The present invention relates to methods for identifying guide RNAs for use in site-directed RNA editing. In particular, the present invention relates to a high-throughput screening method for identifying guide RNAs (gRNAs) effective for site directed A-to-I RNA editing, and methods of use for the identified guide RNAs. Additionally, the invention relates to guide RNA sequences that have been identified by this screening approach to he superior in the repair of the premature W402X stop codon in the human IDUA (alpha-L-iduronidase) transcript.
Site-directed RNA editing is a new technology for manipulating genetic information on the RNA level. This is accomplished by small guide RNAs that recruit the endogenous RNA editing enzymes, ADARs (adenosine deaminases acting on RNA), or engineered ADAR fusion proteins, to user-defined target RNAs, thereby enabling the conversion of specified adenosine residues to inosines (A-to-I editing). Since inosine is biochemically interpreted as guanosine, site-directed A-to-I RNA editing has the potential to manipulate RNA and protein function for therapeutic and bioengineering purposes.
Current ADAR guide RNA designs feature an anti sense domain of variable length that is complementary to the target sequence, and an optional recruitment domain for ADAR binding. Only a small number of ADAR guide designs have been tested so far, with disparate degrees of success achieved in editing of different targets, and uniform design principles are yet to be established. Given the up to 100% editing efficiency of ADAR's diverse natural RNA targets, there appears to be great potential for further optimizing ADAR guide RNAs. However, such optimization efforts have been hampered by the lack of suitable high-throughput approaches for rapid screening of guide candidates. Accordingly, what is needed are methods for high-throughput screening of guide RNA candidates for use in A-to-I RNA editing.
In some aspects, provided herein are fusion constructs. In some embodiments, provided herein is a fusion construct comprising a target sequence and a guide RNA sequence. In some embodiments, the guide RNA sequence comprises an antisense domain that is substantially complementary or perfectly complementary to the target sequence. In some embodiments, the guide RNA sequence further comprises a recruitment domain that recruits endogenous adenosine deaminases acting on RNA (ADARs) and/or engineered ADAR fusion proteins. in some embodiments, the recruitment domain comprises a first strand and a second strand that are substantially complementary or perfectly complementary to each other.
In some embodiments, the fusion construct further comprises a loop sequence, such that the construct forms a stern loop secondary structure. The loop sequence may comprise any suitable number of nucleotides. In some embodiments, the loop sequence comprises 3-50 nucleotides. In some embodiments, the loop sequence comprises 5 nucleotides. In some embodiments, the loop sequence comprises a nucleotide sequence set forth in Table 1. In some embodiments, the antisense domain and the target sequence are linked by the loop sequence. In some embodiments, the first strand and the second strand of the recruitment domain are linked by the loop sequence.
In some embodiments, the guide RNA sequence comprises one or more mutations in the antisense domain that disrupt base pairing between the antisense domain and the target sequence in at least one nucleotide location. In some embodiments, the guide RNA sequence comprises one or more mutations in the first strand and/or the second strand of the recruitment domain that disrupt base pairing between the first strand and the second strand in at least one nucleotide location. In some embodiments, the first strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 3. For example, in some embodiments the first strand comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 3. In some embodiments, the first strand comprises a nucleotide sequence set forth in Table 2. In some embodiments, the second strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 4. For example, in some embodiments the second strand comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 4. In some embodiments, the second strand comprises a nucleotide sequence set forth in Table 3.
In some embodiments, the target sequence is derived from the human IDUA gene. In some embodiments, the target sequence comprises a nucleotide sequence having at least 80% sequence identity to GAGCAGCUCUAGGCCGAA (SEQ ID NO: 1). In some embodiments, the nucleotide at position 11 relative to SEQ ID NO: 1 is an adenine (A). In some embodiments, the antisense domain comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 2. In some embodiments, the antisense domain comprises a sequence set forth in Table 5 or Table 6.
In some aspects, provided herein are vectors. In some embodiments, provided herein is a vector comprising a fusion construct described herein. The fusion constructs and vectors described herein may be used in a high-throughput screening method for selecting guide RNAs for use in site-directed RNA editing
In some aspects, provided herein are high-throughput screening methods. In some embodiments, provided herein is a high-throughput screening method for selecting guide RNAs for use in site-directed RNA editing. In some embodiments, the method comprises generating a plurality of fusion constructs, each fusion construct comprising a target sequence and a guide RNA sequence. In some embodiments, the guide RNA sequence comprises an antisense domain that is substantially complementary or perfectly complementary to the target sequence.
In some embodiments, the method further comprises expressing each of the plurality of fusion constructs in a distinct population of cells. In some embodiments, the method further comprises determining whether a fusion construct induces one or more modifications in nucleic acid isolated from the population of cells expressing the fusion construct. In some embodiments, the cells express endogenous adenosine deaminases acting on RNA (ADARs) and/or at least one engineered ADAR fusion protein.
In some embodiments of the methods described herein, the guide RNA sequence further comprises a recruitment domain that recruits endogenous adenosine deaminases acting on RNA (ADARs) and/or engineered ADAR fusion proteins. In some embodiments, the recruitment domain comprises a first strand and a second strand that are substantially complementary or perfectly complementary to each other.
In some embodiments of the methods described herein, the fusion construct further comprises a loop sequence, such that the construct forms a stern loop secondary structure. In some embodiments, the loop sequence comprises 3-50 nucleotides. For example, in some embodiments the loop sequence comprises 5 nucleotides. In some embodiments, the loop sequence comprises a nucleotide sequence set forth in Table 1. In some embodiments, the antisense domain and the target sequence are linked by the loop sequence. In some embodiments, the first strand and the second strand of the recruitment domain are linked by the loop sequence.
