Patent Application
20210298276
The present disclosure relates generally to methods of sterilizing and sex-determining freshwater and seawater organisms.
The following paragraphs are not an admission that anything discussed in them is prior art or part of the knowledge of persons skilled in the art.
Fish species have been genetically engineered (GE) to produce valuable pharmaceutical proteins or to incorporate advantageous traits for aquaculture. A variety of fish with improved growth rates, food conversion ratios, resistance to disease, and enhanced nutritional benefits, have been developed to address the future demand for seafood and the need to improve sustainability in the aquaculture industry. However, worldwide adoption of these GE fish is hampered by concerns over their accidental release into natural ecosystems. Cultured fish have been shown to reproduce and survive in natural environments, resulting in feral populations. Similarly, GE fish may have native relatives, raising the possibility that the genetic modifications will spread throughout the wild population and alter the native gene pool. Commercial GE fish therefore represent a potential threat to the environment and a challenge to policy makers and regulatory agencies tasked with risk-benefit evaluations.
One approach to address one or more of the aforementioned issues is to sterilize fish. The induction of triploidy is the most used and best studied approach for producing sterile fish. Generally, triploid fish are produced by applying temperature or pressure shock to fertilized eggs, forcing the incorporation of the second polar body and producing cells with three chromosome sets (3N). Triploid fish do not develop normal gonads as the extra chromosome set disrupts meiosis. At the industrial scale, the logistics of reliably applying pressure or temperature shocks to batches of eggs is complicated and carries significant costs. An alternative to triploid induced by physical treatments is triploid induced by genetics, which results from crossing a tetraploid with a diploid fish. Tetraploid fish, however, are difficulty to generate due to poor embryonic survival and slow growth. In some examples, triploid males produce some normal haploid sperm cells thus allowing males to fertilize eggs, though at a reduced efficiency. Also, in some species, negative performance characteristics have been associated with triploid phenotype, including reduced growth and sensitivity to disease.
Another approach for sterilizing fish is by hormone treatment extending over several weeks. However, in many cases, including these intensive long-term treatment processes do not have a desirable efficacy of sterility, and/or have been associated with decreased fish growth performance. Furthermore, treatments involving a synthetic steroid may result in higher mortality rates.
Another approach for sterilizing fish is by using transgenic-based technologies, which include a step of integrating a transgene that induce germ cell death or disrupts their migration patterns resulting in their ablation in developing embryos. However, transgenes are subject to position effect as well as silencing. Consequently, such approaches are subject to extended regulatory review processes before being considered acceptable for commercial use.
An alternative approach for sterilizing fish is by knockdown or knockout of genes governing primordial germ cell (PGC) development. Such approaches have been reported to cause PGC loss and sterility. However, the sterile trait in these fish is not heritable. Accordingly, utilizing an approach of knockdown or knockout of genes governing PGC development may be logistically challenging and costly and thus impractical to efficiently mass produce sterile fish at commercial scale.
Mechanisms governing sexual or gonadal differentiation in teleost fish are complex processes influenced by internal (genetic and endocrine factors) and external factors, including social interaction and environmental conditions (water temperature, pH and oxygen), whose relative contributions can vary significantly depending on the species.
Improvements in generating sterile, sex-determined fish, crustaceans, or mollusks is desirable.
The following introduction is intended to introduce the reader to this specification but not to define any invention. One or more inventions may reside in a combination or sub-combination of the instrument elements or method steps described below or in other parts of this document. The inventors do not waive or disclaim their rights to any invention or inventions disclosed in this specification merely by not describing such other invention or inventions in the claims.
One or more of the previously proposed methods used for sterilizing freshwater and seawater organisms may result in: (1) an insufficient efficacy; (2) increased difficulty to propagate the sterility trait by, for example, having to perform genetic selection to identify a subpopulation of sterile individual, and/or repeating treatment at each generation; (3) an increase in operating costs by, for example, incorporating significant changes in husbandry practices, being untransferable across multiple species, increasing production times, increasing the percentage of sterile organisms with reduced growth and increased sensitivity to disease, increasing mortality rates of sterile organisms, or a combination thereof; (4) gene flow to wild populations and colonization of new habitats by cultured, non-native species; or (4) a combination thereof.
The present disclosure provides methods of producing sex-determined sterilized freshwater and seawater organisms by disrupting their sexual differentiation and gametogenesis pathways. One or more examples of the present disclosure may: (1) increase efficacy of sterilization, by for example, allowing mass production of sterile individuals and ensuring that all individuals are completely sterile; (2) decrease operating costs by, for example, decreasing the amount of costly equipment or treatments, being commercially scalable, being transferable across multiple species, decreasing feed, decreasing production times, decreasing the percentage of organisms that attain sexually maturity, increasing the physical size of sexually mature organisms, or a combination thereof; (3) decrease gene flow to wild populations and colonization of new habitats by cultured non-native species; (4) increase culture performance by decreasing loss of energy to gonad development; or (5) a combination thereof, compared to one or more previously proposed methods used for sterilizing freshwater and seawater organisms.
One or more examples of the present disclosure may yield at least a 10% improvement in food conversion rates (FCR=amount of weight gained per quantity of food fed) and about 20% faster growth rates, compared to other lines currently used in production systems (Methyltestosterone treatment). These performance benefits may only impact feed costs (direct reduction in feed costs) and labor (reduced labor due to shortened culture times). Based on averaged itemized costs of a U.S. tilapia farming operation producing 1000 lbs of product, savings of about $0.23 per market sized fish (1.5 pounds) using all male sterile-Tilapia may be realized, suggesting that an operation choosing to retain its savings in production costs may experience an increase in profit margin approaching about 130%.
The present disclosure also discusses methods of making broodstock freshwater and seawater organisms for use in producing sex-determined sterilized freshwater and seawater organisms, as well as the broodstock itself.
The present disclosure provides a method of generating a sterile sex-determined fish, crustacean, or mollusk, comprising the steps of: breeding (i) a fertile hemizygous mutated female fish, crustacean, or mollusk having at least a first mutation and a second mutation with (ii) a fertile hemizygous mutated male fish, crustacean, or mollusk having at least the first mutation and the second mutation; and selecting a progenitor that is homozygous by genotypic selection, the homozygous mutated progenitor being the sterile sex-determined fish, crustacean, or mollusk, wherein the first mutation disrupts one or more genes that specify sexual differentiation, and wherein the second mutation disrupts one or more genes that specify gamete function.
The present disclosure also provides a method of generating a sterile sex-determined fish, crustacean, or mollusk, comprising the step of: breeding (i) a fertile homozygous mutated female fish, crustacean, or mollusk having at least a first mutation and a second mutation with (ii) a fertile homozygous mutated male fish, crustacean, or mollusk having at least the first mutation and the second mutation to produce the sterile sex-determined fish, crustacean, or mollusk, wherein the first mutation disrupts one or more genes that specify sexual differentiation, wherein the second mutation disrupts one or more genes that specify gamete function, and wherein the fertility of the fertile homozygous female fish, crustacean, or mollusk and the fertile homozygous mutated male fish, crustacean, or mollusk has been rescued.
The fertility rescue may comprise germline stem cell transplantation. The fertility rescue may further comprise sex steroid alteration. The alteration of sex steroid may be an alteration of estrogen, or an alteration of an aromatase inhibitor.
The germline stem cell transplantation may comprise the steps of: obtaining a germline stem cell from a sterile homozygous male fish, crustacean, or mollusk having at least the first mutation and the second mutation or a germline stem cell from a sterile homozygous female fish, crustacean, or mollusk having at least the first mutation and the second mutation; and transplanting the germline stem cell into a germ cell-less recipient male fish, crustacean, or mollusk, or into a germ cell-less recipient female fish, crustacean, or mollusk. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish, crustacean, or mollusk may be homozygous for a null mutation of the dnd, Elavl2, vasa, nanos3, or piwi-like gene. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using ploidy manipulation. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created by hybridization. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using exposure to high levels of sex hormones.
The germline stem cell transplantation may comprise the steps of: obtaining a spermatogonial stem cell from a sterile homozygous male fish, crustacean, or mollusk having at least the first mutation and the second mutation or a oogonial stem cell from a sterile homozygous female fish, crustacean, or mollusk having at least the first mutation and the second mutation; and transplanting the spermatogonial stem cell into a testis of a germ cell-less fertile male fish, crustacean, or mollusk or the oogonial stem cell into an ovary of a germ cell-less fertile female fish, crustacean, or mollusk. The germ cell-less fertile male fish, crustacean, or mollusk and the germ cell-less fertile female fish, crustacean, or mollusk may be homozygous for the mutation of the dnd, ElavI2, vasa, nanos3, or piwi-like gene. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using ploidy manipulation. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created by hybridization. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using exposure to high levels of sex hormones.
