5,5-disubstituted-1,5-dihydro-4,1-benzoxazepin-2 (3H)-ones useful as HIV reverse transcriptase inhibitors

FIELD OF THE INVENTION
This invention relates generally to 5,5-disubstituted-1,5-dihydro-4,1-benzoxazepin-2(3H)-ones which are useful as inhibitors of HIV reverse transcriptase, pharmaceutical compositions and diagnostic kits Comprising the same, and methods of using the same for treating viral infection or as assay standards or reagents.
BACKGROUND OF THE INVENTION
Two distinct retroviruses, human immunodeficiency virus (HIV) type-1 (HIV-1) or type-2 (HIV-2), have been etiologically linked to the immunosuppressive disease, acquired immunodeficiency syndrome (AIDS). HIV seropositive individuals are initially asymptoitatic but typically develop AIDS related complex (ARC) followed by AIDS. Affected individuals exhibit severe immunosuppression which predisposes them to debilitating and ultimately fatal opportunistic infections.
The disease AIDS is the end result of an HIV-1 or HIV-2 virus following its own complex life cycle. The virion life cycle begins with the virion attaching itself to the host human T-4 lymphocyte immune cell through the bonding of a glycoprotein on the surface of the virion's protective coat with the CD4 glycoprotein on the lymphocyte cell. Once attached, the virion sheds its glycoprotein coat, penetrates into the membrane of the host cell, and uncoats its RNA. The virion enzyme, reverse transcriptase, directs the process of transcribing the RNA into single-stranded DNA. The viral RNA is degraded and a second DNA strand is created. The now double-stranded DNA is integrated into the human cell's genes and those genes are used for virus reproduction.
At this point, RNA polymerase transcribes the integrated DNA into viral RNA. The viral RNA is translated into the precursor gag-pol fusion polyprotein. The polyprotein is then cleaved by the HIV protease enzyme to yield the mature viral proteins. Thus, HIV protease is responsible for regulating a cascade of cleavage events that lead to the virus particle's maturing into a virus that is capable of full infectivity.
The typical human immune system response, killing the invading virion, is taxed because the virus infects and kills the immune system's T cells. In addition, viral reverse transcriptase, the enzyme used in making a new virion particle, is not very specific, aid causes transcription mistakes that result in continually changed glycoproteins on the surface of the viral protective coat. This lack of specificity decreases the immune system's effectiveness because antibodies specifically produced against one glycoprotein may be useless against another, hence reducing the number of antibodies available to fight the virus. The virus continues to reproduce while the immune response system continues to weaken. Eventually, the HIV largely holds free reign over the body's immune system, allowing opportunistic infections to set in and without the administration of antiviral agents, immunomodulators, or both, death may result.
There are at least three critical points in the virus's life cycle which have been identified as possible targets for antiviral drugs: (1) the initial attachment of the virion to the T-4 lymphocyte or macrophage site, (2) the transcription of viral RNA to viral DNA (reverse transcriptase, RT), and (3) the processing of gag-pol protein by HIV protease.
Inhibition of the virus at the second critical point, the viral RNA to viral DNA transcription process, has provided a number of the current therapies used in treading AIDS. This transcription must occur for the virion to reproduce because the virion's genes are encoded in RNA and the host cell reads only DNA. By introducing drugs that block the reverse transcriptase from completing the formation of viral DNA, HIV-1 replication can be stopped.
A number of compounds that interfere with viral replication have been developed to treat AIDS. For example, nucleoside analogs, such as 3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxycytidine (ddC), 2',3'-dideoxythymidinene (d4T), 2',3'-dideoxyinosine (ddI), and 2',3'-dideoxy-3'-thia-cytidine (3TC) have been shown to be relatively effective in halting HIV replication at the reverse transcriptase (RT) stage.
Non-nucleoside HIV reverse transcriptase inhibitors have also been discovered. As an example, it has been found that certain benzoxazinones are useful in the inhibition of HIV reverse transcriptase, the prevention or treatment of infection by HIV and the treatment of AIDS. U.S. Pat. No. 5,519,021, the contents of which are hereby incorporated herein by reference, describes reverse transcriptase inhibitors which are benzoxazinones of the formula: ##STR2## wherein X is a halogen, Z may be O. However, benzoxazinones are not part of the present invention.
U.S. Pat. No. 4,476,133 depicts CNS active 4,1-benzoxazepines of the formula: ##STR3## wherein A--B can be NH--C(O), R is H or C.sub.1-5 alkyl, X is H, halo, or NO.sub.2, and Y is phenyl or pyridyl. No mention is made of 5,5-disubstituted-1,5-dihydro-4,1-benzoxazepin-2(3H)-ones which are the subject of the present invention.
EP 0,142,361 illustrates phoepholipase A.sub.2 inhibitors of the formula: ##STR4## wherein R.sub.1 can be a variety of cyclic and acyclic groups, but not hydrogen, R.sub.2 is H, alkyl, or phenyl, and Y.sub.1 is H, halo, NO.sub.2 or CF.sub.3. Compounds of the present invention have a hydrogen at the 1-position and do not have a phenyl group directly attached to the 5-position.
EP 0,567,026 and JP 08/259,417, which have similar disclosures, describe 4,1-benzoxazepinone derivatives of the formula: ##STR5## wherein ring A may be optionally substituted phenyl (also optionally substituted heteroaryl in JP '447), R.sub.1, R.sub.2, and R.sub.3 can be a variety of groups including H and optionally substituted hydrocarbon, X is a bond or spacer and Y (B in JP '447) is optionally substituted cerboxyl, hydroxyl, amino, phenyl, carbamoyl, or a nitrogen-containing heterocycle. In JP '447, B is only optionally substituted phenyl or nitrogen-containing heterocycle. Compounds of this sort are not within the presently claimed invertion.
Even with the current success of reverse transcriptase inhibitors, it has been found that HIV patients can become resistant to a single inhibitor. Thus, it is desirable to develop additional inhibitors to further combat HIV infection.
SUMMARY OF THE INVENTION
Accordingly, one object of the present invention is to provide novel reverse transcriptase inhibitors.
It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt or prodrug form thereof.
It is another object of the present invention to provide a novel method for treating HIV infection which comprises administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected form the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.
It is another object of the present invention to provide pharmaceutical compositions with reverse transcriptase inhibiting activity comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt or prodrug form thereof.
It is another object of the present invention to provide a method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of the present invention.
It is another object of the present invention to provide a kit or container containing at least one of the compounds of the present invention in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
These and other objects, which will become apparent during the following detailed description, have been achieved by the inventors' discovery that compounds of formula (I): ##STR6## wherein A, W, X, Y, Z, R.sup.a, R.sup.b, R.sup.1 and R.sup.2 are defined below, stereoisomeric forms, mixtures of stereoisomeric forms, or pharmaceutically acceptable salt forms thereof, are effective reverse transcriptase inhibitors.
DETAILED DESCRIPTION OF IREFERRED EMBODIMENTS
[1] Thus, in a first embodiment, the present invention provides a novel compound of formula I: ##STR7## or a stereoisomer or pharmaceutically acceptable salt form thereof, wherein:
A is O or S;
W is N or CR.sup.3 ;
X is N or CR.sup.4 ;
Y is N or CR.sup.5 ;
Z is N or CR.sup.6 ;
provided that if two of W, X, Y, and Z are N, then the remaining are other than N;
R.sup.a is selected from H, CF.sub.3, CF.sub.2 H, cycPr, C.sub.1-4 alkyl, C.sub.3-5 cycloalkyl, C.sub.2-4 alkenyl, C.sub.2-4 alkynyl, and phenyl substituted with 0-2 R.sup.10 ;
R.sup.b is selected from H, CF.sub.3, CF.sub.2 H, cycPr, C.sub.1-4 alkyl, C.sub.3-5 cycloalkyl, C.sub.2-4 alkenyl, C.sub.2-4 alkynyl, and phenyl substituted with 0-2 R.sup.10 ;
alternatively, R.sup.a and R.sup.b together form --(CH.sub.2)n--;
R.sup.1 is selected from CF.sub.3, CF.sub.2 H, C.sub.1-4 alkyl, C.sub.3-5 cycloalkyl, C.sub.2-4 alkenyl, and C.sub.2-4 alkynyl;
R.sup.2 is selected from --C.tbd.C--R.sup.8, --CH.dbd.CR.sup.7 R.sup.8, --(CH.sub.2).sub.p CHR.sup.7 R.sup.8, --CHR.sup.7 C.tbd.C--R.sup.8, --CHR.sup.7 CH.dbd.CHR.sup.8, and CH.dbd.CHCHR.sup.7 R.sup.8 ;
provided that when either of R.sup.a or R.sup.b is phenyl, then R.sup.1 is other than C.sub.1-4 alkyl and C.sub.3-5 cycloalkyl and R.sup.2 is other than --(CH.sub.2).sub.p CHR.sup.7 R.sup.8 ;
R.sup.3 is selected from H, F, Cl, Br, I, C.sub.1-3 alkoxy, and C.sub.1-3 alkyl;
R.sup.4 is selected from H, F, Cl, Br, I, C.sub.1-3 alkyl substituted with 0-3 R.sup.11, C.sub.2-3 alkenyl, C.sub.2-3 alkynyl, C.sub.1-3 alkoxy, OCF.sub.3, --CN, NO.sub.2, CHO, C(O)CH.sub.3, C(O)CF.sub.3, C(O)NH.sub.2, C(O)NHCH.sub.3, NR.sup.7 R.sup.7a, NR.sup.7 C(O)OR.sup.7b, C(O)OR.sup.7, S(O).sub.p R.sup.7, SO.sub.2 NHR.sup.7, NR.sup.7 SO.sub.2 R.sup.7b, phenyl substituted with 0-2 R.sup.10, and 5-6 membered aromatic heterocycle system containing from 1-4 heteroatoms selected from the group consisting of N, O, and S and substituted with 0-2 R.sup.10 ;
alternatively, R.sup.3 and R.sup.4 together form --OCH.sub.2.sub.O--;
R.sup.5 is selected from H, F, Cl, Br, and I;
alternatively, R.sup.4 and R.sup.5 together form --OCH.sub.2 O-- or a fused benzo ring;
R.sup.6 is selected from H, OH, C.sub.1-3 alkoxy, --CN, F, Cl, Br, I, NO.sub.2, CF.sub.3, CHO, C.sub.1-3 alkyl, and C(O)NH.sub.2 ;
R.sup.7, at each occurrence, is selected from H and C.sub.1-3 alkyl;
R.sup.7a, at each occurrence, is selected from H and C.sub.1-3 alkyl;
R.sup.7b, at each occurrence, is C.sub.1-3 alkyl;
R.sup.8, at each occurrence, is selected from H, C.sub.1-6 alkyl substituted with 0-3 R.sup.11, CH(--OCH.sub.2 CH.sub.2 O--), C.sub.2-6 alkenyl, C.sub.3-7 cycloalkyl substituted with 0-2 R.sup.9, phenyl substituted with 0-2 R.sup.10, and 5-6 membered aromatic heterocycle system containing from 1-4 heteroatoms selected from the group consisting of N, O, and S and substituted with 0-2 R.sub.10 ;
R.sup.9, at each occurrence, is selected from D, OH, C.sub.1-3 alkoxy, C.sub.1-3 alkyl, and F;
R.sup.10, at each occurrence, is selected from OH, C.sub.1-3 alkyl, C.sub.1-3 alkoxy, F, Cl, Br, I, CN, NR.sup.7 R.sup.7a, and C(O)CH.sub.3 ;
R.sup.11, at each occurrence, is selected from OR.sup.7, CN, F, Cl, Br, I, NO.sub.2, NR.sup.7 R.sup.7a, CHO, C(O)CH.sub.3, C(O)NH.sub.2 ;
n, at each occurrence, is selected from 1, 2, 3, 4, and 5; and,
p, at each occurrence, is selected from 0, 1, and 2.
[2] In a preferred embodiment, the present invention provides a novel compound of formuLa I, wherein:
R.sup.a is H;
R.sup.b is selected from H, CF.sub.3, CF.sub.2 H, cyclopropyl, CH.dbd.CH.sub.2, and C.sub.1-4 alkyl;
R.sup.1 is selected from CF.sub.3, CF.sub.2 H, C.sub.1-3 alkyl, and C.sub.3-5 cycloalkyl; and,
R.sup.8 is selected from H, C.sub.1-6 alkyl substituted with 0-3 R.sup.11, CH(--OCH.sub.2 CH.sub.2.sub.O--), C.sub.2-6 alkenyl, C.sub.3-5 cycloalkyl substituted with 0-1 R.sup.9, phenyl substituted with 0-1 R.sup.10, and 5-6 membered aromatic heterocycle system containing from 1-4 heteroatoms selected from the group consisting of N, O, and S substituted with 0-1 R.sup.10.
[3] In a more preferred embodimeit, the present invention provides a novel compound of formula I, wherein:
A is O;
R.sup.1 is selected from CF.sub.3, CF.sub.2 H, C.sub.2 H.sub.5, isopropyl, and cyclopropyl;
R.sup.3 is selected from H, F, Cl, Br, I, OCH.sub.3, and CH.sub.3 ;
R.sup.4 is selected from H, F, Cl, Br, I, C.sub.1-3 alkyl substituted with 0-3 R.sup.11, C.sub.2-3 alkenyl, C.sub.2-3 alkynyl, C.sub.1-3 alkoxy, OCF.sub.3, --CN, NO.sub.2, CHO, C(O)CH.sub.3, C(O)CF.sub.3, C(O)NH.sub.2, C(O)NHCH.sub.3, NR.sup.7 R.sup.7a, NR.sup.7 C(O)OR.sup.7b, C(O)OR.sup.7, S(O).sub.p R.sup.7, SO.sub.2 NHR.sup.7, NR.sup.7 SO.sub.2 R.sup.7b, phenyl, and 5-6 membered aromatic heterocycle system containing from 1-4 heteroatoms selected from the group consisting of N, O, and S;
alternatively, R.sup.3 and R.sup.4 together form --OCH.sub.2.sub.O--;
R.sup.5 is selected from H and F;
R.sup.6 is selected from H, OH, OCH.sub.3, --CN, F, CF.sub.3, CH.sub.3, and C(O)NH.sub.2 ;
R.sup.7 is selected from H and CH.sub.3 ;
R.sup.7a is selected from H and CH.sub.3 ;
R.sup.7b is CH.sub.3 ;
R.sup.8 is selected from H, C.sub.1-4 alkyl substituted with 0-3 R.sup.11, CH(--OCH.sub.2 CH.sub.2 O--), C.sub.2-4 alkenyl, C.sub.3-5 cycloalkyl substituted with 0-1 R.sup.9, phenyl substituted with 0-1 R.sup.10, and 5-6 membered aromatic heterocycle system containing from 1-4 heteroatoms selected from the group consisting of N, O, and S substituted with 0-1 R.sub.10 ;
R.sup.9 is selected from D, OH, OCH.sub.3, CH.sub.3, and F;
R.sup.10 is selected from OH, CH.sub.3, OCH.sub.3, F, Cl, Br, I, CN, NR.sup.7 R.sup.7a, and C(O)CH.sub.3 ; and,
p is selected from 1 and 2.
[4] In an even more preferred emodiment, the present invention provides a novel compouid of formula I, wherein:
R.sup.b is selected from H, CF.sub.3, CF.sub.2 H, cyclopropyl, CH.dbd.CH.sub.2, CH.sub.3, and CH.sub.2 CH.sub.3 ;
R.sup.1 is selected from CF.sub.3, CF.sub.2 H, and cyclopropyl;
R.sup.2 is selected from --C.tbd.C--R.sup.8 and trans-CH.dbd.CR.sup.7 R.sup.8 ;
R.sup.3 is selected from H, F, Cl, Br, and I;
R.sup.4 is selected from H, F, Cl, Br, I, C.sub.1-3 alkyl substituted with 0-3 R.sup.11, CH.dbd.CH.sub.2, C.tbd.CH, OCH.sub.3, OCF.sub.3, --CN, NO.sub.2, CHO, C(O)CH.sub.3, C(O)CF.sub.3, C(O)NH.sub.2, C(O)NHCH.sub.3, NR.sup.7 R.sup.7a, C(O)OR.sup.7, NR.sup.7 SO.sub.2 R.sup.7b, and 5-6 membered aromatic heterocycle system containing from 1-4 heteroatdms selected from the group consisting of N, O, and S;
alternatively, R.sup.3 and R.sup.4 together form --OCH.sub.2 O--; and,
R.sup.11 is selected from OH, OCH.sub.3, CN, F, Cl, NR.sup.7 R.sup.7a, C(O)CH.sub.3, and C(O)NH.sub.2.
[5] In a further preferred embodiment, the compound of the present invention is selected from:
5-(1-Butynyl)-7-chloro-1,5-dihydro)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-5-(1-Butynyl)-7-chloro)-1,5-dihydro-3-phenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
7-Chloro-1,5-dihydro-5-(isopropylethynyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
(+)-(5S)-7-Chloro-1,5-dihydro-5-(isopropylethynyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
1,5-Dihydro-7-fluoro-5-isopropylethynyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
1,5-Dihydro-7-fluoro-5-(3-methylbutyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-7-Chloro-1,5-dihydro-5-(2-furan-2-ylethenyl)-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
trans-7-Chloro-1,5-dihydro-5-(2-furan-2-yl)ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-1,5-dihydro-5-(2-furanyl)ethynyl-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
5-Butyl-7-chloro-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
4-Isopropylethynyl-4-trifluoromethyl-5,6-difluoro-1,4-dihydro-2H-3,1-benzoxazepin-2-one;
rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3R,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-isopropyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
7-Chloro-5-phenylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-5-isopropylethynyl-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
7-Chloro-5-cyclopropylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
7-Chloro-5-isopropylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
trans-7-Chloro-5-(2-isopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
7-Methoxy-5-(3-methylbutyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3R,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
7-Chloro-5-(3-pyridylethynyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-1benzoxazepin-2(3H)-one;
trans-7-Chloro-5-(3-pyrid-3-ylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
trans-7-Fluoro-5-(2-isopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
trans-6,7-Difluoro-5-(2-isopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S) -trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S) -trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-5-(3-furanylethynyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-5-(3-furanylethynyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-6,7-Difluoro-5-cyclopropylethynyl-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-6,7-Difluoro-5-cyclopropylethynyl-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-6,7-Difluoro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
(+)-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
(3S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
(+)-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
(+)-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Chloro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-cyclopropyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-cyclopropyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-6,7-Difluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-6, 7-Difluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-cyclopropyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Fluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Fluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-7-Fluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-7-Fluoro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-7-Fluoro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-6,7-Methylenedioxy-5-2-cyclopropylethynyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-6,7-Methylenedioxy-5-2-cyclopropylethynyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
rel-(3S,5S)-trans-6,7-Methylenedioxy-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one; and,
rel-(3S,5S)-trans-6,7-Methylenedioxy-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one;
or a pharmaceutically acceptable salt form thereof.
[6] In another preferred embodiment, the present invention provides a compound of formula II: ##STR8## or a stereoisomer or pharmaceutically acceptable salt form thereof.
[7] In another more preferred emodiment, the present invention provides a compound of Formula IIa: ##STR9## or a stereoisomer or pharmaceutically acceptable salt form thereof, wherein R.sup.1 is CF.sub.3.
In a second embodiment, the present invention provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula I or pharmaceutically acceptable salt form thereof.
In a third embodiment, the present invention provides a novel method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of a compound of formula I or pharmaceutically acceptable salt form thereof.
In a fourth embodiment, the present invention provides a novel method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of:
(a) a compound of formula I; and,
(b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors.
In another preferred embodiment, the reverse transcriptase inhibitor is a nucleoside reverse transcriptase inhibitor.
In another more preferred embodiment, the nucleoside reverse transcriptase inhibitor is selected from AZT, 3TC, rescriptor, ddI, ddC, efavirenz, and d4T and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, and U-103017.
In an even more preferred embodiment, the nucleoside reverse transcriptase inhibitor is selected from AZT, efavirenz, rescriptor, and 3TC and the protease inhibitor is selected from saquinavir, ritonavir, indinavir, and nelfinavir.
In a still further preferred embodiment, the nucleoside reverse transcriptase inhibitor is AZT.
In another still further preferred embodiment, the protease inhibitor is indinavir.
In a fifth embodiment, the present invention provides a pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of:
(a) a compound of formula I; and,
(b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers.
In a sixth embodiment, the present invention provides a novel method of inhibiting HIV present in a body fluid sample which comprises treating the body fluid sample with an effective amount of a compound of formula I.
In a seventh embodiment, the present invention to provides a novel a kit or container comprising a compound of formula (I) in an amount effective for use as a standard or reagent in a test or assay for determining the ability of a potential pharmaceutical to inhibit HIV reverse transcriptase, HIV growth, or both.
DEFINITIONS
As used herein, the following terms and expressions have the indicated meanings. It will be appreciated that the compounds of the present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms. It is will known in the art how to prepare optically active forms, sich as by resolution of racemic forms or by synthesis, from optically active starting materials. All chiral, diastereoneric, racemic forms and all geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomer form is specifically indicated.
The processes of the present invention are contemplated to be practiced on at least a multigram scale, kilogram scale, multikilogram scale, or industrial scale. Multigram scale, as used herein, is preferably the scale wherein at least one starting material is present in 10 grams or more, more preferably at least 50 grams or more, even more preferably at least 100 grams or nore. Multikilogram scale, as used herein, is intended to mean the scale wherein more than one kilogram of at least one starting material is used. Industrial scale as used herein is intended to mean a scale which is other than a laboratory scale and which is sufficient to supply product sufficient for either clinical tests or distribution to consumers.
The term "substituted," as used herein, means that any one or more hydrogens on the designated atom is replaced with a selection from the indicated group, provided that the designated atom's normal valency is not exceeded, and that the substitution results in a steble compound. When a substitent is keto (i.e., .dbd.O), then 2 hydrogens on the atom are replaced. Keto substituents are not present on aromatic moieties.
The present invention is intended to include all isotopes of atoms occurring in the present compounds. Isotopes include those atoms having the same atomic number but different mass numbers. By any of general example and without limitation, isotopes of hydrogen include tritium and deuterium. Isotopes of carbon include C-13 and C-14.
When any variable (e.g., R.sup.6, occurs more than one time in any constituent or formula formula for a compound, its definition at each occurrence is independent of its definition at every other occurrence. Thus, for example, if a group is shown to be substituted with 0-2 R.sup.6, then said group may optionally be substituted with up to two R.sup.6 groups and R.sup.6 at each occurrence is selected independently from the definition of R.sup.6. Also, combinations of substituents and/or variables are permissible only if such combinations result in stable compounds.
When a bond to a substituent is shown to cross a bond connecting two atoms in a ring, then such substituent may be bonded to any atom on the ring, then a substituent is listed without indicating the atom via which such substituent is bonded to the rest of the compound of a given formula, then such substituent may be bonded via any atom in such substituent. Combinations of subtituents and/or variables are permissible only if such combinations result in stable compounds.
As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, and s-pentyl. "Haloalkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms, substituted with 1 or more halogen (for example --C.sub.v F.sub.w where v=1 to 3 and w=1 to (2v+1)). Examples of haloalkyl include, but are not limited to, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachlorocethyl. "Alkoxy" represents an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s-pentoxy. "Cyclcoalkyl" is intended to include saturated ring groups, such as cyclopropyl, cyclobutyl, or cyclopentyl. Alkenyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more unsaturated carbon--carbon bonds which may occur in any stable point along the chain, such as ethenyl and propenyl. "Alkynyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more triple carbon--carbon bonds which may occur in any stable point along the chain, such as ethynyl and propynyl.
"Halo" or "halogen" as used herein refers to fluoro, chloro, bromo, and iodo; and "counterion" is used to represent a small, negatively charged species such as chloride, bromide, hydroxide, acetate, and sulfate.
As used herein, "aryl" or "aromatic residue" is intended to mean an aromatic moiety containing the specified number of carbon atoms, such as phenyl or naphthyl. As used herein, "carbocycle" or "carbocyclic residue" is intended to mean any stable 3- to 7-membered monocyclic or bicyclic which may be saturated, partially unsaturated, or aromatic. Examples of such carbocyles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, biphenyl, naphthyl, indanyl, adamantyl, or tetrahydronaphthyl (tetralin).
As used herein, the term "heterocycle" or "heterocyclic system" is intended to mean a staole 5- to 6-membered monocyclic heterocyclic ring which is saturated partially unsaturated or unsaturated (aromatic), and which consists of carbon atoms and from 1 to 3 heteroatoms independently selected from the group consisting of N, O and S. The nitrogen and sulfur heteroatoms nay optionally be oxidized. The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom which results in a stable structure. The heterocyclic rings described herein may be substituted on carbon or on a nitrogen atom if the resulting compound is stable. If specifically noted, a nitrogen in the heterocycle may optionally be quaternized. It is preferred that when the total number of S and O atoms in the heterocycle exceeds 1, then these heteroatoms are not adjacent to one another. It is preferred that the total number of S and O atoms in the heterocycle is not more than 1. As used herein, the term "aromatic heterocyclic system" is intended to mean a stable 5- to 6-membered monocyclic heterocyclic aromatic ring which consists of carbon atoms and from 1 to 3 heterotams independently selected from the group consisting of N, O and S. It is preferred that the total number of S and O atoms in the aromatic heterocycle is not more than 1.
