The present disclosure relates generally to methods of sterilizing freshwater and seawater organisms.
The following paragraphs are not an admission that anything discussed in them is prior art or part of the knowledge of persons skilled in the art.
Facing decreasing yields from wild fisheries, global food supplies will have to rely more heavily on the food farming industry to fulfill an every-increasing public demand for seafood. In contrast to forms of animal agriculture, in aquaculture, many species sexually mature during production resulting in billions of dollars in lost productivity and downgraded product quality. Furthermore, farmed fish can escape and negatively impact aquatic ecosystems. As such, sterilization of farmed aquatic species is preferred for the aquaculture industry.
One approach for sterilizing fish is by induction of triploidy. The induction of triploidy is the most used and well-studied approach for producing sterile fish. Generally, triploid fish are produced by applying temperature or pressure shock to fertilized eggs, forcing the incorporation of the second polar body and producing cells with three chromosome sets (3N). Triploid fish do not develop normal gonads as the extra chromosome set disrupts meiosis. At the industrial scale, the logistics of reliably applying pressure or temperature shocks to batches of eggs is complicated and carries significant costs. An alternative to triploid induced by physical treatments is triploid induced by genetics, which results from crossing a tetraploid with a diploid fish. Tetraploid fish, however, are difficulty to generate due to poor embryonic survival and slow growth. In some examples, triploid males produce some normal haploid sperm cells thus allowing males to fertilize eggs, though at a reduced efficiency. Also, in some species, negative performance characteristics have been associated with triploid phenotype, including reduced growth and sensitivity to disease.
Another approach for sterilizing fish is by hormone treatment. However, in many cases, including intensive long-term treatments, such processes do not have a desirable efficacy of sterility, and/or has been associated with decreased fish growth performance. Furthermore, treatment involving a synthetic steroid may result in higher mortality rates.
Another approach for sterilizing fish is by transient silencing of genes governing germ line development, which includes a step of microinjecting antisense modified oligonucleotides into a single egg to ablate primordial germ cells. However, microinjecting eggs individually is not viable on a commercial scale.
Another approach for sterilizing fish is by using transgenic-based technologies, which include a step of integrating a transgene that induce germ cell death or disrupts their migration patterns resulting in their ablation in developing embryos. However, transgenes are subject to position effect as well as silencing. Consequently, such approaches are subject to extended regulatory review processes before being considered acceptable for commercial use.
Another approach for sterilizing fish is egg bathing treatment with a membrane permeable antisense oligonucleotide or small molecules inhibitor, which requires in vitro fertilization. However, handling eggs during the water-hardening process or early embryo development may impart mechanical, thermal, and/or chemical stresses, which may negatively affect the viability of the egg and/or embryo. Furthermore, hatcheries that are not equipped for egg bathing would incur an increase in production costs.
Improvements in generating sterile fish, crustaceans, or mollusks is desirable.
The following introduction is intended to introduce the reader to this specification but not to define any invention. One or more inventions may reside in a combination or sub-combination of the instrument elements or method steps described below or in other parts of this document. The inventors do not waive or disclaim their rights to any invention or inventions disclosed in this specification merely by not describing such other invention or inventions in the claims.
One or more of the previously proposed methods used for sterilizing freshwater and seawater organisms may result in: (1) an insufficient efficacy of sterilization, for example, by imparting mechanical, thermal, and/or chemical stresses on eggs and/or developing embryos; (2) an increase in operating costs by, for example, incorporating significant changes in husbandry practices, being untransferrable across multiple species, increasing production times, increasing the percentage of sterile organisms with reduced growth and increased sensitivity to disease, increasing mortality rates of sterile organisms, or a combination thereof; (3) gene flow to wild populations and colonization of new habitats by cultured, non-native species; (4) an insufficient efficiency of sterilization by, for example, inefficiently ablating primordial germ cells by microinjection; or (5) a combination thereof.
The present disclosure provides methods of producing sterilized freshwater and seawater organisms by disrupting their primordial germ cell development without impairing their ability to reach adult stage. One or more examples of the present disclosure may: (1) increase efficacy of sterilization by, for example, utilizing natural mating processes rather than in vitro fertilization; (2) decrease operating costs by, for example, decreasing the amount of costly equipment or treatments, being commercially scalable, being transferable across multiple species, decreasing feed, decreasing production times, increasing the percentage of organisms that achieve sexual maturity, increasing the physical size of sexually mature organisms, or a combination thereof; (3) decrease gene flow to wild populations and colonization of new habitats by cultured non-native species; (4) increase culture performance by, for example, decreasing loss of energy to gonad development; (5) increase efficiency of sterilization by, for example: a) decreasing or avoiding the incidence of position effect and silencing, and/or b) causing the creation of sterile progeny; or (6) a combination thereof, compared to one or more previously proposed methods used for sterilizing freshwater and seawater organisms.
The present disclosure also discusses methods of making broodstock freshwater and seawater organisms for use in producing sterilized freshwater and seawater organisms, as well as the broodstock itself.
The present disclosure provides a method of generating a sterile fish, crustacean, or mollusk. The method comprises the steps of: breeding (i) a fertile hemizygous mutated female fish, crustacean, or mollusk with (ii) a fertile hemizygous mutated male fish, crustacean, or mollusk, selecting a female progenitor that is homozygous by genotypic selection, and breeding the homozygous female progenitor to produce the sterile fish, crustacean, or mollusk. The mutation may disrupt the maternal-effect of a primordial germ cell (PGC) development gene and does not impair the viability, sex determination, fertility, or a combination thereof, of a homozygous progenitor.
The mutation may comprise: a mutation in a cis-acting 5′ or 3′ UTR regulatory sequence of the PGC development gene; a mutation in a gene encoding an RNA binding protein involved in the post-transcriptional regulation of the PGC development gene; a mutation in a gene involved in transport or formation of germ plasm; a mutation in a gene involved in germ cell specification, maintenance, or migration; or a combination thereof.
The gene encoding an RNA binding protein involved in the post-transcriptional regulation of the PGC development gene may be: Hnrnpab, Elavl1, Ptbp1a, Igf2bp3, Tia1, TIAR, Rbpms42, Rbpms24, KHSRP, or DHX9. The gene involved in transport or formation of germ plasm may encode a multi-tudor domain-containing protein, a kinesin-like protein, or an adaptor protein. The multi-tudor domain-containing protein may be Tdrd6. The adaptor protein may be hook2. The gene involved in germ cell specification, maintenance, or migration may be a gene expressing non-coding RNA. The non-coding RNA may be miR202-5p.
The mutation in a cis-acting 5′ or 3′ UTR regulatory sequence may disrupt the maternal activity of the PGC development gene, and does not disrupt the function of the PGC development gene during later stages of development. The PGC development gene may be nanos3, dnd1, or a piwi-like gene.
The present disclosure also provides a fertile homozygous mutated female fish, crustacean, or mollusk for producing a sterile fish, crustacean, or mollusk. The mutation disrupts the post-transcriptional regulation of a primordial germ cell (PGC) development gene to reduce the maternal-effect of the PGC development gene and does not impair somatic function of the gene.