In some embodiments, the guide RNA sequence comprises one or more mutations in the antisense domain that disrupt base pairing between the antisense domain and the target sequence in at least one nucleotide location. In some embodiments, the guide RNA sequence comprises one or more mutations in the first strand and/or the second strand of the recruitment domain that disrupt base pairing between the first strand and the second strand in at least one nucleotide location. In some embodiments, the first strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 3. For example, in some embodiments the first strand comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 3. In some embodiments, the first strand comprises a nucleotide sequence set forth in Table 2. In some embodiments, the second strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 4. For example, in some embodiments the second strand comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 4. In some embodiments, the second strand comprises a nucleotide sequence set forth in Table 3.
In some embodiments, the target sequence is derived from a gene for which site-directed A-to-I RNA editing is desired. In some embodiments, the gene comprises a point mutation, wherein the point mutation is a G to A point mutation, a T to A point mutation, or a C to A point mutation. In some embodiments, the point mutation is associated with development of a disease or condition in a subject expressing the gene. In some embodiments, the point mutation is present in the target sequence.
In some embodiments, determining whether a fusion construct induces one or more modifications in nucleic acid isolated from the population of cells expressing the fusion construct comprises sequencing the isolated nucleic acid. In some embodiments, the isolated nucleic acid comprises RNA. In some embodiments, the one or more modifications in nucleic acid isolated from the population of cells comprises a correction of the point mutation initially present in the target sequence. In some embodiments, correction of the point mutation indicates that the guide RNA sequence effectively induces site-directed RNA editing.
In some embodiments, the target sequence comprises a nucleotide sequence having at least 80% sequence identity to GAGCAGCUCUAGGCCGAA (SEQ ID NO: 1). In some embodiments, the nucleotide at position 11 relative to SEQ ID NO: 1 is an adenine (A). In come embodiments, the antisense domain comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 2. In some embodiments, the antisense domain comprises a sequence set forth in Table 5 or Table 6.
In some embodiments of the methods described herein, wherein the method identifies one or more optimized features of the guide RNA sequence that enable the guide RNA sequence to induce one or more modifications in nucleic acid isolated from the population of cells expressing the fusion construct. For example, the optimized features may be selected from the antisense domain, the loop sequence, and the recruitment domain, if present in the guide RNA.
In some aspects, provided herein are methods for site-directed RNA editing. In some embodiments, provided herein is a method for site-directed RNA editing, the method comprising selecting a guide RNA by the methods described herein, and delivering a construct comprising the guide RNA to a cell or a subject. For example, the method for site-directed RNA editing may comprise selecting a guide RNA by a high-throughput screening method described herein, and delivering a construct comprising the selected guide RNA to a cell or a subject. In some embodiments, the cell is a mammalian cell. In some embodiments, the subject is a mammal.
In some aspects, provided herein are guide RNAs. In some embodiments, provided herein are guide RNAs for use in site-directed RNA editing. In some embodiments, provided herein is a guide RNA for use in site-directed RNA editing, wherein the guide RNA comprises an antisense domain that is substantially complementary or perfectly complementary to a target gene sequence. In some embodiments, the guide RNA comprises a recruitment domain that recruits endogenous adenosine deaminases acting on RNA (ADARs) and/or engineered ADAR fusion proteins. In some embodiments, the recruitment domain comprises a first strand and a second strand that are substantially complementary or perfectly complementary to each other. In some embodiments, the first strand and the second strand are linked by a loop sequence. In some embodiments, the loop sequence comprises 3-50 nucleotides. For example, in some embodiments the loop sequence comprises 5 nucleotides. In some embodiments, the loop sequence comprises a nucleotide sequence set forth in Table 1.
In some embodiments, the first strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 3. For example, in some embodiments the first strand comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 3. In some embodiments, the first strand comprises a nucleotide sequence set forth in Table 2. In some embodiments, the second strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 4. For example, in some embodiments the second strand comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 4. In some embodiments, the second strand comprises a nucleotide sequence set forth in Table 3.
In some embodiments, the target gene sequence is present within a portion of the human IDUA gene containing a W402X substitution mutation. In some embodiments, the target gene sequence comprises SEQ ID NO: 5. In some embodiments, the antisense domain comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 2. In some embodiments, the antisense domain comprises a sequence set forth in Table 5 or Table 6. In some embodiments, the guide RNA may be used in a method of treating Hurler syndrome.
Other aspects and embodiments of the disclosure will be apparent in light of the following detailed description and accompanying figures.
The present disclosure is directed to methods for identifying, guide RNAs for use in site-directed RNA editing. In particular, the present invention relates to a high-throughput screening method for identifying guide RNAs effective for site directed A-to-I RNA editing.
To facilitate an understanding of the present technology, a number of terms and phrases are defined below. Additional definitions are set forth throughout the detailed description.
The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.
For the recitation of numeric ranges herein, each intervening number therebetween with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0 6,1, 6.2, 6,3, 6.4, 6.5, 6.6, 6,7, 6.8, 6.9, and 7.0 are explicitly contemplated.
Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. For example, any nomenclature used in connection with, and techniques of, cell and tissue culture, biochemistry, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
The term “amino acid” refers to natural amino acids, unnatural amino acids, and amino acid analogs, all in their D and L stereoisomers, unless otherwise indicated, if their structures allow such stereoisomeric forms.
Natural amino acids include alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), Lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y) and valine (Val or V).
Unnatural amino acids include, but are not limited to, azetidinecarboxylic acid, 2-aminoadipic acid, 3-aminoadipic acid, beta-alanine, naphthylalanine (“naph”), aminopropionic acid, 2-aminobutyric acid 4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisbutyric acid, 2-aminopimelic acid, tertiary-butylglycine (“tBuG”), 2,4-diaminoisobutyric acid, desmosine, 2,2′-diaminopimelic acid, 2,3-diaminopropionic acid, N-ethylglycine, N-ethylasparagine, homoproline (“hPro” or “homoP”), hydroxylysine, allo-hydroxylysine, 3-hydroxyproline (“3Hyp”), 4-hydroxyproline (“4Hyp”), isodesmosine, allo-isoleucine, N-methylalanine (“MeAla” or “Nime”), N-alkylglycine (“NAG”) including N-methylglycine, N-methylisoleucine, N-alkylpentylglycine (“NAPG”) including N-methylpentylglycine, N-methylvaline, naphthylalanine, norvaline (“Norval”), norleucine (“Norleu”), octylglycine (“OctG”), ornithine (“Orn”), pentylglycine (“pG” or “PGly”), pipecolic acid, thioproline (“ThioP” or “tPro”), homoLysine (“hLys”), and homoArginine (“hArg”).