The sterile sex-determined sterile fish, crustacean, or mollusk may be a sterile male fish, crustacean, or mollusk. The first mutation may comprise a mutation in one or more genes that modulates the synthesis of androgen and/or estrogen. The first mutation may comprise a mutation in one or more genes that modulate the expression of aromatase Cyp19a1a, Cyp17, or a combination thereof. The one or more genes that modulate the expression of aromatase Cyp19a1a may be one or more genes selected from the group consisting of cyp19a1a, FoxL2, and an ortholog thereof. The one or more genes that modulate the expression of Cyp17 may be cyp17l or an ortholog thereof. The second mutation may comprise a mutation in one or more genes that modulate spermiogenesis. The second mutation may comprise a mutation in one or more genes that cause globozoospermia. The second mutation in one or more genes that cause globozoospermia may cause sperm with round-headed, round nucleus, disorganized midpiece, partially coiled tails, or a combination thereof. The second mutation may comprise a mutation in one or more genes selected from the group consisting of Gopc, Hiat1, Tjp1a, Smap2, Csnk2a2, and an ortholog thereof.
The sterile sex-determined sterile fish, crustacean, or mollusk may be a sterile female fish, crustacean, or mollusk. The first mutation may comprise a mutation in one or more genes that modulate the expression of an aromatase Cyp19a1a inhibitor. The one or more genes that modulate the expression of an aromatase Cyp19a1a inhibitor may be one or more genes selected from the group consisting of Gsdf, dmrt1, Amh, Amhr, and an ortholog thereof. The second mutation may comprise a mutation in one or more genes that modulate oogenesis, folliculogenesis, or a combination. The one or more genes that modulate oogenesis may modulate the synthesis of estrogen. The one or more genes that modulate the synthesis of estrogen may be FSHR or an ortholog thereof. The one or more genes that modulate folliculogenesis may modulate the expression of vitellogenins. The one or more genes that modulate the expression of vitellogenins may be vtgs or an ortholog thereof. The one or more genes that modulate the expression of vitellogenins may be a mutation in a gene encoding or regulating: Vitellogenin; Estrogen receptor1; Cytochrome p450, family 1, subfamily a; zona pellucida glycoprotein; Choriogenin H; Peroxisome proliferator-activated receptor; Steroidogenic acute regulatory protein, or an ortholog thereof.
The present disclosure also provides a method of generating a sterile sex-determined fish, crustacean, or mollusk, comprising the step of: breeding (i) a fertile female fish, crustacean, or mollusk having a homozygous mutation with (ii) a fertile male fish, crustacean, or mollusk having a homozygous mutation to produce the sterile sex-determined fish, crustacean, or mollusk, wherein the mutation directly or indirectly disrupts spermiogenesis, and/or directly disrupts vitellogenesis, and wherein the fertility of the fertile female fish, crustacean, or mollusk and the fertile male fish, crustacean, or mollusk have been rescued.
The mutation that directly or indirectly disrupts spermiogenesis may be a mutation in Gopc, Hiat1, Tjp1a, Smap2, Csnk2a2, or an ortholog thereof. The mutation that directly disrupts vitellogenesis may be a mutation in a gene encoding or regulating: Vitellogenin; Estrogen receptor1; Cytochrome p450, family 1, subfamily a; zona pellucida glycoprotein; Choriogenin H; Peroxisome proliferator-activated receptor; Steroidogenic acute regulatory protein, or an ortholog thereof. The fertile female fish, crustacean, or mollusk and the fertile male fish, crustacean, or mollusk may have a plurality of homozygous mutations that, in combination: directly or indirectly disrupt spermiogenesis; directly disrupt vitellogenesis; or both.
The fertility rescue may comprise germline stem cell transplantation. The fertility rescue may further comprise sex steroid alteration. The alteration of sex steroid may be an alteration of estrogen, or an alteration of an aromatase inhibitor.
The germline stem cell transplantation may comprise the steps of: obtaining a germline stem cell from a sterile homozygous male fish, crustacean, or mollusk having at least the homozygous mutation or a germline stem cell from a sterile homozygous female fish, crustacean, or mollusk having at least the homozygous mutation; and transplanting the germline stem cell into a germ cell-less recipient male fish, crustacean, or mollusk, or into a germ cell-less recipient female fish, crustacean, or mollusk. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish, crustacean, or mollusk may be homozygous for a null mutation of the dnd, Elavl2, vasa, nanos3, or piwi-like gene. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using ploidy manipulation. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created by hybridization. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using exposure to high levels of sex hormones.
The fertile female fish, crustacean, or mollusk and the fertile male fish, crustacean, or mollusk may have an additional homozygous mutation that specifies sexual differentiation. The mutation that specifies sexual differentiation may modulate the expression of aromatase Cyp19a1a, Cyp17, an inhibitor to aromatase Cyp19a1a, or a combination thereof. The mutation that modulates the expression of Cyp17 may be a mutation in cyp17l or an ortholog thereof. The mutation that modulates the expression of aromatase Cyp19a1a inhibitor may be a mutation in Gsdf, dmrt1, Amh, Amhr, or an ortholog thereof.
The breeding step of the herein disclosed methods may comprise hybridization or hormonal manipulation and breeding strategies, to specify sexual differentiation.
The fish, crustacean, or mollusk of the herein disclosed methods may be a fish.
The present disclosure also provides a fertile homozygous mutated fish, crustacean, or mollusk for producing a sterile sex-determined fish, crustacean, or mollusk, the fertile homozygous mutated fish, crustacean, or mollusk having at least a first mutation and a second mutation, wherein the first mutation disrupts one or more genes that specify sexual differentiation, wherein the second mutation disrupts one or more genes that specify gamete function, and wherein the fertility of the fertile homozygous mutated fish, crustacean, or mollusk has been rescued. The fertility rescue may comprise germline stem cell transplantation. The fertility rescue may further comprise sex steroid alteration. The alteration of sex steroid may be an alteration of estrogen, or an alteration of an aromatase inhibitor.
The germline stem cell transplantation may comprise the steps of: obtaining a germline stem cell from a sterile homozygous male fish, crustacean, or mollusk having at least the first mutation and the second mutation or a germline stem cell from a sterile homozygous female fish, crustacean, or mollusk having at least the first mutation and the second mutation; and transplanting the germline stem cell into a germ cell-less recipient male fish, crustacean, or mollusk, or into a germ cell-less recipient female fish, crustacean, or mollusk. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish, crustacean, or mollusk may be homozygous for a null mutation of the dnd, Elavl2, vasa, nanos3, or piwi-like gene. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using ploidy manipulation. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created by hybridization. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using exposure to high levels of sex hormones.
The germline stem cell transplantation may comprise the steps of: obtaining a spermatogonial stem cell from a sterile homozygous male fish, crustacean, or mollusk having at least the first mutation and the second mutation or a oogonial stem cell from a sterile homozygous female fish, crustacean, or mollusk having at least the first mutation and the second mutation; and transplanting the spermatogonial stem cell into a testis of a germ cell-less fertile male fish, crustacean, or mollusk or the oogonial stem cell into an ovary of a germ cell-less fertile female fish, crustacean, or mollusk. The germ cell-less fertile male fish, crustacean, or mollusk and the germ cell-less fertile female fish, crustacean, or mollusk may be homozygous for the mutation of the dnd, Elavl2, vasa, nanos3, or piwi-like gene. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using ploidy manipulation. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created by hybridization. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using exposure to high levels of sex hormones.
The sterile sex-determined sterile fish, crustacean, or mollusk may be a sterile male fish, crustacean, or mollusk. The first mutation may comprise a mutation in one or more genes that modulates the synthesis of androgen and/or estrogen. The first mutation may comprise a mutation in one or more genes that modulate the expression of aromatase Cyp19a1a, Cyp17, or a combination thereof. The one or more genes that modulate the expression of aromatase Cyp19a1a may be one or more genes selected from the group consisting of cyp19a1a, FoxL2, and an ortholog thereof. The one or more genes that modulate the expression of Cyp17 may be cyp17l or an ortholog thereof. The second mutation may comprise a mutation in one or more genes that modulate spermiogenesis. The second mutation may comprise a mutation in one or more genes that cause globozoospermia. The second mutation in one or more genes that cause globozoospermia may cause sperm with round-headed, round nucleus, disorganized midpiece, partially coiled tails, or a combination thereof. The second mutation may comprise a mutation in one or more genes selected from the group consisting of Gopc, Hiat1, Tjp1a, Smap2, Csnk2a2, and an ortholog thereof.