Examples of heterocycles include, but are not limited to, 2-pyrrolidonyl, 2H-pyrrolyl, 4-piperidonyl, 6H-1,2,5-thiadiazinyl, 2H,6H-1,5,2-dithiazLnyl, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, isoxazolyl, morpholinyl, oxadiazolyl, 1,2,3-ocadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, oxazolidinyl, oxazolyl, piperazin.l, piperidinyl, pteridinyl, piperidonyl, 4-piperidonyl, piperonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, pyrrolyl, tetrahydrofuranyl, 6H-1,2,5-thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, -thienoimidazolyl, thiophenyl, triazinyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,5-triazolyl, and 1,3,4-triazolyl. Preferred heterocycles include, but are not limited to, pyridinyl, furanyl, thienyl, pyrrolyl, pyrazolyl, imidazolyl, and oxazolidinyl. Also included are fused ring and spiro compounds containing, for example, the above heterocycles.
As used herein, "HIV reverse transcriptase inhibitor" is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT). Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddI, d4T, and 3TC. Exanples of non-nucleoside RT inhibitors include, but are not limited to, efavirenz (DuPont), rescriptor (delavirdine, Pharmacia and Upjohn), viviradine (Pharmacia and Upjohn U90152S), TIBO derivatives, BI-RG-587, nevirapine, L-697,661, LY 73497, and Ro 18,893 (Roche).
As used herein, "HIV protease inhibitor" is intended to refer to compounds which inhibit HIV protease. Examples include, but are not limited, saqlinavir (Roche, Ro31-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), VX-478 (Vertex/Glaxo Wellcome), nelfinavir (Agouron, AG-1343), KNI-272 (Japan Energy), CGP-61755 (Ciba-Geigy), DMP450 (DuPont), DMP850 (DuPont), DMP851 (DuPont) and U-103017 (Pharmacia and Upjohn). Additional examples include the cyclic protease inhibitors disclosed in WO93/07128, WO94/19329, WO94/22840, and PCT Aplication Number US 96/03426 and the protease inhibitors disclosed in WO94/04993, WO95/33464, WO96/28,418, and WO96/28,464.
As used herein, "pharmaceutically acceptable salts" refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organdc acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxylenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
The pharmaceutically acceptable salts of the present invention can be synthesized fron the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like other, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, the disclosure of which is hereby incorporated by reference.
The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and andmals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio.
"Prodrugs" are intended to include any covalently bonded carriers which release the active parent drug according to formula (I) or other formulas or compounds of the present invention in vivo when such prodrug is administered to a mammalian subject. Prodrugs of e compound of the present invention, for example formula (I), are prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compourd. Prodrugs include compounds of the present invention wherein the hydroxy or amino group is bonded to any group that, when the prodrug is administered to a mammalian subject, cleaves to form a free hydroxyl or free amino, respectively. Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol end amine functional groups in the compounds of the present invention, and the like.
"Stable compound" and "stable structure" are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds arE. contemplated by the present invention.
"Therapeutically effective anount" is intended to include an amount of a compound of the present invention or an amount of the combination of compounds claimed effective to inhibit HIV infection or treat the symptoms of HIV infection in a host. The combination of compounds is preferably a synergistic combination. Synergy, as described for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55 (1984), occurs when the effect (in this case, inhibition of HIV replication) of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent. In general, a synergistic effect is nost clearly demonstrated at suboptimal concentrations of the compounds. Synergy can be in terms of lower cytotoxicity, increased antiviral effect, or some other beneficial effect cf the combination compared with the individual components.
Synthesis
The compounds of the present invention can be prepared in a number of ways well known to one skilled in the art of organic synthesis. The compounds of the present invention can be synthesized using the methods described below, together with synthetic methods Inown in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Each of the references cited below are hereby incorporated herein by reference. ##STR10## Scheme 1 illustrates a method of making the oxazepinones of the present invention starting from an appropriately substituted aminoalcohol. The amine is acylated by an .alpha.-halo acid halide (preferably an .alpha.-bromoacyl bromide) in the presence of a weak base such as pyridine. After acylation, cyclization is effected by further treatment with base. A tertiary amine base such as diisopropylethylamine, sodium hydride, potassium hydride, lithium hydride, sodium carbonate, potassium carbonate or cesium carbonate, sodium or potassium alkoxides or similar bases may be used with cesium carbonate and sodium hydride being preferred. Any non-protic organic solvent may be used for tie cyclization reaction with DMF being preferred. In cases where R.sup.1 and R.sup.2 are different and R.sup.a and R.sup.b are also different, two diastereomers are formed which may be separated by selective crystallization or chromatography. In the case where R.sup.1 and R.sup.2 are different and either R.sup.a or R.sup.b is H, cyclization with cesium carbonate in the presence of lithium bromide or lithium iodide will often afford a diastereomeric mixture ii which one diastereomer greatly predominates. Thus, in some cases these cyclization conditions are greatly preferred. In cases where both R.sup.a and R.sup.b are H, either sodium hydride or cesium carbonate are preferred bases. When an appropriately strong base is used, both acylation and cyclization reactions illustrated in Scheme 1 may be effected in a single step. ##STR11## Scheme 2 illustrates a second method of making the oxazepinones of the present invention starting from an appropriately substituted N-tritylaminoalcohol. The hydroxy group is alkylated with an .alpha.-haloester in the presence of base, and then after removal of the trityl protecting group, treatment with base and/or heat effects cyclization to the oxazepinone. In some cases it may be preferable to use an unprotected amino group. Also, other protecting groups known to those of skill in the art can be used in place of the shown trityl group. ##STR12## Scheme 3 illustrates a meth)d of making 5,5-disubstituted-benzoxazepin-2-ones starting from an appropriately substituted 2-aminobenzoic acid. In Scheme 3, G can be R.sup.3, R4, R.sup.5 or R.sup.6 or a combination of two or more of these groups. The acid is converted to its N-methoxy-N-methyl amide derivative which cal then be displaced to obtain the R.sup.1 -substituted ketone. Subsequent addition of another metallic species provides the alcohol which is readily cyclized by the 2-step procedure described in Scheme 1. ##STR13## Scheme 4 describes a means of obtaining 5-trifluoromethyl-benzoxazepin-2-ones starting from an appropriately substituted aniline. After iodination, the trifluoromethyl group can be introduced using a strong base and ethyl trifluoroacetate. The second 5-substituent can then be added through andon attach on the ketone or using other means well known to those of skill in the art. Cyclization can be then be completed as in Scheme 1. ##STR14## Because certain benzo-substituents are incompatible with the methods of the previous schemes, it may be necessary to protect these groups before forming the benzoxazepinone. In Scheme 5 there is shown a means of obtaining carbonyl-substituted 5,5-disubstituted-benzoxazepin-2-ones. After iodination of an acetyl-aniline, the acetyl group is protected by means well known to those of skill in the art, such as using 1,3-propanedithiol The same procedures as in Scheme 4 are used to arrive at the cyclized product. Deprotection of the ketone can then be achieved using HgCl.sub.2 and HgO or other means well known to those of skill in the art. ##STR15## A method for forming 5,5-disubstituted-benzoxazepin-2-ones, wherein R.sup.2 is a vinyl or alkynyl group, is described in Scheme 6. Starting from an appropriately substituted ketone which can be obtained using the procedure of Scheme 3 or 4, an acetylide is added. The prodict can be deprotected and cyclized in two steps (Scheme 1) to obtain the alkynyl-substituted material. Alternatively, the vinyl compounds can be obtained by reduction of the alkyne with a reducing agent, such as LiAlH.sub.4, deprotection by standard means, and 2-step cyclization. ##STR16## The acetylide which is required for the reactions illustrated in Scheme 6 may be generated directly from a terminal acetylene by treatment wLth a strong base such as n-butyllithium. An alternate methol for generating an acetylide, illustrated in Scheme 6A, is by converting an aldehyde to a 1,1-dibromoolefin which is then reacted with 2 equivalents of n-butyllithium. ##STR17## Scheme 7 describes an alterrate route to 5,5-disubstituted-benzoxazepin-2-ones from andlines, wherein the aniline is protected, ester addition is accomplished using a strong base and the amine protecting group is removed. The R.sup.2 group can then be added, e.g. via an acetylide, followed by cyclization as in Scheme 1. ##STR18## An intermediate useful in the preparation of the presently claimed compounds is 2-trifluoroacetylaniline. The starting 4-chloro-2-trifluoroacetylaniline can be made as shown in Scheme 4. Reduction and reoxidation removes the chloro group leaving the desired intermediate. ##STR19## Scheme 9 describes a novel n ethod of making 2-trifluoroacetylanilines as well as how these compounds can be further modified to make the presently claimed compounds. The protected aldehyde can be made from the N-methoxy-N-methyl amide of Scheme 3, by addition of a protecting group, preferably trityl, and reduction of the amide to the aldehyde. Other protecting groups known to those of skill in the art can be used in place of tne shown trityl group. ##STR20## Scheme 10 illustrates specific steps of Scheme 9. Intermediate IIIb (R.sup.1a is selected from CF.sub.3, CF.sub.3 CF.sub.2, and CF.sub.3 CF.sub.2 CF.sub.2) is useful for making same of the presently claimed compounds. Pg is an amine protecting group as defined previously, preferably trityl (triphenylmethyl). The protected or unprotected aminobenzaldehyde, preferably protected, is treated with a perfluoralkyl trimethylsilane, preferably trifluoromethyl trimethylsilane, followed by fluoride anion, preferably tetrabutylammonium fluoride. In the same fashion, CF.sub.3 CF.sub.2 TMS, CF.sub.3 CF.sub.2 CF.sub.2 TMS can also be used to prepare the appropriately substituted ketones. Other sources of fluoride andon such as sodium fluoride, potassium fluoride, lithium fluoride, cesilm fluoride as well as oxyandonic species such as potassium tert-butoxide, sodium methoxide, sodium ethoxide and sodium trimethylsilanolate can also be used. Aprotic solvents suich as DMF and THF can be used, preferably THF. The amount of perfluoralkyl trimethylsilane used can be from about 1 to about 3 equivalents with an equivalent amount of fluoride anion or oxyandonic species. The reaction can be typically carried out at temperatures between about -20.degree. C. to about 50.degree. C., preferably about -10 to about 10.degree. C., more preferably about 0.degree. C.
Conversion of IIIb to IIIc can be achieved by using an oxidizing agent well known to one of skill in the art such as MnO.sub.2, PDC, PCC, K.sub.2 Cr.sub.2 O.sub.7, CrO.sub.3, KMnO.sub.4, BaMnO.sub.4, Pb(OAc).sub.4, and RuO.sub.4. A preferred oxidant is MnO.sub.2. Such conversion can be performed in an aprotic solvent like THF, DMF, dichloromethane, dichloroethane, or tetrachloroethane, preferably dichloromethane. ##STR21## An additional means of making 5-alkynyl-benzoxazepin-2-ones is shown in Scheme 11. The alkyne group is added to the keto-aniline via a Grignard type addition, followed by cyclization. The alkyne group of the product can then be modified to obtain the desired compound. ##STR22## In addition to the methods of obtaining keto-anilines described in Schemes 3 and 4, nucleophilic opening of isatoic anhydrides can also be used as shown in Scheme 12. This reaction is accomplished by using an andonic nucleophile of the group R.sup.Ia. See Mack et al, J. Heterocyclic Chem. 1987, 24, 1733-1739; Coppola et al, J. Org. Chem. 1976, 41(6), 825-831; Takimoto et al, Fukuoka Univ. Sci. Reports 1985, 15(1), 37-38; Kadin et al, Synthesis 1977, 500-501; Staiger et al, J. Org. Chem. 1959, 24, 1214-1219.
It is preferred that the stoichiometry of the isatoic anhydride reagent to nucleophile is about 1.0 to 2.1 molar equivalents. The use of 1.0 eq. or more (e.g., 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0) of anion (or anion precursor) is preferred to force he conversion and improve the isolated yield. Preferably, the temperature used is from -20 to +35.degree. C., with temperatures below 0.degree. C. being more preferred and -20.degree. C. being even more preferred. Reactions are run to about completion with time dependent upon inter alia nucleophile, solvent, and temperature. Preferably this nucleophilic addition is run in THF, but any aprotic solvent would be suitable. Reaction with the active nucleophilic anion is the only criterion for exclusion of a solvent. ##STR23## Scheme 13 illustrates the synthesis of a 3,3-disubstituted oxazepinone from a monosubstituted oxazepinone. After first protecting the ring nitrogen with one of several amide protecting groups known to those skilled in the art, treatment with a strong base followed by an alkyl iodide gives after protecting group removal, a 3,3-disubstituted oxazepinone. Using the same sequence of reactions, a 3-monosubstituted oxazepinone (R.sup.a adove is H) can also be synthesized from a 3-unsubstituted oxazepinone. ##STR24## Compounds of the present intention that are thioamides can be prepared as illustrated in Scheme 14 by treating the corresponding amides with either Lawesson's reagent [2,4-bis(4-methoxyphenyl)-1,3-dithia-2,4-diphosphetane-2,4-disulfide] or phosphorous pentasulfide. ##STR25## Compounds of the present invention in which R.sup.a or R.sup.b are vinyl or cyclopropyl can be prepared as illustrated in Scheme 15. 2-Aminoarylketones protected, for example, with an N-p-methoxybenzyl (PMB) group can be treated with an acetylide to give the corresponding acetylenic alcohol. Cyclization can be effected by 2,4-dibromobutyryl chloride and the PMB group can then be removed, for example, by treatment with ceric ammonium nitrate. Displacement cf the bromide with an arylselenide followed by oxidative elimination by treatment with hydrogen peroxide affords the 5-alkynyl-3-vinylbenzoxazepinone. The vinyl group can be converted to a cyclopropane ring by Pd(II) catalylzed reaction with diazomethane. If the acetylenic alcohol is reduced to the olefin with lithium aluminum hydride (LAH), the same reaction sequence can be used to prepare the trans-5-alkenyl-3-vinylbenzoxazepinone and the corresponding trans-5-alkenyl-3-cyclopropylbenzoxazepinone.
One isomer of a compound of formula I may display superior activity compared with the other. Thus, all four of the following stereochemistries are considered to be a part of the present invention. ##STR26##
When required, separation of the racemic material can be achieved by HPLC using a chiral column or by a resolution using a resolving agent such as camphonic chloride as in Steven D. Young, et al, Antimicrobial Agents and Chemotheraphy, 1995, 2602-2605. A chiral compound of Formula I may also be directly synthesized using a chiral catalyst or a chiral ligand, e.g., Andrew S. Thompson, et al, Tet. Lett. 1995, 36, 8937-8940. In addition, separation may be achieved by selective cystallization, optionally in the presence of a chiral acid or base thereby forming a chiral salt.
Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.

EXAMPLES
Abbreviations used in the Examples are defined as follows: anal. for combustion analysis, "g" for gram or grams, HRMS for high resolution mass spectrometry, "mg" for milligram or milligrams, "mL" for milliliter or milliliters, "mmol" for millimole or millimoles, "h" for hour or hours, "HPLC" for high performance liquid chromatography, "M" for molar, "min" for minute or minutes, "MHz" for megahertz, "MS" for mass spectroscopy, "TLC" for thin layer chromatography.
For further clarification of the stereochemistry, in compounds with stereochemistry designated as "rel-(3S,5S)" the 3-substituent is cis to the 5-trifluoromethyl group while in compounds with stereochemistry designated as "rel-(3R,5S)" the 3-substituent is trans to the 5-trifluoromethyl group.
Example 1 ##STR27##
Preparation of 5-(1-Butynyl)-7-chloro-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of 1-(5-Chloro-2-triphenylmethylamino)phenyl-2,2,2-trifluoroethanone
1-(2-Amino-5-chlorophenyl)-2,2-trifluoroethanone (see U.S. Pat. No. 5,519,021)(22.4 g, 100 mmol), trityl chloride (30.0 g, 107 mmol), triethylamine (11.6 g, 115 mmol) and 4-(dimethylamino)pyridine (0.5 g, 4 mmol) were dissolved in DMF (50 mL) and held 14 h at 60.degree. C. The resulting slurry was cooled to room temperature, diluted with 20 mL water and filtered to give 35.9 g (77%) of the title compound.
Part B: Preparation of 6-Amino-3-chloro-.alpha.-(1-butynyl)-.alpha.-(trifluoromethyl)benzyl alcohol
To a -30.degree. solution of 1.4 g of 1-butyne in 30 mL of dry THF was added dropwise over 5 min, 7.5 mL of a 1.6 M solution of n-butyllithium in hexane. The reaction mixture was allowed to warm to 0.degree. and then stirred at this temperature for 30 min after which time 1.4 g of 1-(5-chloro-2-triphenylmethylamino)phenyl-2,2,2-trifluoroethanone was added in one portion. The reaction mixture was stirred at 0.degree. for 30 min after which time it was quenched with saturated aqueous ammonium chloride and poured onto water. This mixture was extracted twice with ether and the combined extracts were washed with brine dried and evaporated to a pure solid. This material was was dissolved in 20 mL of methanol and treated with 0.370 mL of 12 N aqueous hydrochloric acid for 15 min. The reaction mixture was partitioned between water and ether, and the ether layer was washed with aqueous bicarbonate, brine, dried and evaporated. The residue was dissolved in methanol and after cooling in ice for 1 h, the precipitated me hyl trityl ether was filtered off. After evaporation of the filtrate, crystallization from hexanes afforded 675 mg of the title compound as a crystalline solid.
Part C: Preparation of 5-(1-Butynyl)-7-chloro-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solition of 167 mg of 6-amino-3-chloro-.alpha.-(1-butynyl)-.alpha.-(trifluoromethyl)benzyl alcohol in 15 mL of dry ether was added 0.100 mL of dry pyridine and 0.066 mL of bromoacetyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 15 mL of dry DMF and was treated at room temperature with 25 mg of 100% sodium hydride for 1.5 h. The reaction was partitioned between ethyl acetate and water and the ethyl acetate layer was washed with brine, dried and evaporated. The crude product wes purified by preparative silica gel TLC. (elution with ethel acetate/hexanes 1:2) affording after crystallization from ethyl acetate/hexanes 106 mg of the title compound as colorless crystals: mp 167 -168.degree.; Anal. Calcd. for C.sub.14 H.sub.11 NO.sub.2 ClF.sub.3 : C, 52.93; H, 3.49; N, 4.42. Found: C, 52.73; H, 3.64; N, 4.13.
Example 2 ##STR28##
Preparation of rel-(3S,5S)-5-(1-Butynyl)-7-chloro-1,5-dihydro-3-phenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solution of 278 mg of 6-amino-3-chloro-.alpha.-(1-butynyl)-.alpha.-(trifluoromethyl)benzyl alcohol (Example 1, Part B) in 25 mL of dry ether was added 0.150 mL of dry pyridine and 0.200 mL of .alpha.-chlorophenacetyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 15 mL of dry DMF, 50 mg of potassium iodide and 28 mg of 100% sodium hydride were added and this solution was heated at 60.degree. for 12 h. The reaction was partitioned between ethyl acetate and water and the ethyl acetate layer was washed with brine, dried and evaporated. The crude product was subjected to column chromatography over silica gel (elution with ethyl acetate/hexanes 1:3) affording a mixture of diastereomers. These were separated by column chromatography over silica gel (elution with 1% methanol in methylene chloride) and the less polar isomer (27 mg) was crystallized from hexane to give 13 mg of the title compound as colorless crystals: mp 198-199.degree.; HRMS Calcd. for C.sub.20 H.sub.16 NO.sub.2 ClF.sub.3 (M+H).sup.+ : 394.082166. Found: 394.080316.
Example 3 ##STR29##
Preparation of 7-Chloro-1,5-dihydro-5-(isopropylethynyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of 6-Amino-3-chloro-.alpha.-(isopropylethynyl)-.alpha.-(trifluoromethyl)benzyl alcohol
To an ice-cooled solution of 3.06 g (45 mmol) of isopropylacetylene in 90 mL of dry THF was added dropwise over 5 min, 25 mL of a 1.6 M solution of n-butyllithium in hexane (40 mmol). After 30 min at 0.degree., a solution of 9.3 g of 1-(5-chloro-2-triphenylmethylamiio)phenyl-2,2,2-trifluoroethanone (Example 1, Part A) in 40 mL of dry THF was added dropwise over 5 min. The eaction mixture was stirred at 0.degree. for 15 min after which time it was quenched with saturated aqueous ammonium chloride and poured onto water. This mixture was extracted twice with ether and the combined extracts were washed with brine, dried, and evaporated to a pure solid. This material was washed dissolved in 100 mL of methanol and treated with 2.0 mL of 12 N aqueous hydrochloric acid for 15 min. The reaction mixture was partitioned between water and ether, and the ether layer was washed with aqueous bicarbonate, brine, dried, and evaporated. The residue was dissolved in 200 mL of methanol and after cooling in ice for 1 h, the precipitated methyl trityl ether was filtered off. After evaporation of the filtrate, crystallization from 80 mL of hexanes afforded 4.40 g (75.4%) of the title compound as a crystalline solid.
Part B: Preparation of 7-Chloro-1,5-dihydro-5-(isopropylethynyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solution of 4.37 g (15 mmol) of 6-amino-3-chloro-.alpha.-(isopropylethnyl)-.alpha.-(trifluoromethyl)benzyl alcohol in 200 mL of dry ether was added 2.4 mL of dry pyridine and quickly dropwise, 1.40 mL (16 mmol) of bromoacetyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 150 mL of dry DMF and was treated at 0.degree. with 400 mg of 100% sodium hydride (16.7 mmol) for 20 min. The cooling bath was removed, and the reaction was allowed to proceed at ambient temperature for 1.5 h. The reaction mixture was poured onto a mixture of 1.2 L of water and 300 mL of saturated aqueous sodium chloride and this was extracted 3 times with ether. The combined extracts were washed with brine, dried, and evaporated to a solid which was crystallized by dissolving in hot ethyl acetate and adding hexanes. This material was recrystallized from ethyl acetate/hexane to afford 3.125 g of pure title compound as a crystalline solid: mp 183-183.5.degree.; HRMS Calcd. for C.sub.15 H.sub.14 NO.sub.2 ClF.sub.3 (M+H).sup.+ : 332.066516 Found: 332.065892.
Example 4 ##STR30##
Preparation of (+)-(5S)-7-Chloro-1,5-dihydro-5-(isopropylethynyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The racemic material from example 3, Part B above was separated by preparative HPLC or a Chiralcel column maintained at ambient temperature with elution with 10% isopropylamine in carbon dioxide at a pressure of 150 Atm. and a flow rate of 2.0 mL/min. The slower moving isomer was collected and crystallized from hexane: mp 135-136.degree.; [.alpha.].sup.25 +9.69.
Example 5 ##STR31##
Preparation of trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of 3-Chloro-6-(triphenylmethyl)amino-.alpha.-cyclopropylethynyl-.alpha.-(trifluoromethyl)benzyl alcohol
To an ice-cooled solution of 4.5 g (67.55 mmol) of cyclopropylacetylene in 130 mL of dry THF was added dropwise over 5 min, 37.5 mL (60 mmol) of 1.6 M n-butyllithium. The reaction mixture was allowed to warm to 0.degree. over 30 min after which time a solution of 13.95 g (30.0 mmol) of 1-(5-chloro-2-triphenylmethylamino)phenyl-2,2,2-trifluoroethanone (Example 1, Part A) in 50 mL of cry THF was added dropwise over 5 min. The reaction mixture was stirred at 0.degree. for 30 min after which time it was quenched with saturated aqueous ammonium chloride and poured onto water. This mixture was extracted twice with ether and the combined extracts were washed with brine dried and evaporated to pure title compound as a glassy solid.
Part B: Preparation of trans-6-Amino-3-chloro-.alpha.-(2-cyclopropylethenyl)-.alpha.-(trifluoromethyl)benzyl alcohol
The reaction product from part A was dissolved in 100 mL of dry THF and treated overnight with 20 mL of a 1 M solution of lithium aluminum hydride in THF. At this time TLC showed incomplete reaction so an aditional 10 mL of 1 M lithium aluminum hydride was added. After 30 min the reaction was quenched by the addition of 0.800 mL of concentrated aqueous ammonium hydroxide. After gas evoution ceased, the mixture was diluted with ether, filtered through celite, and evaporated. The residue was dissolved in 150 mL of methanol and treated with 3.0 mL of 12 N aqueous hydrochloric acid for 30 min. The reaction mixture was poured onto aqueous bicarbonate and extracted twice with ether. The ether layer was washed with brine, dried and evaporated. The residue was dissolved in 100 mL of boiling methanol after cooling in ice for 1 h, the precipitated methyl trityl ether was filtered off. The filtrate was evaporated to a solid which was suspended in 100 mL of boiling hexane. Pure colorless crystals of the title compound (404 g) were collected from the cooled mixture.