The mutation may comprise: a mutation in a cis-acting 5′ or 3′ UTR regulatory sequence of the PGC development gene; a mutation in a gene encoding an RNA binding protein involved in the post-transcriptional regulation of the PGC development gene; a mutation in a gene involved in transport or formation of germ plasm; a mutation in a gene involved in germ cell specification, maintenance, or migration; or a combination thereof. The gene encoding an RNA binding protein involved in the post-transcriptional regulation of the PGC development gene may be: Hnrnpab, Elavl1, Ptbp1a, Igf2bp3, Tia1, TIAR, Rbpms42, Rbpms24, KHSRP, or DHX9. The gene involved in transport or formation of germ plasm may encode a multi-tudor domain-containing protein, a kinesin-like protein, or an adaptor protein. The multi-tudor domain-containing protein may be Tdrd6. The adaptor protein may be hook2. The gene involved in germ cell specification, maintenance, or migration may be a gene expressing non-coding RNA. The non-coding RNA may be miR202-5p. The mutation in a cis-acting 5′ or 3′ UTR regulatory sequence may disrupt the maternal activity of the PGC development gene, and does not disrupt the function of the PGC development gene during later stages of development. The PGC development gene may be nanos3, dnd1, or a piwi-like gene.
The present disclosure also provides a method of breeding a fertile homozygous mutated female fish, crustacean, or mollusk to generate a sterile fish, crustacean, or mollusk. The method comprises the steps of: breeding a fertile homozygous mutated female fish, crustacean, or mollusk with a wild-type male fish, crustacean, or mollusk, a hemizygous mutated male fish, crustacean, or mollusk, or a homozygous mutated male fish, crustacean, or mollusk to produce the sterile fish, crustacean, or mollusk. The mutation may disrupt the maternal-effect of a primordial germ cell (PGC) development gene and does not impair the viability, sex determination, fertility, or a combination thereof, of a homozygous progenitor.
The mutation may comprise: a mutation in a cis-acting 5′ or 3′ UTR regulatory sequence of the PGC development gene; a mutation in a gene encoding an RNA binding protein involved in the post-transcriptional regulation of the PGC development gene; a mutation in a gene involved in transport or formation of germ plasm; a mutation in a gene involved in germ cell specification, maintenance, or migration; or a combination thereof. The gene encoding an RNA binding protein involved in the post-transcriptional regulation of the PGC development gene may be: Hnrnpab, Elavl1, Ptbp1a, Igf2bp3, Tia1, TIAR, Rbpms42, Rbpms24, KHSRP, or DHX9. The gene involved in transport or formation of germ plasm may encode a multi-tudor domain-containing protein, a kinesin-like protein, or an adaptor protein. The multi-tudor domain-containing protein may be Tdrd6. The adaptor protein may be hook2. The gene involved in germ cell specification, maintenance, or migration may be a gene expressing non-coding RNA. The non-coding RNA may be miR202-5p.
The mutation in a cis-acting 5′ or 3′ UTR regulatory sequence may disrupt the maternal activity of the PGC development gene, and does not disrupt the function of the PGC development gene during later stages of development. The PGC development gene may be nanos3, dnd1, or a piwi-like gene.
The present disclosure also provides a method of making a fertile homozygous mutated female fish, crustacean, or mollusk that generates a sterile fish, crustacean, or mollusk. The method steps comprising: breeding (i) a fertile hemizygous mutated female fish, crustacean, or mollusk with (ii) a fertile hemizygous mutated male fish, crustacean, or mollusk or a homozygous mutated male fish male fish, crustacean, or mollusk, and selecting a female progenitor that is homozygous by genotypic selection. The mutation may disrupt the maternal-effect of a primordial germ cell (PGC) development gene and does not impair the viability, sex determination, fertility, or a combination thereof, of a homozygous progenitor.
The mutation may comprise: a mutation in a cis-acting 5′ or 3′ UTR regulatory sequence of the PGC development gene; a mutation in a gene encoding an RNA binding protein involved in the post-transcriptional regulation of the PGC development gene; a mutation in a gene involved in transport or formation of germ plasm; a mutation in a gene involved in germ cell specification, maintenance, or migration; or a combination thereof. The gene encoding an RNA binding protein involved in the post-transcriptional regulation of the PGC development gene may be: Hnrnpab, Elavl1, Ptbp1a, Igf2bp3, Tia1, TIAR, Rbpms42, Rbpms24, KHSRP, or DHX9. The gene involved in transport or formation of germ plasm may encode a multi-tudor domain-containing protein, a kinesin-like protein, or an adaptor protein. The multi-tudor domain-containing protein may be Tdrd6. The adaptor protein may be hook2. The gene involved in germ cell specification, maintenance, or migration may be a gene expressing non-coding RNA. The non-coding RNA may be miR202-5p.
The mutation in a cis-acting 5′ or 3′ UTR regulatory sequence may disrupt the maternal activity of the PGC development gene, and does not disrupt the function of the PGC development gene during later stages of development. The PGC development gene may be nanos3, dnd1, or a piwi-like gene.
Other aspects and features of the present disclosure will become apparent to those ordinarily skilled in the art upon review of the following description of specific examples in conjunction with the accompanying figures.
Examples of the presently disclosed methods and organisms will now be described, by way of example only, with reference to the attached Figures.
Generally, the present disclosure provides a method of generating a sterile fish, crustacean, or mollusk. The method comprises breeding (i) a fertile hemizygous mutated female fish, crustacean, or mollusk with (ii) a fertile hemizygous mutated male fish, crustacean, or mollusk, selecting a female progenitor that is homozygous by genotypic selection, and breeding the homozygous female progenitor to produce the sterile fish, crustacean, or mollusk. The mutation disrupts the maternal-effect of a primordial germ cell (PGC) development gene and does not impair the viability, sex determination, fertility, or a combination thereof, of a homozygous progenitor.
The present disclosure also provides a method of breeding a fertile homozygous mutated female fish, crustacean, or mollusk to generate a sterile fish, crustacean, or mollusk. The method comprises breeding a fertile homozygous mutated female fish, crustacean, or mollusk with a wild-type male fish, crustacean, or mollusk, a hemizygous mutated male fish, crustacean, or mollusk, or a homozygous mutated male fish, crustacean, or mollusk to produce the sterile fish, crustacean, or mollusk. The mutation disrupts the maternal-effect of a primordial germ cell (PGC) development gene and does not impair the viability, sex determination, fertility, or a combination thereof, of a homozygous progenitor.
The present disclosure further provides a method of making a fertile homozygous mutated female fish, crustacean, or mollusk that generates a sterile fish, crustacean, or mollusk. The method comprises breeding (i) a fertile hemizygous mutated female fish, crustacean, or mollusk with (ii) a fertile hemizygous mutated male fish, crustacean, or mollusk, or a homozygous mutated male fish male fish, crustacean, or mollusk, and selecting a female progenitor that is homozygous by genotypic selection. The mutation disrupts the maternal-effect of a primordial germ cell (PGC) development gene and does not impair the viability, sex determination, fertility, or a combination thereof, of a homozygous progenitor.