The sterile sex-determined sterile fish, crustacean, or mollusk may be a sterile female fish, crustacean, or mollusk. The first mutation may comprise a mutation in one or more genes that modulate the expression of an aromatase Cyp19a1a inhibitor. The one or more genes that modulate the expression of an aromatase Cyp19a1a inhibitor may be one or more genes selected from the group consisting of Gsdf, dmrt1, Amh, Amhr, and an ortholog thereof. The second mutation may comprise a mutation in one or more genes that modulate oogenesis, folliculogenesis, or a combination. The one or more genes that modulate oogenesis may modulate the synthesis of estrogen. The one or more genes that modulate the synthesis of estrogen may be FSHR or an ortholog thereof. The one or more genes that modulate folliculogenesis may modulate the expression of vitellogenins. The one or more genes that modulate the expression of vitellogenins may be vtgs or an ortholog thereof. The one or more genes that modulate the expression of vitellogenins may be a mutation in a gene encoding or regulating: Vitellogenin; Estrogen receptor1; Cytochrome p450, family 1, subfamily a; zona pellucida glycoprotein; Choriogenin H; Peroxisome proliferator-activated receptor; Steroidogenic acute regulatory protein, or an ortholog thereof.
The present disclosure also provides a fertile fish, crustacean, or mollusk having a homozygous mutation for producing a sterile sex-determined fish, crustacean, or mollusk, wherein the mutation directly or indirectly disrupts spermiogenesis, and/or directly disrupts vitellogenesis, and wherein the fertility of the fertile fish, crustacean, or mollusk has been rescued.
The mutation that directly or indirectly disrupts spermiogenesis may be a mutation in Gopc, Hiat1, Tjp1a, Smap2, Csnk2a2, or an ortholog thereof. The mutation that directly disrupts vitellogenesis may be a mutation in a gene encoding or regulating: Vitellogenin; Estrogen receptor1; Cytochrome p450, family 1, subfamily a; zona pellucida glycoprotein; Choriogenin H; Peroxisome proliferator-activated receptor; Steroidogenic acute regulatory protein, or an ortholog thereof. The fertile fish, crustacean, or mollusk may have a plurality of homozygous mutations that, in combination: directly or indirectly disrupt spermiogenesis; directly disrupt vitellogenesis; or both. The fertility rescue may comprise germline stem cell transplantation. The fertility rescue may further comprise sex steroid alteration. The alteration of sex steroid may be an alteration of estrogen, or an alteration of an aromatase inhibitor.
The germline stem cell transplantation may comprise the steps of: obtaining a germline stem cell from a sterile homozygous male fish, crustacean, or mollusk having at least the homozygous mutation or a germline stem cell from a sterile homozygous female fish, crustacean, or mollusk having at least the homozygous mutation; and transplanting the germline stem cell into a germ cell-less recipient male fish, crustacean, or mollusk, or into a germ cell-less recipient female fish, crustacean, or mollusk. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish, crustacean, or mollusk may be homozygous for a null mutation of the dnd, Elavl2, vasa, nanos3, or piwi-like gene. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using ploidy manipulation. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created by hybridization. The germ cell-less recipient male fish, crustacean, or mollusk and the germ cell-less recipient female fish crustacean, or mollusk may be created using exposure to high levels of sex hormones.
The fertile fish, crustacean, or mollusk may have an additional homozygous mutation that specifies sexual differentiation. The mutation that specifies sexual differentiation may modulate the expression of aromatase Cyp19a1a, Cyp17, an inhibitor to aromatase Cyp19a1a, or a combination thereof. The one or more genes that modulate the expression of aromatase Cyp19a1a may be one or more genes selected from the group consisting of cyp19a1a, FoxL2, and an ortholog thereof. The one or more genes that modulate the expression of aromatase Cyp19a1a inhibitor may be one or more genes selected from the group consisting of Gsdf, dmrt1, Amh, Amhr, and an ortholog thereof.
Producing a sterile sex-determined fish, crustacean, or mollusk may comprise a breeding step comprising hybridization or hormonal manipulation and breeding strategies, to specify sexual differentiation.
The herein disclosed fertile fish, crustacean, or mollusk may be a fish.
The present disclosure also provides a method of making a fertile homozygous mutated fish, crustacean, or mollusk that generates a sterile sex-determined fish, crustacean, or mollusk, comprising the steps of: breeding (i) a fertile hemizygous mutated female fish, crustacean, or mollusk having at least a first mutation and a second mutation with (ii) a fertile hemizygous mutated male fish, crustacean, or mollusk having at least the first mutation and the second mutation; selecting a progenitor that is homozygous by genotypic selection; and rescuing the fertility of the homozygous progenitor, wherein the first mutation disrupts one or more genes that specify sexual differentiation, and wherein the second mutation disrupts one or more genes that specify gamete function.
Other aspects and features of the present disclosure will become apparent to those ordinarily skilled in the art upon review of the following description of specific examples in conjunction with the accompanying figures.
Examples of the presently disclosed methods and organisms will now be described, by way of example only, with reference to the attached Figures.
Generally, the present disclosure provides a method of generating a sterile sex-determined fish, crustacean, or mollusk. The method comprises the steps of: breeding (i) a fertile hemizygous mutated female fish, crustacean, or mollusk having at least a first mutation and a second mutation with (ii) a fertile hemizygous mutated male fish, crustacean, or mollusk having at least the first mutation and the second mutation; and selecting a progenitor that is homozygous by genotypic selection, the homozygous mutated progenitor being the sterile sex-determined fish, crustacean, or mollusk. The first mutation disrupts one or more genes that specify sexual differentiation. The second mutation disrupts one or more genes that specify gamete function.
The present disclosure also provides a method of generating a sterile sex-determined fish, crustacean, or mollusk. The method comprises the step of: breeding (i) a fertile homozygous mutated female fish, crustacean, or mollusk having at least a first mutation and a second mutation with (ii) a fertile homozygous mutated male fish, crustacean, or mollusk having at least the first mutation and the second mutation to produce the sterile sex-determined fish, crustacean, or mollusk. The first mutation disrupts one or more genes that specify sexual differentiation. The second mutation disrupts one or more genes that specify gamete function. The fertility of the fertile homozygous female fish, crustacean, or mollusk and the fertile homozygous mutated male fish, crustacean, or mollusk having been rescued.
The present disclosure also provides a method of generating a sterile sex-determined fish, crustacean, or mollusk. The method comprises the step of: breeding (i) a fertile female fish, crustacean, or mollusk having a homozygous mutation with (ii) a fertile male fish, crustacean, or mollusk having a homozygous mutation to produce the sterile sex-determined fish, crustacean, or mollusk. The mutation directly or indirectly disrupts spermiogenesis, and/or that directly disrupts vitellogenesis. The fertility of the fertile female fish, crustacean, or mollusk and the fertile male fish, crustacean, or mollusk have been rescued.
The present disclosure also provides method of making a fertile homozygous mutated fish, crustacean, or mollusk that generates a sterile sex-determined fish, crustacean, or mollusk. The method comprises the steps of: breeding (i) a fertile hemizygous mutated female fish, crustacean, or mollusk having at least a first mutation and a second mutation with (ii) a fertile hemizygous mutated male fish, crustacean, or mollusk having at least the first mutation and the second mutation; selecting a progenitor that is homozygous by genotypic selection; and rescuing the fertility of the homozygous progenitor. The first mutation disrupts one or more genes that specify sexual differentiation. The second mutation disrupts one or more genes that specify gamete function.
The present disclosure further provides a fertile homozygous mutated fish, crustacean, or mollusk for producing a sterile sex-determined fish, crustacean, or mollusk. The fertile homozygous mutated fish, crustacean, or mollusk having at least a first mutation and a second mutation, where the first mutation disrupts one or more genes that specify sexual differentiation, and the second mutation disrupts one or more genes that specify gamete function. The fertility of the fertile homozygous mutated fish, crustacean, or mollusk having been rescued.