Part C: Preparation of trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred 0.degree. solution of 230 mg of trans-6-amino-3-chloro-.alpha.-cyclopropylethenyl-.alpha.-(trifluoromethyl)benzyl alcohol in 10 mL of dry ether was added 0.140 mL of dry pyridine and 0.075 mL of bromoacetyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 8 mL of dry DMF and was treated at 0.degree. with 24 mg of 100% sodium hydride. After 15 min the cooling bath was removed and stirring was continued at ambient temperature for 3 h. The reaction was poured onto aqueous ammonium chloride and extracted with ether. The ether layer was washed with brine, dried and evaporated. The crude product was purified by column chromatiography over silica gel (elution with ethyl acetate/hexanes 1:3) affording efter crystallization from ethyl acetate/hexanes 127 mg of the title compound as colorless crystals: mp 157-158.degree.; HRMS Calcd. for C.sub.15 H.sub.14 NO.sub.2 ClF.sub.3 (M+H).sup.+ : 332.066516. Found: 332.064517.
Example 6 ##STR32##
Preparation of rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solition of 291 mg of trans-6-Amino-3-chloro-.alpha.-cyclopropylethenyl-.alpha.-(trifluoromethyl)benzyl alcohol (from Example 5, Part C.) in 13 mL of dry ether was added 0.180 mL of dry pyridine and 0.120 mL of bromopropionyl bromide. After 1 h, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 10 mL of dry DMF and was treated at 0.degree. with 40 mg of 100% sodium hydride. After 15 min the cooliing bath was removed and stirring was continued at ambient temperature for 20 h. The reaction was poured onto aqueous ammonium chloride and extracted with ether. The ether layer was washed with brine, dried and evaporated. The residie was dissolved in a small amount of ethyl acetate, and addition of hexane resulted in the crystallization of 40 mg of the title compound as colorless crystals: mp 171-172.degree.; HRMS: Calcd. for C.sub.16 H.sub.16 NO.sub.2 ClF.sub.3 (M+H).sup.+ : 346.082166. Found: 346.080681. A second crop of slightly less pure product weighed 41 mg.
Example 7 ##STR33##
Preparation of 1,5-Dihydro-7-fluoro-5-isopropylethynyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of N-(4-Fluorophenyl)-2,2-dimethylpropanamide
To an ice-cooled solution of 125 mL of 4-fluoroaniline and 18.4 mL of triethylamine in 300 mL of methylene chloride was added dropwise over 30 min 14.8 mL of trimethylacetyl chloride. After addition was complete, the cooling bath was removed and stirring was continued at ambient temperature for 1 h. The reaction mixture was brought to pH 3 with 6N HCl and was partitioned between methylene chloride and water. Evaporation of the organiclayer afforded a solid which was collected and washed with hexane to afford 21.35 g (83%) of the title compound as a crystalline solid.
Part B: Preparation of 1-(2-Amino-5-fluorophenyl)-2,2,2-trifluoroethanone
To an ice-cooled solution o 4.0 g of N-(4-fluorophenyl)-2,2-dimethylpropandamide in 80 mL of dry THF was added dropwise over 30 min 30.8 mL of a 1.6 M solution of n-butyllithium in hexane. After addition was complete, the reaction mixture was stirred an additional 1 h at 0.degree. after which time 5.63 mL of ethyl trifluoroacetate was added quickly dropwise. The cooling bath was removed and the reaction was allowed to proceed at ambient temperature for 40 min. The reaction was quenched by the addition of aqueous ammonium chloride and the react on mixture was partitioned between ether and water. The ether layer was washed with brine, dried and evaporated to 6.29 g of the title compound as an orange oil. The bulk of this material (6.0 g) was dissloved in ethylene glycol dimethyl ether, 30 mL of 6N HCl was added nd the mixture was heated at reflux for 1.5 h. The cooled reaction mixture was diluted with water, and made basic by the addition of solid sodium carbonate. This was extracted with ether, and the combined extacts were dried and evaporated. The residue was pulified by column chromatography over silica gel (elution with 10-20% ethyl acetate in hexanes) affording 2.10 g of the title compound as an orange solid.
Part C: Preparation of 6-Amino-3-fluoro-.alpha.-isopropylethynyl-.alpha.-(trifluoromethyl)benzyl alcohol
To an ice-cooled solution of 1.89 mL of isopropylacetylene in 35 mL of dry THF was added dropwise over 5 min, 10.0 mL of 1.6 M n-butyllithium. The reaction mixture was stirred at 0.degree. for 30 min after which time 828 mg of 1-(2-amino-5-fluorophenyl)-2,2,2-trifluoroethanone was added. The reaction mixture was stirred at 0.degree. for 1.25 h after which time it was quenched with saturated aqueous ammonium chloride and poured onto water. This mixture was extracted twice with ether and the combined extracts were washed with brine dried and evaporated. The residue was purified by column chromatography on silica gel (elution wth ethyl acetate/hexanes) affording 220 mg of the title compound as a tan solid.
Part D: 1,5-Dihydro-7-fluoro-5-isopropylethynyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred 0.degree. solution of 210 mg of 6-Amino-3-fluoro-.alpha.-isopropylethynyl-.alpha.-(trifluoromEthyl)benzyl alcohol in 20 mL of dry ether was added 120 mL of dry pyridine and 0.080 mL of bromoacetyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 20 mL of dry DMF and was treated at room temperature with 33 mg of 100% sodium hydride for 30 min. The reaction was partitioned between ethyl acetate and water and the ethyl acetate layer was washed with brine, dried and evaporated. The crude product was purified by column chromatography over silica gel (elution with ethyl acetate/hexanes 1:2) affording after crystallization from ethyl acetate/hexanes 89 mg of the title compound as colorless crystals: mp 172-173.degree.; Anal. Calcd. for C.sub.15 H.sub.13 NO.sub.2 F.sub.4 : C, 57.15; H, 4.17; N, 4.44. Found: C, 57.10; H, 3.98; N, 4.21.
Example 8 ##STR34##
Preparation of 1,5-Dihydro-7-fluoro-5-(3-methylbutyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
A solution of 32 mg of 7-fluoro-5-isopropylethynyl-5-(trifluoromethyl)-4,1-benzoxazepin-2-one in 4 mL of ethanol was stirred under 1 atmosphere of hydrogen in the presence of 5 mg of 10% palladium on carbon for 12 h. Filtration and evaporation afforded a solid material which was recrystallized from ethyl acetate/hexanes to afford 18 mg of the title compound as colorless crystals: HRMS: Calcd. for C.sub.15 H.sub.18 NO.sub.2 F.sub.4 (M+H).sup.+ : 320.127367. Found: 320.127936.
Example 9 ##STR35##
Preparation of rel-(3S,5S)-trans-7-Chloro-1,5-dihydro-5-(2-furan-2-ylethenyl)-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of 1,1-dibromo-2-furan-2-yl-ethylene
To a stirred solution of 9.6 g (29 mmol) of carbon tetrabromide in 120 mL of dry me hylene chloride at 0.degree. was added 15.2 g (58 mmol) of tripheiiylphosphine. After 15 min 3.0 mL (22.5 mmol) of triethylamine was added, and after stirring another 5 min at 0.degree., the reaction mixture was cooled to -780.degree.. At this temperature 1.50 mL (22.5 mmol) of 2-furaldehyde was added quickly dropwise, and after addition was complete, the mixture was stirred a -70.degree. for 30 min. The reaction mixture was poured onto a rapidly stirring saturated solution of sodium bicarbonate in water. The methylene chloride phase was removed and the aqueous layer was extracted with additional methylene chloride. The combined extracts were evaporated to a solid which was stirred in 500 mL of hexanes for 2 h. After filtration, the filtrate was concentrated to a volume of 50 mL and the filtered again to remove precipitated solid. Final evaporation of the filtrate afforded 3.1 g (58%) of the title compound.
Part B: Preparation of 3-Chloro-6-(triphenylmethy)amino-.alpha.-(2-furanyl)ethynyl-.alpha.-(trifluoromethyl)benzyl alcohol
To a solution of 2.88 g (11.4 mmol) of 1,1-dibromo-2-furan-2-ylethene in 40 mL of dry THF at -20.degree. was added dropwise over 5 min, 14.25 mL (22.8 mmol) of 1.6 M n-butyllithium. The reaction mixture was allowed to warm to 0.degree. over 30 min at which time a solution of 4.2 g (9.0 mmol) of 1-(5-chloro-2-triphenylmethylamino)phenyl-2,2,2-trifluoroethanone in 12 mL of dry THF was added dropwise over 1 min. The reaction mixture was stirred at 0.degree. for 30 min after which time it was poured onto saturated aqueous ammonium chloride. This mixture was extracted twice with ether and the combined extracts vere washed with brine, dried, and evaporated to 5.6 g of 3-chloro-6-(triphenylmethy)amino-.alpha.-(furan-2-yl)ethynyl-.alpha.-(trifluoromethyl)benzyl alcohol is a dark colored solid.
Part C: Preparation of trans-6-Amino-3-chloro-.alpha.-(2-furan-2-yl)ethenyl-.alpha.-(trifluoromethyl)benzyl alcohol
To a stirred solution of 3.35 g of 3-chloro-6-(triphenylmethy)amino-.alpha.-(furan-2-yl)ethynyl-.alpha.-(trifluoromethyl)benzyl alcohol in 25 mL of dry THF was added 6 mL of 1.0 M lithium aluminum hydride in THF. After 1 h the reaction was quenched by the addition of 0.54 mL of concentrated aqueous ammonium hydroxide. After gas evolution ceased, the mixture was diluted with ether, filtered through celite, and evaporated. The residue was dissolved in 30 mL of methanol and treated with 0.70 mL of 12 N aqueous hydrochloric acid for 30 min. The reaction mixture was poured onto aqueous bicarbonate and extracted with ether. The ether layer was washed with brine, dried and evaporated. The residue was dissolved in metlanol after cooling in ice for 1 h and the precipitated metlyl trityl ether was filtered off. After evaporation of the filtrate, crystallization from hexanes afforded 888 mg of trans-3-chloro-6-amino-.alpha.-(furan-2-yl)ethenyl-.alpha.-(trifluoromethyl)berzyl alcohol as crystals.
Part D: Preparation of rel-(3S,5S)-trans-7-Chloro-1,5-dihydro-5-(2-furan-2-yl)ethenyl-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred 0.degree. solution of 317 mg of trans-3-chloro-6-amino-.alpha.-(furan-2-yl)ethenyl-.alpha.-(trifluoromethyl)benzyl alcohol in 15 mL of dry ether was added 0.100 mL of dry pyridine and 0.125 mL of bromopropionyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, fried and evaporated. The residue was dissolved in 15 mL of dry DMF, 268 mg of lithium iodide and 489 mg of cesium carbonate was added, and the resulting heterogeneous mixture was stirred at room temperature for 24 h. The reaction mixture was then poured onto water and extracted twice with ether. The combined extracts were washed with water and brine, dried and evaporated to 350 mg of crude product from which 108 mg of a single isomer could be isolated by crystallization (ethyl acetate/hexanes). This material was purified further on a short silica gel column, and then recrystallized from ethyl acetate/hexanes to give 86 mg of the title compound as colorless crystals: mp 205-206.5.degree.; Anal. Calcd. for C.sub.17 H.sub.13 NO.sub.3 F.sub.3 Cl: C, 54.93; H, 3.54; N, 3.78. Found: C., 54.83; H, 3.40; N, 3.61.
Example 10 ##STR36##
Preparation of trans-7-Chloro-1,5-dihydro-5-(2-furan-2-yl)ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled soliution of 159 mg of trans-3-chloro-6-amino-.alpha.-(furan-2-yl)ethenyl-.alpha.-(trifluoromethyl)benzyl alcohol (from Example 9, Part C) in 8 mL of dry ether was added 0.050 mL of dry pyridine and 0.055 mL of bromoacetyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried, and evaporated. The residue was dissolved in 8 mL of dry DMF, 245 mg of cesium carbonate was added, and the resulting heterogeneous mixture gas stirred at room temperature for 1.5 h. The reaction mixture was then poured onto water and extracted twice with ether. The combined extracts were washed with water and brine, dried and evaporated to crude product from which 86 mg of crystalline material was obtained (ethyl aceate/hexanes). This material was purified further on a short silica gel column (elution with ethyl acetate/hexanes 1:1), and then recrystallized from ethyl acetate/hexanes to give 68 mg of title compound: mp 199-200.degree.; Anal. Calcd. for C.sub.16 H.sub.11 NO.sub.3 F.sub.3 Cl: C, 53.72; H, 3.11; N, 3.93. Found: C, 54.09 H, 3.35; N, 3.83.
Example 11 ##STR37##
Preparation of rel-(3S,5S)-7-Chloro-1,5-dihydro-5-(2-furanyl)ethynyl-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of 6-Amino-3-chloro-.alpha.-(furan-2-yl)ethynyl-.alpha.-(trifluoromethyl)benzyl alcohol
To a stirred solution of 20 g of 3-Chloro-6-(triphenylmethy)amino-.alpha.-(2-furanyl)ethynyl-.alpha.-(trifluoromethyl)benzyl alcohol (Example 9, Part B) in 20 mL of methanol was added 0.125 mL of 12 N aqueous hydrochloric acid, and the resulting solution was stirred at ambient temperature for 30 min. The reaction mixture was poured onto aqueous bicarbonate and extractec with ether. The ether layer was washed with brine, dried and evaporated. The residue was dissolved in methanol after cooling in ice for 1 h, the precipitated methyl trityl ether was filtered off. After evaporation of the filtrate, the residue was chromatographed over silica gel (elution with hexanes/ethyl acetate 3:1) affording after crystalization from hexane/ethyl acetate 280 mg of the title compound.
Part B: Preparation of rel-(3S,5S)-7-Chloro-1,5-dihydro-5-(2-furanyl)ethynyl-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solution of 265 mg of 6-amino-3-chloro-.alpha.-(furan-2-yl)ethynyl-.alpha.-(trifluoromethyl)benzyl alcohol in 10 mL of dry ether was added 0.150 mL of dry pyridine and 0.100 mL of bromopropionyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 10 mL of dry DMF at 0.degree., 25 mg of 100% sodium hydride was added, and the resulting mixture was stirred for 15 min at 0.degree. and at room temperature for 30 min. The reaction mixture was then poured onto water and extracted twice with ether. The combined extracts were washed with water and brine, dried and evaporated to a residue which was purified by column chromatography on silica gel (elution with 17-33% ethyl acetate in hexanes) affording after crystallization from ethyl acetale/hexanes 5 mg of the title compound: HRMS: Calcd. for C.sub.17 H.sub.12 NO.sub.3 ClF.sub.3 (M+H).sup.+ : 369.037956. Found: 369.036835.
Example 12 ##STR38##
Preparation of 5-Butyl-7-chloro-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of 6-Amino-3-chloro-.alpha.-butyl-.alpha.-(trifluoromethyl)benzyl alcohol
To an ice-cooled solution of 465 mg (1 mmol) of 1-(5-chloro-2-triphenylmethylamino)phenyl-2,2,2-trifluoroethanone in 15 mL of dry THF was added dropwise 2 mmol of n-butylmagnesium chloride in ether. The reaction mixture was stirred at 0.degree. for 30 min after which time it was quenched with saturated aqueous ammonium chloride and poured onto water. This mixture was extractdd twice with ether and the combined extracts were washed with brine, dried, and evaporated to a pure solid. This material was was dissolved in 10 mL of methanol and treated with 0.100 mL of 12 N aqueous hydrochloric acid for 1 h. The reaction mixture was partitioned between water and ether, and the ether layer was washed with aqueous bicarbonate, brine, dried and evaporated. Crystallization from hexanes afforded 195 mg of the title compound as a crystalline solid.
Part B: Preparation of 5-Butyl-7-chloro-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solution of 185 mg of 6-amino-3-chloro-.alpha.-butyl-.alpha.-(trifluoromethyl)benzyl alcohol in 15 mL of dry ether was added 0.100 mL of cry pyridine and 0.060 mL of bromoacetyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 8 mL of dry DMF and was treated at room temperature with 40 mg of 100% sodium hydride for 16 h. The reaction was partitioned between ethyl acetate and water and the ethyl acetate layer was washed with brine, dried, and evaporated. The crude product was purified first by column chromatography over silica gel (elution with ethyl acetate/hexanes 1:3), and then by preparative silica gel TLC. (elution with 2.5% methanol in methylene chloride) affording 32 mg of the title compound as an amorphous solid: HRMS: Calcd. for C.sub.14 H.sub.16 NO.sub.2 ClF.sub.3 (M+H).sup.+ : 322.082166. Found: 322.080685.
Example 13 ##STR39##
Preparation of 4-Isopropylethynyl-4-trifluoromethyl-5,6-difluoro-1,4-dihydro-2H-3,1-benzoxazin-2-one.
Part A: Preparation of N-trimethylacetyl-3,4-difluoroandlide.
To a solution of 3,4-difluoroaniline (19 mL, 191 mmol) in methylene chloride (500 mL) at 0.degree. was added triethylamine (32 mL, 230 mmol) followed dropwise with trimethylacetyl chloride (24 mL, 191 mmol) and the resulting reaction mixture was allowed to stir at room temperature for 3 h. The reaction mixture was poured onto 3N HCl ard extracted with methylene chloride (3.times.100 mL) and the combined organic extracts were dried over anhydrous NaSO.sub.4 and concentrated in vacuo. The residue was taken up in hexanes (300 mL) and filtered through a sintered glass funnel. The solids are washed thoroughly with hexanes (500 mL) and dried under vacuum to give 37.36 g of the pivaloyl amide as a solic (40.68 g theoretical, 92% yield).
Part B: Preparation of N-Trimethylacetyl 5,6-difluoro-2-trifluoroacetylandlide.
To a solution of N-trimethlacetyl-3,4-difluoroandlide (4.0 g, 14.6 mmol) in THF (60 mL) at -78.degree. C. was added dropwise 1.6M nBuLi in hexane (22 mL, 35 nmol) and the resulting reaction mixture was allowed to stir at -78.degree. C. for 1 h. Ethyl trifluoroacetate (4 mL, 33.6 mmol) was added to the reaction mixture and the resulting solution was allowed to stir with warming to room temperature (ice bath removed after the addition of reagent) for 0.5 h. Phe reaction mixture was poured onto saturated NH.sub.4 Cl and extracted with ether (3.times.50 mL). The combined ether extracts were dried over anhydrous MgSO.sub.4 and concentrated in vacuo to give an orange oil. This product was used in the next step of the synthetic sequence without further purification.
Part C: Preparation of 5,6-Difluoro-2-trifluoroacetylaniline.
To a solution of the orange oil in dimethoxyethane (15 mL) was added 6N HCl (75 mL) and the resulting mixture was allowed to reflux for 2 h. The reaction mixture was cooled, made basic with solid Na.sub.2 CO.sub.3 and extracted with ether (3.times.50 mL). The combined ether extracts were dried over anhydrous MgSO.sub.4 and concentrated in vacuo. Chromatography (SiO.sub.2, 20% EtOAc-hexanes eluant) provided 2110 mg of 5,6-Difluoro-2-trifluoroacetylaniline as a yellcw solid (3285 mg theoretical, 64% yield).
Part D: Preparation of 1-(2,3-difluoro-6-triphenylmethylamino)phenyl-2,2,2-trifluoroethanone
A solution of 500 mg of 5,6(-Difluoro-2-trifluoroacetylaniline, 693 mg of triphenylmethanol, and 8 mg of p-toluenesulfonic acid in 50 mL of toluene was heated a reflux for 3.5 h using a Dean-Stark trap for water separation. After evaporation of the solvent, the residue was purified by column chromatography over silica gel (5% ethylacetate in hexanes as eluent) affording 760 mg of the title compound as a yellow foam.
Part E: Preparation of 6-Amino-2,3-difluoro-.alpha.-(isopropylethynyl)-.alpha.-(trifluoromethyl)benzyl alcohol
To an ice-cooled solution of 250 mg of isopropylacetylene in 10 mL of dry THF was added dropwise 1.90 mL of a 1.6 M solution of n-butyllithium in hexane. After 30 min at 0.degree., 450 mg of 1-(2,3-difluoro-6-triphenylmethylamino)phenyl-2,2,2 -trifluoroethanone in 3 mL of dry THF was added quickly dropwise. The reaction mixture was stirred at 0.degree. for 20 min after which time it was poured onto saturated aqueous ammonium chloride. This mixture was extracted twice with ether and the combined extracts were washed with brine dried and evaporated to an orange solid. 248 mg of this material was was dissolved in 5 mL of methanol and treated with 0.05 mL of 12 N aqueous hydrochloric acid for 20 min. The reaction mixture was partitioned between water and ether, and the ether layer was washed with aqueous bicarbonate, brine, dried, and evaporated. The crude product was purified by column chromatography over silica gel (elution with ethyl acetate/hexanes 1:3) affording 81 mg of the title compound.
Part F: Preparation of 6,7-Difluoro-1,5-dihydro-5-(isopropylethynyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled soliution of 81 mg of 6-Amino-2,3-difluoro-.alpha.-(isopropylethynyl)-.alpha.-(trifluoromethyl)benzyl alcohol in 8 mL of dry ether was added 0.55 mL of dry pyridine and 0.032 mL of bromoacetyl bromide. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 10 mL of dry DMF and was treated at 0.degree. with 10 mg of 100% sodium hydride for 20 min. The cooling bath was removed, and the reaction was allowed to proceed at ambient temperature for 1 h. The reaction was quenched with one drop of acetic acid and then the mixture was concentrated in vacuo. The residue was dissolved in ethyl acetate and this solution vas washed with water and brine, dried and evaporated to a solid which was crystallized from ethyl acetate/hexanes affording 28 mg of the title compound as colorless crystals: mp 192.5-193.5.degree.; HRMS: Calcd. for C.sub.15 H.sub.13 NO.sub.2 F.sub.5 (M+H).sup.+ : 334.086645. Found: 334.084917.
Example 14 ##STR40##
Preparation of rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one (Example 14a) and rel-(3R,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one (Example 14b)
Part A: Preparation of 6-Amino-3-chloro-.alpha.-cyclopropylethynyl-.alpha.-(trifluoromethyl)benzyl alcohol
To a stirred solution of 3.0 g of 3-Chloro-6-(triphenylmethyl)amino-.alpha.-cycloprcpylethynyl-.alpha.-(trifluoromethyl)benzyl alcohol (Example 5, Part A) in 30 mL of methanol was added 0.60 mL of 12 N aqueous hydrochloric acid, and this mixture was stirned at ambient temperature for 10 min. The reaction mixture was poured onto aqueous bicarbonate and extracted twice with ether. The combined extracts were washed withh brine, dried, and evaporated. The residue was dissolved in 20 mL of methanol and after cooling in ice for 1 h, the precipitated methyl trityl ether was filtered off. After evaporation of the filtrate, the crude solid was recrystallized from hekanes affording 1.16 g of the title compound as a purple solid.
Part B: Preparation of rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one and rel-(3R,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solition of 290 mg of 6-amino-3-chloro-.alpha.-cyclopropylethynyl-.alpha.-trifluoromethyl)benzyl alcohol in 15 mL of dry ether was added 0.100 mL of dry pyridine and 220 mg of .alpha.-bromobutyryl chloride. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 15 mL of dry DMF, 268 mg of lithium iodide and 978 mg of cesium carbonate was added, and the resulting heterogeneous mixture was stirred at room temperature overnight. The reaction mixture was then poured onto water and extracted twice with ether. The combined extracts were washed with water end brine, dried and evaporated to 300 mg of crude product. This material was subjected to column chromatography over silica gel (elution with 5-25% ethyl acetate in hexares) affording after crystallization from ethyl acetate/hexanes: 115 mg of rel-(3S,5S)-7-chloro-5-cyclopropyletlynyl-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one as colorless crystals: mp 191-1920.degree.; Anal. Calcd. for C.sub.18 H.sub.17 NO.sub.2 F.sub.3 Cl: C, 58.15; H, 4.62; N, 3.78. Found: C, 57.89; H, 4.61; N, 3.60, and 25 mg of rel-(3R,5S)-7-chloro-5-cyclopropylethynyl-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one: mp 141.degree.; HRMS: Calcd. for C.sub.18 H.sub.18 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 372.097816. Found: 372.096539.
Example 15 ##STR41##
Preparation of rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-isopropyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solution of 290 mg of 6-amino-3-chloro-.alpha.-cyclopropylethynyl-.alpha.-(trifluoromethyl)benzyl alcohol (Example 14, Part A) in 15 mL of dry ether was added 0.100 mL of dry pyridine and 228 mg of .alpha.-bromoisobutyryl chloride. After 30 min, the reaction mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residue was dissolved in 15 mL of dry DMF, 268 mg of lithium iodide and 978 mg of cesium carbonate was added, and the resulting heterogeneous mixture was stirred at room temperature overnight. The reaction mixture was then poured onto water and etracted twice with ether. The combined extracts were washed with water and brine, dried and evaporated. Since TLC. showed the reaction had only gone halfway to completion, the crude product was redissloved in 15 mL of DMF and subjected to the same reaction conditions as above for another 24 h. After the same work-up, the crude product was purified by column chromatography over silica gel (elution with 5-15% ethyl acetate in hexanes) and then recrystallized from ethyl acetate/hexanes to give 45 mg of the title compound as colorless crystals: mp 167.degree.; Anal. Calcd. for C.sub.18 H.sub.17 NO.sub.2 F.sub.3 Cl: C, 58.15; H, 4.62; N, 3.78. Found: C, 58.11; H, 4.59; N, 3.70.