As used herein, the term “artificial” refers to compositions and systems that are designed or prepared by humankind, and are not naturally occurring. For example, an artificial peptide or nucleic acid is one comprising a non-natural sequence (e.g., a nucleic acid or a peptide without 100% identity with a naturally-occurring protein or a fragment thereof).
As used herein, a “conservative” amino acid substitution refers to the substitution of an amino acid in a peptide or polypeptide with another amino acid having similar chemical properties, such as size or charge. For purposes of the present disclosure, each of the following eight groups contains amino acids that are conservative substitutions for one another:
Naturally occurring residues may be divided into classes based on common side chain properties, for example: polar positive (or basic) (histidine (H), lysine (K); and arginine (R)); polar negative (or acidic) (aspartic acid (D), glutamic acid (E)); polar neutral (serine (S), threonine (T), asparagine (N), glutamine (Q)); non-polar aliphatic (alanine (A), valine (V), leucine (L), isoleucine methionine (M)); non-polar aromatic (phenylalanine (F), tyrosine (Y), tryptophan (W)); proline and glycine; and cysteine. As used herein, a “semi-conservative” amino acid substitution refers to the substitution of an amino acid in a peptide or polypeptide with another amino acid within the same class.
In some embodiments, unless otherwise specified, a conservative or semi-conservative amino acid substitution may also encompass non-naturally occurring amino acid residues that have similar chemical properties to the natural residue. These non-natural residues are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include, but are not limited to, peptidontimetics and other reversed or inverted forms of amino acid moieties. Embodiments herein may, in some embodiments, be limited to natural amino acids, non-natural amino acids, and/or amino acid analogs.
Non-conservative substitutions may involve the exchange of a member of one class for a member from another class.
The term “amino acid analog” refers to a natural or unnatural amino acid Where one or more of the C-terminal carboxy group, the N-terminal amino group and side-chain functional group has been chemically blocked, reversibly or irreversibly, or otherwise modified to another functional group. For example, aspartic acid-(beta-methyl ester) is an amino acid analog of aspartic acid; N-ethylglycine is an amino acid analog of glycine; or alanine carboxamide is an amino acid analog of alanine. Other amino acid analogs include methionine sulfoxide, methionine sulfone, S-(carboxymethyl)-cysteine, S-(carboxymethyl)-cysteine sulfoxide and S-(carboxymethyl)-cysteine sulfone.
The terms “complementary” and “complementarity” refer to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base-paring or other non-traditional types of pairing. The degree of complementarity between two nucleic acid sequences can be indicated by the percentage of nucleotides in a nucleic acid sequence which can form hydrogen bonds Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 50%, 60%, 70%, 80%, 90%, and 100% complementary). Two nucleic acid sequences are “perfectly complementary” if all the contiguous nucleotides of a nucleic acid sequence will hydrogen bond with the same number of contiguous nucleotides in a second nucleic acid sequence. Two nucleic acid sequences are “substantially complementary” if the degree of complementarity between the two nucleic acid sequences is at least 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100%) over a region of at least 8 nucleotides (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides), or if the two nucleic acid sequences hybridize under at least moderate, preferably high, stringency conditions. Exemplary moderate stringency conditions include overnight incubation at 37° C. in a solution comprising 20% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1×SSC at about 37-50° C., or substantially similar conditions, e.g., the moderately stringent conditions described in Sambrook et al., infra. High stringency conditions are conditions that use, for example (1) low ionic strength and high temperature for washing, such as 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate (SDS) at 50° C., (2) employ a denaturing agent during hybridization, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin (BSA)/0.1% Ficoll/0.1% polyvinylpyrrolidone (PVP)/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride and 75 mM sodium citrate at 42° C., or (3) employ 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0,1% sodium pyrophosphate, 5×Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at (i) 42° C. in 0.2×SSC, (ii) 55° C. in 50% formamide, and (iii) 55° C. in 0.1×SSC (preferably in combination with EDTA). Additional details and an explanation of stringency of hybridization reactions are provided in, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001); and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, New York (1994).
The term “adenosine deaminases acting on RNA” or “ADARs” are used herein to refer to a class of enzymes that naturally catalyze A-to-I editing of sites within double-stranded RNA (dsRNA) regions of the transcriptome of higher organisms. ADARs can play important roles in the regulation of protein function, RNA splicing, immunity and RNA interference.
The term “ADAR fusions” as used herein refers to engineered enzymes that comprise an ADAR deaminase domain and a domain which is able to bind a guide RNA.
The term “donor nucleic acid molecule” refers to a nucleotide sequence that is inserted into the target DNA (e.g., genomic DNA). As described above the donor DNA may include, for example, a gene or part of a gene, a sequence encoding a tag or localization sequence, or a regulating element. The donor nucleic acid molecule may be of any length. In some embodiments, the donor nucleic acid molecule is between 10 and 10,000 nucleotides in length. For example, between about 100 and 5,000 nucleotides in length, between about 200 and 2,000 nucleotides in length, between about 500 and 1,000 nucleotides in length, between about 500 and 5,000 nucleotides in length, between about 1,000 and 5,000 nucleotides in length, or between about 1,000 and 10,000 nucleotides in length.