In the context of the present disclosure, a fish refers to any gill-bearing craniate animal that lacks limbs with digits. Examples of fish are carp, tilapia, salmon, trout, and catfish. In the context of the present disclosure, a crustacean refers to any arthropod taxon. Examples of crustaceans are crabs, lobsters, crayfish, and shrimp. In the context of the present disclosure, a mollusk refers to any invertebrate animal with a soft unsegmented body usually enclosed in a calcareous shell. Examples of mollusks are clams, scallops, oysters, octopus, squid and chitons. A hemizygous fish, crustacean, or mollusk refers to any diploid fish, crustacean, or mollusk that carries one copy of the chromosome containing the mutation but the matching chromosome does not have the mutation. A homozygous fish, crustacean, or mollusk refers to any diploid fish, crustacean, or mollusk that carries two copies of the chromosome containing the mutation.
A sterile fish, crustacean, or mollusk refers to any fish, crustacean, or mollusk with a diminished ability to generate progeny through breeding or crossing as compared to its wild-type counterpart; for example, a sterile fish, crustacean, or mollusk may have an about 50%, about 75%, about 90%, about 95%, or 100% reduced likelihood of producing progeny. In contrast, a fertile fish, crustacean, or mollusk refers to any fish, crustacean, or mollusk that possesses the ability to produce progeny through breeding or crossing. Breeding and crossing refer to any process in which a male species and a female species mate to produce progeny or offspring.
Maternal-effect refers to a situation where the phenotype of an organism is expected from the genotype of its mother due to the mother supplying RNA, proteins, or a combination thereof to the oocyte. Disrupting the maternal-effect of a PGC development gene refers to impairing or abolishing the function of one or a combination of genes that are maternally expressed in the oocyte and function in PGC development, maintenance, migration, or a combination thereof. The disruption of the one or combination of genes that are maternally expressed in the oocyte and function in PGC development, maintenance, migration, or a combination thereof does not impair or abolish a zygotic function of the one or combination of genes involved in the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor carrying said impairment or abolishment gene function. Of note, disruption of the one or combination of genes that are maternally expressed in the oocyte and function in PGC development, maintenance, migration, or a combination thereof may impair or abolish the zygotic function of the one or combination of genes that are not involved in the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor, for example, those involved in immunity, metabolism, stress or disease response. Disrupting the one or combination of genes that are maternally expressed in the oocyte and function in PGC development, maintenance, migration, or a combination thereof disrupts the formation of gametes and may result in sterile and sexually immature organisms.
Germ plasm genes have been subjected to knockout experiments resulting in their inactivation. However, after some germ plasm genes were knocked out, the expected phenotype was not observed and/or pleiotropic phenotypes were detected resulting in: 1) the development into defective fish that cannot breed to produce sterile progeny; or 2) a developed fish that produces non-viable progeny. Yet other germ plasm genes were knocked out resulting in a homozygous mutant having impaired development of the ovary, testis, or both and therefore cannot breed to produce a sterile progeny. The inventors have discovered that by introducing one or more specific mutations that affect PGC function without impairing or abolishing the ability of the mutated organism to develop into a sexually mature adult, i.e., does not impair their viability, sex determination, fertility, or a combination thereof, allows for the generation of a broodstock that can be used to produce sterile progeny. Importantly, the one or more specific mutations disrupt the maternal function of PGC formation such that the progeny of the homozygous mutant female is normal but depleted in their germ cells.
A mutation that disrupts the maternal-effect function of a PGC development gene refers to any genetic mutation that directly or indirectly impairs or abolishes a PGC development gene's maternal-effect function. Directly or indirectly affecting gene function refers to: (1) mutating the coding sequence of one or more PGC development genes; (2) mutating a non-coding sequence that has at least some control over the transcription or post transcriptional regulation of one or more PGC development genes; (3) mutating the coding sequence of another gene that is involved in post-transcriptional regulation of one or more PGC development genes; (4) mutating the coding sequence of another gene that is involved in the transport, formation, or combination thereof of germ plasm, for example, a gene product of one or more PGC development genes; (5) mutating the coding sequence of another gene that is involved in germ cell specification, maintenance, migration, or a combination thereof; (6) mutating the coding sequence of another gene that is involved in the epigenetic regulation of one or more PGC development genes; or (7) a combination thereof, to impair or ablate the PGC development gene's function. Gene function refers to the direct function of the gene itself and to the function of molecules produced during expression of the gene, for example, the function of RNA and proteins. Impairing gene function refers to decreasing the amount of gene function compared to the function of the gene's wild-type counterpart by, for example, about 10%, about 25%, about 50%, about 75%, about 90%, or about 95%. Abolishing gene function, or loss of function, refers to decreasing the amount of gene function compared to the function of the gene's wild-type counterpart by 100%. As used herein, “wild-type” refers generally to an organism where the maternal-effect function is undisrupted. “Wild-type counterpart” refers generally to normal organisms of the same age, species, etc.
A mutation may be any type of alteration of a nucleotide sequence of interest, for example, nucleotide insertions, nucleotide deletions, nucleotide substitutions. Preferred mutations in the coding sequence of one or more PGC development genes are nucleotide insertions or nucleotide deletions that cause a frameshift mutation, which may result in the production of a non-functional protein.
Mutating the coding sequence of one or more PGC development genes refers to any type of mutation to the coding sequence that: (1) impairs or abolishes the maternal-effect function of the PGC development genes involved in PGC development, maintenance, migration, or a combination thereof; and (2) does not impair or abolish the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor carrying said mutation. Examples of mutations to the coding sequence of the primordial germ cell development gene are mutations in the coding sequence of Tia1, TIAR, KHSRP, DHX9, Elavl1, Igf2bp3, Ptbp1a, TDRD6, Hook2 and Hnrnpab. The inventors discovered that mutating the coding sequence of certain PGC genes that impaired or abolished the maternal-effect function of the PGC development genes involved in PGC development, maintenance, migration, or a combination thereof also impaired or abolished the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor carrying said mutation, for example, Hnrnph1, Hermes, Elavl2, KIF5B.
Surprisingly, the inventors discovered that mutating: (1) a non-coding sequence that has at least some control in the transcription or post transcriptional regulation of one or more PGC development genes; (2) mutating the coding sequence of another gene that is involved in post-transcriptional regulation of the PGC development gene; (3) mutating the coding sequence of another gene that is involved in the transport, formation, or combination thereof of germ plasm; (4) mutating the coding sequence of another gene that is involved in germ cell specification, maintenance, migration, or a combination thereof; or (5) a combination thereof, may avoid impairing or abolishing the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor carrying said mutation. See Examples 10-13 and 16-18.
Mutating a non-coding sequence that has at least some control over the transcription or post transcriptional regulation of one or more PGC development genes refers to any type of mutation of a non-coding region that: (1) impairs or abolishes the maternal-effect function of the PGC development genes involved in PGC development, maintenance, migration, or a combination thereof; and (2) does not impair or abolish the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor carrying said mutation. Examples of mutating the non-coding sequence of one or more PGC development gene are mutations in: (1) one or more cis-acting 5′ UTR regulatory sequences of the one or more PGC development genes; (2) one or more cis-acting 3′ UTR regulatory sequences of the one or more PGC development genes; (4) promoters of the one or more PGC development genes; or (4) a combination thereof. Examples of cis-acting 5′ UTR regulatory sequences are the 5′ UTR regulatory sequence of nanos3, dnd1, and piwi-like genes, for example, ziwi. Examples of cis-acting 3′ UTR regulatory sequences are the 3′ UTR regulatory sequence of nanos3, dnd1, and piwi-like genes.