The present disclosure further provides a fertile fish, crustacean, or mollusk having a homozygous mutation for producing a sterile sex-determined fish, crustacean, or mollusk, wherein the mutation directly or indirectly disrupts spermiogenesis, and/or directly disrupts vitellogenesis, and wherein the fertility of the fertile fish, crustacean, or mollusk has been rescued.
In the context of the present disclosure, a fish refers to any gill-bearing craniate animal that lacks limbs with digits. Examples of fish are carp, tilapia, salmon, trout, and catfish. In the context of the present disclosure, a crustacean refers to any arthropod taxon. Examples of crustaceans are crabs, lobsters, crayfish, and shrimp. In the context of the present disclosure, a mollusk refers to any invertebrate animal with a soft unsegmented body usually enclosed in a calcareous shell. Examples of mollusks are clams, scallops, oysters, octopus, squid and chitons.
A sterile fish, crustacean, or mollusk refers to any fish, crustacean, or mollusk with a diminished ability to generate progeny through breeding or crossing as compared to its wild-type counterpart; for example, a sterile fish, crustacean, or mollusk may have an about 50%, about 75%, about 90%, about 95%, or 100% reduced likelihood of producing viable progeny. In contrast, a fertile fish, crustacean, or mollusk refers to any fish, crustacean, or mollusk that possesses the ability to produce progeny through breeding or crossing. Breeding and crossing refer to any process in which a male species and a female species mate to produce progeny or offspring.
A sex-determined fish, crustacean, or mollusk refers to any fish, crustacean, or mollusk progenitor in which the sex of the progenitor has been pre-determined by disrupting the progenitor's sexual differentiation pathway. In some examples, sex-determined progenitor of the same generation are monosex.
Gamete function refers to the process in which a gamete fuses with another gamete during fertilization in organisms that sexually reproduce.
A mutation that disrupts one or more genes that specify sexual differentiation refers to any genetic mutation that directly or indirectly modulates gonadal function. Directly or indirectly affecting gonadal function refers to: (1) mutating the coding sequence of one or more gonadal genes; (2) mutating a non-coding sequence that has at least some control over the transcription of one or more gonadal genes; (3) mutating the coding sequence of another gene that is involved in post-transcriptional regulation of one or more gonadal genes; or (4) a combination thereof, to modulate gonadal function. Modulating gonadal function refers to specifying that the gonad produces female gametes or produces male gametes. Examples for when masculinization is preferred include modulating one or more genes that modulate the synthesis of androgen and/or estrogen, for example, modulating the expression of aromatase Cyp19a1a, Cyp17, or a combination thereof. Genes involved in modulating the expression of aromatase Cyp19a1a include cyp19ala, FoxL2, sf1 (steroidogenic factor 1), and an ortholog thereof. Genes involved in modulating the expression of Cyp17 include cyp17l or an ortholog thereof. Examples for when feminization is preferred include modulating one or more genes that modulate the expression of an aromatase Cyp19a1a inhibitor. Genes involved in modulating the expression of an aromatase Cyp19a1a inhibitor include Gsdf, dmrt1, Amh, Amhr, and an ortholog thereof.
Alternatively, sexual differentiation may be specified without one or more genetic mutations. Examples of non-genetic mutational methods of specifying sexual differentiation include utilizing sex reversal (hormonal manipulation) and breeding, progeny testing, androgenesis, and gynogenesis, which can produce monosex male or female populations that are homozygous XX, YY or ZZ (see for example [21]; Dunham 2004, which is incorporated by reference). In some examples according to the present disclosure, the step of breeding (i) a fertile female fish, crustacean, or mollusk having a homozygous mutation with (ii) a fertile male fish, crustacean, or mollusk having a homozygous mutation to produce the sterile sex-determined fish, crustacean, or mollusk comprises a non-genetic mutational method of specifying sexual differentiation. In some examples according to the present disclosure using Atlantic salmon, creating and crossing a neomale (XX) with a female produces a monosex progeny of females. In another example according to the present disclosure, specifying sexual differentiation can be achieved by interspecific hybridization (see for example Pruginin, Rothbard et al. 1975, Wolters and DeMay 1996, which is incorporated by reference).
A mutation that disrupts one or more genes that specify gamete function refers to any genetic mutation that directly or indirectly modulates spermiogenesis, oogenesis, and/or folliculogenesis to produce a sterile fish, crustacean, or mollusk. Directly or indirectly modulating spermiogenesis, oogenesis, and/or folliculogenesis refers to: (1) mutating the coding sequence of one or more gamete genes; (2) mutating a non-coding sequence that has at least some control over the transcription of one or more gamete genes; (3) mutating the coding sequence of another gene that is involved in post-transcriptional regulation of one or more gamete genes; or (4) a combination thereof, to produce a sterile fish, crustacean, or mollusk.
A mutation that directly or indirectly disrupts spermiogenesis, and/or directly disrupts vitellogenesis refers to any genetic mutation that directly or indirectly modulates spermiogenesis, and/or directly disrupts vitellogenesis to produce a sterile fish, crustacean, or mollusk. Directly or indirectly modulating spermiogenesis refers to: (1) mutating the coding sequence of one or more gamete genes involved in spermiogenesis; (2) mutating a non-coding sequence that has at least some control over the transcription of one or more gamete genes involved in spermiogenesis; (3) mutating the coding sequence of another gene that is involved in post-transcriptional regulation of one or more gamete genes involved in spermiogenesis; or (4) a combination thereof, to produce a sterile fish, crustacean, or mollusk. Directly modulating vitellogenesis refers to: (1) mutating the coding sequence of one or more gamete genes involved in vitellogenesis; (2) mutating a non-coding sequence that has at least some control over the transcription of one or more gamete genes involved in vitellogenesis; or (3) a combination thereof, to produce a sterile fish, crustacean, or mollusk.
Examples for when producing a sterile male fish, crustacean, or mollusk is preferred include modulating one or more genes that modulate spermiogenesis. Examples of one or more genes that modulate spermiogenesis may cause globozoospermia, sperm with round-headed, round nucleus, disorganized midpiece, partially coiled tails, or a combination thereof. Examples of genes that cause globozoospermia include Gopc, Hiat1, Tjp1a, Smap2, Csnk2a2, and an ortholog thereof. Examples for when producing a sterile female fish, crustacean, or mollusk is preferred include modulating one or more genes that modulate oogenesis, folliculogenesis, or a combination. Examples of one or more genes that modulate oogenesis include one or more genes that modulate the synthesis of estrogen. Examples of one or more genes that modulate the synthesis of estrogen include FSHR or an ortholog thereof. Examples of one or more genes that modulate folliculogenesis include one or more genes that modulate the expression of vitellogenins. Examples of one or more genes that modulate the expression of vitellogenins include vtgs or an ortholog thereof. Examples of mutations that directly or indirectly disrupt spermiogenesis are mutations in Gopc, Hiat1, Tjp1a, Smap2, Csnk2a2, or an ortholog thereof. Examples of mutations that directly disrupts vitellogenesis are mutations in a gene encoding or regulating: Vitellogenin; Estrogen receptor1; cytochrome p450, family 1, subfamily a; Zona pellucida glycoprotein; Choriogenin H; Peroxisome proliferator-activated receptor; Steroidogenic acute regulatory protein, or an ortholog thereof.
A mutation may be any type of alteration of a nucleotide sequence of interest, for example, nucleotide insertions, nucleotide deletions, and nucleotide substitutions.