A cell has been “genetically modified,” “transformed,” or “transfected” by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that comprise a population of daughter cells containing the transforming DNA. A “clone” is a population of cells derived from a single cell or common ancestor by mitosis. A “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
As used herein, a “nucleic acid” or a “nucleic acid sequence” refers to a polymer or oligomer of pyrimidine and/or purine bases, preferably cytosine (C), thymine (T), and uracil (U), and adenine (A) and guanine (G), respectively. The present technology contemplates any deoxyribonucleotide, ribonucleotide, or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated, or glycosylated forms of these bases, and the like. The polymers or oligomers may be heterogenous or homogenous in composition and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states. In some embodiments, a nucleic acid or nucleic acid sequence comprises other kinds of nucleic acid structures such as, for instance, a DNA/RNA helix, peptide nucleic acid (PNA), morpholino nucleic acid (see, e.g., Braasch and Corey, Biochemistry, 41(14): 4503-4510 (2002)) and U.S. Pat. No. 5,034,506, incorporated herein by reference), locked nucleic acid (LNA; see Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 97: 5633-5638 (2000), incorporated herein by reference), cyclohexenyl nucleic acids (see Wang, J. Am. Chem. Soc., 122: 8595-8602 (2000), incorporated herein by reference), and/or a ribozyme. Hence, the term “nucleic acid” or “nucleic acid sequence” may also encompass a chain comprising non natural nucleotides, modified nucleotides, and/or non-nucleotide building blocks that can exhibit the same function as natural nucleotides (i.e., “nucleotide analogs”); further, the term “nucleic acid sequence” as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single or double-stranded, and represent the sense or antisense strand. The terms “nucleic acid,” “polynucleotide,” “nucleotide sequence,” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
The term “linker,” as used herein, refers to a bond (e.g., covalent bond), chemical group, or a molecule linking two molecules or moieties, e.g., two domains of a fusion protein. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond, thus connecting the two. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein). In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20-30, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated herein.
The term “mutation,” as used herein, refers to a substitution of a residue within a sequence, e.g., a. nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)).
A “peptide” or “polypeptide” is a linked sequence of two or more amino acids linked by peptide bonds. The peptide or polypeptide can be natural, synthetic, or a modification or combination of natural and synthetic. Polypeptides include proteins such as binding proteins, receptors, and antibodies. The proteins may be modified by the addition of sugars, lipids or other moieties not included in the amino acid chain. The terms “polypeptide” and “protein,” are used interchangeably herein.
As used herein, the term “percent sequence identity” refers to, the percentage of nucleotides or nucleotide analogs in a nucleic acid sequence, or amino acids in an amino acid sequence, that is identical with the corresponding nucleotides or amino acids in a reference sequence after aligning the two sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Hence, in case a nucleic acid according to the technology is longer than a reference sequence, additional nucleotides in the nucleic acid, that do not align with the reference sequence, are not taken into account for determining sequence identity. Methods and computer programs for alignment are well known in the art, including BLAST, Align 2, and FASTA.
The term “guide RNA,” as used herein refers to a nucleic acid designed to be complementary to the “target sequence”. The terms “target RNA sequence;” “target nucleic acid,” “target sequence,” and “target site” are used interchangeably herein to refer to a polynucleotide (nucleic acid, gene, chromosome, genome, etc.) to which a guide RNA sequence is designed to have complementarity. Typically, the gRNA and target RNA form a dsRNA duplex structure with a central A:C mismatch at the targeted site to induce efficient and precise editing by the ADAR deaminase domain.
In some embodiments, the guide RNAs (also referred to herein as ASOs) described herein comprise two components: an antisense domain and a recruitment domain. The terms “antisense domain” and “antisense sequence” are used interchangeably herein. The antisense domain (i.e., antisense sequence) of the gRNA binds to the target RNA. The recruitment domain (also referred to herein as the ADAR-recruiting part), enables the interaction with the ADAR or ADAR fusion protein. In some embodiments, the guide RNAs described herein comprise only the antisense domain (i.e., lack a recruitment domain). In some embodiments, the guide RNAs described herein may be optimized for RNA editing. For example, a guide RNA may contain one or more mutations to optimize RNA editing. Suitable locations for the mutations and types of mutations are described herein.
The target sequence and guide sequence need not exhibit complete complementarity, provided that there is sufficient complementarity to cause hybridization. Suitable gRNA:RNA binding conditions include physiological conditions normally present in a cell. Other suitable binding conditions (e.g., conditions in a cell-free system) are known in the art; see, e.g., Sambrook, referenced herein and incorporated by reference.
The target RNA sequence may be a gene product. The term “gene product,” as used herein, refers to any biochemical product resulting from expression of a gene. Gene products may be RNA or protein. RNA gene products include non-coding RNA, such as tRNA, rRN, micro RNA (miRNA), and small interfering RNA (siRNA), and coding RNA, such as messenger RNA (mRNA).
A “vector” or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, e.g. an “insert,” may be attached or incorporated so as to bring about the replication of the attached segment in a cell. For example, the “insert” may be a construct as described herein. For example, the “insert” may be a construct comprising a target sequence and a guide RNA sequence as described herein.
The term “wild-type” refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene. In contrast, the term “modified,” “mutant,” or “polymorphic” refers to a gene or gene product that displays modifications in sequence and or functional properties (e.g., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
In some embodiments, provided herein are fusion constructs. In some embodiments, provided herein are fusion constructs comprising a guide RNA sequence and a target sequence. The fusion constructs provided herein find use in various methods, including methods of high-throughput screening for selecting guide RNAs for use in site-directed RNA editing.
In some embodiments, the fusion construct possesses a stem loop secondary structure. The terms “hairpin,” “hairpin loop,” “stem loop,” and/or “loop” are used interchangeably herein to refer to a structure formed in a single stranded oligonucleotide when sequences within the single strand which are complementary when read in opposite directions base pair to form a region whose conformation resembles a hairpin or loop.