Mutating the coding sequence of another gene that is involved in post-transcriptional regulation of one or more PGC development genes refers to any type of mutation of a gene other than the one or more PGC development genes that: (1) impairs or abolishes the maternal-effect function of the PGC development genes involved in PGC development, maintenance, migration, or a combination thereof; and (2) does not impair or abolish the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor carrying said mutation. Examples of mutating the coding sequence of another gene that is involved in post-transcriptional regulation of one or more PGC development genes are mutating a gene encoding an RNA binding protein involved in the post-transcriptional regulation of the one or more PGC development genes and mutating a gene encoding an microRNA involved in the post-transcriptional regulation of the one or more PGC development genes. Examples of RNA binding proteins that are involved in the post-transcriptional regulation of one or more PGC development genes are Hnrnpab, Elavl1, Ptbp1a, Igf2bp3, Tia1, TIAR, Rbpm42, Rbpm24, KHSRP, and DHX9.
Mutating the coding sequence of another gene that is involved in the transport, formation, or combination thereof of germ plasm refers to any type of mutation of a gene other than the one or more PGC development genes that: (1) impairs or abolishes the maternal-effect function of the PGC development genes involved in PGC development, maintenance, migration, or a combination thereof; and (2) does not impair or abolish the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor carrying said mutation. Examples of mutating a coding sequence of another gene that is involved in the transport, formation, or combination thereof of germ plasm are one or more genes that encode a multi-tudor domain-containing protein, a kinesin-like protein, or an adaptor protein. An example of a multi-tudor domain-containing protein is Tdrd6. An example of an adaptor protein is hook2.
Mutating a coding sequence of another gene that is involved in germ cell specification, maintenance, migration, or a combination thereof refers to any type of mutation of a gene other than the one or more PGC development genes that: (1) impairs or abolishes the maternal-effect function of the PGC development genes involved in PGC development, maintenance, migration, or a combination thereof; and (2) does not impair or abolish the viability, sex determination, fertility, or a combination thereof of a homozygous progenitor carrying said mutation. An example of mutating a coding sequence of another gene that is involved in germ cell specification, maintenance, migration, or a combination is mutating a gene expressing a non-coding RNA. An example of a non-coding RNA is miR202-5p.
In step 2, a male F0 mosaic founder is crossed with a wild-type female to produce F1 progeny. The progeny may be fertile given that the one or more PGC development genes are provided by the wild-type mother. Given that the male F0 mosaic founder carries different types of mutant alleles in different cells, the progeny are screened to locate progeny carrying the desired mutation(s), which is designated by “m1” in
In step 3, a hemizygous mutated male F1 and a hemizygous mutated female F1 from step 2 are identified as carrying the same mutation(s) of interest and are crossed to produce F2 progeny. The progeny may be fertile given that the hemizygous mutated female F1 carries one wild-type copy of the mutated gene(s). An F2 homozygous mutated female is identified and may be used as a homozygous broodstock, which is designated by the checkered outline in
In step 4, the F2 homozygous mutated female broodstock is crossed with a wild-type male fish, crustacean, or mollusk to produce F3 progeny that are sterile, which may be referred to as sterile seedstock. Alternatively, the F2 homozygous mutated female broodstock is crossed with a hemizygous mutated male fish, crustacean, or mollusk or a homozygous mutated male fish, crustacean, or mollusk wild-type male fish, crustacean, or mollusk to produce F3 progeny that are sterile. The sterility of the progeny stems from the homozygous mutation in the F2 mother, which does not carry a wild-type copy of the mutated gene(s). Preferably, the F2 homozygous mutated female broodstock is crossed with a wild-type male fish, crustacean, or mollusk to produce F3 progeny that are sterile because crossing the F2 homozygous mutated female broodstock with a hemizygous mutated male fish, crustacean, or mollusk or a homozygous mutated male fish, crustacean, or mollusk wild-type male fish, crustacean, or mollusk may generate 50% or 100% of F3 progeny that is homozygous for the mutation. If the mutated gene has pleiotropic function beyond its role in PGC development, the F3 progeny may be impaired for the alternative function, for example, metabolism and immunity.
In step 5, an F2 homozygous mutated male, which is designated by the solid outline in
We have independently targeted two genes involved in pigmentation, namely the genes encoding tyrosinase (tyr) [1] and the mitochondrial inner membrane protein MpV17 (mpv17) [2]. We found that 50% and 46% of all injected embryos showed a high degree of mutation at the tyr and mpv17 loci respectively (
We tested whether multiple genomic loci can be targeted simultaneously and whether mutagenic efficiency measured at one loci is predictable of mutation at other loci in the tilapia genome. To test our hypothesis, we co-targeted tyr and Dead-end1 (dnd1). Dnd1 is a PGC-specific RNA binding protein (RBP) that maintains germ cell fate and migration ability [3]. Following injection of programmed nucleases, we found that mutations in both gene targets tyr and dnd1 were highly correlated. Approximately 95% of abino (tyr; see adult phenotype in
Tilapia orthologues of the selected genes and cis-acting elements in nos-3 and dnd1 3′UTR have been identified in silico from genomic databases and from software motif discovery algorithm searches [4-7]. To enhance the frequency of generating null mutations in the gene of interest, we targeted 2 separate exons simultaneously. Alongside the gene of interest, we co-targeted a pigmentation gene to serve as a mutagenesis selection marker. All mutants were created in tilapia lines containing the ZPC5:eGFP:nos 3′UTR construct (
Selected F0 mutants were screened for morphological malformations, developmental delays and sex differentiation. If the mutated fish develop normally, fertility of 3 males and 3 females were assessed at 4 and 6 months respectively by crossing them with ZPC5:eGFP:tnos 3′UTR tilapia. For each cross, 30 F1 progeny were genotyped and an additional 20 were analyzed by fluorescent microscopy. Since these lines express GFP selectively in PGCs, labelled-PGCs can be counted at 4 dpf when all PGCs have completed their migration to the genital ridges. The mean total PGC numbers were statistically compared across F1 progenies using an unpaired t test. If the engineered mutations function as hypothesized, we expected F1 embryos produced from F0 females to have reduced or absent GFP-PGC counts. Likewise, if the mutations are indeed maternal-effect specific, we expected F0 males to produce F1 progeny with a normal PGC counts (˜35+/−5 PGCs/embryo) (see
To select F1 hemizygous (outcrossed with WT fish of different genetic backgrounds) and F2 homozygous lines, we used QPCR melt analysis (MA) on amplicons spanning the target regions (
For each RBP and 3′UTR target, F3 embryos from F2 homozygous mutant males and females crossed with WT broodstock (n=30/group), were produced and raised to 2-3 months of age. Gonads from 10 juveniles were dissected and RNA/cDNA were screened by QPCR using vasa, a germ cell specific gene [9]. Q-PCRs for each sample was performed in triplicate and the level of vasa expression was normalized to a set of host house-keeping genes [57] (β-actin and ef1α). We expected no expression of vasa in sterile fish. At 5 months of age, we expect sterile males to have translucid testes and sterile females to yield a string-like ovary. An additional subset of dissected gonads was fixed (n=10/group) in Bouin's solution, dehydrated and infiltrated with paraffin for sectioning. Sterility was apparent from a complete absence of germ cells.