Example 16
7-Chloro-5-phenylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 7, except that dilsopropylethylamine was used as a base rather than sodium hydride: mp 190-191.degree.; Anal. Calcd. for C.sub.18 H.sub.17 NO.sub.2 F.sub.3 Cl: C, 5 59.11; H, 3.03; N, 3.84. Found: C, 58.95; H, 3.12; N, 3.33.
Example 17
rel-(3S,5S)-7-Chloro-5-isopropylethynyl-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 7: mp 181-182.8.degree.; Anal. Calcd. for C.sub.16 H.sub.15 NO.sub.2 F.sub.3 Cl: C, 55.58; H, 4.37 N, 4.05. Found: C, 55.37; H, 4.39; N, 3.87.
Example 18
7-Chloro-5-cyclopropylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 7: mp 199.5-200.5.degree.; Anal. Calcd. for C.sub.15 H.sub.11 NO.sub.2 F.sub.3 Cl: C, 54.64; H, 36; N, 4.26. Found: C, 54.46; H, 3.17; N, 4.03.
Example 19
7-Chloro-5-isopropylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 7: mp 168-169.degree.; Anal. Calcd. for C.sub.16 H.sub.16 NO.sub.2 F.sub.3 Cl: C, 58.72; H, 4.94; N, 4.29. Found: C, 58.68; H, 4.90; N, 4.29.
Example 20
trans-7-Chloro-5-(2-isopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 5: mp 148-149.degree.; HRMS: Calcd. for C.sub.15 H.sub.16 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 334.082166. Found: 334.081071.
Example 21
7-Methoxy-5-(3-methylbutyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 8: mp 123-130.degree.; Anal. Calcd. for C.sub.16 H.sub.20 NO.sub.3 F.sub.3 : C, 58.00; H, 6.08; N, 4.24. Found: C, 57.86; H, 5.95; N, 4.12.
Example 22
rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was obtained along with the title compound of Example 23 by a procedure similar to that of Example 7: mp 180-181.degree.; Anal. Calcd. for C.sub.17 H.sub.15 NO.sub.2 F.sub.3 Cl: C, 57.07; H, 4.24; N, 3.93. Found: C, 56.85; H, 4.04; N, 3.95.
Example 23
rel-(3R,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was obtained along with the title compound of Example 22 by a procedure similar to that of Example 7: mp 129-130.degree.; HRMS. Calcd. for C.sub.17 H.sub.15 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 358.082166. Found: 358.081980.
Example 24
7-Chloro-5-(3-pyridylethynyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 11 except that sodium hydride rather than cesium carbonate was the base used in the final reaction step: mp 219-221.degree.; HRMS: Calcd. for C.sub.17 H.sub.11 N.sub.2 O.sub.2 F.sub.3 Cl (M+H).sup.+ : 367.046115. Found: 367.046761.
Example 25
trans-7-Chloro-5-(3-pyrid-3-ylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 9 except that sodium hydride rather than cesium carbonate was the base used in the final reaction step: mp 199-201.degree.; HRMS: Calcd for C.sub.17 H.sub.13 N.sub.2 O.sub.2 F.sub.3 Cl (M+H).sup.+ : 369.061765. Found: 369.060918.
Example 26
trans-7-Fluoro-5-(2-isopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 5: mp 145-156.degree..
Example 27
trans-6,7-Difluoro-5-(2-isopropylethenyl)-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepered in a manner similar to the product of Example 5: mp 159-160.degree.; HRMS: Calcd. for C.sub.15 H.sub.15 NO.sub.2 F.sub.5 (M+H).sup.+ : 336.102295. Found: 336.102028.
Example 28
rel-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 14: mp :169-174.degree.; HRMS: Calcd. for C.sub.16 H.sub.3 NO.sub.2 F.sub.3 Cl (M.sup.+): 343.058691. Found: 343.057486.
Example 29
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a stirred ice-cooled solution of 987 mg of trans-6-amino-3-chloro-.alpha.-cyclopropyletheayl-.alpha.-(trifluoromethyl)benzyl alcohol (from Example 5, Part B) in 50 mL of dry ether was added 0.350 mL of dry pyridine aid 1.66 g of .alpha.-bromopropionyl bromide. The cooling bath was removed and then after 30 min at ambient temperature, the reacation mixture was diluted with ether, washed with water and aqueous sodium bicarbonate, dried and evaporated. The residte was dissolved in 50 mL of dry DMF, 2.35 g of lithium iodide and 2.3 g of cesium carbonate was added, and the resulting heterogeneous mixture was stirred at room temperature for 3 days. The reaction mixture was then poured onto water and extracted twice with ether. The combined extracts were washed with water and brine, dried and evaporated to crude product. The title compound was obtained by crystallization from ethyl acetate/hexanes, and recrystallization from ethyl acetate afforded 650 mg of pure title corpound: mp 171-172.degree.; HRMS: Calcd. for C.sub.16 H.sub.168 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 346.082166. Found: 346.080681: mp 147-147.5.degree.; HRMS: Calcd. for C.sub.17 H.sub.18 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 360.097816. Found: 360.097869
Example 30
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-propyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 29: mp 165-167.degree.; HRMS: Calcd. for C.sub.18 H.sub.19 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 374.113467. Found: 374.114742.
Example 31
rel-(3S,5S)-7-Chloro-5-(3-furanylethynyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 11 except that cesium carbonate/lithium iodide rather than sodium hydride was used in the final reaction step: mp 214-215.degree..
Example 32
rel-(3S,5S)-7-Chloro-5-(3-furanylethynyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 11 except that cesium carbonate/lithium iodide rather than sodium hydride was used in the final reaction step: mp 169-170.degree.; HRMS: Calcd. for C.sub.18 H.sub.14 NO.sub.3 F.sub.3 Cl (M+H).sup.+ : 384.061431. Found: 384.058632.
Example 33
rel-(3S,5S)-6,7-Difluoro-5-cyclopropylethynyl-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepered in a manner similar to the product of Example 14: mp 219-220.degree..
Example 34
rel-(3S,5S)-6,7-Difluoro-5-cyclopropylethynyl-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 14: mp 180.4-181.4.degree..
Example 35
rel-(3S,5S)-trans-6,7-Difluoro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound was prepared in a manner similar to the product of Example 6 except that cesium carbonate/lithium iodide rather than sodium hydride was used in the final reaction step: mp 192-193.degree.; HRMS: Calcd. for C.sub.16 H.sub.15 NO.sub.2 F.sub.5 (M+H).sup.+ : 348.102295. Found: 343.102515.
Example 36
(+)-(3S,5S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared from the product of Example 28 in a manner similar to the procedure described in Example 4: mp 145-146.degree.; Anal. Calcd. for C.sub.16 H.sub.13 NO.sub.2 F.sub.3 Cl C, 55.91; H, 3.81; N, 4.07. Found: C, 55.80; H, 3.75; N, 3.88. [.alpha.].sup.25 +94.200.
Example 37
(3S)-7-Chloro-5-cyclopropylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared from the product of Example 18 in a manner similar to the procedure described in Example 4: mp 135-136.degree.; Anal. Calcd. for C.sub.15 H.sub.11 NO.sub.2 F.sub.3 Cl C, 54.64; H, 3.36; N, 4.26. Found: C, 54.69; H, 3.17; N, 4.00.
Example 38
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 29: mp 147-147.5.degree.; HRMS: Calcd. for C.sub.17 H.sub.18 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 360.097816. Found: 360.097869
Example 39
(+)-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared from the product of Example 29 in a manner similar to the procedure described in Example 4: mp 175-175.5.degree.; Anal. Calcd. for C.sub.16 H.sub.15 NO.sub.2 F.sub.3 Cl C, 55.58; H, 4.37; N, 4.05. Found: C, 55.38; H, 4.21; N, 3.83. [.alpha.].sup.25 +61.7.degree..
Example 40
(+)-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared from the product of Example 38 in a manner similar to the procedure described in Example 4: mp 163-164.degree.; [.alpha.].sup.25 +22.70.
Example 41
rel-(3S,5S)-7-Chloro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of 1-(5-Chloro-2-(4-methoxyphenyl)methylamino)phenyl-2,2,2-trifluoroethanone
A mixture of 6.0 g of 1-(2-amino-5-chlorophenyl)-2,2,2-trifluoroethanone, 3.84 mL of 4methoxybenzyl alcohol, 114 mg of p-toluensulfonic acid, and 25 mL of dry acetonitrile was heated at 80.degree. for 3.5 hr. An additional 0.5 g of 4-methoxybenzyl alcohol was added and heating was continued for another 2 hr. The cooled solutexon was diluted with ethyl acetate, washed with aqueous sodium bicarbonate, water, and brine, dried and evaporated . This material was subjected to column chromatography over silica gel (elution with 5-10% ethyl acetate in hexanes) affording 8.2 g of 1-(5-chloro-2-(4-methoxyphenyl)methylamino)phenyl-2,2,2-trifluoroethanone as a yellow solid.
Part B: Preparation of 3-Chloro-6-(4-methoxyphenyl)methylamino-.alpha.-cyclopropylethynyl-.alpha.-(trifluoromethyl)benzyl alcohol
To an ice-cooled solution of 3.92 g (59.6 mmol) of cyclopropylacetylene in 100 mL of dry THF was added dropwise over 5 min, 33.0 mL (52.4 mmol) of 1.6 M n-butyllithium. The reaction mixture was allowed to stir at 0.degree. for 30 min after which time it was cooled to -40.degree. and a solution of 8.20 g (23.85 mmol) of 1-(5-chloro-2-(4-methoxyphenyl)methylamino)phenyl-2,2,2-trifluoroethanone in 20 mL of dry THF was added dropwise over 5 min. The reaction mixture was stirred at -40.degree. for 2.0 h after which time it was quenched with saturated aqueous ammonium chloride and poured onto water. This mixture was extracted twice with ether and the combined extracts were washed with brine, dried, and evaporated to an oil. This material was subjected to column chromatography over silica gel (elution with 5-20% ethyl acetate in hexanes) affording 6.0 g of the title compound as a solid.
Part C: 3-(2-Bromoethyl)-7-chloro-5-cyclopropylethynyl-1,5-dihydro-1-(4-methoxybenzyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a solution of 1.64 g of 3-chloro-6-(4-methoxyphenyl)methylamino-.alpha.-cyclopropylethynyl-.alpha.-(trifluoromethyl)benzyl alcohol and 2.0 mL of diisopropylethylamine in 30 mL of dry methylene chloride was added 1.6 g of 2,4-dibromobutyryl chloride. After stirring at room temperature overnight, the mixture was poured onto water and extracted with ether. The ether layer was washed with aqueous sodium bicarbonate, dried, and evaporated to an oil. This material was subjected to column chromatography over silica gel (elution with 5-10% ethyl acetate in hexanes) affording 1.13 g of the title compound as a mixture of diastereomers.
Part D: rel-(3S,5S)-3-(2-Bromoethyl)-7-chloro-5-cyclopropylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a room temperature solution of 1.13 g of 3-(2-bromoethyl)-7-chloro-5-cycloproprolethynyl-1,5-dihydro-1,5-(4-methoxybenzyl)-5-(trifluoromethy )-4,1-benzoxazepin-2(3H)-one in 50 mL of acetonitrile was added 25 mL of water and 5.7 g of ceric ammonium nitrate. After 30 min, the reaction mixture was partitioned between water and ether, and the organic layer was washed with aqueous bicarbonate and brine, dried and evaporated. This produced two diastereomeric products which were separated by column chromatography over silica gel (elution with 10-25% ethyl acetate in hexanes). The first diastereomer eluted (270 mg) was the title compound.
Part E: rel-(3S,5S)-7-Chloro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a room temperature solution of 409 mg (1.8 mmol) of 2-nitrophenylselenocyanate in 5.0 mL of THF was added 16 mL of ethanol and 90 mg of sodium borohydride. After stirring 1 h, a solution of 260 mg of rel-3S,5S)-3-(2-Bromoethyl)-7-chloro-5-cyclopropylethynyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one in 1.5 mL of dry THF and 8 mL of ethanol was added, and the resulting mixture was stirred at ambient temperature for 2 h, at which time an additional 20 mg of sodium borohydride was added and stirring was continued for an additional 2 h. The reaction mixture was partitioned between water and ether, and the organic layer was washed with aqueous bicarbonate and brine, dried and evaporated. The crude product was purified by column chromatography over silica gel (elution with 10-25% ethyl acetate in hexanes) to give 130 mg of the title compound as a pure solid: HRMS: Calcd. for C.sub.17 H.sub.14 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 354.0508. Found: 354.0487.
Example 42
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
Part A: Preparation of trans-3-Chloro-6-(4-methoxyphenyl)methylamino-.alpha.-cyclopropylethenyl-.alpha.-(trifluoromethyl)benzyl alcohol
To a solution of 1.23 g of 3-chloro-6-(4-methoxyphenyl)methylamino-.alpha.-cyclopropylethynyl-.alpha.-(trifluoromethyl)benzyl alcohol from Example 41, Part B) in 12 mL of dry THF was added 15 mL of a 1M solution of lithium aluminum hydride in THF. The reaction mixture was stirred at ambient temperature for 3 days after which time it was quenched by the dropwise addition of 1.1 mL of concentrated aqueous ammonium hydroxide. This mixture was poured onto water and extracted with ether. The extracts were washed with brine, dried and evaporated to afford 1.15 g of the title compound as a pure oil.
Part B: trans-3-(2-Bromoethyl)-7-chloro-5-cyclopropylethenyl-1,5-dihydro-1-(4-methoxybenzyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a solution of 1.65 g of trans-3-chloro-6-(4-methoxyphenyl)methylamino-.alpha.-cyclopropylethenyl-.alpha.-(trifluoromethyl)benzyl alcohol and 2.0 mL of diisopropylethylamine in 30 mL of dry methylene chloride was added 1.6 g of 2,4-dibromobutyryl chloride. After stirring at room temperature overnight, the mixture was poured onto water and extracted with ether. The ether layer was washed with aqueous sodium bicarbonate, dried and evaporated to an oil. This material was subjected to column chromatography over silica gel (elution with 5-33% ethyl acetate in hexanes) affording the title compound. A later eluting fraction (160 mg) proved to be uncyclized material, This was combined with 300 mg of cesium carbonate in 4 mL of DMF and stirred overnight at room temperature. The reaction mixture was poured onto water and extracted with ether. the organic layer was washed with brine, dried and evaporated to give when combined with the product obtained from the column chromatography 750 mg of the title compound as a mixture of diastereomers.
Part C: rel-(3S,5S)-trans-3-(2-Bromoethyl)-7-chloro-5-cyclopropylethenyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a room temperature solution of 750 mg of trans-3-(2-bromoethyl)-7-chloro-5-cyclopropylethenyl-1,5-dihydro-1-(4-methoxybenzyl)-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one in 35 mL of acetonitrile was added 18 mL of water and 3.78 g of ceric ammonium nitrate. After 20 min, the reaction mixture was partitioned between eater and ether, and the organic layer was washed with aqueous bicarbonate and brine, dried and evaporated. This produced two diastereomeric products which were separated by column chromatography over silica gel (elution with 10-25% ethyl acetate in hexanes). The first diastereomer eluted (162 mg) was the title compound.
Part D: rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a room temperature solution of 238 mg (1.05 mmol) of 2-nitrophenylselenocyanate in 3.0 mL of THF was added 9 mL of ethanol and 66 mg of sodium borchydride. After stirring 1.5 h, a solution of 153 mg of rel-(3S,5S)-trans-3-(2-bromoethyl)-7-chloro-5-cyclopropylethenyl-1,5-dihydro-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one in 1.5 mL of dry THF and 5 mL of ethanol was added, and the resulting mixture was stirred at ambient temperature for 32 h. The reaction mixture was partitioned between water and ether, and the organic layer was washed with aqueous bicarbonate and brine, dried and evaporated. The crude product was purified by column chromatography over silica gel (elution with 10-25% ethyl acetate in hexanes) to give 73 mg of the title compound as a pure solid which can be recrystallized from ethanol-hexanes: mp 165.5-166.5.degree.; HRMS Calcd. for C.sub.17 H.sub.16 NO.sub.2 F.sub.3 Cl (M+H).sup.+ : 358.082166. Found: 358.081658.
Example 43
rel-(3S,5S)-7-Chloro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-cyclopropyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a solution of 71 mg of rel-(3S,5S)-7-chloro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one (from Example 41) in 7.5 mL of anhydrous ether was added first 4 mg of palladium (II) acetate and then a solution of approximately 1.23 mmol of diazomethane in 3.5 mL of ether. After stirring 30 min at room temperature, the reaction mixture was filtered through a pad of filter-aid and the filtrate was evaporated to dryness. The crude product was purified by column chromatography over silica gel (elution with methylene chloride) to give 65 mg of the title compound as a pure solid was recrystallized from ether-hexanes to afford 36 mg: mp 192-192.50; HRMS: Calcd. for C.sub.18 H.sub.14 NO.sub.2 F.sub.3 Cl (M-H).sup.- : 368.0665. Found: 368.0657.
Example 44
rel-(3S,5S)-trans-7-Chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-cyclopropyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
To a solution of 73 mg of rel-(3S,5S)-trans-7-chloro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one (from Example 42) in 7.5 mL of anhydrous ether was added first 4 mg of palladium (II) acetate and then a solution of approximately 1.23 mmol of diazomethane in 3.5 mL of ether. After stirring 30 min at room temperature, the reaction mixture was filtered through a pad of filter-aid and he filtrate was evaporated to dryness. The crude product was purified by column chromatography over silica gel (elution with methylene chloride) to give 47 mg of the title compound as a pure solid was recrystallized from ether-hexanes to afford 31 mg: mp 143-144.degree.; HRMS: Calcd. for C.sub.18 H.sub.16 NO.sub.2 F.sub.3 Cl (M-H).sup.- : 370.0822. Found: 370.0801.
Example 45
rel-(3S,5S)-6,7-Difluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 41: mp 171-172.degree.; HRMS: Calcd. for C.sub.17 H.sub.13 NO.sub.2 F.sub.5 (M+H).sup.+ : 358.0866. Found: 358.0881.
Example 46
rel-(3S,5S)-6,7-Difluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-cyclopropyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared from the product of Example 45 in a manner similar to the procedure described in Example 43: mp 222-222.5.degree.; HRMS Calcd. for C.sub.18 H.sub.15 NO.sub.2 F.sub.5 (M+H).sup.+ : 373.1023. Found: 372.1013.
Example 47
rel-(3S,5S)-7-Fluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethenyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 41: Calcd. for C.sub.17 H.sub.12 NO.sub.2 F.sub.4 (M-H).sup.- : 338.0804. Found: 338.0815.
Example 48
rel-(3S,5S)-7-Fluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 14: mp 184-185.degree.; HRMS: Calcd. for C.sub.16 H.sub.14 NO.sub.2 F.sub.4 (M+H).sup.+ : 328.0961. Found: 328.0955.
Example 49
rel-(3S,5S)-7-Fluoro-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 14: mp 186.degree.; Anal. Calcd. for C.sub.17 H.sub.15 NO.sub.2 F.sub.4 : C, 59.83; H, 4,43; N. 4.10. Found: C, 59.56; H. 4.37; N, 4.02.
Example 50
rel-(3S,5S)-trans-7-Fluoro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 29: mp 180-182.degree.; HRMS: Calcd. for C.sub.16 H.sub.16 NO.sub.2 F.sub.4 (M+H).sup.+ : 330.1117. Found: 330.1118.
Example 51
rel-(3S,5S)-trans-7-Fluoro-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 29: mp 148-149.degree.; HRMS: Calcd. for C.sub.17 H.sub.183 NO.sub.2 F.sub.4 (M+H).sup.+ : 344.1274. Found: 344.1265.
Example 52
rel-(3S,5S)-6,7-Methylenedioxy-5-(2-cyclopropylethynyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 14: mp 252-253.degree..
Example 53
rel-(3S,5S)-6,7-Methylenedioxy-5-(2-cyclopropylethynyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 14: mp 201-202.degree.; HRMS: Calcd. for C.sub.18 H.sub.17 NO.sub.4 F.sub.3 (M.sup.+): 367.1031. Found: 367.1041.
Example 54
rel-(3S,5S)-trans-6,7-Methylenedioxy-5-(2-cyclopropylethenyl)-1,5-dihydro-3-methyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 29: mp 236-237.degree.; HRMS: Calcd. for C.sub.17 H.sub.17 NO.sub.4 F.sub.3 (M+H).sup.+ : 356.1110. Found: 356.1110.
Example 55
rel-(3S,5S)-trans-6,7-Methylenedioxy-5-(2-cyclopropylethenyl)-1,5-dihydro-3-ethyl-5-(trifluoromethyl)-4,1-benzoxazepin-2(3H)-one
The title compound can be prepared in a manner similar to the procedure described in Example 29: mp 188-190.degree.; HRMS: Calcd. for C.sub.18 H.sub.19 NO.sub.4 F.sub.3 (M+H).sup.+ : 370.1267. Found: 370.1269.
TABLE 1__________________________________________________________________________ #STR42## -Ex. # G R.sup.2 R.sup.a m.p. (.degree. C.) Mass Spec__________________________________________________________________________ 1 7-Cl C.tbd.C-Et H 167-168 2 7-Cl (S)-C.tbd.C-Et (S)-Ph 198-199 394.08 3 7-Cl C.tbd.C-iPr H 183-183.5 332.07 4 (+) 7-Cl (S)-C.tbd.C-iPr H 135-136 5 7-Cl trans-C.dbd.C-cycPr H 157-158 332.06 6 7-Cl trans-C.dbd.C-cycPr (S)-CH.sub.3 171-172 346.08 7 7-F C.tbd.C-iPr H 172-173 8 7-F 3-methylbutyl H 320.13 9 7-Cl (S)-trans-C.dbd.C-2-furan (S)-CH.sub.3 205-206.5 10 7-Cl trans-C.dbd.C-2-furan H 199-200 11 7-Cl (S)-C.tbd.C-2-furan (S)-CH.sub.3 369.04 12 7-Cl butyl H 322.08 13 6,7-diF C.tbd.C-iPr H 192.5-193.5 334.08 14a 7-Cl (S)-C.tbd.C-cycPr (S)-CH.sub.3 191-92 14b 7-Cl (S)-C.tbd.C-cycPr (R)-CH.sub.3 141 372.10 15 7-Cl (S)-C.tbd.C-CycPr (S)-iPr 167 16 7-Cl C.tbd.C-Ph H 190-191 17 7-Cl (S)-C.tbd.C-iPr (S)-CH.sub.3 181-182.8 18 7-Cl C.tbd.C-cycPr H 199.5-200.5 19 7-Cl C.tbd.C-iPr H 168-169 20 7-Cl trans-C.dbd.C-cycPr H 148-149 21 7-CH.sub.3 O C.tbd.C-cycPr H 129-130 22 7-Cl (S)-C.tbd.C-cycPr (S)-Et 180-181 23 7-Cl (S)-C.tbd.C-cycPr (R)-Et 129-130 358.08 24 7-Cl C.tbd.C-3-pyridyl H 219-221 367.05 25 7-Cl trans-C.dbd.C-3-pyridyl H 199-201 369.06 26 7-F trans-C.dbd.C-iPr H 145-156 27 6,7-F trans-C.dbd.C-iPr H 159-160 336.10 28 7-Cl (S)-C.tbd.C-cycPr (S)-CH.sub.3 169-174 343.06 29 7-Cl (S)-trans-C.dbd.C-cycPr (S)-CH.sub.3 147-147.5 360.10 30 7-Cl (S)-trans-C.dbd.C-cycPr (S)-Pr 165-167 374.11 31 7-Cl (S)-C.tbd.C-3-furan (S)-CH.sub.3 214-215 32 7-Cl (S)-C.tbd.C-3-furan (S)-Et 169-170 384.06 33 6,7-F (S)-C.tbd.C-cycPr (S)-CH.sub.3 219-220 34 6,7-F (S)-C.tbd.C-cycPr (S)-Et 180.4-181.4 35 6,7-F (S)-C.tbd.C-cycPr (S)-CH.sub.3 192-193 348.10 36 (+) 7-Cl (S)-C.tbd.C-cycPr (S)-CH.sub.3 145-146 37 7-Cl (S)-C.tbd.C-cycPr H 135-136 38 7-Cl (S)-trans-C.dbd.C-cycPr (S)-Et 147-147.5 360.10 39 (+) 7-Cl (S)-trans-C.dbd.C-cycPr (S)-CH.sub.3 175-175.5 40 (+) 7-Cl (S)-trans-C.dbd.C-cycPr (S)-Et 163-164 41 7-Cl (S)-C.tbd.C-cycPr (S)-CH.dbd.CH.sub.2 354.05 42 7-Cl (S)-trans-C.dbd.C-cycPr (S)-CH.dbd.CH.sub.2 165.5-166.5 358.08 43 7-Cl (S)-C.tbd.C-cycPr (S)-cycPr 192-192.5 368.07 44 7-Cl (S)-trans-C.dbd.C-cycPr (S)-cycPr 143-144 370.08 45 6,7-F (S)-C.tbd.C-cycPr (S)-CH.dbd.CH.sub.2 171-172 358.09 46 6,7-F (S)-C.tbd.C-cycPr (S)-cycPr 222-222.5 372.10 47 7-F (S)-C.tbd.C-cycPr (S)-CH.dbd.CH.sub.2 338.08 48 7-F (S)-C.tbd.C-cycPr (S)-CH.sub.3 184-185 328.10 49 7-F (S)-C.tbd.C-cycPr (S)-Et 186 50 7-F (S)-trans-C.dbd.C-cycPr (S)-CH.sub.3 180-182 330.11 51 7-F (S)-trans-C.dbd.C-cycPr (S)-Et 148-149 344.13 52 6,7-(CH.sub.2).sub.2 O (S)-C.tbd.C-cycPr (S)-CH.sub.3 252-252 53 6,7-(CH.sub.2).sub.2 O (S)-C.tbd.C-c ycPr (S)-Et 201-202 367.10 54 6,7-(CH.sub.2).sub.2 O (S)-trans-C.dbd.C-cycPr (S)-CH.sub.3 236-237 356.11 55 6,7-(CH.sub.2).sub.2 O (S)-trans-C.dbd.C-cycPr (S)-Et 188-190__________________________________________________________________________ 370.13 *Unless otherwise noted, stereochemistry is (+/-).