In some embodiments, the fusion construct comprises a target sequence. The target sequence is selected based upon the gene of interest (i.e., the gene for which site-directed A-to-I RNA editing is desired). In some embodiments, the target sequence comprises a mutated sequence. For example, the target sequence may comprise a nucleotide sequence possessing one or more mutations, wherein said one or more mutations result in a disease phenotype. In some embodiments, the gene of interest is IDUA. The sequence of the human IDUA gene is shown in
In some embodiments, the target sequence comprises a nucleotide sequence having at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity) to GAGCAGCUCUAGGCCGAA (SEQ ID NO: 1), provided that nucleotide at position 11 relative to SEQ ID NO: 1 is an adenine (A).
in some embodiments, the guide RNA sequence comprises an antisense domain. The antisense domain of the gRNA binds to the target RNA. Accordingly, selection of the sequence of the antisense domain depends on the sequence of the target RNA of interest (i.e., the desired RNA to be edited). The antisense domain may comprise any suitable number of nucleotides. In some embodiments, the antisense domain comprises 10-50 nucleotides. For example, in some embodiments the antisense domain comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. In some embodiments, the antisense domain comprises more than 50 nucleotides. in some embodiments, the antisense domain comprises 10-30 nucleotides. In some embodiments, the antisense domain comprises 15-25 nucleotides. In some embodiments, the length of the antisense domain depends on whether the guide RNA additionally comprises a recruitment domain. For example, guide RNA sequences lacking a recruitment domain may contain antisense domains of longer length compared to guide RNA sequences containing both a recruitment domain and an antisense domain. This concept is exemplified in
In some embodiments, the guide RNA described herein lacks a recruitment domain. For example, in some embodiments the guide RNA comprises a target sequence and an antisense domain, and does not comprise a recruitment domain. In some embodiments, the target sequence and the antisense domain are linked by a loop structure, such that the construct forms a stem-loop secondary structure. The loop structure may comprise any suitable number of nucleotides. In some embodiments, the loop structure comprises 3-50 nucleotides. In some embodiments, the loop structure comprises 3-50 nucleotides, 3- 45 nucleotides, 3-40 nucleotides, 3-35 nucleotides, 3-30 nucleotides, 3-25 nucleotides, 3-20 nucleotides, 3-15 nucleotides, 3-10 nucleotides, or 3-7 nucleotides. In some embodiments, the loop structure is a pentaloop (i.e., comprises 5 nucleotides). In some embodiments, the loop structure comprises a sequence set forth in Table 1. In some embodiments, the loop structure comprises SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, OR SEQ ID NO: 18.
In some embodiments, the guide RNA comprises an antisense domain and a recruitment domain. The guide RNA sequence may be optimized for RNA editing, such as by making one or more mutations in the antisense domain and/or recruitment domain as described herein.
In some embodiments, the antisense domain is intended to target a portion of the human IDUA gene. However, the high-throughput sequencing methods described herein may be applied to any suitable target to identify optimized gRNAs for site directed editing of any desired gene. In some embodiments, the anti sense domain is substantially complementary to the target sequence. Accordingly, nucleotides within the antisense domain base pair with corresponding nucleotides on the target sequence, thus forming the secondary structure of the construct (i.e., the stem loop structure of the construct). The base pairing need not be 100%. For example, in some embodiments one or more nucleotides in the antisense domain do not base pair with the nucleotide in the corresponding location in the target sequence. In some embodiments, the antisense domain comprises one or more mutations that disrupt perfect complementarity (i.e., disrupt base pairing). For example, the antisense domain may comprise one or more mutations that disrupt base pairing with the target sequence, which may result in mismatches within the stem of the stem loop structure. In some embodiments, the antisense domain comprises a nucleotide sequence having at least 50% sequence identity to UUCGGCCCAGAGCUGCUC (SEQ ID NO: 2). For example, the antisense domain may comprise a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2. In some embodiments, the nucleotide at position 8 relative to SEQ ID NO: 2 (i.e., the position opposite from the target adenosine residue in the target strand) is a cytidine. The nucleotides 3′ of position 8 (i.e., 3′ of the cytidine at position 8) are denoted herein as “−” followed by the number of nucleotides away from position 8, whereas the nucleotides 5′ of position 8 are denoted herein as “+” followed by the number of nucleotides away from position 8. In some embodiments, the antisense domain comprises a nucleotide sequence as shown in Table 4. In some embodiments, the antisense domain comprises a nucleotide sequence of SEQ ID NO: 195.
In some embodiments, the antisense domain possesses more than 18 nucleotides. For example, the antisense domain may comprise additional nucleotides in addition to those present in the sequence having at least 50% identity to SEQ ID NO: 2. Such additional oligonucleotides may be present at the 3′ end or the 5′ end of the antisense domain. Exemplary such antisense domains are highlighted in
In some embodiments, the antisense domain comprises a sequence shown in Table 5. In some embodiments, the antisense domain comprises a nucleotide sequence of SEQ ID NO: 202. In some embodiments, the antisense domain comprises a nucleotide sequence shown in Table 6. In some embodiments, the antisense domain comprises a nucleotide sequence of SEQ ID NO: 303. In some embodiments, the antisense domain comprises a nucleotide sequence of SEQ ID NO: 304.
In some embodiments, the guide RNA sequence comprises a recruitment domain. The recruitment domain (also referred to herein as the ADAR-recruiting part), facilitates the interaction with the ADAR or ADAR fusion protein. The recruitment domain is configured to bind (i.e., recruit) one or more ADAR proteins or fusions thereof. For example, the recruitment domain may be configured to recruit an ADAR1, an ADAR2 protein or a fusion thereof. In some embodiments, the recruitment domain recruits at least an ADAR2 protein. The recruitment domain may comprise any suitable number of nucleotides. For example, the recruitment domain may comprise 15-100 nucleotides. In some embodiments, the recruitment domain comprises about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, or about 100 nucleotides. In some embodiments, the recruitment domain is part of a construct that possesses a stem-loop secondary structure. In some embodiments, the recruitment domain forms a part of a stem loop structure. In some embodiments, the loop portion of the stem loop structure consists of 5 nucleotides (i.e., pentaloop).
In some embodiments, the recruitment domain is based upon the sequence of an endogenous (i.e., naturally occuring) ADAR target. The recruitment domain may possess one or more modifications compared to the endogenous ADAR target, which may enhance ADAR recruitment or interactions. For example, the recruitment domain may be based upon the sequence of the GRIA2 R/G site, an endogenous target for ADAR2.
