We generated 16 Tenax tubes for each individual human (
We used an Agilent GC-MS system (Agilent Technologies, GC 7890B, MS 5977B, high-efficiency source) outfitted with a DB-624 fused-silica capillary column (30 m long x 0.25 mm I.D., d.f.=1.40 μm, Agilent 122-1334UI). Tenax tubes were inserted into a Gerstel TD3.5+ thermal-desorption unit (Gerstel Inc.) mounted on a PTV inlet (Gerstel CIS 4) with a glass-wool-packed liner. Tubes were heated in the TD unit from 50° C. to 280° C. at a rate of 400° C./min, then held at 280° C. for 3 min. During the TD heating time, volatiles were swept splitless into the cold inlet (−120° C.) under helium flow of 50 ml/min. After the tube was removed and the inlet repressurized, the inlet began heating at a rate of 720° C./min to a 3 min hold temperature of 275° C. The GC oven program began simultaneously with inlet heating, starting at an initial temperature of 40° C. and ramping at a rate of 8° C./min to a 10 min hold temperature of 220° C. Transfer from the inlet to the GC column was performed at a 20:1 split ratio (40:1 split for milkweed). Carrier-gas flow rate was 40 cm/s. The MS was operated in EI mode, scanning from m/z 40 to 250 at a rate of 6.4 Hz.
The major steps in our analysis pipeline are illustrated in
We identified peaks by using Unknowns Analysis to search the NIST17 MS EI library for matches. The program finds the best match in the reference library for each peak (with a minimum match score of 70), then for each compound selects the peak with the highest match score. We manually selected alternate best-hit peaks (sometimes with match score below 70) if the automated choice looked non-Gaussian or was composed of misaligned component-ion peaks (implying the peak was made up of multiple co-eluting compounds). We also manually selected alternate peaks if there was an excess of background ions in the automated choice. We ensured that retention times for each compound matched across samples.
Because 1-octen-3-ol is known to be an important mosquito attractant despite its low abundance in host odours80,81, we performed a targeted search for this compound. In 19 out of 21 samples where 1-octen-3-ol was present, the level was too low to be detected by the automated pipeline, particularly because 1-octen-3-ol co-elutes with the common compound benzaldehyde. Therefore, we wrote custom R scripts to quantify the amount of 1-octen-3-ol in our samples. We used the mzR package82 to access the raw GC-MS data from .mzxml files. For each sample, we fit Gaussian curves to the m/z 51 and m/z 57 ion peaks under the shared 1-octen-3-ol/benzaldehyde peak; at this retention time, these ions are diagnostic for benzaldehyde and 1-octen-3-ol, respectively. The abundance ratio of the two ions is directly proportional to the abundance ratio of the two compounds. We used this ratio to infer the amount of 1-octen-3-ol present in every sample by extrapolating from the two samples where the deconvolution algorithm successfully pulled out and integrated a separate 1-octen-3-ol peak.
In the final dataset for analysis, we retained only compounds eluting between 6 and 22 minutes. We ignored early-eluting compounds because breakthrough analysis suggested we were not able to obtain quantitative estimates of their abundance. Few compounds eluted after 22 minutes; these tended to be less volatile and more difficult to identify because of the high background. We also removed obvious contaminants: siloxane column artefacts, 4-cyanocyclohexene (a compound likely from nitrile gloves83), and other components not plausibly produced by biological metabolism because they contained heteroatoms other than O, N, and S. Finally, we ignored carboxylic acids because (1) they are difficult to quantify reliably without derivatizing samples, and (2) they are not typically detected by the Orco+ neurons84 on which we focus in this study.
We set an abundance criterion for including compounds in the analysis: for a focal compound X to qualify, it must have constituted at least 2% of the ‘odour profile’ of at least one sample, where the ‘odour profile’ comprises non-contaminant compounds just as or more abundant than X in the given sample (
Verification with Synthetic Standards.