Tables 2 and 3 show representative compounds of the present invention. Each formula shown at the start of Table 2 and 3 is intended to be paired with each entry in the table which follows.
TABLE 2______________________________________ #STR43## #STR44## #STR45## #STR46## #STR47## #STR48## #STR49## #STR50## #STR51## - Ex. # G R.sup.1 R.sup.2______________________________________201 6-Cl CF.sub.3 n-butyl 202 6-Cl CF.sub.3 C.tbd.C-Et 203 6-Cl CF.sub.3 C.tbd.C-iPr 204 6-Cl CF.sub.3 C.tbd.C-cycPr 205 6-Cl CF.sub.3 C.tbd.C-2-pyridyl 206 6-Cl CF.sub.3 C.tbd.C-3-pyridyl 207 6-Cl CF.sub.3 C.tbd.C-2-furanyl 208 6-Cl CF.sub.3 C.tbd.C-3-furanyl 209 6-Cl CF.sub.3 C.tbd.C-2-thienyl 210 6-Cl CF.sub.3 C.tbd.C-3-thienyl 211 6-Cl CF.sub.3 CH.dbd.CH-Et 212 6-Cl CF.sub.3 CH.dbd.CH-iPr 213 6-Cl CF.sub.3 CH.dbd.CH-cycPr 214 6-Cl CF.sub.3 CH.dbd.CH-2-pyridyl 215 6-Cl CF.sub.3 CH.dbd.CH-3-pyridyl 216 6-Cl CF.sub.3 CH.dbd.CH-2-furanyl 217 6-Cl CF.sub.3 CH.dbd.CH-3-furanyl 218 6-Cl CF.sub.3 CH.dbd.CH-2-thienyl 219 6-Cl CF.sub.3 CH.dbd.CH-3-thienyl 220 6-Cl CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 221 6-Cl CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 222 6-Cl CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 223 6-Cl CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 224 6-Cl CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 225 6-Cl CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 226 7-Cl CF.sub.3 n-butyl 227 7-Cl CF.sub.3 C.tbd.C-Et 228 7-Cl CF.sub.3 C.tbd.C-iPr 229 7-Cl CF.sub.3 C.tbd.C-cycPr 230 7-Cl CF.sub.3 C.tbd.C-2-pyridyl 231 7-Cl CF.sub.3 C.tbd.C-3-pyridyl 232 7-Cl CF.sub.3 C.tbd.C-2-furanyl 233 7-Cl CF.sub.3 C.tbd.C-3-furanyl 234 7-Cl CF.sub.3 C.tbd.C-2-thienyl 235 7-Cl CF.sub.3 C.tbd.C-3-thienyl 236 7-Cl CF.sub.3 CH.dbd.CH-Et 237 7-Cl CF.sub.3 CH.dbd.CH-iPr 238 7-Cl CF.sub.3 CH.dbd.CH-cycPr 239 7-Cl CF.sub.3 CH.dbd.CH-2-pyridyl 240 7-Cl CF.sub.3 CH.dbd.CH-3-pyridyl 241 7-Cl CF.sub.3 CH.dbd.CH-2-furanyl 242 7-Cl CF.sub.3 CH.dbd.CH-3-furanyl 243 7-Cl CF.sub.3 CH.dbd.CH-2-thienyl 244 7-Cl CF.sub.3 CH.dbd.CH-3-thienyl 245 7-Cl CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 246 7-Cl CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 247 7-Cl CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 248 7-Cl CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 249 7-Cl CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 250 7-Cl CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 251 6-F CF.sub.3 n-butyl 252 6-F CF.sub.3 C.tbd.C-Et 253 6-F CF.sub.3 C.tbd.C-iPr 254 6-F CF.sub.3 C.tbd.C-cycPr 255 6-F CF.sub.3 C.tbd.C-2-pyridyl 256 6-F CF.sub.3 C.tbd.C-3-pyridyl 257 6-F CF.sub.3 C.tbd.C-2-furanyl 258 6-F CF.sub.3 C.tbd.C-3-furanyl 259 6-F CF.sub.3 C.tbd.C-2-thienyl 260 6-F CF.sub.3 C.tbd.C-3-thienyl 261 6-F CF.sub.3 CH.dbd.CH-Et 262 6-F CF.sub.3 CH.dbd.CH-iPr 263 6-F CF.sub.3 CH.dbd.CH-cycPr 264 6-F CF.sub.3 CH.dbd.CH-2-pyridyl 265 6-F CF.sub.3 CH.dbd.CH-3-pyridyl 266 6-F CF.sub.3 CH.dbd.CH-2-furanyl 267 6-F CF.sub.3 CH.dbd.CH-3-furanyl 268 6-F CF.sub.3 CH.dbd.CH-2-thienyl 269 6-F CF.sub.3 CH.dbd.CH-3-thienyl 270 6-F CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 271 6-F CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 272 6-F CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 273 6-F CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 274 6-F CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 275 6-F CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 276 7-F CF.sub.3 n-butyl 277 7-F CF.sub.3 C.tbd.C-Et 278 7-F CF.sub.3 C.tbd.C-iPr 279 7-F CF.sub.3 C.tbd.C-cycPr 280 7-F CF.sub.3 C.tbd.C-2-pyridyl 281 7-F CF.sub.3 C.tbd.C-3-pyridyl 282 7-F CF.sub.3 C.tbd.C-2-furanyl 283 7-F CF.sub.3 C.tbd.C-3-furanyl 284 7-F CF.sub.3 C.tbd.C-2-thienyl 285 7-F CF.sub.3 C.tbd.C-3-thienyl 286 7-F CF.sub.3 CH.dbd.CH-Et 287 7-F CF.sub.3 CH.dbd.CH-iPr 288 7-F CF.sub.3 CH.dbd.CH-cycPr 289 7-F CF.sub.3 CH.dbd.CH-2-pyridyl 290 7-F CF.sub.3 CH.dbd.CH-3-pyridyl 291 7-F CF.sub.3 CH.dbd.CH-2-furanyl 292 7-F CF.sub.3 CH.dbd.CH-3-furanyl 293 7-F CF.sub.3 CH.dbd.CH-2-thienyl 294 7-F CF.sub.3 CH.dbd.CH-3-thienyl 295 7-F CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 296 7-F CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 297 7-F CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 298 7-F CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 299 7-F CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 300 7-F CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 301 6,7-diCl CF.sub.3 n-butyl 302 6,7-diCl CF.sub.3 C.tbd.C-Et 303 6,7-diCl CF.sub.3 C.tbd.C-iPr 304 6,7-diCl CF.sub.3 C.tbd.C-cycPr 305 6,7-diCl CF.sub.3 C.tbd.C-2-pyridyl 306 6,7-diCl CF.sub.3 C.tbd.C-3-pyridyl 307 6,7-diCl CF.sub.3 C.tbd.C-2-furanyl 308 6,7-diCl CF.sub.3 C.tbd.C-3-furanyl 309 6,7-diCl CF.sub.3 C.tbd.C-2-thienyl 310 6,7-diCl CF.sub.3 C.tbd.C-3-thienyl 311 6,7-diCl CF.sub.3 CH.dbd.CH-Et 312 6,7-diCl CF.sub.3 CH.dbd.CH-iPr 313 6,7-diCl CF.sub.3 CH.dbd.CH-cycPr 314 6,7-diCl CF.sub.3 CH.dbd.CH-2-pyridyl 315 6,7-diCl CF.sub.3 CH.dbd.CH-3-pyridyl 316 6,7-diCl CF.sub.3 CH.dbd.CH-2-furanyl 317 6,7-diCl CF.sub.3 CH.dbd.CH-3-furanyl 318 6,7-diCl CF.sub.3 CH.dbd.CH-2-thienyl 319 6,7-diCl CF.sub.3 CH.dbd.CH-3-thienyl 320 6,7-diCl CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 321 6,7-diCl CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 322 6,7-diCl CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 323 6,7-diCl CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 324 6,7-diCl CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 325 6,7-diCl CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 326 6,7-diF CF.sub.3 n-butyl 327 6,7-diF CF.sub.3 C.tbd.C-Et 328 6,7-diF CF.sub.3 C.tbd.C-iPr 329 6,7-diF CF.sub.3 C.tbd.C-cycPr 330 6,7-diF CF.sub.3 C.tbd.C-2-pyridyl 331 6,7-diF CF.sub.3 C.tbd.C-3-pyridyl 332 6,7-diF CF.sub.3 C.tbd.C-2-furanyl 333 6,7-diF CF.sub.3 C.tbd.C-3-furanyl 334 6,7-diF CF.sub.3 C.tbd.C-2-thienyl 335 6,7-diF CF.sub.3 C.tbd.C-3-thienyl 336 6,7-diF CF.sub.3 CH.dbd.CH-Et 337 6,7-diF CF.sub.3 CH.dbd.CH-iPr 338 6,7-diF CF.sub.3 CH.dbd.CH-cycPr 339 6,7-diF CF.sub.3 CH.dbd.CH-2-pyridyl 340 6,7-diF CF.sub.3 CH.dbd.CH-3-pyridyl 341 6,7-diF CF.sub.3 CH.dbd.CH-2-furanyl 342 6,7-diF CF.sub.3 CH.dbd.CH-3-furanyl 343 6,7-diF CF.sub.3 CH.dbd.CH-2-thienyl 344 6,7-diF CF.sub.3 CH.dbd.CH-3-thienyl 345 6,7-diF CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 346 6,7-diF CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 347 6,7-diF CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 348 6,7-diF CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 349 6,7-diF CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 350 6,7-diF CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 351 6-Cl, 7-F CF.sub.3 n-butyl 352 6-Cl, 7-F CF.sub.3 C.tbd.C-Et 353 6-Cl, 7-F CF.sub.3 C.tbd.C-iPr 354 6-Cl, 7-F CF.sub.3 C.tbd.C-cycPr 355 6-Cl, 7-F CF.sub.3 C.tbd.C-2-pyridyl 356 6-Cl, 7-F CF.sub.3 C.tbd.C-3-pyridyl 357 6-Cl, 7-F CF.sub.3 C.tbd.C-2-furanyl 358 6-Cl, 7-F CF.sub.3 C.tbd.C-3-furanyl 359 6-Cl, 7-F CF.sub.3 C.tbd.C-2-thienyl 360 6-Cl, 7-F CF.sub.3 C.tbd.C-3-thienyl 361 6-Cl, 7-F CF.sub.3 CH.dbd.CH-Et 362 6-Cl, 7-F CF.sub.3 CH.dbd.CH-iPr 363 6-Cl, 7-F CF.sub.3 CH.dbd.CH-cycPr 364 6-Cl, 7-F CF.sub.3 CH.dbd.CH-2-pyridyl 365 6-Cl, 7-F CF.sub.3 CH.dbd.CH-3-pyridyl 366 6-Cl, 7-F CF.sub.3 CH.dbd.CH-2-furanyl 367 6-Cl, 7-F CF.sub.3 CH.dbd.CH-3-furanyl 368 6-Cl, 7-F CF.sub.3 CH.dbd.CH-2-thienyl 369 6-Cl, 7-F CF.sub.3 CH.dbd.CH-3-thienyl 370 6-Cl, 7-F CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 371 6-Cl, 7-F CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 372 6-Cl, 7-F CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 373 6-Cl, 7-F CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 374 6-Cl, 7-F CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 375 6-Cl, 7-F CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 376 6-F, 7-Cl CF.sub.3 n-butyl 377 6-F, 7-Cl CF.sub.3 C.tbd.C-Et 378 6-F, 7-Cl CF.sub.3 C.tbd.C-iPr 379 6-F, 7-Cl CF.sub.3 C.tbd.C-cycPr 380 6-F, 7-Cl CF.sub.3 C.tbd.C-2-pyridyl 381 6-F, 7-Cl CF.sub.3 C.tbd.C-3-pyridyl 382 6-F, 7-Cl CF.sub.3 C.tbd.C-2-furanyl 383 6-F, 7-Cl CF.sub.3 C.tbd.C-3-furanyl 384 6-F, 7-Cl CF.sub.3 C.tbd.C-2-thienyl 385 6-F, 7-Cl CF.sub.3 C.tbd.C-3-thienyl 386 6-F, 7-Cl CF.sub.3 CH.dbd.CH-Et 387 6-F, 7-Cl CF.sub.3 CH.dbd.CH-iPr 388 6-F, 7-Cl CF.sub.3 CH.dbd.CH-cycPr 389 6-F, 7-Cl CF.sub.3 CH.dbd.CH-2-pyridyl 390 6-F, 7-Cl CF.sub.3 CH.dbd.CH-3-pyridyl 391 6-F, 7-Cl CF.sub.3 CH.dbd.CH-2-furanyl 392 6-F, 7-Cl CF.sub.3 CH.dbd.CH-3-furanyl 393 6-F, 7-Cl CF.sub.3 CH.dbd.CH-2-thienyl 394 6-F, 7-Cl CF.sub.3 CH.dbd.CH-3-thienyl 395 6-F, 7-Cl CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 396 6-F, 7-Cl CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 397 6-F, 7-Cl CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 398 6-F, 7-Cl CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 399 6-F, 7-Cl CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 400 6-F, 7-Cl CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 401 7-CH.sub.3 CF.sub.3 n-butyl 402 7-CH.sub.3 CF.sub.3 C.tbd.C-Et 403 7-CH.sub.3 CF.sub.3 C.tbd.C-iPr 404 7-CH.sub.3 CF.sub.3 C.tbd.C-cycPr 405 7-CH.sub.3 CF.sub.3 C.tbd.C-2-pyridyl 406 7-CH.sub.3 CF.sub.3 C.tbd.C-3-pyridyl 407 7-CH.sub.3 CF.sub.3 C.tbd.C-2-furanyl 408 7-CH.sub.3 CF.sub.3 C.tbd.C-3-furanyl 409 7-CH.sub.3 CF.sub.3 C.tbd.C-2-thienyl 410 7-CH.sub.3 CF.sub.3 C.tbd.C-3-thienyl 411 7-CH.sub.3 CF.sub.3 CH.dbd.CH-Et 412 7-CH.sub.3 CF.sub.3 CH.dbd.CH-iPr 413 7-CH.sub.3 CF.sub.3 CH.dbd.CH-cycPr 414 7-CH.sub.3 CF.sub.3 CH.dbd.CH-2-pyridyl 415 7-CH.sub.3 CF.sub.3 CH.dbd.CH-3-pyridyl 416 7-CH.sub.3 CF.sub.3 CH.dbd.CH-2-furanyl 417 7-CH.sub.3 CF.sub.3 CH.dbd.CH-3-furanyi 418 7-CH.sub.3 CF.sub.3 CH.dbd.CH-2-thienyl 419 7-CH.sub.3 CF.sub.3 CH.dbd.CH-3-thienyl 420 7-CH.sub.3 CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 421 7-CH.sub.3 CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 422 7-CH.sub.3 CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 423 7-CH.sub.3 CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 424 7-CH.sub.3 CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 425 7-CH.sub.3 CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 426 7-OCH.sub.3 CF.sub.3 n-butyl 427 7-OCH.sub.3 CF.sub.3 C.tbd.C-Et 428 7-OCH.sub.3 CF.sub.3 C.tbd.C-iPr 429 7-OCH.sub.3 CF.sub.3 C.tbd.C-cycPr 430 7-OCH.sub.3 CF.sub.3 C.tbd.C-2-pyridyl 431 7-OCH.sub.3 CF.sub.3 C.tbd.C-3-pyrldyl 432 7-OCH.sub.3 CF.sub.3 C.tbd.C-2-furanyl 433 7-OCH.sub.3 CF.sub.3 C.tbd.C-3-furanyl 434 7-OCH.sub.3 CF.sub.3 C.tbd.C-2-thienyl 435 7-OCH.sub.3 CF.sub.3 C.tbd.C-3-thienyl 436 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-Et 437 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-iPr 438 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-cycPr 439 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-2-pyridyl 440 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-3-pyridyl 441 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-2-furanyl 442 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-3-furanyl 443 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-2-thienyl 444 7-OCH.sub.3 CF.sub.3 CH.dbd.CH-3-thienyl 445 7-OCH.sub.3 CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 446 7-OCH.sub.3 CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 447 7-OCH.sub.3 CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 448 7-OCH.sub.3 CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 449 7-OCH.sub.3 CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 450 7-OCH.sub.3 CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 451 7-pyrazol-6-yl CF.sub.3 n-butyl 452 7-pyrazol-6-yl CF.sub.3 C.tbd.C-Et 453 7-pyrazol-6-yl CF.sub.3 C.tbd.C-iPr 454 7-pyrazol-6-yl CF.sub.3 C.tbd.C-cycPr 455 7-pyrazol-6-yl CF.sub.3 C.tbd.C-2-pyridyl 456 7-pyrazol-6-yl CF.sub.3 C.tbd.C-3-pyridyl 457 7-pyrazol-6-yl CF.sub.3 C.tbd.C-2-furanyl 458 7-pyrazol-6-yl CF.sub.3 C.tbd.C-3-furanyl 459 7-pyrazol-6-yl CF.sub.3 C.tbd.C-2-thienyl 460 7-pyrazol-6-yl CF.sub.3 C.tbd.C-3-thienyl 461 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-Et 462 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-iPr 463 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-cycPr 464 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-2-pyridyl 465 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-3-pyridyl 466 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-2-furanyl 467 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-3-furanyl 468 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-2-thienyl 469 7-pyrazol-6-yl CF.sub.3 CH.dbd.CH-3-thienyl 470 7-pyrazol-6-yl CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 471 7-pyrazol-6-yl CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 472 7-pyrazol-6-yl CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 473 7-pyrazol-6-yl CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 474 7-pyrazol-6-yl CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 475 7-pyrazol-6-yl CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 476 6,7-OCH.sub.2 O-- CF.sub.3 n-butyl 477 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-Et 478 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-iPr 479 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-cycPr 480 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-2-pyridyl 481 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-3-pyridyl 482 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-2-furanyl 483 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-3-furanyl 484 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-2-thienyl 485 6,7-OCH.sub.2 O-- CF.sub.3 C.tbd.C-3-thienyl 486 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-Et 487 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-iPr 488 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-cycPr 489 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-2-pyridyl 490 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-3-pyridyl 491 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-2-furanyl 492 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-3-furanyl 493 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-2-thienyl 494 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CH-3-thienyl 495 6,7-OCH.sub.2 O-- CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 496 6,7-OCH.sub.2 O-- CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 497 6,7-OCH.sub.2 O-- CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 498 6,7-OCH.sub.2 O-- CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 499 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 500 6,7-OCH.sub.2 O-- CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 501 7-CONH.sub.2 CF.sub.3 n-butyl 502 7-CONH.sub.2 CF.sub.3 C.tbd.C-Et 503 7-CONH.sub.2 CF.sub.3 C.tbd.C-iPr 504 7-CONH.sub.2 CF.sub.3 C.tbd.C-cycPr 505 7-CONH.sub.2 CF.sub.3 C.tbd.C-2-pyridyl 506 7-CONH.sub.2 CF.sub.3 C.tbd.C-3-pyridyl 507 7-CONH.sub.2 CF.sub.3 C.tbd.C-2-furanyl 508 7-CONH.sub.2 CF.sub.3 C.tbd.C-3-furanyl 509 7-CONH.sub.2 CF.sub.3 C.tbd.C-2-thienyl 510 7-CONH.sub.2 CF.sub.3 C.tbd.C-3-thienyl 511 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-Et 512 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-iPr 513 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-cycPr 514 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-2-pyridyl 515 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-3-pyridyl 516 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-2-furanyl 517 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-3-furanyl 518 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-2-thienyl 519 7-CONH.sub.2 CF.sub.3 CH.dbd.CH-3-thienyl 520 7-CONH.sub.2 CF.sub.3 CH.sub.2 --C.tbd.C-cycPr 521 7-CONH.sub.2 CF.sub.3 CH.sub.2 --C.tbd.C-2-furanyl 522 7-CONH.sub.2 CF.sub.3 CH.sub.2 CH.dbd.CH-cycPr 523 7-CONH.sub.2 CF.sub.3 CH.sub.2 CH.dbd.CH-2-furanyl 524 7-CONH.sub.2 CF.sub.3 CH.dbd.CHCH.sub.2 -cycPr 525 7-CONH.sub.2 CF.sub.3 CH.dbd.CHCH.sub.2 -2-furanyl 526 6-Cl C.sub.2 F.sub.5 n-butyl 527 6-Cl C.sub.2 F.sub.5 C.tbd.C-Et 528 6-Cl C.sub.2 F.sub.5 C.tbd.C-iPr 529 6-Cl C.sub.2 F.sub.5 C.tbd.C-cycPr 530 6-Cl C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 531 6-Cl C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 532 6-Cl C.sub.2 F.sub.5 C.tbd.C-2-furanyl 533 6-Cl C.sub.2 F.sub.5 C.tbd.C-3-furanyl 534 6-Cl C.sub.2 F.sub.5 C.tbd.C-2-thienyl 535 6-Cl C.sub.2 F.sub.5 C.tbd.C-3-thienyl 536 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-Et 537 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-iPr 538 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-cycPr 539 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 540 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 541 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 542 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 543 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 544 6-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 545 6-Cl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 546 6-Cl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 547 6-Cl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 548 6-Cl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 549 6-Cl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 550 6-Cl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 551 7-Cl C.sub.2 F.sub.5 n-butyl 552 7-Cl C.sub.2 F.sub.5 C.tbd.C-Et 553 7-Cl C.sub.2 F.sub.5 C.tbd.C-iPr 554 7-Cl C.sub.2 F.sub.5 C.tbd.C-cycPr 555 7-Cl C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 556 7-Cl C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 557 7-Cl C.sub.2 F.sub.5 C.tbd.C-2-furanyl 558 7-Cl C.sub.2 F.sub.5 C.tbd.C-3-furanyl 559 7-Cl C.sub.2 F.sub.5 C.tbd.C-2-thienyl 560 7-Cl C.sub.2 F.sub.5 C.tbd.C-3-thienyl 561 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-Et 562 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-iPr 563 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-cycPr 564 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 565 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 566 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 567 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 568 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 569 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 570 7-Cl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 571 7-Cl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 572 7-Cl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 573 7-Cl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 574 7-Cl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 575 7-Cl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 576 6-F C.sub.2 F.sub.5 n-butyl 577 6-F C.sub.2 F.sub.5 C.tbd.C-Et 578 6-F C.sub.2 F.sub.5 C.tbd.C-iPr 579 6-F C.sub.2 F.sub.5 C.tbd.C-cycPr 580 6-F C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 581 6-F C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 582 6-F C.sub.2 F.sub.5 C.tbd.C-2-furanyl 583 6-F C.sub.2 F.sub.5 C.tbd.C-3-furanyl 584 6-F C.sub.2 F.sub.5 C.tbd.C-2-thienyl 585 6-F C.sub.2 F.sub.5 C.tbd.C-3-thienyl 586 6-F C.sub.2 F.sub.5 CH.dbd.CH-Et 587 6-F C.sub.2 F.sub.5 CH.dbd.CH-iPr 588 6-F C.sub.2 F.sub.5 CH.dbd.CH-cycPr 589 6-F C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 590 6-F C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 591 6-F C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 592 6-F C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 593 6-F C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 594 6-F C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 595 6-F C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 596 6-F C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 597 6-F C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 598 6-F C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 599 6-F C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 600 6-F C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 601 7-F C.sub.2 F.sub.5 n-butyl 602 7-F C.sub.2 F.sub.5 C.tbd.C-Et 603 7-F C.sub.2 F.sub.5 C.tbd.C-iPr 604 7-F C.sub.2 F.sub.5 C.tbd.C-cycPr 605 7-F C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 606 7-F C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 607 7-F C.sub.2 F.sub.5 C.tbd.C-2-furanyl 608 7-F C.sub.2 F.sub.5 C.tbd.C-3-furanyl 609 7-F C.sub.2 F.sub.5 C.tbd.C-2-thienyl 610 7-F C.sub.2 F.sub.5 C.tbd.C-3-thienyl 611 7-F C.sub.2 F.sub.5 CH.dbd.CH-Et 612 7-F C.sub.2 F.sub.5 CH.dbd.CH-iPr 613 7-F C.sub.2 F.sub.5 CH.dbd.CH-cycPr 614 7-F C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 615 7-F C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 616 7-F C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 617 7-F C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 618 7-F C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 619 7-F C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 620 7-F C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 621 7-F C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 622 7-F C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 623 7-F C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 624 7-F C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 625 7-F C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 626 6,7-diCl C.sub.2 F.sub.5 n-butyl 627 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-Et 628 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-iPr 629 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-cycPr 630 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 631 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 632 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-2-furanyl 633 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-3-furanyl 634 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-2-thienyl 635 6,7-diCl C.sub.2 F.sub.5 C.tbd.C-3-thienyl 636 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-Et 637 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-iPr 638 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-cycPr 639 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 640 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 641 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 642 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 643 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 644 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 645 6,7-diCl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 646 6,7-diCl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 647 6,7-diCl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 648 6,7-diCl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 649 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 650 6,7-diCl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 651 6,7-diF C.sub.2 F.sub.5 n-butyl 652 6,7-diF C.sub.2 F.sub.5 C.tbd.C-Et 653 6,7-diF C.sub.2 F.sub.5 C.tbd.C-iPr 654 6,7-diF C.sub.2 F.sub.5 C.tbd.C-cycPr 655 6,7-diF C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 656 6,7-diF C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 657 6,7-diF C.sub.2 F.sub.5 C.tbd.C-2-furanyl 658 6,7-diF C.sub.2 F.sub.5 C.tbd.C-3-furanyl 659 6,7-diF C.sub.2 F.sub.5 C.tbd.C-2-thienyl 660 6,7-diF C.sub.2 F.sub.5 C.tbd.C-3-thienyl 661 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-Et 662 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-iPr 663 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-cycPr 664 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 665 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 666 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 667 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 668 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 669 6,7-diF C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 670 6,7-diF C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 671 6,7-diF C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 672 6,7-diF