To generate 3 half sibling groups for these trials, embryos from 3 WT males crossed with 3 F2 homozygous mutant females (sterile groups) and 3 WT females (fertile groups) will be reared separately using established hatchery procedures. At ˜1 month of age, tilapia progeny (n=100/group) will be weighed, pit-tagged and held together in 3×300-Liters tanks in a recirculating culture system maintained at 27° C. All fish will be fed twice daily, to satiation, using a commercially prepared grow-out diet. Each fish will be individually weighed and measured at 4-week intervals over a 24-week period. At the end of the experiment, fish will be sacrificed, sexed, the mean total fish length, weight, filet yield and growth curves will be statistically compared using an unpaired t test.
Generation of nucleases and strategies: To create DNA double strand breaks (DSBs) at specific genomic site, we used engineered nucleases. In most applications a single DSB is produced in the absence of a repair template, leading to the activation of the non-homologous end joining (NHEJ) repair pathway. In a percentage of cases NHEJ can be an imperfect repair process, generating insertions or deletions (indels) at the target site. Introduction of an indel can create a frameshift within the coding region of the gene or a change in its regulatory region, disrupting the gene translation or its spatio-temporal regulation, respectively. To enhance the frequency of generating null mutations in the gene of interest, we targeted 2 separate exons simultaneously with the exception of those targeting nos 3′UTR and miR202. Alongside the gene of interest, we co-targeted a pigmentation gene to serve as a mutagenesis selection marker.
In some embodiments, to introduce custom nucleotide changes to the DNA sequence, two target sites were used to cut out the region to be modified. This strategy requires a donor vector which contain, the dsDNA with the desired mutations flanked by homology arms targeting regions of DNA outside the 2 target sites. This strategy activates the microhomology-directed repair (mHDR). The end result is that the DNA sequence included in the donor vector is incorporated into the native locus (
The template DNA coding for the engineered nuclease were linearized and purified using a DNA Clean & concentrator-5 column (Zymo Resarch). One microgram of linearized template was used to synthesize capped RNA using the mMESSAGE mMACHINE T3 kit (Invitrogen), purified using Qiaquick (Qiagen) columns and stored at −80° in RNase-free water at a final concentration of 800 ng/μl.
Embryo injections: All animal husbandry procedures were performed according to IACUC-approved CAT animal protocol CAT-003. All injections were performed in tilapia lines containing the ZPC5:eGFP:tnos 3′UTR construct or a wild-type strain. Approximately 10 nL total volume of solution containing the programmed nucleases were co-injected into the cytoplasm of one-cell stage embryos. Injection of 200 embryos typically produce 10-60 embryos with complete pigmentation defect (albino phenotype). Embryo/larvae survival was monitored for the first 10-12 days post injection.
Selection of founders: Selected albino F0 mutants were screened for morphological malformations, developmental delays and sex differentiation. If the mutated fish developed normally, fertility of 3 males and 3 females were assessed at 4 and 6 months respectively by crossing them with ZPC5:eGFP:tnos 3′UTR tilapia. For each cross 20 F1 progeny were analyzed by fluorescent microscopy. Since these lines express GFP selectively in PGCs, labelled-PGCs were counted at 4 dpf when all PGCs have completed their migration to the genital ridges (see Example 9). The mean total PGC numbers was then statistically compared across F1 progenies using an unpaired t test. If the engineered mutations function as hypothesized, we expect F1 embryos produced from F0 females to have reduced or absent GFP-PGC counts. Likewise, if the mutations are indeed maternal-effect specific, we expect F0 males to produce F1 progeny with a normal PGC counts (˜35+/−5 PGCs/embryo).
For mutant lines that confer a maternal effect specific PGC reduction, 3-5 F0 males were quantitatively assayed for genome modifications by fluorescence PCR fragment analysis (see Tables 1 and 2 for gene specific genotyping primers). We selected males in which mutations were produced at the one or two cell stage (detection of 2 or 4 mutant alleles per target loci by fragment analysis (
indicates data missing or illegible when filed
In the transgenic line, Tg(Zpc5:eGFP:tnos 3′UTR) the tilapia Zpc5 promoter is an oocyte-specific promoter, active during oogenesis prior to the first meiotic division. As such, all embryos from a heterozygous or homozygous transgenic female inherit the eGFP:tnos 3′UTR mRNA, which localizes and becomes expressed exclusively in PGCs through the action of cis-acting RNA elements in their 3′UTR (tilapia nos3 3′UTR). Embryos (4 days post fertilization) were euthanized by an overdose of tricaine methanesulfonate (MS-222, 200-300 mg/I) by prolonged immersion for at least 10 minutes. Stock preparation is 4 g/L buffered to pH 7 in sodium bicarbonate (at 2:1 bicarb to MS-222). The embryo were transferred onto a glass surface in PBS and their yolk removed. Deyolked embryos were squashed between a microscope slide and a cover slip and analyzed under fluorescent microscopy equipped with camera for imaging.
F1 genotyping: The selected male founders were crossed with tilapia female carrying the ZPC5:eGFP:tnos 3′UTR construct. Their F1 progeny were raised to 2 months of age, anesthetized by immersion in 200 mg/L MS-222 (tricaine) and transferred onto a clean surface using a plastic spoon. Their fin was clipped with a razor blade, and place onto a well (96 well plate with caps). Fin clipped fish were then placed in individual jars while their fin DNA was analyzed by fluorescence PCR. In brief, 60 μl of a solution containing 9.4% Chelex and 0.625 mg/ml proteinase K is added to each well for overnight tissue digestion and gDNA extraction in a 55° C. incubator. The plate is then vortexed and centrifuged. gDNA extraction solution was then diluted 10× with ultra-clean water to remove any PCR inhibitors in the mixture. Typically, we analyzed 80 juveniles/founder to select and raised batches of approximately 20 juveniles carrying identical size mutations.
Fluorescence PCR (see
One-two microliters of 1:10 dilution of the resulting amplicon were resolved via capillary electrophoresis (CE) with an added LIZ labeled size standard to determine the amplicon sizes accurate to base-pair resolution (Retrogen Inc., San Diego). The raw trace files were analyzed on Peak Scanner software (ThermoFisher). The size of the peak relative to the wild-type peak control determines the nature (insertion or deletion) and length of the mutation. The number of peak(s) indicate the level of mosaicism. We selected F0 mosaic founder carrying the fewest number of mutant alleles (2-4 peak preferentially).
The allele sizes were used to calculate the observed indel mutations. Mutations that are not in multiples of 3 bp and thus predicted to be frameshift mutations were selected for further confirmation by sequencing except for mutation in the non-coding sequence of genes targeted. Mutations of size greater than 8 bp but smaller than 30 bp were preferentially selected to ease genotyping by QPCR melt analysis for subsequent generations. For sequence confirmation, the PCR product of the selected indel is further submitted to sequencing. Sequencing chromatography of PCR showing two simultaneous reads are indicative of the presence of indels. The start of the deletion or insertion typically begins when the sequence read become divergent. The dual sequences are than carefully analyze to detect unique nucleotide reads. The pattern of unique nucleotide read is then analyzed against series of artificial single read patterns generated from shifting the wild type sequence over itself incrementally.