In some embodiments, the recruitment domain comprises a first strand (i.e., a 5′ strand) and a second strand (i.e., a 3′ strand) connected by a loop structure (also referred to herein as a loop sequence). The first strand and the second strand exhibit complementary base pairing, thus assisting in the formation of the stem loop structure of the construct. In some embodiments, this base pairing is disrupted by one or more mutations within the first strand and/or the second strand of the recruitment domain. In some embodiments, an unmodified recruitment domain refers to a recruitment domain that exhibits base pairing with no disruptions (i.e., perfect complementarity), whereas a mutated recruitment domain refers to a domain comprising one or more mutations in the first strand or the second strand that disrupt base pairing. In other words, an unmodified recruitment domain comprises a first strand with perfect complementarity to a second strand, whereas a mutated recruitment domain comprises a first strand and a second strand with substantial (i.e., at least 60%), but not perfect complementarity.
In some embodiments the recruitment domain comprises a first strand and a second strand connected by a loop structure. The loop structure may comprise any suitable number of nucleotides. In some embodiments, the loop structure comprises 3-50 nucleotides. In some embodiments, the loop structure comprises 3-50 nucleotides, 3-45 nucleotides, 3-40 nucleotides, 3-35 nucleotides, 3-30 nucleotides, 3-25 nucleotides, 3-20 nucleotides, 3-15 nucleotides, 3-10 nucleotides, or 3-7 nucleotides. In some embodiments, the loop structure is a pentaloop structure. Suitable sequences of a pentaloop structure are shown in Table 1. Any of the sequences shown in Table 1 may be used for a fusion construct as described herein. In some embodiments, the loop structure comprises SEQ ED NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, OR SEQ ID NO: 18.
In some embodiments, the first strand (i.e., the 5′ strand) comprises a nucleotide sequence having at least 50% sequence identity to GGUGUCGAGAAGAGGAGAACAAUAU (SEQ ID NO: 3). For example, the first strand may comprise a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3. In some embodiments, the first strand (i.e., the 5′ strand) comprises a sequence as shown in Table 2. In some embodiments, the first strand comprises a nucleotide sequence of SEQ ID NO: 108. In some embodiments, the first strand comprises a nucleotide sequence of SEQ ID NO: 109.
In some embodiments, the second strand comprises nucleotide sequence having at least 50% sequence identity to AUGUUGUUCUCGUCUCCUCGACACC (SEQ ID NO: 4). For example, the second strand may comprise a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4. In some embodiments, the second strand (i.e., 3′ strand) comprises a sequence as shown in Table 3. In some embodiments, the second strand comprises a nucleotide sequence of SEQ ID NO: 144. In some embodiments, the second strand comprises a nucleotide sequence of SEQ ID NO: 145. In some embodiments, the second strand comprises a nucleotide sequence of SEQ ID NO: 146.
In some embodiments, the first strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 3 and the second strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 4, and the first and second strand are connected by a loop structure. In some embodiments, the loop structure is a pentaloop structure. Suitable sequences of a pentaloop structure are shown in Table 1. Any of the sequences shown in Table 1 may be used for a fusion construct as described herein. In some embodiments, the loop structure comprises SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, OR SEQ ID NO: 18.
In some embodiments, the fusion construct comprises a combination of mutations. The combination of mutations may be in one or more regions within the construct. For example, the fusion construct may comprise multiple mutations in the guide RNA. For example, the construct may comprise one or more mutations within the antisense domain (i.e., one or more mutations that disrupt a given base pairing with a corresponding nucleotide in the target sequence) of the guide RNA and one or more mutations within the recruitment domain of the guide RNA (i.e., one or more mutations that disrupt or restore base pairing between the first strand and the second strand of the recruitment domain). For example, in some embodiments the construct comprises an antisense domain as set forth in Table 4, Table 5, or Table 6, and a loop sequence set forth in Table 1. In some embodiments, the construct comprises an antisense domain as set forth in Table 4, Table 5, or Table 6, and a recruitment domain comprising a first sequence as set forth in Table 2 and/or a second sequence as set forth in Table 3. In some embodiments, the construct comprises an antisense domain as set forth in Table 4, Table 5, or Table 6, a loop sequence as set forth in Table 1, and recruitment domain comprising a first sequence as set forth in Table 2 and/or a second sequence as set forth in Table 3.
In some embodiments, the fusion construct comprises one or more components in addition to the guide RNA sequence and the target sequence. For example, the fusion construct may additionally comprise one or more components to facilitate determination of whether the construct is effectively expressed in a cell of interest. For example, the fusion construct may additionally comprise sequences encoding a fluorescent protein, which enables visualization of whether a construct is expressed in a cell of interest. In some embodiments, the fusion construct comprises intervening sequences between the guide RNA sequence and the target sequence. Such intervening sequences may comprise any suitable number of nucleic acids. For example, the fusion construct may comprise a sequence encoding a fluorescent protein, which may assist in determining that the construct is expressed in a cell of interest. Such an. embodiment is shown, for example, in
Great efforts have been made to develop tools that enable precise manipulation of genetic information. Besides various applications in the life sciences, these tools have a great potential to be used for the treatment of diseases, especially those where classical therapeutic approaches, using antibodies or small molecules, would fail. One approach to precisely changing genetic information is the targeted manipulation of the genome. The CRISPR-Cas system has made genome engineering a mainstream method that is widely used in basic research to study gene function in vitro and in vivo.1,2 Intense efforts are currently being undertaken to translate this technology to the clinic. However, the way to its therapeutic use remains challenging, which is highlighted by recent reports showing that the CRISPR-Cas system can induce cell cycle arrest3, cell death4 or an immune response5-7. The fact that changes introduced into DNA persist permanently is both a blessing and a curse at the same time. On the one hand, genome engineering offers a chance for permanent cure of challenging diseases. On the other hand, this is accompanied with enormous safety risks since potentially harmful off-target mutations, occurring as unintentional by-products, might be stably installed in the genome.