C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 673 6,7-diF C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 674 6,7-diF C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 675 6,7-diF C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 676 6-Cl, 7-F C.sub.2 F.sub.5 n-butyl 677 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-Et 678 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-iPr 679 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-cycPr 680 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 681 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 682 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-2-furanyl 683 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-3-furanyl 684 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-2-thienyl 685 6-Cl, 7-F C.sub.2 F.sub.5 C.tbd.C-3-thienyl 686 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-Et 687 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-iPr 688 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-cycPr 689 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 690 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 691 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 692 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 693 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 694 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 695 6-Cl, 7-F C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 696 6-Cl, 7-F C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 697 6-Cl, 7-F C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 698 6-Cl, 7-F C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 699 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 700 6-Cl, 7-F C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 701 6-F, 7-Cl C.sub.2 F.sub.5 n-butyl 702 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-Et 703 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-iPr 704 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-cycPr 705 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 706 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 707 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-2-furanyl 708 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-3-furanyl 709 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-2-thienyl 710 6-F, 7-Cl C.sub.2 F.sub.5 C.tbd.C-3-thienyl 711 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-Et 712 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-iPr 713 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-cycPr 714 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 715 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 716 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 717 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 718 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 719 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 720 6-F, 7-Cl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 721 6-F, 7-Cl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 722 6-F, 7-Cl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 723 6-F, 7-Cl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 724 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 725 6-F, 7-Cl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 726 7-CH.sub.3 C.sub.2 F.sub.5 n-butyl 727 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-Et 728 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-iPr 729 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-cycPr 730 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 731 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 732 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-2-furanyl 733 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-3-furanyl 734 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-2-thienyl 735 7-CH.sub.3 C.sub.2 F.sub.5 C.tbd.C-3-thienyl 736 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-Et 737 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-iPr 738 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-cycPr 739 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 740 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 741 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 742 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 743 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 744 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 745 7-CH.sub.3 C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 746 7-CH.sub.3 C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 747 7-CH.sub.3 C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 748 7-CH.sub.3 C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 749 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 750 7-CH.sub.3 C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 751 7-OCH.sub.3 C.sub.2 F.sub.5 n-butyl 752 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-Et 753 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-iPr 754 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-cycPr 755 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 756 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 757 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-2-furanyl 758 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-3-furanyl 759 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-2-thienyl 760 7-OCH.sub.3 C.sub.2 F.sub.5 C.tbd.C-3-thienyl 761 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-Et 762 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-iPr 763 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-cycPr 764 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 765 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 766 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 767 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 768 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 769 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 770 7-OCH.sub.3 C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 771 7-OCH.sub.3 C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 772 7-OCH.sub.3 C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 773 7-OCH.sub.3 C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 774 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 775 7-OCH.sub.3 C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 776 7-pyrazol-6-yl C.sub.2 F.sub.5 n-butyl 777 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-Et 778 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-iPr 779 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-cycPr 780 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 781 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 782 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-2-furanyl 783 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-3-furanyl 784 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-2-thienyl 785 7-pyrazol-6-yl C.sub.2 F.sub.5 C.tbd.C-3-thienyl 786 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-Et 787 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-iPr 788 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-cycPr 789 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 790 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 791 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 792 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 793 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 794 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 795 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 796 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 797 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 798 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 799 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CHC H.sub.2 -cycPr 800 7-pyrazol-6-yl C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 801 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 n-butyl 802 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-Et 803 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-iPr 804 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-cycPr 805 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 806 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 807 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-2-furanyl 808 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-3-furanyl 809 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-2-thienyl 810 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 C.tbd.C-3-thienyl 811 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-Et 812 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-iPr 813 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-cycPr 814 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 815 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 816 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 817 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 818 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 819 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 820 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 821 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 822 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 823 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 824 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 825 6,7-OCH.sub.2 O-- C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 826 7-CONH.sub.2 C.sub.2 F.sub.5 n-butyl 827 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-Et 828 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-iPr 829 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-cycPr 830 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-2-pyridyl 831 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-3-pyridyl 832 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-2-furanyl 833 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-3-furanyl 834 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-2-thienyl 835 7-CONH.sub.2 C.sub.2 F.sub.5 C.tbd.C-3-thienyl 836 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-Et 837 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-iPr 838 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-cycPr 839 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-2-pyridyl 840 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-3-pyridyl 841 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-2-furanyl 842 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-3-furanyl 843 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-2-thienyl 844 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CH-3-thienyl 845 7-CONH.sub.2 C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-cycPr 846 7-CONH.sub.2 C.sub.2 F.sub.5 CH.sub.2 --C.tbd.C-2-furanyl 847 7-CONH.sub.2 C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-cycPr 848 7-CONH.sub.2 C.sub.2 F.sub.5 CH.sub.2 CH.dbd.CH-2-furanyl 849 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -cycPr 850 7-CONH.sub.2 C.sub.2 F.sub.5 CH.dbd.CHCH.sub.2 -2-furanyl 851 6-Cl cycPr n-butyl 852 6-Cl cycPr C.tbd.C-Et 853 6-Cl cycPr C.tbd.C-iPr 854 6-Cl cycPr C.tbd.C-cycPr 855 6-Cl cycPr C.tbd.C-2-pyridyl 856 6-Cl cycPr C.tbd.C-3-pyridyl 857 6-Cl cycPr C.tbd.C-2-furanyl 858 6-Cl cycPr C.tbd.C-3-furanyl 859 6-Cl cycPr C.tbd.C-2-thienyl 860 6-Cl cycPr C.tbd.C-3-thienyl 861 6-Cl cycPr CH.dbd.CH-Et 862 6-Cl cycPr CH.dbd.CH-iPr 863 6-Cl cycPr CH.dbd.CH-cycPr 864 6-Cl cycPr CH.dbd.CH-2-pyridyl 865 6-Cl cycPr CH.dbd.CH-3-pyridyl 866 6-Cl cycPr CH.dbd.CH-2-furanyl 867 6-Cl cycPr CH.dbd.CH-3-furanyl 868 6-Cl cycPr CH.dbd.CH-2-thienyl 869 6-Cl cycPr CH.dbd.CH-3-thienyl 870 6-Cl cycPr CH.sub.2 --C.tbd.C-cycPr 871 6-Cl cycPr CH.sub.2 --C.tbd.C-2-furanyl 872 6-Cl cycPr CH.sub.2 CH.dbd.CH-cycPr 873 6-Cl cycPr CH.sub.2 CH.dbd.CH-2-furanyl 874 6-Cl cycPr CH.dbd.CHCH.sub.2 -cycPr 875 6-Cl cycPr CH.dbd.CHCH.sub.2 -2-furanyl 876 7-Cl cycPr n-butyl 877 7-Cl cycPr C.tbd.C-Et 878 7-Cl cycPr C.tbd.C-iPr 879 7-Cl cycPr C.tbd.C-cycPr 880 7-Cl cycPr C.tbd.C-2-pyridyl 881 7-Cl cycPr C.tbd.C-3-pyridyl 882 7-Cl cycPr C.tbd.C-2-furanyl 883 7-Cl cycPr C.tbd.C-3-furanyl 884 7-Cl cycPr C.tbd.C-2-thienyl 885 7-Cl cycPr C.tbd.C-3-thienyl 886 7-Cl cycPr CH.dbd.CH-Et 887 7-Cl cycPr CH.dbd.CH-iPr 888 7-Cl cycPr CH.dbd.CH-cycPr 889 7-Cl cycPr CH.dbd.CH-2-pyridyl 890 7-Cl cycPr CH.dbd.CH-3-pyridyl 891 7-Cl cycPr CH.dbd.CH-2-furanyl 892 7-Cl cycPr CH.dbd.CH-3-furanyl 893 7-Cl cycPr CH.dbd.CH-2-thienyl 894 7-Cl cycPr CH.dbd.CH-3-thienyl 895 7-Cl cycPr CH.sub.2 --C.tbd.C-cycPr 896 7-Cl cycPr CH.sub.2 --C.tbd.C-2-furanyl 897 7-Cl cycPr CH.sub.2 CH.dbd.CH-cycPr 898 7-Cl cycPr CH.sub.2 CH.dbd.CH-2-furanyl 899 7-Cl cycPr CH.dbd.CHCH.sub.2 -cycPr 900 7-Cl cycPr CH.dbd.CHCH.sub.2 -2-furanyl 901 6-F cycPr n-butyl 902 6-F cycPr C.tbd.C-Et 903 6-F cycPr C.tbd.C-iPr 904 6-F cycPr C.tbd.C-cycPr 905 6-F cycPr C.tbd.C-2-pyridyl 906 6-F cycPr C.tbd.C-3-pyridyl 907 6-F cycPr C.tbd.C-2-furanyl 908 6-F cycPr C.tbd.C-3-furanyl 909 6-F cycPr C.tbd.C-2-thienyl 910 6-F cycPr C.tbd.C-3-thienyl 911 6-F cycPr CH.dbd.CH-Et 912 6-F cycPr CH.dbd.CH-iPr 913 6-F cycPr CH.dbd.CH-cycPr 914 6-F cycPr CH.dbd.CH-2-pyridyl 915 6-F cycPr CH.dbd.CH-3-pyridyl 916 6-F cycPr CH.dbd.CH-2-furanyl 917 6-F cycPr CH.dbd.CH-3-furanyl 918 6-F cycPr CH.dbd.CH-2-thienyl 919 6-F cycPr CH.dbd.CH-3-thienyl 920 6-F cycPr CH.sub.2 --C.tbd.C-cycPr 921 6-F cycPr CH.sub.2 --C.tbd.C-2-furanyl 922 6-F cycPr CH.sub.2 CH.dbd.CH-cycPr 923 6-F cycPr CH.sub.2 CH.dbd.CH-2-furanyl 924 6-F cycPr CH.dbd.CHCH.sub.2 -cycPr 925 6-F cycPr CH.dbd.CHCH.sub.2 -2-furanyl 926 7-F cycPr n-butyl 927 7-F cycPr C.tbd.C-Et 928 7-F cycPr C.tbd.C-iPr 929 7-F cycPr C.tbd.C-cycPr 930 7-F cycPr C.tbd.C-2-pyridyl 931 7-F cycPr C.tbd.C-3-pyridyl 932 7-F cycPr C.tbd.C-2-furanyl 933 7-F cycPr C.tbd.C-3-furanyl 934 7-F cycPr C.tbd.C-2-thienyl 935 7-F cycPr C.tbd.C-3-thienyl 936 7-F cycPr CH.dbd.CH-Et 937 7-F cycPr CH.dbd.CH-iPr 938 7-F cycPr CH.dbd.CH-cycPr 939 7-F cycPr CH.dbd.CH-2-pyridyl 940 7-F cycPr CH.dbd.CH-3-pyridyl 941 7-F cycPr CH.dbd.CH-2-furanyl 942 7-F cycPr CH.dbd.CH-3-furanyl 943 7-F cycPr CH.dbd.CH-2-thienyl 944 7-F cycPr CH.dbd.CH-3-thienyl 945 7-F cycPr CH.sub.2 --C.tbd.C-cycPr 946 7-F cycPr CH.sub.2 --C.tbd.C-2-furanyl 947 7-F cycPr CH.sub.2 CH.dbd.CH-cycPr 948 7-F cycPr CH.sub.2 CH.dbd.CH-2-furanyl 949 7-F cycPr CH.dbd.CHCH.sub.2 -cycPr 950 7-F cycPr CH.dbd.CHCH.sub.2 -2-furanyl 951 6,7-diCl cycPr n-butyl 952 6,7-diCl cycPr C.tbd.C-Et 953 6,7-diCl cycPr C.tbd.C-iPr 954 6,7-diCl cycPr C.tbd.C-cycPr 955 6,7-diCl cycPr C.tbd.C-2-pyridyl 956 6,7-diCl cycPr C.tbd.C-3-pyridyl 957 6,7-diCl cycPr C.tbd.C-2-furanyl 958 6,7-diCl cycPr C.tbd.C-3-furanyl 959 6,7-diCl cycPr C.tbd.C-2-thienyl 960 6,7-diCl cycPr C.tbd.C-3-thienyl 961 6,7-diCl cycPr CH.dbd.CH-Et 962 6,7-diCl cycPr CH.dbd.CH-iPr 963 6,7-diCl cycPr CH.dbd.CH-cycPr 964 6,7-diCl cycPr CH.dbd.CH-2-pyridyl 965 6,7-diCl cycPr CH.dbd.CH-3-pyridyl 966 6,7-diCl cycPr CH.dbd.CH-2-furanyl 967 6,7-diCl cycPr CH.dbd.CH-3-furanyl 968 6,7-diCl cycPr CH.dbd.CH-2-thienyl 969 6,7-diCl cycPr CH.dbd.CH-3-thienyl 970 6,7-diCl cycPr CH.sub.2 --C.tbd.C-cycPr 971 6,7-diCl cycPr CH.sub.2 --C.tbd.C-2-furanyl 972 6,7-diCl cycPr CH.sub.2 CH.dbd.CH-cycPr 973 6,7-diCl cycPr CH.sub.2 CH.dbd.CH-2-furanyl 974 6,7-diCl cycPr CH.dbd.CHCH.sub.2 -cycPr 975 6,7-diCl cycPr CH.dbd.CHCH.sub.2 -2-furanyl 976 6,7-diF cycPr n-butyl 977 6,7-diF cycPr C.tbd.C-Et 978 6,7-diF cycPr C.tbd.C-iPr 979 6,7-diF cycPr C.tbd.C-cycPr 980 6,7-diF cycPr C.tbd.C-2-pyridyl 981 6,7-diF cycPr C.tbd.C-3-pyridyl 982 6,7-diF cycPr C.tbd.C-2-furanyl 983 6,7-diF cycPr C.tbd.C-3-furanyl 984 6,7-diF cycPr C.tbd.C-2-thienyl 985 6,7-diF cycPr C.tbd.C-3-thienyl 986 6,7-diF cycPr CH.dbd.CH-Et 987 6,7-diF cycPr CH.dbd.CH-iPr 988 6,7-diF cycPr CH.dbd.CH-cycPr 989 6,7-diF cycPr CH.dbd.CH-2-pyridyl 990 6,7-diF cycPr CH.dbd.CH-3-pyridyl 991 6,7-diF cycPr CH.dbd.CH-2-furanyl 992 6,7-diF cycPr CH.dbd.CH-3-furanyl 993 6,7-diF cycPr CH.dbd.CH-2-thienyl 994 6,7-diF cycPr CH.dbd.CH-3-thienyl 995 6,7-diF cycPr CH.sub.2 --C.tbd.C-cycPr 996 6,7-diF cycPr CH.sub.2 --C.tbd.C-2-furanyl 997 6,7-diF cycPr CH.sub.2 CH.dbd.CH-cycPr 998 6,7-diF cycPr CH.sub.2 CH.dbd.CH-2-furanyl 999 6,7-diF cycPr CH.dbd.CHCH.sub.2 -cycPr 1000 6,7-diF cycPr CH.dbd.CHCH.sub.2 -2-furanyl 1001 6-Cl, 7-F cycPr n-butyl 1002 6-Cl, 7-F cycPr C.tbd.C-Et 1003 6-Cl, 7-F cycPr C.tbd.C-iPr 1004 6-Cl, 7-F cycPr C.tbd.C-cycPr 1005 6-Cl, 7-F cycPr C.tbd.C-2-pyridyl 1006 6-Cl, 7-F cycPr C.tbd.C-3-pyridyl 1007 6-Cl, 7-F cycPr C.tbd.C-2-furanyl 1008 6-Cl, 7-F cycPr C.tbd.C-3-furanyl 1009 6-Cl, 7-F cycPr C.tbd.C-2-thienyl 1010 6-Cl, 7-F cycPr C.tbd.C-3-thienyl 1011 6-Cl, 7-F cycPr CH.dbd.CH-Et 1012 6-Cl, 7-F cycPr CH.dbd.CH-iPr 1013 6-Cl, 7-F cycPr CH.dbd.CH-cycPr 1014 6-Cl, 7-F cycPr CH.dbd.CH-2-pyridyl 1015 6-Cl, 7-F cycPr CH.dbd.CH-3-pyridyl 1016 6-Cl, 7-F cycPr CH.dbd.CH-2-furanyl 1017 6-Cl, 7-F cycPr CH.dbd.CH-3-furanyl 1018 6-Cl, 7-F cycPr CH.dbd.CH-2-thienyl 1019 6-Cl, 7-F cycPr CH.dbd.CH-3-thienyl 1020 6-Cl, 7-F cycPr CH.sub.2 --C.tbd.C-cycPr 1021 6-Cl, 7-F cycPr CH.sub.2 --C.tbd.C-2-furanyl 1022 6-Cl, 7-F cycPr CH.sub.2 CH.dbd.CH-cycPr 1023 6-Cl, 7-F cycPr CH.sub.2 CH.dbd.CH-2-furanyl 1024 6-Cl, 7-F cycPr CH.dbd.CHCH.sub.2 -cycPr 1025 6-Cl, 7-F cycPr CH.dbd.CHCH.sub.2 -2-furanyl 1026 6-F, 7-Cl cycPr n-butyl 1027 6-F, 7-Cl cycPr C.tbd.C-Et 1028 6-F, 7-Cl cycPr C.tbd.C-iPr 1029 6-F, 7-Cl cycPr C.tbd.C-cycPr 1030 6-F, 7-Cl cycPr C.tbd.C-2-pyridyl 1031 6-F, 7-Cl cycPr C.tbd.C-3-pyridyl 1032 6-F, 7-Cl cycPr C.tbd.C-2-furanyl 1033 6-F, 7-Cl cycPr C.tbd.C-3-furanyl 1034 6-F, 7-Cl cycPr C.tbd.C-2-thienyl 1035 6-F, 7-Cl cycPr C.tbd.C-3-thienyl 1036 6-F, 7-Cl cycPr CH.dbd.CH-Et 1037 6-F, 7-Cl cycPr CH.dbd.CH-iPr 1038 6-F, 7-Cl cycPr CH.dbd.CH-cycPr 1039 6-F, 7-Cl cycPr CH.dbd.CH-2-pyridyl 1040 6-F, 7-Cl cycPr CH.dbd.CH-3-pyridyl 1041 6-F, 7-Cl cycPr CH.dbd.CH-2-furanyl 1042 6-F, 7-Cl cycPr CH.dbd.CH-3-furanyl 1043 6-F, 7-Cl cycPr CH.dbd.CH-2-thienyl 1044 6-F, 7-Cl cycPr CH.dbd.CH-3-thienyl 1045 6-F, 7-Cl cycPr CH.sub.2 --C.tbd.C-cycPr 1046 6-F, 7-Cl cycPr CH.sub.2 --C.tbd.C-2-furanyl 1047 6-F, 7-Cl cycPr CH.sub.2 CH.dbd.CH-cycPr 1048 6-F, 7-Cl cycPr CH.sub.2 CH.dbd.CH-2-furanyl 1049 6-F, 7-Cl cycPr CH.dbd.CHCH.sub.2 -cycPr 1050 6-F, 7-Cl cycPr CH.dbd.CHCH.sub.2 -2-furanyl 1051 7-CH.sub.3 cycPr n-butyl 1052 7-CH.sub.3 cycPr C.tbd.C-Et 1053 7-CH.sub.3 cycPr C.tbd.C-iPr 1054 7-CH.sub.3 cycPr C.tbd.C-cycPr 1055 7-CH.sub.3 cycPr C.tbd.C-2-pyridyl 1056 7-CH.sub.3 cycPr C.tbd.C-3-pyridyl 1057 7-CH.sub.3 cycPr C.tbd.C-2-furanyl 1058 7-CH.sub.3 cycPr C.tbd.C-3-furanyl 1059 7-CH.sub.3 cycPr C.tbd.C-2-thienyl 1060 7-CH.sub.3 cycPr C.tbd.C-3-thienyl 1061 7-CH.sub.3 cycPr CH.dbd.CH-Et 1062 7-CH.sub.3 cycPr CH.dbd.CH-iPr 1063 7-CH.sub.3 cycPr CH.dbd.CH-cycPr 1064 7-CH.sub.3 cycPr CH.dbd.CH-2-pyridyl 1065 7-CH.sub.3 cycPr CH.dbd.CH-3-pyridyl 1066 7-CH.sub.3 cycPr CH.dbd.CH-2-furanyl 1067 7-CH.sub.3 cycPr CH.dbd.CH-3-furanyl 1068 7-CH.sub.3 cycPr CH.dbd.CH-2-thienyl 1069 7-CH.sub.3 cycPr CH.dbd.CH-3-thienyl 1070 7-CH.sub.3 cycPr CH.sub.2 --C.tbd.C-cycPr 1071 7-CH.sub.3 cycPr CH.sub.2 --C.tbd.C-2-furanyl 1072 7-CH.sub.3 cycPr CH.sub.2 CH.dbd.CH-cycPr 1073 7-CH.sub.3 cycPr CH.sub.2 CH.dbd.CH-2-furanyl 1074 7-CH.sub.3 cycPr CH.dbd.CHCH.sub.2 -cycPr 1075 7-CH.sub.3 cycPr CH.dbd.CHCH.sub.2 -2-furanyl 1076 7-OCH.sub.3 cycPr n-butyl 1077 7-OCH.sub.3 cycPr C.tbd.C-Et 1078 7-OCH.sub.3 cycPr C.tbd.C-iPr 1079 7-OCH.sub.3 cycPr C.tbd.C-cycPr 1080 7-OCH.sub.3 cycPr C.tbd.C-2-pyridyl 1081 7-OCH.sub.3 cycPr C.tbd.C-3-pyridyl 1082 7-OCH.sub.3 cycPr C.tbd.C-2-turanyl 1083 7-OCH.sub.3 cycPr C.tbd.C-3-furanyl 1084 7-OCH.sub.3 cycPr C.tbd.C-2-thienyl 1085 7-OCH.sub.3 cycPr C.tbd.C-3-thienyl 1086 7-OCH.sub.3 cycPr CH.dbd.CH-Et 1087 7-OCH.sub.3 cycPr CH.dbd.CH-iPr 1088 7-OCH.sub.3 cycPr CH.dbd.CH-cycPr 1089 7-OCH.sub.3 cycPr CH.dbd.CH-2-pyridyl 1090 7-OCH.sub.3 cycPr CH.dbd.CH-3-pyridyl 1091 7-OCH.sub.3 cycPr CH.dbd.CH-2-furanyl 1092 7-OCH.sub.3 cycPr CH.dbd.CH-3-turanyl 1093 7-OCH.sub.3 cycPr CH.dbd.CH-2-thienyl 1094 7-OCH.sub.3 cycPr CH.dbd.CH-3-thienyl 1095 7-OCH.sub.3 cycPr CH.sub.2 --C.tbd.C-cycPr 1096 7-OCH.sub.3 cycPr CH.sub.2 --C.tbd.C-2-furanyl 1097 7-OCH.sub.3 cycPr CH.sub.2 CH.dbd.CH-cycPr 1098 7-OCH.sub.3 cycPr CH.sub.2 CH.dbd.CH-2-furanyl 1099 7-OCH.sub.3 cycPr CH.dbd.CHCH.sub.2 -cycPr 1100 7-OCH.sub.3 cycPr CH.dbd.CHCH.sub.2 -2-furanyl 1101 7-pyrazol-6-yl cycPr n-butyl 1102 7-pyrazol-6-yl cycPr C.tbd.C-Et 1103 7-pyrazol-6-yl cycPr C.tbd.C-iPr 1104 7-pyrazol-6-yl cycPr C.tbd.C-cycPr 1105 7-pyrazol-6-yl cycPr C.tbd.C-2-pyridyl 1106 7-pyrazol-6-yl cycPr C.tbd.C-3-pyridyl 1107 7-pyrazol-6-yl cycPr C.tbd.C-2-furanyl 1108 7-pyrazol-6-yl cycPr C.tbd.C-3-furanyl 1109 7-pyrazol-6-yl cycPr C.tbd.C-2-thienyl 1110 7-pyrazol-6-yl cycPr C.tbd.C-3-thienyl 1111 7-pyrazol-6-yl cycPr CH.dbd.CH-Et 1112 7-pyrazol-6-yl cycPr CH.dbd.CH-iPr 1113 7-pyrazol-6-yl cycPr CH.dbd.CH-cycPr 1114 7-pyrazol-6-yl cycPr CH.dbd.CH-2-pyridyl 1115 7-pyrazol-6-yl cycPr CH.dbd.CH-3-pyridyl 1116 7-pyrazol-6-yl cycPr CH.dbd.CH-2-furanyl 1117 7-pyrazol-6-yl cycPr CH.dbd.CH-3-furanyl 1118 7-pyrazol-6-yl cycPr CH.dbd.CH-2-thienyl 1119 7-pyrazol-6-yl cycPr CH.dbd.CH-3-thienyl 1120 7-pyrazol-6-yl cycPr CH.sub.2 --C.tbd.C-cycPr 1121 7-pyrazol-6-yl cycPr CH.sub.2 --C.tbd.C-2-furanyl 1122 7-pyrazol-6-yl cycPr CH.sub.2 CH.dbd.CH-cycPr 1123 7-pyrazol-6-yl cycPr CH.sub.2 CH.dbd.CH-2-furanyl 1124 7-pyrazol-6-yl cycPr CH.dbd.CHCH.sub.2 -cycPr 1125 7-pyrazol-6-yl cycPr CH.dbd.CHCH.sub.2 -2-furanyl 1126 6,7-OCH.sub.2 O-- cycPr n-butyl 1127 6,7-OCH.sub.2 O-- cycPr C.tbd.C-Et 1128 6,7-OCH.sub.2 O-- cycPr C.tbd.C-iPr 1129 6,7-OCH.sub.2 O-- cycPr C.tbd.C-cycPr 1130 6,7-OCH.sub.2 O-- cycPr C.tbd.C-2-pyridyl 1131 6,7-OCH.sub.2 O-- cycPr C.tbd.C-3-pyridyl 1132 6,7-OCH.sub.2 O-- cycPr C.tbd.C-2-furanyl 1133 6,7-OCH.sub.2 O-- cycPr C.tbd.C-3-furanyl 1134 6,7-OCH.sub.2 O-- cycPr C.tbd.C-2-thienyl 1135 6,7-OCH.sub.2 O-- cycPr C.tbd.C-3-thienyl 1136 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-Et 1137 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-iPr 1138 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-cycPr 1139 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-2-pyridyl 1140 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-3-pyridyl 1141 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-2-furanyl 1142 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-3-furanyl 1143 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-2-thienyl 1144 6,7-OCH.sub.2 O-- cycPr CH.dbd.CH-3-thienyl 1145 6,7-OCH.sub.2 O-- cycPr CH.sub.2 --C.tbd.C-cycPr 1146 6,7-OCH.sub.2 O-- cycPr CH.sub.2 --C.tbd.C-2-furanyl 1147 6,7-OCH.sub.2 O-- cycPr CH.sub.2 CH.dbd.CH-cycPr 1148 6,7-OCH.sub.2 O-- cycPr CH.sub.2 CH.dbd.CH-2-furanyl 1149 6,7-OCH.sub.2 O-- cycPr CH.dbd.CHCH.sub.2 -cycPr 1150 6,7-OCH.sub.2 O-- cycPr CH.dbd.CHCH.sub.2 -2-furanyl 1151 7-CONH.sub.2 cycPr n-butyl 1152 7-CONH.sub.2 cycPr C.tbd.C-Et 1153 7-CCNH.sub.2 cycPr C.tbd.C-iPr 1154 7-CONH.sub.2 cycPr C.tbd.C-cycPr 1155 7-CONH.sub.2 cycPr C.tbd.C-2-pyridyl 1156 7-CONH.sub.2 cycPr C.tbd.C-3-pyridyl 1157 7-CONH.sub.2 cycPr C.tbd.C-2-furanyl 1158 7-CONH.sub.2 cycPr C.tbd.C-3-furanyl 1159 7-CONH.sub.2 cycPr C.tbd.C-2-thienyl 1160 7-CONH.sub.2 cycPr C.tbd.C-3-thienyl 1161 7-CONH.sub.2 cycPr CH.dbd.CH-Et 1162 7-CONH.sub.2 cycPr CH.dbd.CH-iPr 1163 7-CONH.sub.2 cycPr CH.dbd.CH-cycPr 1164 7-CONH.sub.2 cycPr CH.dbd.CH-2-pyridyl 1165 7-CONH.sub.2 cycPr CH.dbd.CH-3-pyridyl 1166 7-CONH.sub.2 cycPr CH.dbd.CH-2-furanyl 1167 7-CONH.sub.2 cycPr CH.dbd.CH-3-furanyl 1168 7-CONH.sub.2 cycPr CH.dbd.CH-2-thienyl 1169 7-CONH.sub.2 cycPr CH.dbd.CH-3-thienyl 1170 7-CONH.sub.2 cycPr CH.sub.2 --C.tbd.C-cycPr 1171 7-CONH.sub.2 cycPr CH.sub.2 --C.tbd.C-2-furanyl 1172 7-CONH.sub.2 cycPr CH.sub.2 CH.dbd.CH-cycPr 1173 7-CONH.sub.2 cycPr CH.sub.2 CH.dbd.CH-2-furanyl 1174 7-CONH.sub.2 cycPr CH.dbd.CHCH.sub.2 -cycPr 1175 7-CONH.sub.2 cycPr CH.dbd.CHCH.sub.2 -2-furanyl______________________________________ *Unless otherwise noted, stereochemistry is (+/-) and in R.sup.2, all double bonds are trans.