We used retention-time and mass-spectrum information from external standards to verify the identities of all compounds mentioned in
Our main odour analysis only considered compounds that constituted at least 2% of the odour profile of at least one sample. To ensure we had not overlooked any human-biased compounds that failed to meet this threshold, we also used an R implementation of XCMS metabolomics software to analyse the odour profiles of all 16 humans and 5 animals. XCMS detects and aligns peaks of component ions across samples85. XCMS identified 1067 component ions in our dataset. We then grouped ions that eluted less than 10 s apart and whose abundance across our samples had a Pearson correlation >0.5 (suggesting they were component ions from the same compound). This grouping procedure reduced our total to 672 components. For each component, we used a Kolmogorov-Smirnov test to look for enrichment in human or animal samples, applying the Benjamini-Hochberg procedure to correct for multiple testing (
We adapted a thermal-desorption (TD) system marketed for GC-MS applications to deliver complex odour extracts from Tenax tubes to mosquitoes during imaging. The Unity-Ultra-xr TD system from Markes International Inc. uses a 2-step desorption procedure (
We relied on two additional features of the Unity-Ultra-xr TD system to precisely control and standardize odour stimuli across individual puffs and mosquitoes. First, we used the ‘stacking’ feature to pool multiple odour tubes from the same or different extractions and thereby generate concentrated, homogeneous extracts for each animal species or human individual (
Second, we used the ‘split-recollect’ feature to dispense concentration-matched aliquots for use in imaging (
We also used the split-recollect feature to deliver a prespecified percentage of each concentration-matched aliquot to the mosquito during imaging and recollect the remainder. We desorbed the sample tube for 2 min with the temperature ramping to 200° C. and then desorbed the focusing trap for 1 min at 220° C. (
To define a standard dose, we selected one reference subject whose total odour content was approximately average among all human subjects. We then defined the 1× human dose such that the release rate from the odour-delivery system was approximately equal to the release rate from the reference subject's body during odour extraction. This is similar to funnelling all the odour from a human subject into a narrow tube and aiming it at the mosquito in real time. Our calculation took into account the duration of the odour extraction, the number of collection tubes, the duration of the odour puff, and dilution of the odour stream by the carrier stream in our odour-delivery system. 1× doses of other stimuli were defined as having the same total odour content as 1× human.
Our single-odorant panel was made up of three groups of compounds. The first group included compounds identified in our human or animal odour samples-more specifically those that made up ≥0.1% of the extract of any species (after averaging across individuals within the species). The second group included 13 compounds that were not identified in our samples, but suggested by previous research to be relevant to mosquitoes. The third group included five compounds that are chemically similar to decanal and undecanal (i.e., similar chemical formula and general molecule shape, but in most cases with different functional groups) and had been documented at least once in nature. In order to make the final panel, compounds in all three groups also had to be (1) commercially available, (2) stable during delivery, and (3) volatile enough to be detectable by GC-MS for dose calibrations. Altogether, the panel comprised 50 compounds.
We developed a method to measure the volatility of single odorants based on a previously published study86 (
We designed and built a high-throughput system to deliver synthetic odorants and blends during imaging. Our design was inspired by the commercial Aurora 206A system but has 20 odour channels and a flush stream. We briefly describe the system here, with more detail in
We prepared an odorant panel by filling each of the twenty 40 ml odour vials with 3 ml of odorant dilution. When switching in a new odorant panel, we flushed the flow path of the system with hexane and purged it overnight with filtered air to remove potential traces of the previous panel. We characterized the puff shape (
During imaging, we recorded the neural response of each mosquito to 2-3 replicate, 3-second puffs per odorant, presented in random order with an inter-puff interval of 60-90 sec. We also recorded the baseline response for a given odour channel (clean air passing through the channel's valves/tubing but bypassing the odour bottle) and the response to solvent only and subtracted these from the response to stimulus. We used odorants of the highest commercially available purity and diluted them in paraffin oil (Hampton Research, HR3-421) or ultrapure water (Table 2).
The wind tunnel system, flight arena and data acquisition were previously described in detail87. In brief, laminar, carbon-filtered, and conditioned air (27° C., 70% RH, wind speed 0.22 m/s) was passed through a pre-chamber, where carbon dioxide (CO2) and the specific odour stimuli were presented, and into the flight arena, where individual mosquitoes were released (
We tested females that were 7-12 days old (post-eclosion), mated (housed with males), and non-blood-fed. Females were deprived of sucrose, but not water, and transferred to individual release cages 17-20 h before testing. For each trial, a release cage containing a single female was placed at the downwind end of the flight chamber. After an acclimation period of 2 min, the door of the release cage was gently opened and the mosquito was given 5 min to enter the filmed volume. If the mosquito entered the filmed volume, the filming continued for 10 min or until either (1) the mosquito landed and remained at rest for 10 s or (2) the mosquito left the filmed volume towards the downwind end of the flight arena and remained out of view for 1 min. We tested thirty females per treatment, and each mosquito was tested once. All trials were conducted within a 3-hour period before scotophase.