The embryos generated from pairwise breeding of single gene heterozygote mutant fish were analyzed under stereomicroscopy (both bright and fluorescent lights) for gross visible deformities. Clutches of progeny were grown to adulthood (3-6 months). Fin clips from adult fish were processed for DNA extraction with Chelex Resin and used for genotyping by melt analysis: Example 10—F2 and subsequent generation Genotyping by melt analysis (see below)
Real-time qPCR was performed ROTOR-GENE RG-3000 REAL TIME PCR SYSTEM (Corbett Research). 1-μL genomic DNA (gDNA) template (diluted at 5-20 ng/μl) was used in a total volume of 10 μL containing 0.15 μM concentrations each of the forward and reverse primers and 5 μL of QPCR 2× Master Mix (Apex Bio-research products). qPCR primers used are presented in Tables 1 and 2 (Genotyping RT-PCR primers in Table 2). The qPCR was performed using 40 cycles of 15 seconds at 95° C., 60 seconds at 60° C., followed by melting curve analysis to confirm the specificity of the assay (67° C. to 97° C.). In this approach, short PCR amplicons (approx 120-200 bp) that include the region of interest are generated from a gDNA sample, subjected to temperature-dependent dissociation (melting curve). When induced indels are present in hemizygous gDNA, heteroduplex as well as different homoduplex molecules are formed. The presence of multiple forms of duplex molecules is detected by Melt profile, showing whether duplex melting acts as a single species or more than one species. Generally, the symmetry of the melting curve and melting temperature infers on the homogeneity of the dsDNA sequence and its length. Thus, homozygous and wild type (WT) show symmetric melt curved that are distinguishable by varied melting temperature. The Melt analysis is performed by comparison with reference DNA sample (from control wild type DNA) amplified in parallel with the same master mix reaction. In short, variation in melt profile distinguishes amplicons generated from homozygous, hemizygous and WT gDNA (see
The genotyping data were used to analyze for Mendelian ratios of surviving homozygous knockout fish compared to the homozygote WT and heterozygous fish. Under the null hypothesis of no viability selection, progeny genotypes should conform to an expected Mendelian ratio of 1:2:1. Deviations from expected number of homozygous knockouts (25%) were tested with goodness-of-fit Chi-square statistical analysis.
Sex Ratio Determinations: At 3-4 months of age, progeny (n=40/group) were sexed. Males and females were identified, visually, based on their sex-specific uro-genital papillae.
Morphological and cellular analysis of the gonads: Sterility was evaluated by comparing the overall morphology of the gonads. Gonadal structure in the homozygous maternal progeny (n=20 per cross) was compared to age-matched (3 months old) paternal progeny (fertile control). To analyze the cellular structure of the gonads we fixed gonads in Bouin's solution for 48 h. After dehydration in ethanol and clearing in toluene, the specimens were infiltrated with paraffin, embedded, and sectioned. Each section was read blind by two reviewers. Sterility in male is apparent from a complete absence of spermatozoa in the tubule lumen. Sterility in female is apparent by a gonad reduced to a string like structure and histology sections revealing no oocytes.
Confirmation of sterility at the molecular level: Total RNA was extracted from dissected gonads (from each paternal and maternal group/line) and the corresponding cDNA were screened to quantify expression of germ cell specific genes (tilapia vasa accession #AB03246766) and gonad specific supporting somatic cells (tilapia Sox 9a and tilapia cyp19a1a for male and female gonad respectively). Q-PCRs were performed in triplicate and level of expression was normalized against host house-keeping gene (tilapia b-actin). Relative copy number estimates were generated using established procedures. We expected no expression of vasa in sterile fish but normal expression of sox9a relative to wild type testis.
To test if the coding sequence or regulatory sequences of selected genes are strictly essential for PGC development, we generated tilapia mutants using programmable nucleases with or without donor DNA. To enhance the frequency of generating null mutations in Nanos3 (nos3), Dead end-1 (dnd1), TIAR, Tia1, KHSRP, DHX9, Elavl1, Elavl2, Igf2bp3, Rbm42, Rbms (Hermes), Rbm24, Hnmph1, Hnrmpab, Tdrd6, Hook2, Ptbp1a, KIF5B, Cxcr4a genes, we targeted two separate exons of each gene simultaneously. To maximize the chances of generating loss-of-function mutations, we preferentially selected target sites in the first half of the coding region. Alongside the gene of interest, we co-targeted a pigmentation gene to serve as a mutagenesis selection marker (
Survival and deformities of F0 treated embryos were analyzed and compared to non-injected controls. We found that Rbms and Hnmph1 F0 treated embryos had low survival rates and no albino fish were recovered, suggesting that these genes play an essential role in embryo morphogenesis. Similarly, KIF5B treated embryos had poor viability. Nonetheless, we successfully recovered and propagated one viable F0 KIF5B mutant displaying severe morphological deformities.
We did not observe a significant difference in viability or visible gross developmental abnormalities between the treatment groups and controls in any other gene mutant fish for the remaining 17 genes targeted. For each treatment group, a minimum of 20 albinos were selected and propagated. All F0 mutant treated groups developed with a normal sex ratio at 5 months of age with the exception of nos3 (88% males, n=42), dnd1 (83% males, n=41), Tia1 (80% males, n=20) and Elavl1 (90% males, n=20) (see Table 3). Furthermore, we found that disruption of the coding sequences of nos3 and dnd1 caused 30% (n=3/10) of nos3 F0 females and 60% (n=4/10) of dnd1 F0 males to develop into agametic adult. In those fish, stripping procedures at maturity yielded no gametes. Upon further analysis of their gonads, we found string-like oocytes-free ovaries in F0 nos3 mutant females and translucid sperm-free testes in F0 dnd mutant males (
Next, we investigated the maternal effect of the mutations to determine if they altered the PGC development pathways. For this, 2-4 sibling F0 female tilapia in each treatment group were bred with wild type male and their embryo progeny was analyzed under fluorescent microscopy to score their PGC count. The average PGC ablation level ranged from 20% to 85%, depending on the gene targeted (
To determine if F0 females carrying mutation in nos33′UTR produced embryos with reduced PGC count, we analyzed the gonads of these progeny at 4 months and 6 months of age (since F0 female in this treatment group do not carry the GFP transgene, PGC count is not possible). Surprisingly, we observed a strong maternal effect sterility characterized by reduced gonadosomatic index with translucent testis and string-like ovaries (
We further analyzed the development of PGC depleted gonads in the progeny from F0 females carrying mutations in TIA1, Rbms42 and Ptbp1a. We compared individuals with low PGC and high PGC counts and found a positive correlation between PGC reduction level and gonad size reduction (
Altogether, our results identified several genes whose loss of function or misexpression confer a maternal-effect PGC depletion and associated sterile phenotype.
Since F0 mutant tilapia have unpredictable plurality of sequence outcomes at the site of targeted DNA double stranded breaks, and the extent to which remaining wildtype or in-frame indel sequences are capable of obscuring the phenotype is unknown, we performed additional phenotypic characterization. Furthermore, off-target nuclease activity could have contributed to the phenotype. Thus, we propagated the intended mutation selectively, to ensure that putative off-target mutations are segregated and eliminated from subsequent generations of offspring. Eventually, the full phenotype can be measured when identical mutations are found in every cell of the animal in the F2 homozygous generations. Accordingly, for each treated group, we outbred the selected founder males with germline transmitting mutations with females Tg(Zpc5:eGFP:nanos 3′UTR) to generate F1 fish heterozygous for either frameshift mutations, insertion or precise edits in targeted gene.