Rescuing sterility or fertility refers to any process in which a sterile fish, crustacean, or mollusk is converted into a fertile fish, crustacean, or mollusk. In some examples, an aromatase inhibitor is provided to the sterile fish, crustacean, or mollusk to restore fertility. In other examples, germline stem cell transplantation of the sterile fish, crustacean, or mollusk restores fertility. Germline stem cell transplantation refers to any process in which reproductive stem cells from a sterile fish, crustacean, or mollusk is transplanted into a fertile fish, crustacean, or mollusk and restores fertility. In some examples according to the present disclosure, the germline stem cell transplantation is a process comprising: obtaining a germline stem cell from a sterile homozygous male fish, crustacean, or mollusk having at least the first mutation and the second mutation or a germline stem cell from a sterile homozygous female fish, crustacean, or mollusk having at least the first mutation and the second mutation; and transplanting the germline stem cell into a germ cell-less recipient male fish, crustacean, or mollusk, or into a germ cell-less recipient female fish, crustacean, or mollusk. A recipient male or female fish, crustacean, or mollusk is any embryo depleted of their own germ cells but carrying functional copies of genes targeted that specify sexual differentiation and gamete function. Alternatively, the germ cell depleted recipient can be a juvenile or adult fish carrying functional copies of genes targeted. Preferably, the recipient species is the same as the donor species (allogenic recipient) but other species may be used (Xenogeneic recipient). The recipient after transplantation is a chimeric fish, crustacean or mollusk with normal somatic cells but a mutant germline. These chimeric recipients restore the normal sex ratio and/or sterility as they possess functional somatic gene(s). A germ cell-less recipient may be created using ploidy manipulation, hybridization strategies, or exposure to high levels of sex hormones. Exposure of juvenile aquatic species to high levels of sex hormones may result in sterility in the exposed animals. This technique has been demonstrated (Hunter et al, 1982; Solar et al, 1984; Piferrer et al, 1994), but has not been used at a commercial scale. While the technique may be effective in creating sterile fish, it has never been demonstrated effective at inducing sterility in 100% of the treated fish. Treated fish may be suitable for research, or as recipients for germ cell transfer, but the technique may not be adequate for creating sterile fish for commercial farming (see also Hunter, G. A., E. M. Donaldson, F. W. Goetz, and P. R. Edgell. 1982. Production of all-female and sterile Coho salmon, and experimental evidence for male heterogamety. Transactions of the American Fisheries Society 111: 367-372; Piferrer, F, M Carillo, S. Zanuy, I. I. Solar, and E. M. Donaldson. 1994. Induction of sterility in Coho salmon (Oncorhynchus kisutch) by androgen immersion before first feeding. Aquaculture 119: 409-423; and Solar, I., E. M. Donaldson, and G. A. Hunter. 1984. Optimization of treatment regimes for controlled sex differentiation and sterilization in wild rainbow trout (Salmo gairdeneri Richardson) by oral administration of 17α-methyltestosterone. Aquaculture 42: 129-139.
In some examples, the germline stem cell transplantation is a process comprising: obtaining a spermatogonial stem cell from a sterile homozygous male fish, crustacean, or mollusk or a oogonial stem cell from a sterile homozygous female fish, crustacean, or mollusk, and transplanting the spermatogonial stem cell into the peritoneal cavity of a germ cell-less embryo or into a germ cell-less differentiated testis or ovary of a fish, crustacean, or mollusk. Optionally, in addition to germline stem cell transplantation, an exogenous sex steroid is provided to the sterile fish, crustacean, or mollusk, for example, estrogen to restore fertility. In other examples, an aromatase inhibitor is provided to the sterile fish, crustacean, or mollusk to restore fertility.
One or more mutations in the gene cyp19a1a, Foxl2, or a combination thereof, results in low or decreased estrogen expression causing testis formation and the production of a male fish, crustacean, or mollusk. Similarly, one or more mutations in the gene cyp17 results in low or decreased estrogen and androgen expression producing a male fish, crustacean, or mollusk. One or more additional mutations in a gene that disrupts spermiogenesis (SMS) causes the male fish, crustacean, or mollusk to be sterile. Accordingly, a sterile homozygous mutated male fish, crustacean, or mollusk is produced.
In an additional step used to propagate the line, the fertility of the sterile homozygous mutated male fish, crustacean, or mollusk may be rescued with treatment of estrogen. Following treatment, a fertile homozygous mutated female fish, crustacean, or mollusk is generated. In this sex reversal process, the phenotypic female is carrying the one or more mutations disrupting spermiogenesis and should be fertile, and oocytes carrying the one more mutations disrupting spermiogenesis should be produced and allow for propagation of the line. Alternatively, and as described in Example 10, the fertility of the sterile homozygous mutated male fish, crustacean, or mollusk may be rescued by implanting a germ cell from the sterile homozygous mutated male fish, crustacean, or mollusk into a fertile wild-type male testis cell to generate a fertile homozygous mutated male fish, crustacean, or mollusk, which allows for propagation of the line.
On the flip side of
In an additional step used to propagate the line, the fertility of the sterile homozygous mutated female fish, crustacean, or mollusk may be rescued with treatment of an aromatase inhibitor. Following treatment, a fertile homozygous mutated male fish, crustacean, or mollusk is generated. In this sex reversal process, the phenotypic male is carrying the one or more mutations disrupting oogenesis, folliculogenesis, or a combination and should be fertile, and sperm carrying the one more mutations disrupting oogenesis, folliculogenesis, or a combination should be produced and allow for propagation of the line. Alternatively, and as described in Example 10, the fertility of the sterile homozygous mutated female fish, crustacean, or mollusk may be rescued by implanting a germ cell from the sterile homozygous mutated female fish, crustacean, or mollusk into a fertile wild-type female ovary cell to generate a fertile homozygous mutated female fish, crustacean, or mollusk, which allows for propagation of the line.
Animal used and ethical statement: All experiments complied with US regulations ensuring animal welfare and animal husbandry procedures were performed according to IACUC-approved animal protocol CAT-004. Tilapia (Oreochromis niloticus) lines used in this study are derived from a Brazilian strain obtained from a US commercial producer.
Generation of nucleases and strategies: Generation of F0 mutants: Tilapia orthologs of the cyp17, Cyp19a1a, Tjp1a, Csnk2a2, Hiat1, Smap2, Gopc, Gsdf, Dmrt1, FSHR and vitellogenin genes (VtgAa and VtgAb) were identified in silico from genomic databases.
To create DNA double strand breaks (DSBs) at specific genomic site, we used engineered nucleases. In most applications, a single DSB was produced in the absence of a repair template, leading to the activation of the non-homologous end joining (NHEJ) repair pathway. The NHEJ can be an imperfect repair process, generating insertions or deletions (indels) at the target site. Introduction of an indel can create a frameshift within the coding region of the gene resulting in abnormal protein products with an incorrect amino acid sequence. To enhance the frequency of generating null mutations in the gene of interest, we targeted 2 separate exons simultaneously apart from those targeting cyp17. Alongside the gene of interest, we co-targeted a pigmentation gene to serve as a mutagenesis selection marker. Typically, mutagenic frequency between the pigment gene and the gene of interest are correlated. Thus, embryos showing complete lack of pigmentation (albino phenotype) were preferentially selected compare to mosaic pigment phenotype (partial gene inactivation). To confirm functionality of the newly designed nuclease, five albino embryos from each treated batch were quantitatively assayed for genome modifications at the loci of interest by PCR fragment analysis. Treated embryos of the same batch were eliminated if all five embryos tested showed no indels at the targeted loci. Furthermore, we preferentially raised batches of embryos in which mutations are produced at the one or two cell stage, (i.e. detection of 2 or 4 mutant alleles per targeted loci by fragment analysis assay).
The template DNA coding for the engineered nuclease were linearized and purified using a DNA Clean & concentrator-5 column (Zymo Resarch). One microgram of linearized template was used to synthesize capped RNA using the mMESSAGE mMACHINE T3 kit (Invitrogen), purified using Qiaquick (Qiagen) columns and stored at −80° in RNase-free water at a final concentration of 800 ng/μl.
Embryo injections: Embryos were produced from in vitro fertilization. Approximately 10 nL total volume of solution containing the programmed nucleases were co-injected into the cytoplasm of one-cell stage embryos. Injection of 200 embryos typically produce 10-60 embryos with complete pigmentation defect (albino phenotype). Embryo/larvae survival was monitored for the first 10-12 days post injection.
Selection of founders: A minimum of 10 albino embryos were raised to 3 months of age and quantitatively assayed for genome modifications by fluorescence PCR fragment analysis (see Table 1 for gene specific genotyping primers columns 8 and 11). We preferentially selected founders in which mutations were produced at the one or two cell stage (detection of 2 or 4 mutant alleles per target loci by fragment analysis (
F1 genotyping: The selected founders were outcrossed with wild-type lines. Their F1 progeny were raised to 2 months of age, anesthetized by immersion in 200 mg/L MS-222 (tricaine) and transferred onto a clean surface using a plastic spoon. Their fin was clipped with a razor blade, and place onto a well (96 well plate with caps). Fin clipped fish were then placed in individual jars while their fin DNA was analyzed by fluorescence PCR. In brief, 60 μl of a solution containing 9.4% Chelex and 0.625 mg/ml proteinase K was added to each well for overnight tissue digestion and gDNA extraction in a 55° C. incubator. The plate was then vortexed and centrifuged. gDNA extraction solution was then diluted 10× with ultra-clean water to remove any PCR inhibitors in the mixture. Typically, we analyzed 80 juveniles/founder to select and raised batches of approximately 20 juveniles carrying identical size mutations.