The manipulation of genetic information without the safety concerns that are associated with genome engineering might be achieved by tools enabling transcriptome engineering, as changes made in RNA are transient. The reversibility of RNA modification offers the opportunity to temporarily manipulate essential biological processes, such as cell signaling or inflammation, whose permanent alteration would otherwise have serious consequences. Additionally, the tunability of introducing a change in RNA (potentially from 0% to 100%) allows the precise regulation of the biological outcome. In the recent years, several tools have been developed enabling the site-specific conversion of adenosine to inosine (
ADARs share common structural features which include multiple dsRNA-binding domains (dsRBDs) at the N-terminus and a C-terminal deaminase domain. The dsRBDs largely contribute to the promiscuity of ADARs as they enable the binding to various dsRNA structures. To engineer a specific editing machine (i.e., ADAR fusion protein), the dsRBDs are removed, and the ADAR deaminase domain is fused to a protein domain allowing the interaction with a guide RNA (gRNA), leading to the formation of a deaminase-gRNA complex. By applying simple base pairing rules, the gRNA directs the engineered deaminase to any chosen target RNA. Typically, the gRNA and target RNA form a dsRNA duplex structure with a central A:C mismatch at the targeted site to induce efficient and precise editing by the deaminase domain8,9
Several deaminase-gRNA complexes have been engineered whose assemblies are mediated by the MS2-MCP15,16, CRISPR-Cas1317,70, λN-boxB18-20 or SNAP-tag21-23 system. For example, the ADAR fusion protein may comprise an ADAR deaminase domain fused to a Cas enzyme. For example, ADAR fusion proteins have been shown to carry out C-to-U editing when fused with Cas13b17.
To perform site-directed RNA editing, the engineered ADAR fusion and the gRNA have to be ectopically introduced into the cell. Under optimized conditions, ADAR-fusion-gRNA complexes can edit transcripts with almost quantitative yield.17,20,23 However, it is recurrently found that efficient editing typically comes along with numerous off-target editing all over the transcriptome (up to several tens of thousands of off target sites), which arises from the high levels of the engineered ADAR fusions in the cell after ectopic expression.16,17,23,27
One possibility to perform site-directed RNA editing without the risk of off-target editing associated with the ectopic expression of a deaminase, is by harnessing endogenous ADAR enzymes. The first evidence that human ADARs can indeed be used for site-directed editing was provided by the groups of Stafforst and Fukuda.28-30 However, successful editing was still dependent on the ectopic expression of the ADAR enzymes. In those reports, ADARs were recruited towards target RNAs by plasmid-derived gRNAs containing two functional domains. The first domain, the antisense domain of the gRNA, binds to the target RNA, while the second domain, the ADAR-recruiting part, is intended to facilitate the interaction with the ADAR dsRBDs (
Endogenous ADARs require highly potent gRNAs to perform site-directed RNA editing with sufficient efficiency. However, cell culture experiments with ADAR-recruiting gRNAs with the current state-of-the art design showed that many target sites were only edited under 50%.32 Given that ADARs naturally edit sites in the human transcriptome with yields up to 100%,46 there is still potential for improving the gRNA design for maximum site-directed RNA editing. However, rational gRNA engineering for highly selective and efficient editing within the formed target RNA/gRNA duplex remains challenging.
In some embodiments, provided herein are systems and methods that find use to identify, select, produce, and utilize gRNAs that maximize the RNA editing yield. The platform allows the high-throughput screening of gRNA sequences for their ability to mediate site-directed RNA editing in mammalian cells (
In some embodiments, provided herein is a high-throughput screening method for selecting guide RNAs for use in site-directed RNA editing. In some embodiments, the method comprises generating a plurality of fusion constructs as described herein. The fusion constructs comprise a target sequence and a guide RNA sequence as described herein. In some embodiments, the target sequence is derived from a gene for which site-directed A-to-I RNA editing is desired. For example, in some embodiments, the gene comprises a G to A point mutation, a T to A point mutation, or a C to A point mutation. In some embodiments, correction of such a mutation is desired. For example, correction of a G to A point mutation, correction of a T to A point mutation, or correction of a C to A point mutation may be desired. In some embodiments, the point mutation is associated with development of a disease or condition in a subject expressing the gene. For example, the subject may suffer from Hurler Syndrome. In some embodiments, point mutation is present in the target sequence. For example, the target sequence may contain the G to A point mutation, T to A point mutation, or C to A point mutation which causes a disease or condition in a subject expressing the gene. In some embodiments, the mutation is a G to A point mutation, and the mutation is present in the target sequence.
The methods further comprise inducing expression of the fusion construct in a suitable cell. For example, the method may further comprise transfecting cells expressing adenosine deaminases acting on RNA (ADARs) or cells expressing ADAR fusion proteins with the fusion constructs. The method further comprises determining whether a fusion construct effectively induces one or more mutations in nucleic acid isolated from the cells relative to a control. Any suitable cells expressing ADARs or ADAR fusion proteins may be used. Suitable cells include eukaryotic cells including but not limited to yeast cells, higher plant cells, animal cells, insect cells, and mammalian cells. Non-limiting examples of eukaryotic cells include simian, bovine, porcine, murine, rat, avian, reptilian and human cells.
Transfection methods may be assisted by the use of suitable cell permeabilizing agents (e.g., lipofectamine) or may be performed by other suitable techniques such as electroporation. The fusion constructs may be housed in a suitable vector prior to delivery to the cell. Suitable vectors include viral vectors (e.g., lentiviral vectors, retroviral vectors, adenovirus vectors, adeno-associated virus vectors, alphavirus vectors, etc.) and non-viral vectors (e.g., plasmids, cosmids, phages, etc.). Following achieving the desired expression of the construct within the cell, the method further comprises determining whether a given fusion construct effectively induces one or more modifications in nucleic acid isolated from the cells relative to a control. Accordingly, in some embodiments the method further comprises isolating nucleic acid from the cells. The isolated nucleic acid may be RNA.