We used 2P calcium imaging to identify concentrations of 1-hexanol and decanal that evoked activity in their cognate glomeruli (B and H, respectively) at a level approximately equal to ⅕th that evoked by 1× human odour. The odorants were diluted in paraffin oil and calibrated separately before creating a binary mixture with the same respective concentrations. This binary mixture, which we defined as the 1/5× blend, evoked simultaneous activity in B and H at the expected level, but no detectable activity in any other Orco+glomeruli (
The odour-delivery system we use for imaging is designed to generate consistent 3-sec puffs of odour, but we needed to stably deliver the blend for 10 minutes or more during behavioural trials. We therefore switched from the 3 ml stimulus solution in a 40 ml vial to a 50 ml solution in a 100 ml flask. To ensure that the vapour-phase release rates of each blend component in the new high-volume system matched those used for imaging, we captured and quantified the odour released by both systems over a given period of time using Tenax collection tubes and GC-MS (as in Estimation of vapour-phase concentration of synthetic odorants and blends). The liquid-phase dilution factors for the ⅕× blend in the high-volume system were then repeatedly adjusted to achieve the release rates of the imaging system. Finally, we increased the concentration of the high-volume ⅕× blend by 5 to obtain the 1× dose and serially diluted by factors of 5 to obtain the 1/25× and 1/125× doses. See Table 2, below, for recipe and final dilution factors.
CO2 was delivered alongside the specific odour stimulus in all trials. Metered CO2 of 1200 ppm (in 20.0% O2, 79.9% N2; Strandmöllen A B, Ljungby, Sweden) was presented using a glass hoop with equidistant holes to create a turbulent flow45, adjusted to a flow rate of 0.4 L/min. The synthetic binary blend, its individual components, and solvent controls were delivered by pumping carbon-filtered, humidified air at 0.4 L/min through a 100 ml Erlenmeyer flask containing 50 ml of the stimulus (see above). The system terminated in a glass tip, pointing upwind to generate a homogeneous plume. The shape and dimensions of both the CO2 and specific odour plumes were verified using smoke paper (Günther Schaidt SAFEX Chemie GmbH, Tangstedt, Germany). To help characterize host-seeking flight patterns, we also conducted trials with a cotton sock that had been worn by a human for 20 h. The sock was suspended from a metal hook in the pre-chamber87.
Spatial Progression within the Flight Arena.
We manually recorded whether each mosquito (1) left the release cage within 5 min and (2) entered the filmed volume (
Mosquito flight trajectories were reconstructed, processed, and analysed as previously described87, using Etho Vision XT 40 and Track 3D (Noldus Information Technology), as well as customized Matlab scripts (version R2020a; MathWorks, Natick, MA, US). Variables calculated and used for subsequent analyses included the position in three dimensions (x, y, z), flight speed in 3D, tortuosity in 3D, and heading angle in the vertical plane.
Host-seeking flight was assessed visually and via automated analysis. Visual classification of host seeking was conducted by the experimenter based on, e.g., zigzagging crosswind flight, sharp crosswind turns upon exiting the approximated volume of the plume, and a generally high flight speed (e.g. ref45,88 for Aedes aegypti). A mosquito exhibiting even a relatively short bout of such behaviour was considered to have displayed host seeking (
To identify host-seeking mosquitoes more objectively, we also conducted an automated analysis aimed at both (1) assessing whether an individual showed even a single short bout of host seeking (
We also conducted a second analysis in which all five parameters were used to classify host-seeking segments. We used k-means clustering to separate into three clusters the pooled segments from all mosquitoes in a given experiment. Three clusters were used because we wanted to separate host-seeking flight from non-host-seeking flight, while also accounting for the fact that many 10-second segments included very little flight at all (zero values for one or more parameters). The results were similar to those obtained with the simple proportion-in-plume threshold (
This application claims priority to U.S. Patent Application Ser. No. 63/244,779 filed on Sep. 16, 2021, the disclosure of which is incorporated herein by reference in its entirety.
This invention was made with government support under Grant No. NIDCD (R00DC012069) and NIAID (DP2AI144246) awarded by the National Institutes of Health. The Government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2022/076556 | 9/16/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63244779 | Sep 2021 | US |