Fluorescence PCR (see
One-two microliters of 1:10 dilution of the resulting amplicons were resolved via capillary electrophoresis (CE) with an added LIZ labeled size standard to determine the amplicon sizes accurate to base-pair resolution (Retrogen Inc., San Diego). The raw trace files were analyzed on Peak Scanner software (ThermoFisher). The size of the peak relative to the wild-type peak control determines the nature (insertion or deletion) and length of the mutation. The number of peak(s) indicate the level of mosaicism. We selected F0 mosaic founder carrying the fewest number of mutant alleles (2-4 peak preferentially).
The allele sizes were used to calculate the observed indel mutations. Mutations that are not in multiples of 3 bp and thus predicted to be frameshift mutations were selected for further confirmation by sequencing. Mutations of size greater than 8 bp but smaller than 30 bp were preferentially selected to ease genotyping by QPCR melt analysis for subsequent generations. For sequence confirmation, the PCR product of the selected indel was further submitted to sequencing. Sequencing chromatography of PCR showing two simultaneous reads are indicative of the presence of indels. The start of the deletion or insertion typically begins when the sequence read become divergent. The dual sequences were carefully analyzed to detect unique nucleotide reads. The pattern of unique nucleotide read is then analyzed against series of artificial single read patterns generated from shifting the wild type sequence over itself incrementally.
QPCR genotyping of F1 and F2 generations: Real-time qPCR was performed on a ROTOR-GENE RG-3000 REAL TIME PCR SYSTEM (Corbett Research). 1-μL genomic DNA (gDNA) template (diluted at 5-20 ng/μl) was used in a total volume of 10 μL containing 0.15 μM concentrations each of the forward and reverse primers and 5 μL of QPCR 2× Master Mix (Apex Bio-research products). qPCR primers used are presented in Table 2 (Genotyping RT-PCR primers columns 11-14). The qPCR was performed using 40 cycles of 15 seconds at 95° C., 60 seconds at 60° C., followed by melting curve analysis to confirm the specificity of the assay (67° C. to 97° C.). In this approach, short PCR amplicons (approx 120-200 bp) that include the region of interest are generated from a gDNA sample, subjected to temperature-dependent dissociation (melting curve). When induced indels are present in hemizygous gDNA, heteroduplex as well as different homoduplex molecules are formed. The presence of multiple forms of duplex molecules is detected by Melt profile, showing whether duplex melting acts as a single species or more than one species. Generally, the symmetry of the melting curve and melting temperature infers on the homogeneity of the dsDNA sequence and its length. Thus, homozygous and wild type (WT) show symmetric melt curved that are distinguishable by varied melting temperature. The Melt analysis was performed by comparison with reference DNA sample (from control wild type DNA) amplified in parallel with the same master mix reaction. In short, variation in melt profile distinguishes amplicons generated from homozygous, hemizygous and WT gDNA (see
Assessment of sterility in males: The volume of strippable sperm and sperm density was measured from 10 males (5 months of age) for each genotype. Sperm were counted using a Neubauer hemocytometer slide, as well as by spectrophotometry (optical density (O.D) at 600 nm) of serially diluted samples. Sperm motility was measured in terms of percent motile spermatozoa in field of view [4]. Morphology of the sperm cells stained with eosin-nigrosin was analyzed under light microscopy at 400×. Fertilization capacity of sperm was assayed by in vitro fertilization of wild type eggs from 3 different females at the optimal sperm to egg ratio (100 eggs for 5·106 spermatozoa). Wild type egg quality was tested in parallel using sperm from WT males. Fertilization rates was expressed as a percentage of surviving embryos to total eggs collected at 24 hrs post fertilization. The mean values obtained from these studies was compared across mutant genotypes using an unpaired t-test.
Assessment of sterility in females: We recorded the body weight of all fish sampled. A minimum of six females for each genotype was dissected at 4 and 6 months of age and their gonads photographed in situ before dissection. The mean total gonadosomatic index was statistically compared across all genotypes (unpaired T-test). Survival of eggs, embryos and larvae produced from a minimum of six mutant females outcrossed with wild-type males were statistically analyzed (unpaired T-test) and compared to controls (wild-type females crossed with mutant males).
Donor cell isolation and germ cell transplantation: Germ cell stem cells were harvested from the gonads of 3-4 months old fish (˜50-70 g) through enzymatic digestion as described by Lacerda [5]. In brief, the freshly isolated gonads were minced and incubated in 1 ml of 0.5% trypsin (Worthington Biochemical Corp., Lakewood, N.J.) in PBS (pH 8.2) containing 5% fetal bovine serum (Gibco Invitrogen Co., Grand Island, N.Y.) and 0.05% DNase I (Roche Diagnostics, Mannheim, Germany) for 3-4 h at 25° C. During incubation, gentle pipetting was applied to physically disrupt any remaining intact portions of the gonads. The resulting cell suspension was filtered through a nylon screen with a pore size of 42 μm (N-No. 330T; Tokyo Screen Co. Ltd., Tokyo, Japan) to remove any undissociated cell clumps and then resuspended in L-15 medium (Gibco Invitrogen Co.) before storage on ice until transplantation.
Germ cell-free recipient larvae (5-7dpf) were anesthetized with 0.0075% ethyl 3-aminobenzoate methanesulfonate salt (Sigma-Aldrich Inc.) and transferred to a Petri dish coated with 2% agar. Cell transplantation was performed by injecting approximately 15,000 testicular cells into the peritoneal cavity of approximately 80 larvae progeny from Elavl2 hemizygous mutant parents. Alternatively, PGC-free embryos were obtained from a cross between MSC homozygous female and wild type male [6]. After transplantation, recipient larvae were transferred back to aerated embryo hatching water and raised to adulthood.
We have independently targeted two genes involved in pigmentation, namely the genes encoding tyrosinase (tyr) [2] and the mitochondrial inner membrane protein MpV17 (mpv17) (Krauss, Astrinides et al. 2013) [8]. We found that 50% and 46% of all injected embryos showed a high degree of mutation at the tyr and mpv17loci respectively (
We tested whether multiple genomic loci can be targeted simultaneously and whether mutagenic efficiency measured at one loci is predictable of mutation at other loci in the tilapia genome. To test our hypothesis, we co-targeted tyr and Dead-end1 (dnd). Dnd is a PGC-specific RNA binding protein (RBP) that maintains germ cell fate and migration ability [3]. Following injection of programmed nucleases, we found that mutations in both gene targets tyr and dnd were highly correlated. Approximately 95% of abino (tyr) mutants also carried mutations at the dnd loci, demonstrating the suitability of the pigmentation defect as a selection marker (
We produced sterile tilapia by implementing transient silencing of the dnd gene in embryos via microinjection of antisense modified oligonucleotides (dnd-Morpholino as well as dnd-AUM oligos). We produced sterile tilapia following bath-immersion of embryos exposed to a small molecule initially discovered in a screen to ablate PGCs in zebrafish [10]. We further generated sterile tilapia using gene knockout strategies as describe for dnd in the section above (Example 3). We also found that breeding Elavl2 heterozygous mutant lines and selecting the homozygous-mutant progeny allow production of germ cell-free adult of both sexes (
The balance of steroidogenic hormones may govern sex differentiation and maturation of the gonads in teleost fish, with estrogen playing an essential role for female differentiation. However, gonadal differentiation and gametogenesis in the absence of both androgen and estrogen has not been investigated. To this end, we produced an in vivo tilapia model lacking the cyp17l gene (hereafter referred to as cyp17).
