CC0000: Color is not claimed as a feature of the mark.
DM0000: The mark consists of the wording "NAB" in capital letters and "SYS" in lowercase with the final "S" forming part of a helix with the remaining letters, "CGATTCCGATCTTACTGAGATAAACTGAACTGAAATTCCGATCCGAATCTCAAGATAGATACTA", being a tail therefrom.
GS0091: Laboratory equipment, namely, bio-analytical devices using electronic detection for nucleic acid analysis and molecular diagnostics
GS0421: Laboratory research in the field of bio-analytics with respect to nucleic acid analysis and molecular diagnostics