TABLE 3______________________________________ #STR52## - #STR53## - #STR54## - #STR55## - #STR56## Ex. # W X Y Z R.sup.1 R.sup.2______________________________________2001 CH CCl CH N CF.sub.3 C.tbd.C-nPr 2002 CH CCl CH N CF.sub.3 C.tbd.C-Bu 2003 CH CCl CH N CF.sub.3 C.tbd.C-iBu 2004 CH CCl CH N CF.sub.3 C.tbd.C-tBu 2005 CH CCl CH N CF.sub.3 C.tbd.C-Et 2006 CH CCl CH N CF.sub.3 C.tbd.C-Me 2007 CH CCl CH N CF.sub.3 C.tbd.C-Ph 2008 CH CCl CH N CF.sub.3 C.tbd.C-2-Pyridyl 2009 CH CCl CH N CF.sub.3 C.tbd.C-3-Pyridyl 2010 CH CCl CH N CF.sub.3 C.tbd.C-4-Pyridyl 2011 CH CCl CH N CF.sub.3 C.tbd.C-2-furanyl 2012 CH CCl CH N CF.sub.3 C.tbd.C-3-furanyl 2013 CH CCl CH N CF.sub.3 C.tbd.C-2-thienyl 2014 CH CCl CH N CF.sub.3 C.tbd.C-3-thienyl 2015 CH CCl CH N CF.sub.3 CH.dbd.CH-cycPr 2016 CH CCl CH N CF.sub.3 CH.dbd.CH-iPr 2017 CH CCl CH N CF.sub.3 CH.dbd.CH-nPr 2018 CH CCl CH N CF.sub.3 CH.dbd.CH-Bu 2019 CH CCl CH N CF.sub.3 CH.dbd.CH-iBu 2020 CH CCl CH N CF.sub.3 CH.dbd.CH-tBu 2021 CH CCl CH N CF.sub.3 CH.dbd.CH-Et 2022 CH CCl CH N CF.sub.3 CH.dbd.CH-Me 2023 CH CCl CH N CF.sub.3 CH.dbd.CH-Ph 2024 CH CCl CH N CF.sub.3 CH.dbd.CH-2-Pyridyl 2025 CH CCl CH N CF.sub.3 CH.dbd.CH-3-Pyridyl 2026 CH CCl CH N CF.sub.3 CH.dbd.CH-4-Pyridyl 2027 CH CCl CH N CF.sub.3 CH.dbd.CH-2-furanyl 2028 CH CCl CH N CF.sub.3 CH.dbd.CH-3-furanyl 2029 CH CCl CH N CF.sub.3 CH.dbd.CH-2-thienyl 2030 CH CCl CH N CF.sub.3 CH.dbd.CH-3-thienyl 2031 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2032 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 CH(CH.sub.3).sub.2 2033 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2034 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.3 2035 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -cycPr 2036 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -tBu 2037 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -2-Pyridyl 2038 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -3-Pyridyl 2039 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -4-Pyridyl 2040 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -2-furanyl 2041 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -3-furanyl 2042 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -2-thienyl 2043 CH CCl CH N CF.sub.3 CH.sub.2 CH.sub.2 -3-thienyl 2044 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-cycPr 2045 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-iPr 2046 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-nPr 2047 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-Bu 2048 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-iBu 2049 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-tBu 2050 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-Et 2051 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-Me 2052 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-Ph 2053 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-2-Pyridyl 2054 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-3-Pyridyl 2055 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-4-Pyridyl 2056 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-2-furanyl 2057 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-3-furanyl 2058 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-2-thienyl 2059 CH C(OCH.sub.3) CH N CF.sub.3 C.tbd.C-3-thienyl 2060 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-cycPr 2061 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-iPr 2062 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-nPr 2063 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-Bu 2064 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-iBu 2065 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-tBu 2066 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-Et 2067 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-Me 2068 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-Ph 2069 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-2-Pyridyl 2070 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-3-Pyridyl 2071 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-4-Pyridyl 2072 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-2-furanyl 2073 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-3-furanyl 2074 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-2-thienyl 2075 CH C(OCH.sub.3) CH N CF.sub.3 CH.dbd.CH-3-thienyl 2076 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2077 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 CH(CH.sub.3).sub.2 2078 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2079 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.3 2080 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -cycPr 2081 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -tBu 2082 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -Ph 2083 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -2-Pyridyl 2084 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -3-Pyridyl 2085 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -4-Pyridyl 2086 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -2-furanyl 2087 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -3-furanyl 2088 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -2-thienyl 2089 CH C(OCH.sub.3) CH N CF.sub.3 CH.sub.2 CH.sub.2 -3-thienyl 2090 CH CH CH N CF.sub.3 C.tbd.C-cyc Pr 2091 CH CH CH N CF.sub.3 C.tbd.C-iPr 2092 CH CH CH N CF.sub.3 C.tbd.C-nPr 2093 CH CH CH N CF.sub.3 C.tbd.C-Et 2094 CH CH CH N CF.sub.3 C.tbd.C-3-Pyridyl 2095 CH CH CH N CF.sub.3 C.tbd.C-2-furanyl 2096 CH CH CH N CF.sub.3 C.tbd.C-3-furanyl 2097 CH CH CH N CF.sub.3 C.tbd.C-2-thienyl 2098 CH CH CH N CF.sub.3 C.tbd.C-3-thienyl 2099 CH CCl N CH CF.sub.3 C.tbd.C-iPr 2100 CH CCl N CH CF.sub.3 C.tbd.C-nPr 2101 CH CCl N CH CF.sub.3 C.tbd.C-Bu 2102 CH CCl N CH CF.sub.3 C.tbd.C-iBu 2103 CH CCl N CH CF.sub.3 C.tbd.C-tBu 2104 CH CCl N CH CF.sub.3 C.tbd.C-Et 2105 CH CCl N CH CF.sub.3 C.tbd.C-Me 2106 CH CCl N CH CF.sub.3 C.tbd.C-Ph 2107 CH CCl N CH CF.sub.3 C.tbd.C-2-Pyridyl 2108 CH CCl N CH CF.sub.3 C.tbd.C-3-Pyridyl 2109 CH CCl N CH CF.sub.3 C.tbd.C-4-Pyridyl 2110 CH CCl N CH CF.sub.3 C.tbd.C-2-furanyl 2111 CH CCl N CH CF.sub.3 C.tbd.C-3-furanyl 2112 CH CCl N CH CF.sub.3 C.tbd.C-2-thienyl 2113 CH CCl N CH CF.sub.3 C.tbd.C-3-thienyl 2114 CH CCl N CH CF.sub.3 CH.dbd.CH-cycPr 2115 CH CCl N CH CF.sub.3 CH.dbd.CH-iPr 2116 CH CCl N CH CF.sub.3 CH.dbd.CH-nPr 2117 CH CCl N CH CF.sub.3 CH.dbd.CH-Bu 2118 CH CCl N CH CF.sub.3 CH.dbd.CH-iBu 2119 CH CCl N CH CF.sub.3 CH.dbd.CH-tBu 2120 CH CCl N CH CF.sub.3 CH.dbd.CH-Et 2121 CH CCl N CH CF.sub.3 CH.dbd.CH-Me 2122 CH CCl N CH CF.sub.3 CH.dbd.CH-Ph 2123 CH CCl N CH CF.sub.3 CH.dbd.CH-2-Pyridyl 2124 CH CCl N CH CF.sub.3 CH.dbd.CH-3-Pyridyl 2125 CH CCl N CH CF.sub.3 CH.dbd.CH-4-Pyridyl 2126 CH CCl N CH CF.sub.3 CH.dbd.CH-2-furanyl 2127 CH CCl N CH CF.sub.3 CH.dbd.CH-3-furanyl 2128 CH CCl N CH CF.sub.3 CH.dbd.CH-2-thienyl 2129 CH CCl N CH CF.sub.3 CH.dbd.CH-3-thienyl 2130 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2131 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 CH(CH.sub.3).sub.2 2132 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2133 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.3 2134 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -cycPr 2135 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -tBu 2136 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -Ph 2137 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -2-Pyridyl 2138 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -3-Pyridyl 2139 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -4-Pyridyl 2140 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -2-furanyl 2141 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -3-furanyl 2142 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -2-thienyl 2143 CH CCl N CH CF.sub.3 CH.sub.2 CH.sub.2 -3-thienyl 2144 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-iPr 2145 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-nPr 2146 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-Bu 2147 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-iBu 2148 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-tBu 2149 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-Et 2150 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-Me 2151 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-Ph 2152 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-2-Pyridyl 2153 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-3-Pyridyl 2154 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-4-Pyridyl 2155 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-2-furanyl 2156 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-3-furanyl 2157 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-2-thienyl 2158 CH C(OCH.sub.3) N CH CF.sub.3 C.tbd.C-3-thienyl 2159 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-cycPr 2160 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-iPr 2161 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-nPr 2162 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-Bu 2163 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-iBu 2164 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-tBu 2165 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-Et 2166 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-Me 2167 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-Ph 2168 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-2-Pyridyl 2169 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-3-Pyridyl 2170 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-4-Pyridyl 2171 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-2-furanyl 2172 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-3-furanyl 2173 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-2-thienyl 2174 CH C(OCH.sub.3) N CH CF.sub.3 CH.dbd.CH-3-thienyl 2175 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2176 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 CH(CH.sub.3).sub.2 2177 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2178 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.3 2179 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -cycPr 2180 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -tBu 2181 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -Ph 2182 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -2-Pyridyl 2183 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -3-Pyridyl 2184 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -4-Pyridyl 2185 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -2-furanyl 2186 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -3-furanyl 2187 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -2-thienyl 2188 CH C(OCH.sub.3) N CH CF.sub.3 CH.sub.2 CH.sub.2 -3-thienyl 2189 CH CH N CH CF.sub.3 C.tbd.C-cyc Pr 2190 CH CH N CH CF.sub.3 C.tbd.C-iPr 2191 CH CH N CH CF.sub.3 C.tbd.C-nPr 2192 CH CH N CH CF.sub.3 C.tbd.C-Et 2193 CH CH N CH CF.sub.3 C.tbd.C-3-Pyridyl 2194 CH CH N CH CF.sub.3 C.tbd.C-2-furanyl 2195 CH CH N CH CF.sub.3 C.tbd.C-3-furanyl 2196 CH CH N CH CF.sub.3 C.tbd.C-2-thienyl 2197 CH CH N CH CF.sub.3 C.tbd.C-3-thienyl 2198 CCl N CH CH CF.sub.3 C.tbd.C-cycPr 2199 CCl N CH CH CF.sub.3 C.tbd.C-iPr 2200 CCl N CH CH CF.sub.3 C.tbd.C-nPr 2201 CCl N CH CH CF.sub.3 C.tbd.C-Bu 2202 CCl N CH CH CF.sub.3 C.tbd.C-iBu 2203 CCl N CH CH CF.sub.3 C.tbd.C-tBu 2204 CCl N CH CH CF.sub.3 C.tbd.C-Et 2205 CCl N CH CH CF.sub.3 C.tbd.C-Me 2206 CCl N CH CH CF.sub.3 C.tbd.C-Ph 2207 CCl N CH CH CF.sub.3 C.tbd.C-2-Pyridyl 2208 CCl N CH CH CF.sub.3 C.tbd.C-3-Pyridyl 2209 CCl N CH CH CF.sub.3 C.tbd.C-4-Pyridyl 2210 CCl N CH CH CF.sub.3 C.tbd.C-2-furanyl 2211 CCl N CH CH CF.sub.3 C.tbd.C-3-furanyl 2212 CCl N CH CH CF.sub.3 C.tbd.C-2-thienyl 2213 CCl N CH CH CF.sub.3 C.tbd.C-3-thienyl 2214 CCl N CH CH CF.sub.3 CH.dbd.CH-cycPr 2215 CCl N CH CH CF.sub.3 CH.dbd.CH-iPr 2216 CCl N CH CH CF.sub.3 CH.dbd.CH-nPr 2217 CCl N CH CH CF.sub.3 CH.dbd.CH-Bu 2218 CCl N CH CH CF.sub.3 CH.dbd.CH-iBu 2219 CCl N CH CH CF.sub.3 CH.dbd.CH-tBu 2220 CCl N CH CH CF.sub.3 CH.dbd.CH-Et 2221 CCl N CH CH CF.sub.3 CH.dbd.CH-Me 2222 CCl N CH CH CF.sub.3 CH.dbd.CH-Ph 2223 CCl N CH CH CF.sub.3 CH.dbd.CH-2-Pyridyl 2224 CCl N CH CH CF.sub.3 CH.dbd.CH-3-Pyridyl 2225 CCl N CH CH CF.sub.3 CH.dbd.CH-4-Pyridyl 2226 CCl N CH CH CF.sub.3 CH.dbd.CH-2-furanyl 2227 CCl N CH CH CF.sub.3 CH.dbd.CH-3-furanyl 2228 CCl N CH CH CF.sub.3 CH.dbd.CH-2-thienyl 2229 CCl N CH CH CF.sub.3 CH.dbd.CH-3-thienyl 2230 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2231 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH(CH.sub.3).sub.2 2232 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2233 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.3 2234 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -cycPr 2235 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -tBu 2236 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -Ph 2237 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-Pyridyl 2238 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-Pyridyl 2239 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -4-Pyridyl 2240 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-furanyl 2241 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-furanyl 2242 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-thienyl 2243 CCl N CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-thienyl 2244 CH N CH CH CF.sub.3 C.tbd.C-iPr 2245 CH N CH CH CF.sub.3 C.tbd.C-nPr 2246 CH N CH CH CF.sub.3 C.tbd.C-Et 2247 CH N CH CH CF.sub.3 C.tbd.C-3-Pyridyl 2248 CH N CH CH CF.sub.3 C.tbd.C-2-furanyl 2249 CH N CH CH CF.sub.3 C.tbd.C-3-furanyl 2250 CH N CH CH CF.sub.3 C.tbd.C-2-thienyl 2251 CH N CH CH CF.sub.3 C.tbd.C-3-thienyl 2252 N CCl CH CH CF.sub.3 C.tbd.C-cycPr 2253 N CCl CH CH CF.sub.3 C.tbd.C-iPr 2254 N CCl CH CH CF.sub.3 C.tbd.C-nPr 2255 N CCl CH CH CF.sub.3 C.tbd.C-Bu 2256 N CCl CH CH CF.sub.3 C.tbd.C-iBu 2257 N CCl CH CH CF.sub.3 C.tbd.C-tBu 2258 N CCl CH CH CF.sub.3 C.tbd.C-Et 2259 N CCl CH CH CF.sub.3 C.tbd.C-Me 2260 N CCl CH CH CF.sub.3 C.tbd.C-Ph 2261 N CCl CH CH CF.sub.3 C.tbd.C-2-Pyridyl 2262 N CCl CH CH CF.sub.3 C.tbd.C-3-Pyridyl 2263 N CCl CH CH CF.sub.3 C.tbd.C-4-Pyridyl 2264 N CCl CH CH CF.sub.3 C.tbd.C-2-furanyl 2265 N CCl CH CH CF.sub.3 C.tbd.C-3-furanyl 2266 N CCl CH CH CF.sub.3 C.tbd.C-2-thienyl 2267 N CCl CH CH CF.sub.3 C.tbd.C-3-thienyl 2268 N CCl CH CH CF.sub.3 CH.dbd.CH-cycPr 2269 N CCl CH CH CF.sub.3 CH.dbd.CH-iPr 2270 N CCl CH CH CF.sub.3 CH.dbd.CH-nPr 2271 N CCl CH CH CF.sub.3 CH.dbd.CH-Bu 2272 N CCl CH CH CF.sub.3 CH.dbd.CH-iBu 2273 N CCl CH CH CF.sub.3 CH.dbd.CH-tBu 2274 N CCl CH CH CF.sub.3 CH.dbd.CH-Et 2275 N CCl CH CH CF.sub.3 CH.dbd.CH-Me 2276 N CCl CH CH CF.sub.3 CH.dbd.CH-Ph 2277 N CCl CH CH CF.sub.3 CH.dbd.CH-2-Pyridyl 2278 N CCl CH CH CF.sub.3 CH.dbd.CH-3-Pyridyl 2279 N CCl CH CH CF.sub.3 CH.dbd.CH-4-Pyridyl 2280 N CCl CH CH CF.sub.3 CH.dbd.CH-2-furanyl 2281 N CCl CH CH CF.sub.3 CH.dbd.CH-3-furanyl 2282 N CCl CH CH CF.sub.3 CH.dbd.CH-2-thienyl 2283 N CCl CH CH CF.sub.3 CH.dbd.CH-3-thienyl 2284 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2285 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH(CH.sub.3).sub.2 2286 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2287 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.3 2288 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -cycPr 2289 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -tBu 2290 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -Ph 2291 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-Pyridyl 2292 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-Pyridyl 2293 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -4-Pyridyl 2294 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-furanyl 2295 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-furanyl 2296 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-thienyl 2297 N CCl CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-thienyl 2298 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-cycPr 2299 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-iPr 2300 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-nPr 2301 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-Bu 2302 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-iBu 2303 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-tBu 2304 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-Et 2305 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-Me 2306 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-Ph 2307 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-2-Pyridyl 2308 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-3-Pyridyl 2309 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-4-Pyridyl 2310 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-2-furanyl 2311 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-3-furanyl 2312 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-2-thienyl 2313 N C(OCH.sub.3) CH CH CF.sub.3 C.tbd.C-3-thienyl 2314 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-cycPr 2315 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-iPr 2316 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-nPr 2317 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-Bu 2318 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-iBu 2319 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-tBu 2320 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-Et 2321 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-Me 2322 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-Ph 2323 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-2-Pyridyl 2324 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-3-Pyridyl 2325 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-4-Pyridyl 2326 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-2-furanyl 2327 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-3-furanyl 2328 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-2-thienyl 2329 N C(OCH.sub.3) CH CH CF.sub.3 CH.dbd.CH-3-thienyl 2330 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2331 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH(CH.sub.3).sub.2 2332 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.2 CH.sub.3 2333 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 CH.sub.3 2334 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -cycPr 2335 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -tBu 2336 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -Ph 2337 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-Pyridyl 2338 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-Pyridyl 2339 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -4-Pyridyl 2340 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-furanyl 2341 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-furanyl 2342 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -2-thienyl 2343 N C(OCH.sub.3) CH CH CF.sub.3 CH.sub.2 CH.sub.2 -3-thienyl 2344 N CH CH CH CF.sub.3 C.tbd.C-cyc Pr 2345 N CH CH CH CF.sub.3 C.tbd.C-iPr 2346 N CH CH CH CF.sub.3 C.tbd.C-nPr 2347 N CH CH CH CF.sub.3 C.tbd.C-Et 2348 N CH CH CH CF.sub.3 C.tbd.C-3-Pyridyl 2349 N CH CH CH CF.sub.3 C.tbd.C-2-furanyl 2350 N CH CH CH CF.sub.3 C.tbd.C-3-furanyl 2351 N CH CH CH CF.sub.3 C.tbd.C-2-thienyl 2352 N CH CH CH CF.sub.3 C.tbd.C-3-thienyl______________________________________ *Unless otherwise noted, stereochemistry is (+/-) and in R.sup.2, all double bonds are trans.
Utility
The compounds of this invention possess reverse transcriptase inhibitory activity, in particular, HIV inhibitory efficacy. The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV infection and associated disease,. The compounds of formula (I) possess HIV reverse transcridtase inhibitory activity and are effective as inhibitors of HIV growth. The ability of the compounds of the present invention to inhibit viral growth or infectivity is demonstrated in standard assay of viral growth or infectivity, for example, using the assay described below.