Details of the selected mutant alleles including the size of indel and predicted cDNA and protein changes are summarized in Table 3 and described in
Heterozygous tilapia carrying these mutations appear healthy and differentiated into fertile adults of both sexes. The absence of a reproductive phenotype in these sexually mature F1 generation is not unexpected given the presence of a wild type allele of each targeted gene in all cells of selected mutant.
Given the apparent critical role of the genes targeted in PGC development, we further tested whether they represent a dosage-dependent mechanism. To this end, we investigated whether decreasing the maternal dose of functional mRNA/protein decreases the number of PGCs. Indeed, in oocytes of hemizygous mutant females, both alleles are expressed but only one code for a functional protein. Thus, if the targeted gene works in a dose dependent manner, we should expect the progeny from hemizygous females crossed to wild type males to show reduction in the number of PGC. We found that hemizygous mutant for KHSRP (KSHRPΔ17/+) and ElavL1 (ElavL1Δ3k/+) produced embryos progeny with a normal PGC count (
To further investigate the possibility of a zygotic effect of the mutation in early developmental processes, we scored the viability of embryos progeny from hemizygous mutant female crossed with hemizygous mutant male. We anticipated that approximately 25% of the embryo progeny are homozygous for the mutant allele.
Under white light stereomicroscope, we measured that ˜25% of the larvae from the KIFSB family developed severe craniofacial deformities, curved body with bent tails (
To learn more about possible function of the genes targeted at later developmental stage, we raised each clutches of embryos to adulthood and analyzed the sex ratios, fertility and gonadal morphology of homozygous, hemizygous and WT sibling progeny.
Consistent with the phenotype observed in F0 generations, the lack of zygotic nos3 and dnd1 mRNA resulted in sterility phenotypes. We found that nos3-knockout (nos3Δ5/Δ5) developed into fish of both sexes. We found nos3Δ5/Δ5 female to be agametic with a string like ovary (
We only raised dnd1 KO tilapia (dnd1) and all developed into males (n=17). These males showed translucid testes and were agametic, as confirmed by cellular and molecular analysis of their testes (
We further show that the RNA binding protein Elavl2 is fundamental for gametogenesis both in males and females because loss-of-function mutation results in complete abrogation of gametes in both sexes as evidence by morphological and molecular analysis of their gonads (
For all other genes targeted, we recovered all anticipated genotypes at the expected Mendelian frequencies with no obvious phenotypes through adulthood. To measure the full strength of the maternal effect sterility phenotype, we crossed homozygous mutant females with WT males and analyzed the embryos progeny. We observed strong PGC reduction in the progeny of females homozygous for the following alleles TIAR, KHSRP, TIA1, DHX9, Elavl1, Cxcr4 (
To better understand the genetic architecture of PGCs development and determine a functional order of action of genes involves in these processes, we established double mutant lines and compared the PGCs count in the progeny from single gene or double gene loss-of function phenotypes. Furthermore, to determine if existing mutations govern the post-transcriptional regulation of nos3, we study the effect single mutations in a transgenic line of tilapia expressing the proapoptotic gene bax fused to nos3 3′UTR under the control of an oocyte specific promoter (MSC transgenic line). We previously established that MSC female produce embryos lacking PGCs from ectopic maternal expression of BAX in these cells (Lauth and BUCHANAN 2016).
We found merely additive PGC effect (no epistasis) in tilapia lines carrying MSC-khrspΔ16/Δ16, MSC-DHX9Δ7/Δ7, MSC-TIARι11/ι11 suggesting that these genes do not interact with nos3′UTR (
Our mutagenesis screen uncovered new germ plasm genes whose inactivation in tilapia prevent the development of fertile female. We found that inactivation of Hnrnph1 and Rbms resulted in embryonic lethality. Our results further agree with earlier finding that embryos deficient for Kif5Ba exhibit a mix of moderately to severely ventralized phenotypes (Campbell, Heim et al. 2015).
Our results show that the zygotic function of nos3 in tilapia is required for the maintenance of oogonial stem cell, with nos3Δ5/Δ5 mutant females developing string like agametic ovaries at maturity, while mutant males remain fertile (
Our results confirm the findings of a previous study in Atlantic salmon showing that zygotic dnd1 expression is required for the continued maintenance of germ cells and that maternally contributed dnd1 mRNA and/or protein cannot rescue the zygotic function of this gene (Wargelius, Leininger et al. 2016).
We generated loss of function mutation in ElavL2 which encodes a protein that shows significant similarity to the product of the Drosophila elav gene (embryonic lethal, abnormal visual system), the absence of which causes multiple structural defects and embryonic lethality. Elavl2 was found to be abundantly expressed in zebrafish brain as well as in PGCs during early embryonic development (Thisse and Thisse 2004, Mickoleit, Banisch et al. 2011). We were therefore surprised to see that tilapia ElavL2Δ8/Δ8 homozygous mutants are perfectly viable, developing into sterile male and female (
Somewhat surprisingly, we successfully identified genes whose loss-of-function mutations produced severe defect in PGCs development with no other obvious phenotype to adulthood, indicating that they are not required for viability or fertility. Here, we describe for the first time the defects caused by TIA1, TIAR, KHSRP, Rbm24, Rbm42, DHX9, Igf2pb3, Hnrnph1 and EIavL1 loss of function mutations in any animal species where germ cells are specified by maternal inheritance (e.g all fish, many insects and frog species). Embryos derived from mutant mothers for these genes had, on average, between 60% and up to 88% of PGC number reduction. In some, but not all maternal mutant genotypes this reduction correlated with an increase in variance of this quantitative trait. An increase variance could indicate a role of buffering agent to stabilize gene regulatory network controlling germ cell number. Mice lacking TIAL1 exhibit partial embryonic lethality and defective germ cell maturation (Beck et al., 1998), implicating TIA1 proteins in regulation of essential aspects of vertebrate development. We also describe the first defect caused by the inactivation of Hook2, Tdrd6, dnd1 and KIFSB in tilapia.
To solve the problem associated with pleiotropic function of essential protein required for germ cell maintenance, we investigated the possibility to deactivate selectively the maternal gene function without affecting its zygotic activity. We specially investigated the 3′UTR function of tilapia nos3 and dnd1 which are respectively required in embryos and adults for the formation and continued maintenance of the germ line. Given the possible involvement of Elavl2 in PGC formation (Mickoleit, Banisch et al. 2011), and its requirement for germ line maintenance in adult (our study), we further included Elavl23′UTR to our analysis.
To interrogate the contribution of tilapia dnd1 3′UTR in maintaining adult germ cells, we performed a 3′UTR swapping experiment with the 3′UTR of the tilapia β-globin gene. The expression of cytoplasmic β-globin gene is generally believed to be constitutive and ubiquitous in all cell type and expected to lack cis-acting motifs necessary for PGCs expression (Herpin, Nakamura et al. 2009). We found that β-globin 3′UTR cannot be used as an alternative 3′UTR to maintain the zygotic function of dnd1, suggesting that specific post-transcriptional regulations are necessary for DND1 activity in the zygote.