In Nile tilapia, this enzyme is exclusively expressed in Theca cells and produces androgens in response to luteinizing hormone (LH) [13]. Androgens are then converted into estrogen by follicle stimulating hormone (FSH)-induced aromatase (cyp19a1a) in the neighboring granulosa cells of growing follicles. Accordingly, cyp17 loss of function (via gene editing knockout) should simultaneously block androgen and estrogen synthesis. Consistent with this model, we found that 20 of the 22 selected F0 albino/cyp17 mutants developed as phenotypic males, which all displayed minuscule UGP (
We then quantified the amount of free plasma testosterone by ELISA in wild-type and cyp17-mutant tilapia. A mean of 86 pg/mL of testosterone was measured in wild-type (cyp17+/+) and heterozygous mutant tilapia (cyp17+/−) whereas no detectable level of testosterone was found in homozygous mutant (cyp17−/−) (
We further examined the morphology and functionality of the gonads in Cyp17 deficient fish. Sibling 5-month-old males cyp17+/+, cyp17+/− and cyp17−/−, of identical size were dissected and all organs except the gonads were removed from their body cavity (
The fact that cyp17 null mutants can undergo spermatogenesis suggests that androgens are not strictly necessary for this process in Nile tilapia. Thus, a loss of function mutation in this gene may not be sufficient to produce all-sterile male populations. To identify the regulatory mechanism responsible for the formation of functional spermatozoa, we investigated additional genes associated with male infertility in mammals.
There are significant differences in the morphology and function of mammalian and fish sperm. In particular, fish sperm lack an acrosome and are immotile in seminal fluid, while mammalian spermatozoa possess an acrosome (a key organelle necessary to penetrate the egg chorion) and is mobile in seminal fluid. Globozoospermia is a rare and severe form of human infertility characterized by sperm defective in both morphology and function. Fish models of this disease, however, have not been developed, likely because fish sperm lack an acrosome. Using genomic databases, we identified in silico the tilapia orthologs of the following mammalian genes: Csnk2a2 [15] Gopc [16, 17], Hiat1 [18], Tjp1a, Smap2 [21]. To explore their function in tilapia, we targeted 2 separate exons for each gene (see
In conjunction with non-treated controls, approximately 20 embryos per candidate gene displaying pigmentation defects were raised to adulthood. At 5 months of age, milt from F0 males and WT controls were stripped to assay sperm density, motility and morphology. Compared to controls, all F0 mutant males produced diluted sperm. Under microscopy, mutant spermatozoa largely produced only a trembling movement and we found wide-ranging frequencies (25%-95%) of abnormally shaped sperm heads, characteristic of the defects seen in human and mice with globozoospermia (
Our results point to the existence of an evolutionarily conserved pathway controlling spermiogenesis in fish and mammals. These results support the idea that the targeted disruption of these corresponding genes will cause a sterility phenotype in many other teleost species, and possibly more broadly in other taxa as well.
To engineer male sterility, we first evaluated the effect of null mutations in the cyp17gene, which controls an important branch point in steroid hormone synthesis, regulating both androgen and estrogen production. We found that all cyp17−/− fish develop as male. Surprisingly, milt produced by cyp17−/− contained a small number of mature spermatozoa that could fertilize oocytes by in vitro fertilization. We than investigated the possibility of blocking spermiogenesis. Our preliminary screens focused on five genes associated with globozoospermia (collectively termed spermiogenesis specific genes or SMS-genes: Smap2, Cnsk2a2, Gopc, Hiat1 and Tjp1a), whose mutations caused subfertility in F0 males with severe oligo-astheno-teratozoospermia, while F0 mutant females were fully fertile. Previous genetic characterizations of F0 KO fish indicate that they typically carry mosaic mutations at the corresponding targeted loci, some of which are often in-frame causing partial rescue of the phenotype. Thus, to measure the full loss-of function phenotype, we performed additional phenotypic characterization on homozygous SMS-null-mutants. We further established lines of tilapia carrying double homozygous mutations to interrogate the effect of simultaneously impairing spermiogenesis and steroid hormone synthesis.
Experiment: To assess in vivo function of double gene knockouts in cyp17 and one of the 5 SMS gene, we outcrossed F0 SMS mutant females with cyp17Δ16/+ males. Offspring (120 to 180 fish) were genotyped at each target locus by PCR fragment analysis (as described in
Without being bound by theory, we believe that in finfish, as in mammals, null mutations in all 5 conserved spermiogenesis specific genes will result in oligo-astheno-teratozoospermia and cause infertility. We expect that all double homozygous mutants (cyp17−/−; SMS−/−) will develop as sterile males with even lower sperm counts than any single KO male defective in spermiogenesis (SMS−/−). Indeed, cyp17−/− fish should be deficient in 11-ketotestosterone, a positive regulator of spermatogenesis. Consistent with the idea that androgen plays an intra-testicular paracrine role in spermatogenesis, cyp17−/− tilapia have previously been shown to display low sperm counts.
An alternative strategy to generate all-male population is to inactivate the Cyp19a1a aromatase (hereafter referred to as Cyp19). We created out of frame mutations in the coding sequence of the tilapia cyp19 gene (
Experiment: We first outcrossed heterozygous F1 males Δ10-cyp19a1a with the heterozgygous mutant females from Example 7 (GopcΔ8/+; Smap2Δ17/+; TjP1aΔ7/+; Csnk2a2Δ22/+; Hiat1Δ17/+. Only SMS genes that cause male sterility when disrupted in a Cyp17 null background (results from Example 7) will be selected. The progeny will be genotyped and at least 10 double heterozygous will be raised to adulthood, sexed, and inter-crossed. The resulting progeny will be assayed for fertility as described in Example 7. A maximum of 5 different double KO males will be generated. Without being bound by theory, we expect double KO cyp19−/−; SMS−/− fish to develop as sterile males and anticipate a progeny population of 62% male, with 25% of them being sterile.
The transcriptional inhibitor Gonadal soma-derived factor (Gsdf) is a TGF-b superfamily member expressed only in the gonads of fish, predominantly in the Sertoli cells. Similarly, the transcription factor Dmrt1 is preferentially expressed in pre Sertoli and Sertoli cells as well as in epithelial cells of the testis. Both genes are necessary for normal testis development ([23, 24]).
To produce all-female tilapia populations, we generated null mutations in either Dmrt1 or Gsdf genes (maleness genes or MA) (
To engineer sterility in females, we targeted genes involved in the maturation of ovarian follicle. We have identified two genes in the molecular pathway controlling folliculogenesis: 1) FSHR which acts upstream of ovarian estrogen synthesis and. 2) vitellogenins (Vtgs) which act downstream of ovarian estrogen synthesis. Vitellogenins are preferentially produced by the liver while FSHR, the follicle-stimulating hormone (FSH) receptor is expressed in Theca cells surrounding the developing oocytes. To test the necessity of FSHR and Vtgs in normal ovarian development (folliculogenesis specific genes or FLS) we produced loss-of-function mutations in those genes in independent F0 lines (
We found that FSHR is indispensable to folliculogenesis and the disruption of the FSHR gene resulted in a complete failure of follicle activation and female sterility (
Nile tilapia only possess 3 Vtg genes [25], two forms of complete Vtgs (VtgAa and VtgAb) and one form of incomplete C-type teleost vitellogenin, lacking three protein domains (VtgC). Since VtgAa and VtgAb are expressed at higher level than VtgC and assumed to be critical to early embryo development, we targeted those two genes individually as well as jointly (
For a complete phenotypic characterization, it is essential to generate identical mutations in every cell of the animal. Thus, we will establish and characterize 4 lines of tilapia deficient in both masculinization and vitellogenesis.
At 6 months of age, mosaic F0 XX MA m1-n female (e.g. Dmrt1 m1-n or Gsdf m1-n) were outcrossed to mosaic F0 FLS m1-n males (FSHRm1-n or Vtgs m1-n) and their F1 progeny genotyped to identify double heterozygous mutants (e.g. Dmrt1Δ7/+-FSHRΔ5/+) carrying the same gene specific indel at each locus (Table 3).
Experiment: A minimum of 10 double heterozygotes (for each of the four gene combinations) are currently being raised to adulthood. The WT alleles should ensure that these F1 fish develop as both fertile males and females. These double heterozygous mutants will then be incrossed, and their progeny genotyped at 1 month of age by QPCR melt analysis. For each of the 9 ensuing possible genotypes (see
Our phenotypic investigations in F0 mutant lines (Table 3) mostly agree with our initial hypothesis and we fully expect corroborating genotype-phenotype relationships in subsequent generations. We found that Gsdf deficiency caused feminization while FSHR and Vtgs inactivation resulted in female sterility. These results strongly suggest that double FSHR-Gsdf KOs will develop into monosex sterile female populations characterized by atrophic ovaries containing follicles arrested at the previtellogenic stage. The lack of a sex differentiation phenotype in F0 Dmrt1 mutant likely reflects incomplete editing, regional mosaicism and compensation by non-mutated cells. Without being bound by theory however, we believe that double FSHR-Dmrt1 KOs in which the mutations have been inherited through the germline, will develop into all female sterile populations. In our F0 mutagenesis screen we observed that blocking the precursor of major yolk proteins (as in Vtg KOs), compromises egg quality and impairs the development and survival of embryos. As such, we expect that double KOs Gsdf-Vtgs and Dmrt1-Vtgs will develop into monosex sterile female populations.