The compounds of formula (I) of the present invention are also useful for the inhibition of HIV in an ex vivo sample containing HIV or expected to be exposed to HIV. Thus, the compounds of the present invention may be used to inhibit HIV present in a body fluid sample (for example, a serum or semen sample) which contains or is suspected to contain or be exposed to HIV.
The compounds provided by this invention are also useful as standard or reference compounds for use in tests or assays for determining the ability of an agent to inhibit viral clone replication and/or HIV reverse transcriptase, for example in a pharmaceutical research program. Thus, the compounds of the present invention may be used as a control or reference compound in such aesays and as a quality control standard. The compounds of the present invention may be provided in a commercial kit or container for use as such standard or reference compound.
Since the compounds of the present invention exhibit specificity for HIV reverse trarscriptase, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays for the detection of HIV reverse transcriptase. Thus, inhibition of the reverse transcriptase activity in an assay (such as the assays described herein) by a compound of the present invention would be indicative of the presence of HIV reverse transcriptase and HIV virus.
As used herein ".mu.g" denotes microgram, "mg" denotes milligram, "g" denotes gram, ".mu.L" denotes microliter, "mL" denotes milliliter, "L" denotes liter, "nM" denotes nanomolar, ".mu.M" denotes micromolar, "mM" denotes millimolar, "M" denotes molar and "nm" denotes nanometer. "Sigma" stands for the Sigma-Aldrich Corp. of St. Louis, Mo.
HIV RNA Assay
DNA Plasmids and in vitro RNA Transcripts
Plasmid pDAB 72 containing both gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19R was prepared according to Erickson-Viitanen et al. AIDS Research and Human Retroviruses 1989, 5, 577. The Iplasmid was linearized with Bam HI prior to the generation of in vitro RNA transcripts using the Riboprobe Gemini systemi II kit (Promega) with T7 RNA polymerase. Synthesized RNA was purified by treatment with RNase free DNAse (Promega), phenol-chloroform extraction, and ethanol precipitation. RNA transcripts were dissolved in water, and stored at -70.degree. C. The concentration of RNA was determined from the A.sub.260.
Probes
Biotinylated capture probes were purified by HPLC after synthesis on an Applied Biosysteits (Foster City, Calif. DNA synthesizer by addition of biotii to the 5' terminal end of the oligonucleotide, using the biotin-phosphoramidite reagent of Cocuzza, Tet. Lett. 1989, 30, 6287. The gag biotinylated capture probe (5-biotin-CTAGCTCCCTGCTTGCCATACTA 3') was complementary to nucleotndes 889-912 of HXB2 and the pol biotinylated capture probe (5'-biotin-CCCTATCATTTTTGGTCCAT- 3') was complementary to nucleotides 2374-2395 of HXB2. Alkaline phosphates conjugated oligonucleotides used as reporter probes were prepared by Syngene (San Diego, Calif.). The pol reporter probe (5' CTGTCTTACTTTGATAAAACCTC 3') was complementary to nucleotides 2403-2425 of HXB2. The gag reporter probe (5' CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides 950-973 of HXB2. All nucleotide positions are those of the GenBank Genetic Sequence Data Bank as accessed through the Genetics Computer Group Sequence Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387). The reporter probes were prepared as 0.5 .mu.M stocks in 2.times.SSC. (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture probes were prepared as 100 .mu.M stocks in water.
Streptavidin Coated Plates
Streptavidin coated plates were obtained from Du Pont Biotechnology Systems (Boston, Ma.).
Cells and Virus Stocks
MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5% fetal calf Eerum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM L-glutamine and 50 .mu.g/mL gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored as aliquots at -70.degree. C. Infectious titers of HIV-1(RF) stocks were 1-3.times.10.sup.7 PFU (plaque forming units)/mL as measured by plaque assay on MT-2 cells (see below). Each aliquot of virus stock used for infection was thawed only once.
For evaluation of antiviral efficacy, cells to be infected were subcultured one day prior to infection. On the day of infection, cells were resuspended at 5.times.10.sup.5 cells/mL in RPMI 1640, 5% FCS for bulk infections or at 2.times.10.sup.6 /mL in Dulbecco's modified Eagles medium with 5% FCS for infection in microtiter plates. Virus was added and culture continued for 3 days at 37.degree. C.
HIV RNA Assay
Cell lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and capture probe to a final guanidinium isothiocyanate concentration of 3 M and a final biotin oligonucleotide concentration of 30 nM. Hybridization was carried out in sealed U bottom 96 well tissue culture plates (Nunc or Costar) for 16-20 hours at 37.degree. C. RNA hybridization reactions were diluted three-fold with deionized water to a final guanddinium isothiocyanate concentration of 1 M and aliquots (150 .mu.L) were transferred to streptavidin coated microtiter plates wells. Binding of capture probe and capture probe-RNA hybrid to the immobilized streptavidin was allowed to proceed for 2 hours at room temperature, after which the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline(PBS), 0.05% Tween 20.) A second hybridization of reporter probe to the immobilized complex of capture probe and hybridized target RNA was carried out in the washed streptavidin coated well by addition of 120 .mu.l of a hybridization cocktail containing 4.times.SSC, 0.66% Triton X 100, 6.66% deionized formamide, 1 mg/mL BSA and 5 nM reporter probe. After hybridization for one hour at 37.degree. C., the plate was again washed 6 times. Immobilized alkaline phosphatase activity was detected by addition of 100 .mu.L of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in buffer .delta. (2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl.sub.2, 5 mM zinc acetate dihydrate and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid). The plates were incubated at 37.degree. C. Fluorescence at 450 nM was measured using a microplate fluorometer (Dynateck) exciting at 365 nM.
Microslate Based Compound Evaluation in HIV-1 Infected MT-2 Cells
Compounds to be evaluated were dissolved in DMSO and diluted in culture medium to twice the highest concentration to be tested and a maximum DMSO concentration of 2%. Further three-fold serial dilutions of the compound in culture medium were performed directly in U bottom microtiter plates (Nunc). After compound dilution, MT-2 (50 .mu.L) were added to a final concentration of 5.times.10.sup.5 per mL (1.times.10.sup.5 per well). Cells were incubated with compounds for 30 minutes at 37.degree. C. in a CO.sub.2 incubator. For evaluatior of antiviral potency, an appropriate dilution of HIV-1 (RF) virus stock (50 .mu.L) was added to culture wells containing cells and dilutions of the test compounds. The final volune in each well was 200 .mu.L. Eight wells per plate were left uninfected with 50 .mu.L of medium added in place of virus, while eight wells were infected in the absence of any antiviral compound. For evaluation of compound toxicity, parallel plates were cultured without virus infection.
After 3 days of culture at 37.degree. C. in a humidified chamber inside a CO.sub.2 incubator, all but 25 .mu.L of medium/well was removed from the HIV infected plates. Thirty seven .mu.L of 5 M GED containing biotinylated capture probe was added to the settled cells and remaining medium in each well to a final concentration of 3 M GED and 30 nM capture probe. Hybridization of the capture probe to HIV RNA in the cell lysate was carried out in the same microplate well used for virus culture by sealing the plate with a plate sealer (Costar), and incubating for 16-20 hrs in a 37.degree. C. incubator. Distilled water was then added to each well to dilute the hybridization reaction three-fold and 150 .mu.L of this diluted mixture was transferred to a stieptavidin coated microtiter plate. HIV RNA was quantitated as described above. A standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA transcript to wells containing lysed uninfected cells, was run on each microtiter plate in order to determine the amount of viral RNA made during the infection.
In order to standardize thE virus inoculum used in the evaluation of compounds for antiviral activity, dilutions of virus were selected which resulted in an IC.sub.90 value (concentration of compound required to reduce the HIV RNA level by 90%) for dideoxycytidine (ddC.) of 0.2 .mu.g/mL. IC.sub.90 values of other antiviral compounds, both more and less potent than ddC, were reproducible using several stocks of HIV-1 (RF) when this procedure was followed. This concentration of virus corresponded to .about.3.times.10.sup.5 PFU (measured by plaque assay on MT-2 cells) per assay well and typically produced approximately 75% of the maximum viral RNA level achievable at any virus inoculum. For the HIV RNA assay, IC.sub.90 values were determined from the percent reduction of net signal (signal from infected cell samples minus signal from uninfected cell samples) in the ANA assay relative to the net signal from infected, untreated cells on the same culture plate (average of eight wells). Valid performance of individual infection and RNA assay tests was judged according to three criteria. It was required that the virus infection should result in an RNA assay signal equal to or greater than the signal generated from 2 ng of pDAB 72 in vitro RNA transcript. The IC.sub.90 for ddC, determined in each assay run, should be between 0.1 and 0.3 .mu.g/mL. Finally, the plateau level of viral RNA produced by an effective reverse transcriptase inhibitor should he less than 10% of the level achieved in an uninhibited infection. A compound was considered active if its IC.sub.90 was found to be less than 20.mu.M.
For antiviral potency tests, all mandpulations in microtiter plates, following the initial addition of 2.times. concentrated compound solution to a single row of wells, were performed using a Perkin Elmer/Cetus ProPette.
HIV-1 RT Assay Materials and Methods
This assay measures HIV-1 FT RNA dependent DNA polymerase activity by the incozporation of 3H dTMP onto the template primer Poly (rA) oligo (dT)12-18. The template primer containing the incorporated radioactivity was separated from unincorporated label by one of two methods:
Method 1. The template primer was precipitated with TCA, collected on glass fiber filters and counted for radioactivity with a scintillation counter.
Method 2. The currently used method is more rapid and convenient. The template primer is captured on an diethyl amino ethyl (DEAE) ion exchange membrane which is then counted for radioactivity after washing off the free nucleotide.
Materials and Reagents
The template primer Poly (rA) oligo (dT)12-18 and dTTP were purchased from Pharmacia Biotech. The template primer and nucleotide were dissolved in diethyl pyrocarbonate water to a concentration of 1 mg/mL and 5.8 mM respectively. The substrates were aliquoted (template primer at 20 .mu.l/aliquot, dTTP at 9 .mu.l/aliquot) and frozer at -20 C.
The 3H dTTP (2.5 mCi/mL in 10 mM Tricine at pH 7.6; specific activity of 90-120 Ci/mmol) and the recombinant HIV-1 Reverse Transcriptase (HxB2 background; 100 U/10 .mu.l in 100 mM potassium phosphate at pH 7.1, 1 mM dithiothreitol and 50% glycerol) were purchased from DUPont NEN. 1 Unit of enzyme is defined by DuPont NEN as the amount required to incorporate 1 nmol of labelled dTTP into acid-insoluble material in 10 minutes at 37 C. The 3H dTTP was aliquoted at 23.2 .mu.l/microfuge tube (58 .mu.Ci) and frozen at -20 C. The HIV-1 Reverse Transcriptase (RT) was diluted 10 fold with RT buffer (80 mM KCl, 50 mM Tris HCl, 12 mM MgC12, mM DTT, 50 .mu.M EGTA, 5 mg/mL BSA, 0.01% Triton-X 100, pH 8.2) and aliquoted at 10 .mu.l/microfuge tube (10 Units/10 .mu.l). One aliquot (enough for 8 assays) wes diluted further to 10 Units/100 .mu.l and aliquoted into 8 tubes (1.25 Units/12.5 .mu.l). All aliquots were frozen at -70 C.
The Millipore Multiscreen DE 96 well filter plates, multiscreen plate adaptors, and microplate press-on adhesive sealing film were purchased from Millipore. The filter plate containing 0.65 .mu.m pore size diethyl amino ethyl cellulose (DEAE) paper disks was pretreated with 0.3 M ammonium formate and 10 mM sodium pyrophosphate (2 times 200 .mu.l /well) at pH 8.0 prior to use. A Skatron 96 well cell harvester and glass fiber filter mats were pulchased from Skatron Instruments. Microscint 20 scirtillation cocktail was purchased from Packard. Beckman Ready Flow III scintillation cocktail was purchased from Becknan.
HIV-1 RT Assay
The enzyme and substrate mixture were freshly prepared from the above stock solutions. 1.25 Units of enzyme was diluted with RT buffer (containing 5 mg/mL BSA) to a concentration of 0.05 Units/10 .mu.l or 0.7 nM. Final enzyme and BSA concentrations in the assay were 0.01 Units or 0.14 nM and 1 mg/mL respectively. The inhibitor and substrate mixture were diluted with RT buffer containing no BSA. All inhibitors were dissolved in dimethyl sulfoxide (DMSO) at a stock concentration of 3 mM and stored at -20 C. after use. A Biomek robot was used to dilute the inhibitors in a 96 well plate. Inhibitors were initially diluted 96 fold from stock and then serially diluted two tines (10 fold/dilution) from 31.25 .mu.M to 3125 nM and 312.5 nM. Depending on the potency of the inhibitor, one of the three dilutions was further diluted. Typically the highest concentration (31.25 .mu.M) was serially diluted three times at 5 fold/dilution to 6.25, 1.25, and 0.25 .mu.M. Final inhibitor concentrations in the assay were 12.5, 2.5, 0.5, and 0.1 .mu.M. For potent inhibitors of HIV-1 RT, the final inhibitor concentrations used were 0.1 or 0.01 that stated above. The substrate mixture contained 6.25 .mu.g/mL of Poly (rA) oligo (dT)12-18 and 12.5 .mu.M of dTTP (58 .mu.Ci 3H dTTP). The final substrate concentrations were 2.5 .mu.g/mL and 5 .mu.M respectively.
Using the Beckman Instrumerts Biomek robot, 10 .mu.l of HIV-1 RT was combined with 20 .mu.l of inhibitor in a 96 well U bottom plate. The enzyme and inhibitor were preincubated at ambient temperature for 6 minutes. 20 .mu.l of the substrate mixture was added to each well to initiate the reaction (total volume was 50 .mu.l). The reactions were incubated at 37 C. and terminated after 45 minutes.
For method 1,200 .mu.l of an ice-cold solution of 13% trichloroacetic acid (TCA) and 10 mM sodium pyrophosphate was added to each of the 96 wells. The 96 well plate was then placed in an ice-water bath for 30 minutes. Using A Skatron 96 well cell harvester, the acid precipitable material was collected on a glass fiber filter mat that had been presoaked in 13% TCA and 10 mM sodium pyro)hosphate. The filter disks were washed 3 times (2.0 mL/wash, with 1 N HCl and 10 mM sodium pyrophosphate. The filter disks were punched out into scintillation vials, 2.0 mL of Beckman Ready Flow III scintillant was added, and the vials were counted for radioactivity for 1 minute.
For method 2, the assay was terminated with the addition of 175 1 .mu.l/well of 50 mM EDTA at pH 8.0. Then 180 .mu.l of the mixture was transferred to a pretreated Millipore DE 96 well filter plate. Vacuum was appliel to the filter plate to aspirate away the liquid and immobilize the template primer on the DEAE filter disks. Each well was washed 3 times with 200 .mu.l of 0.3 M ammonium formate and 10 mM sodium pyrophosphate at pH 8.0. 50 .mu.l of microscint 20 scintillation cocktail was added to each well and the plate was counted for radioactivity on a Packard Topcount at 1 minute/well.
The IC.sub.50 values are calculated with the equation:
IC.sub.50 =[Inh]/(1/fractional activity-1)
where the fractional activity=RT activity (dpms) in the presence of inhibitor/RT activity (dpms) in the absence of inhibitor. For a given inhibitor, the IC.sub.50 values were calculated for the inhibitor concentrations that range between 0.1-0.8 fractional activity. The IC.sub.50 values in this range (generally 2 values) were averaged. A compound was considered active if its IC.sub.50 was found to be less than 12.mu.M.
Protein Binding and Mutant Resistance
In order to characterize NNRTI analogs for their clinical efficacy potential the effect of plasma proteins on antiviral potency and measurements of antiviral potency against wild type and mutant variants of HIV which carry amino acid changes in the known binding site for NNRTIs were examined. The rationale for this testing strategy is two fold:
1. Many drugs are extensively bound to plasma proteins. Although the binding affinity for most drugs for the major components of human plasma, namely, human serum albumin (HSA) or alpha-1-acid glycoprotein (AAG), is low, these major components are present in high concentration in the blood. Only free or unbound drug is available to cross the infected cell membrane for interaction with the target site (i.e., HIV-1 reverse transcriptase, HIV-1 RT). Therefore, the effect of added HSA+AAG on the antiviral potency in tissue culture more closely reflects the potency of a given compound in the clinical setting. The concentration of compound required for 90% inhibitiion of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. The fold increase in apparent IC90 for test compounds in the presence or added levels of HSA and AAG that reflect in vivo concentrations (45 mg/mL HSA, 1 mg/mL AAG) was then calculated. The lower the fold increase, the more compound will be available to interact with the target site.
2. The combination of the high rate of virus replication in the infected individual and the poor fidelity of the viral RT results in the production of a quasi-species or mixtures of HIV species in the infected individual. These species will include a majority wild type species, but also mutant variants of HIV and the proportion of a given mutant will reflect its relative fitness and replication rate. Because mutant variants including mutants with changes in the amino acid sequence of the viral RT likely pre-exist in the infected individual's quasi-species, the overall potency observed in the clinical setting will reflect the ability of a drug to inhibit not only wild type HIV-1, but mutant variants as well. We thus have constructed, in a known genetic background, mutant variants of HIV-1 which carry amino acid substitutions at positions thought to be involved in NNRTI binding, and measured the ability of test compounds to inhibit replication of these mutant viruses. The concentration of compound required for 90% inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. It is desirable to have a compound which has high activity against a variety of mutants.
Dosage and Formulation
The antiviral compounds of this invention can be administered as treatment for viral infections by any means that produces contact of the active agent with the agent's site of action, i.e., the viral reverse transcriptase, in the body of a mammal. They can be administered by any conventional means available for use in conjunction with pharmaceuticals, either as individual therapeutic agents or in a combination of therapeutic agents. They can be administered alone, but preferably are administered with a pharmaceutical carrier selected on the basis of the chosen route of administration and standard pharmaceutical practice.
The dosage administered will, of course, vary depending upon known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment; the frequency of treatment; and the effect desired. A daily dosage of active ingredient can be expected to be about 0.001 to about 1000 milligrams per kilogram of body weight, with the preferred dose being about 0.1 to about 30 mg/kg.
Dosage forms of composition, suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions the active ingredient will ordinarily be present in an amount of about 0.5-95% by weight based on the total weight of the composition. The active ingredient can be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally, in sterile liquid dosage forms.
Gelatin capsules contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.
In general, water, a suitable oil, saline, aqueous dextrose (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are suitable carriers for parenteral solutions. Solutions for parenteral administration preferably contain a water soluble salt of the active ingredient, suitable stabilizing agents, and if necessary, buffer substances. Antioxidizing agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, are suitable stabilizing agents. Also used are citric acid and its salts, and sodium EDTA. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Suitable pharmaceutical carriers are described in Remington's PharmacEutical Sciences, supra, a standard reference text in this field.
Useful pharmaceutical dosage-forms for administration of the compounds of this invention can be illustrated as follows:
Capsules
A large number of unit capsules can be prepared by filling standard two-piece hard gelatin capsules each with 100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose, and 6 mg magnesium stearic.
Soft Gelatin Capsules
A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules should then be washed and dried.
Tablets
A large number of tablets can be prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose. Appropriate coatings may be applied to increase palatability or delay absorption.
Suspension
An aqueous suspension can le prepared for oral administration so that each 5 mL contain 25 mg of finely divided active ingredient, 200 ng of sodium carboxymethyl cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025 mg of vanillin.
Injectable
A parenteral composition suitable for administration by injection can be prepared by stirring 1.5% by weight of active ingredient in 10% by volune propylene glycol and water. The solution is sterilized by commonly used techniques.
Combination of Components (a) and (b)
Each therapeutic agent component of this invention can independently be in any dosage form, such as those described above, and can also be administered in various ways, as described above. In the following description component (b) is to be understood to represent one or more agents as described previously. Thus, if components (a) and (b) are to be treated the same or independently, each agent of component (b) may also be treated the same or independently.
Components (a) and (b) of the present invention may be formulated together, in a single dosage unit (that is, combined together in one capsule, tablet, powder, or liquid, etc.) as a combination product. When component (a) and (b) are not formulated together in a single dosage unit, the component (a) may be administered at the same time as component (b) or in any order; for example component (a) of this invention may be administered first, followed by administration of component (b), or they may be administered in the reverse order. If component (b) contains more that one agent, e.g., one RT inhibitor and one protease inhibitor, these agents may be administered together or in any order. When not administered at the same time, preferably the administration of component (a) and (b) occurs less than about one hour apart. Preferable, the route of administration of component (a) and (b) is oral. The terms oral agent, oral inhibitor, oral compound, or the like, as used herein, denote compounds which may be orally administered. Although it is preferable that component (a) and component (b) both be administered by the same route (that is, for example, both orally) or dosage form, if desired, they may each be administered by different routes (that is, for example, one component of the combination product may be administered orally, and another component may be administered intravenously) or dosage forms.
As is appreciated by a medical practitioner skilled in the art, the dosage of the combination therapy of the invention may vary depending upon various factors such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the kind of concurrent treatment, the frequency of treatment, and the effect desired, as described above.
The proper dosage of components (a) and (b) of the present invention will be readily ascertainable by a medical practitioner skilled in the art based upon the present disclosure. By way of general guidance, typically a daily dosage may be about 100 milligrams to about 1.5 grams of each component. If component (b) represents more than one compound, then typically a daily dosage may be about 100 milligrams to about 1.5 grams or each agent of component (b). By way of general guidance, when the compounds of component (a) and component (b) are administered in combination, the dosage amount of each component may be reduced by about 70-80% relative to the usual dosage of the component when it is administered alone as a single agent for the treatment of HIV infection, in view of the synergistic effect of the combination.
The combination products of this invention may be formulated such that, although the active ingredients are combined in a single dosage unit, the physical contact between the active ingredients is minimized. In order to minimize contact, for example, where the product is orally administered, one active ingredient may be enteric coated. By enteric coating one of the active ingredients, it is possible not only to minimize the contact between the combined active ingredients, but also, it is possible to control the release of one of these components in the gastrointestinal tract such that one of these components is not released in the stomach but rather is released in the intestines. Another embodiment of this invention where oral administration is desired provides for a combination product wherein one of the active ingredients is coated with a sustained-release material which effects a sustained-release throughout the gastrointestinal tract and also serves to minimize physical contact between the combined active ingredients. Furthermore, the sustained-released component can be additionally enteric coated such that the release of this component occurs only in the intestine. Still another approach would involve the formulation of a combination product in which the one component is coated with a sustained and/or enteric release polymer, and the other component is also coated with a polymer such as a lowviscosity grade of hydroxypropyl methylcellulose or other appropriate materials as known in the art, in order to further separate the active components. The polymer coating serves to form an additional barrier to interaction with the other component. In each formulation wherein contact is prevented between components (a) and (b) via a coating or some other material, contact may also be prevented between the individual agents of component (b).
Dosage forms of the combination products of the present invention wherein one active ingredient is enteric coated can be in the form of tablets such that the enteric coated component and the other active ingredient are blended together and then compressed into a tablet or such that the enteric coated component is compressed into one tablet layer and the other active ingredient is compressed into an additional layer. Optionally, in order to further separate the two layers, one or more placebo layers may be present such that the placebo layer is between the layers of active ingredients. In addition, dosage forms of the present invention can be in the form of capsules wherein one active ingredient is compressed into a tablet or in the form of a plurality of microtablets, particles, granules or non-perils, which are then enteric coated. Phese enteric coated microtablets, particles, granule, or non-perils are then placed into a capsule or compressed into a capsule along with a granulation of the other active ingredient.
These as well as other ways of minimizing contact between the components of combination products of the present invention, whether administered on a single dosage form or administered in separate forms but at the same time or concurrently by the same manner, will be readily apparent to those skilled in the art, based on the present disclosure.
Pharmaceutical kits useful for the treatment of HIV infection, which comprise a therapeutically effective amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b), in one or more sterile containers, are also within the ambit of the present invention. Sterilization of the container may be carried out using conventional sterilization methodology well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers. The sterile containers of materials may comprise separate containers, or one or more multi-part containers, as desired. Component (a) and component (b), may be separate, or physically combined into a single dosage form or unit as described above. Such kits may further include, if desired, one or more of various conventional pharmaceutical kit components, such as for example, one or more pharmaceutically acceptable carriers, additional vials for mixing the components, etc, as will be readily apparent to those skilled in the art. Instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, may also be included in the kit.
Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.

Number	Name	Date	Kind
4476133	Hirai et al.	Oct 1984
5519021	Young et al.	May 1996

Number	Date	Country
142361	May 1985	EPX
567026	Oct 1993	EPX
8-259447	Oct 1996	JPX

5,5-disubstituted-1,5-dihydro-4,1-benzoxazepin-2 (3H)-ones useful as HIV reverse transcriptase inhibitors

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

US Referenced Citations (2)

Foreign Referenced Citations (3)

Non-Patent Literature Citations (2)

Entry
JPAB abstract of JP 08 259 447, Oct. 1996.
DWPI abstract of JP 08 259 447, Oct. 1996.