RNA Localization to germ plasm is mediated by 3′UTR specific cis-regulatory elements whose requirement for the zygotic function remain untested. To first map candidate regulatory elements, we imputed the 3′UTR sequences of varied nos3, dnd1 and Elavl2 transcripts across different species into a web-based software motif discovery algorithm. Despite the low sequence similarities in multiple sequence alignments, and 3-9 folds variation in their length, we successfully identified varied conserved motifs in the 3′UTR for these orthologous genes. The result of nos33′UTR sequences analysis reveal two conserved motifs, one of which was present in all nos33′UTR sequences analyzed (
To further evaluate the plausibility of these regions we performed a scan for consequential pairing of seed target for miR-430, miR-23 and miR-101. miR430 is the most abundant miR in early zebrafish embryo and is known to inhibit nos3 and tdrd7 mRNAs in somatic cells (Mishima, Giraldez et al. 2006). These conserved miRNA families have been detected in unfertilized eggs and early embryos in many teleost species (Ramachandra, Salem et al. 2008) suggesting an important conserved role, possibly regulating germ plasm RNA. We found two putative oni-miR-23 sites in tilapia dnd1 3′UTR, one miR-430 and one miR-101 site in tilapia nos3 3′UTR located in closed proximity to the conserved predicted binding motifs1 and 2 of tilapia nos3 and dnd1 3′UTR. Without wishing to be bound by a theory, our analysis suggests a mechanism in which conserved cis-acting motifs and trans-acting RNA binding factors form mRNA-protein complexes (mRNPs). These interactions may protect against miRNA degradation in a germ plasm specific manner. Taken together, of the 6 binding motifs, dnd1-1 and nos3-1 were prioritized for further investigation in this study.
As initially hypothesized and in contrast to nos3 loss of function mutation, we found that the disruption of nos3-3′UTR motif-1 does not impair the zygotic function of the gene. We observed that motif-1 deficient females develop a functional ovary. Importantly, we confirmed that this motif is required for the maternal function of the gene. We observed that motif-1 deficient females produce PGC depleted embryos that grew into sexually delayed and/or agametic adults (
We propose that a similar approach can be used for the prediction of binding motifs target of RNA-binding proteins and anticipate that such systematic identification will identify valuable target for modification to achieve deregulation of additional maternal genes governing the formation of PGCs.
We speculate that inactivation of other conserved 3′UTR regulatory sequences will not result in pleiotropic phenotypes detrimental to the survival, sex determination or fertility of the homozygous mutant female. The conserved nature of cis-acting elements renders these sequences specifically attractive as target to achieve the same maternal effect phenotypes in different aquaculture species of fish.
We further describe for the first time the effect caused by miR-202-5p inactivation on PGCs development. This miR202 is evolutionary conserved and has two mature transcripts, miR-202-5p and miR-202-3p with miR-202-5p representing the dominant arm in ovaries during late vitellogenesis of zebrafish (Vaz, Wee et al. 2015) marine medaka (Presslauer, Bizuayehu et al. 2017), rainbow trout (Juanchich, Le Cam et al. 2013), tilapia (Xiao, Zhong et al. 2014), Atlantic halibut (Bizuayehu, Babiak et al. 2012) and Xenopus tropicalis (Armisen, Gilchrist et al. 2009). It was recently reported that the inactivation of miR-202 (combined loss of miR202-3p and miR202-5p) in medaka result in sterile female lacking eggs or subfertile female laying reduced number of abnormal and non-viable eggs. The reproductive phenotype reflect an impaired folliculogenesis (Gay, Bugeon et al. 2018). Interestingly, our F0 and F1 miR-202 mutant females produced viable PGC depleted progeny.
TAGGAGTGCAGCAAGCATGTGAATTTCCATTCGTGAACCG
TGTAAAACGACGGCCAGTTTTGCATATGGGCAGACATC
TAGGAGTGCAGCAAGCATtataattcattgttgtgggttgta
TGTAAAACGACGGCCAGTCCATTCTGAAGTTATCCTTTT
TAGGAGTGCAGCAAGCATtctttcacagGGTCCACCG
TGTAAAACGACGGCCAGTTGATTTGAATCCAGAGATTACT
TAGGAGTGCAGCAAGCATtgtccttcagGTTGATTACAG
TAGGAGTGCAGCAAGCATGGCTTCAACTACATTGGGATGGG
TGTAAAACGACGGCCAGTttctcagGGGACGGCAGCG
TAGGAGTGCAGCAAGCATGGCAATGGAGAAGCTGAATGGAT
TGTAAAACGACGGCCAGTagaagttctaatgcacctccaa
TAGGAGTGCAGCAAGCATCGCTAAAGGAGCTGCTGGAAATg
TGTAAAACGACGGCCAGTGGGAGCTCATCCTCTGGTTGGTG
TGTAAAACGACGGCCAGTttttctttgtctctttagCAGGT
TAGGAGTGCAGCAAGCATttgtgttttaacagCAGGTTCTC
TGTAAAACGACGGCCAGTTGGGATAGTTGGTAATGGATT
TAGGAGTGCAGCAAGCATGTCTGTGCACATGATCTACACCA
TAGGAGTGCAGCAAGCATCCAATGGCAACGACAGCAAAAAG
TGTAAAACGACGGCCAGTTCTCTGGACGGTCAGAACATCTA
TAGGAGTGCAGCAAGCATATGAACGGAATGGTTTGG
TGTAAAACGACGGCCAGTCCCGCGAATGTGCACTAACGAG
TAGGAGTGCAGCAAGCATTTTCCCAATTCCTCCACCCAAG
TAGGAGTGCAGCAAGCATATGTCTGAGTCAGAGCAACAGTA
TGTAAAACGACGGCCAGTGAAGAAGGATCCAGTAAAGAAAA
TAGGAGTGCAGCAAGCATtttgttctgtctccttgtctccc
TGTAAAACGACGGCCAGTCCAAGATGGCCAAAAACAAGC
TAGGAGTGCAGCAAGCATCACACAACCGACTCAAGT
TGTAAAACGACGGCCAGTTTCCCCATACCTTGACTATACTG
TAGGAGTGCAGCAAGCATACCTCCACCCATGATGCTCCC
TGTAAAACGACGGCCAGTtgccaaaATGTCATCAATCTAG
TAGGAGTGCAGCAAGCATAATTGTCTGCACTTATAGATGTC
TGTAAAACGACGGCCAGTCTCGGTCACCAGGTGTCTGAT
TAGGAGTGCAGCAAGCATAAGCTCAGCCTCAGCGAATCTCT
TGTAAAACGACGGCCAGTgttccagtgtccagaatcggg
TGTAAAACGACGGCCAGTCTCCGTGTACGCCAAGTCCAGA
In the preceding description, for purposes of explanation, numerous details are set forth in order to provide a thorough understanding of the embodiments. However, it will be apparent to one skilled in the art that these specific details are not required.
The above-described embodiments are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art. The scope of the claims should not be limited by the particular embodiments set forth herein, but should be construed in a manner consistent with the specification as a whole.
Aspects of the work described herein were supported by grant 2019-67030-29002 from the USDA-National Institute of Food and Agriculture. The United States Government may have certain rights in these inventions.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2019/042543 | 7/19/2019 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62701278 | Jul 2018 | US |