Examples 8 and 9 above illustrate how to generate monosex sterile fish by breeding double hemizygous mutant and by individually selecting the subpopulation of double KO progeny. This approach however may not be sufficiently efficient and may be too expensive to be used in industrial settings. Intracytoplasmic sperm injection in assisted reproduction offers a solution to propagate male broodstock that are defective in spermiogenesis. However, this approach is also not scalable for mass production of commercial stocks (as it requires conducting methods on ‘one fish at a time). The key to larger scale production is to generate male and female broodstock that only produce mutant gametes so that no selection is needed to identify the double KO progeny. Importantly, those mutant gametes should also be functional so that natural mating of these broodstock can be used to produce a viable population of monosex sterile progeny. This is only possible if sex ratio and gamete functionality are rescued in the broodstock. We speculated that this can be achieved by germline stem cell transplantation from a double KO mutant fish to a germ cell free recipient not mutated for the same genes. Such transplanted broodstock have normal somatic cells but a mutant germline (see
Since spermatogenic failure can result from defects in germ cells or in their somatic environment we analyzed the SMS genes expressions to identify those preferentially not expressed in germ cells (
These results suggest that mutant of those genes develop a testicular microenvironment, where spermiogenesis is impaired due to Sertoli and/or Leydig-specific defects (
Likewise, FSHR and Vtgs, are strictly expressed in somatic cells (Theca and liver cells respectively). Thus, oocytes carrying null alleles of these genes should retain their intrinsic capacity to proliferate and differentiate, ensuring that oogonial stem cells from a sterile female mutant donor can re-populate the ovaries and differentiate into functional eggs upon transplantation into a WT/permissive recipient (
To confirm that sterile Elavl2 KO recipients can produce functional gametes from donor-derived germ cells, we harvested spermatogonial stem from the testes of albino (tyr−/−) male tilapia carrying mutations (in-frame and out-of-frame) in a reference gene (
Experiment: Spermatogonial and oogonial stem cells (SSCs, OSCs) will be isolated from all-male and all-female juvenile tilapia lines (developed as per Examples 7, 8, and 9). After harvest, these germline stem cells will be transplanted into Elavl2 KO recipient hatchlings as described above. Without being bound by theory, we expect production of functional spermatozoa and oocytes carrying the donor genotypes. To evaluate the functionality of donor-derived gametes produced after transplantation, in vitro fertilization assays will be performed. Moreover, we expect only albino progeny to arise from a cross between the naturally pigmented recipient carrying albino donor gametes and albino lines. We will genotype 10 progenies for mutations in donor-derived spermatogenesis and vitellogenesis specific genes.
As illustrated in
There is a direct trade-off between growth and reproduction, as energy channeled into the gonads detracts from somatic growth. Nile tilapia mature precociously and can reproduce throughout the year, with short vitellogenic periods [26], and a physiological process that demands a high metabolic rate. Furthermore, Tilapia species can suppress growth to maintain their reproductive capacity [27], and in other fish species the onset of puberty can have a major impact on important production parameters in fish farming such as appetite, growth rate, feed conversion efficiency, flesh quality traits, external appearance, health, welfare and survival rates. Thus, delaying or blocking sexual maturation is likely to confer significant benefits to commercial aquaculture producers. In our efforts to develop sterile monosex populations, we have targeted genes whose mutations block or delay the onset of puberty. However, genes targeted for these effects might also have pleiotropic effects, detrimental to the line, acting via unknown hormonal, physiological or behavioral changes.
Experiment: To generate groups used for growth performance trials, embryos from single paired crossings (at least three separate crosses) will be produced for each line of interest. Treatment and control embryos will be reared separately using established hatchery procedures. At the feeding stage, half of the control animals will be sex reversed using appropriate exogenous hormone treatment protocols (i.e. feeding methyl testosterone or DES). When fish within a group (treatment and control) reach a mean weight of 60 g, they will be PIT tagged and divided into six 1000 L tanks (3 control and 3 treatment tanks, with 50 fish/tank). All fish will be fed three times daily, to satiation.
Each fish will be individually weighed, and the length of each fish measured at 4-week intervals over a period necessary to reach market size (680 g Sdv: 77 g, 8 months). At the end of the experiment, fish will be sacrificed and sexed based on the structure of the urogenital orifice. We will record the individual weights of dissected gonads and carcass for calculation of gonadosomatic index (GSI) and carcass index (n=60 per group). Specific growth rate (G) will be calculated according to the formula of Houde & Scheckter [28]
Without being bound by theory, we believe that most, if not all, double KO fish created in Examples 7, 8, and 9 will develop as monosex and be sterile with no other biological processes impaired. Thus, selected mutations should not negatively impact the overall fish performance. On the contrary, we expect to find an improved growth rate and feed conversion ratios inversely correlated to gonad weight. Mutant lines should be sexually delayed (male sterile) or immature (female arrested at the previtellogenic stage). In the unlikely event that we achieve only partial sterilization of monosex populations, we expect improvement in productivity in tilapia to be proportional to the fraction of sterile fish in the population, as a result of reduced energy expenditure. In all cases, we anticipate sterile fish and fish with atrophic gonads to out-perform their fully fertile counterparts (e.g. monosex populations derived from exogenous hormone treatments) in regard to growth characteristics.
Asian journal of andrology, 2003. 5(2): p. 137-147.
TGTAAAACGACGGCCAGTttgaagttgctacataaaag
TAGGAGTGCAGCAAGCATtgttctacatcatcacccttctc
TGTAAAACGACGGCCAGTTGATGGAGAGCTTCATCTACGAA
TAGGAGTGCAGCAAGCATgcgtgatttgctgacctttttac
TGTAAAACGACGGCCAGTGAAAAAGGATGgtgagggatgac
TGTAAAACGACGGCCAGTgtatttagaaggcggtgaaggtc
TAGGAGTGCAGCAAGCATATGCTCATGTGCCAAACTG
TGTAAAACGACGGCCAGTtactgacacatccagcagcgtct
TAGGAGTGCAGCAAGCATTGGAGCCTACCTGTCTGAG
TAGGAGTGCAGCAAGCATgctcctctgcgaagactctc
TGTAAAACGACGGCCAGTAGAGGAGGGCACAGTCAAGAAAC
TAGGAGTGCAGCAAGCATtttaacggtgttggcagagatt
TGTAAAACGACGGCCAGTtgcccctttaaaccaccta
TAGGAGTGCAGCAAGCATttgccaggacccATGAGCCAG
TGTAAAACGACGGCCAGTctcttcatcctctgtgtctcatc
TAGGAGTGCAGCAAGCATttatgttcagGTGCCAAGGTG
TGTAAAACGACGGCCAGTagATCTGGGCTGGGACA
TAGGAGTGCAGCAAGCATttttctccgcttgcttctgc
TGTAAAACGACGGCCAGTCATCTTGGCGTTCTTCTGTGT
TAGGAGTGCAGCAAGCATGCAATCCTTGATGCTCCTTGAC
TGTAAAACGACGGCCAGTAGAAGATCATCAAACACATCACG
TAGGAGTGCAGCAAGCATttttgtgatctagTCTGGAG
TGTAAAACGACGGCCAGTAGAAGATCATCAAACACATCACG
TGTAAAACGACGGCCAGT
TAGGAGTGCAGCAAGCAT
In the preceding description, for purposes of explanation, numerous details are set forth in order to provide a thorough understanding of the embodiments. However, it will be apparent to one skilled in the art that these specific details are not required.
The above-described embodiments are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art. The scope of the claims should not be limited by the particular embodiments set forth herein, but should be construed in a manner consistent with the specification as a whole.
Aspects of the work described herein were supported by grant award #2018-33522-28745 from the USDA-National Institute of Food and Agriculture. The United States Government may have certain rights in these inventions.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US19/46088 | 8/12/2019 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62717201 | Aug 2018 | US |