In some embodiments, determining whether a fusion construct induces one or more modifications in nucleic acid isolated from the population of cells expressing the fusion construct comprises sequencing the isolated nucleic acid. In sonic embodiments, the one or more modifications in nucleic acid isolated from the population of cells comprises a correction of the mutation (e.g. G to A point mutation, C to A point mutation, or to A point mutation) initially present in the target sequence. For example, RNA may be isolated from the cells and sequencing may be performed to determine whether the G to A point mutation initially present in the target sequence has been corrected. For example, successful recruitment of ADARs enables modification of selected adenine residues to inosine. Since inosine is biochemically interpreted as guanosine by the cellular machinery, A-to-I editing introduces A-to-G point mutations in RNA. Accordingly, point mutations present in the target sequence, such as a G to A point mutation present in the target sequence, may be corrected. For example, the adenosine residue originally present in the target sequence may be corrected to a guanine residue. Correction of the G to A point mutation indicates that the guide RNA sequence effectively induces site-directed RNA editing (i.e., site-directed A-to-I RNA editing).
In some embodiments, the method further comprises determining whether expression of the construct effectively induced a modification in the RNA compared to a control. For example, the method may comprise determining the sequence of the isolated nucleic acid (e.g., RNA). A variety of suitable sequencing methods and technologies may be used to determine the sequence of the nucleic acid strands. For example, the sequencing method may be Sanger sequencing. As another example, the sequencing method may be a next generation sequencing technology (e.g., next generation RNA sequencing technology). The term next generation sequencing, or “NGS”, refers to a variety of sequencing techniques that permit simultaneous sequencing of millions of nucleic acid sequences, and is otherwise referred to as high-throughput sequencing or massively parallel sequencing. In some embodiments, RNA may be isolated from the cells and cDNA of the target RNA/gRNA fusions may be prepared for subsequent sequencing with NGS (such as by using a platform commercially available from Illumina). For the sequencing library preparation, NGS adapters with different indexes may be used, which allows the concurrent analysis of multiple constructs. To analyze the sequencing data, a computational pipeline may be used which enables the detection of editing levels within the target RNA sequences and the identification of the corresponding gRNAs.
In some embodiments, the methods described herein may be used to identify gRNAs comprising one or more optimized features such that a guide RNA comprising the optimized feature(s) effectively induces site-directed RNA editing. The optimized features may be selected from the antisense domain, the recruitment domain, and the loop sequence. For example, the methods described herein may be used to identify optimized antisense domains, target sequences, loop sequences, and/or recruitment domain sequences. In some embodiments, the methods described herein may be used to identify optimized antisense domains. Accordingly, such optimized antisense domains may be used in circular guide RNAs or in guide RNAs lacking a recruitment domain. For example, optimized antisense domains may be used in circular guide RNAs or in guide RNAs lacking a recruitment domain for methods of site-directed gene editing. Alternatively, optimized antisense domains may be used in combination with another optimized feature in a guide RNA, such as an optimized recruitment domain and/or an optimized loop sequence. In some embodiments, the methods described herein may be used to identify gRNAs containing an optimized recruitment domain. For example, the methods may identify gRNAs containing optimized first strand sequences and/or optimized second strand sequences for a recruitment domain. In some embodiments, the methods may identify optimized loop sequences. Accordingly, the methods described herein may be used to assist in the generation of guide RNAs containing one or more optimized features, including an optimized antisense domain, an optimized target sequence, and optimized loop sequence and/or an optimized recruitment domain sequence.
The therapeutic capability of site-directed A-to-I RNA editing results from its ability to produce a change in codon meaning by formally introducing an A-to-G point mutation. All three stop codons and 12 out the 20 canonical amino acids can he recoiled by A-to-I editing (
A particularly appealing application of therapeutic A-to-I RNA editing is the repair of pathogenic G-to-A point mutations (
Site-directed A-to-I RNA editing finds use to reverse the above-described and other disease phenotypes caused by G-to-A point mutations without the safety concerns which are associated with genome engineering. In a therapeutic context, harnessing endogenous ADARs for site-directed RNA editing is promising since this approach is currently much more precise than those applying ectopically expressed engineered ADAR fusions.17,23,32,43 Furthermore, successful editing with endogenous ADARs requires only the administration of the gRNA as a chemically modified nucleic acid, which enormously simplifies the therapeutic application of site-directed RNA editing. Suitable modifications include, but are not limited to, 2′-O-methyl (2′-OMe), phosphorothioate (PS), 2′-O-methyl thioPACE (MSP), 2′-O-methyl-PACE (MP), 2′-fluoro RNA (2′,-F-RNA), and constrained ethyl (S-cEt). Alternatively, the gRNA can be expressed from a plasmid, e.g., with adeno-associated virus (AAV) delivery.
In some embodiments, provided herein are methods for harnessing endogenous ADARs for the correction of the premature IDUA W402X stop codon causing Hurler Syndrome (
In some embodiments, provided herein are methods for site-directed RNA editing. The methods comprise selecting a gRNA by a method/platform as described herein, and providing a construct comprising the guide RNA to a cell or a subject. In some embodiments, the guide RNA is a gRNA as described herein. In some embodiments, the construct may additionally comprise a targeting domain, as described herein.
In some embodiments, provided herein are guide RNAs for use in site-directed RNA editing,. The guide RNA may be any suitable guide RNA described herein. The guide RNA may be identified using a high-throughput screening method as described herein. In some embodiments, the guide RNA comprises an antisense domain that is substantially complementary or perfectly complementary to a target gene sequence. The target gene sequence may be any gene sequence for which site-directed RNA editing is desired. In some embodiments, the target gene sequence is present within the IDUA gene. For example, the target gene sequence may be present within the human IDUA gene. The sequence of the human IDUA gene is shown in
Selection of an appropriate antisense domain sequence depends on the target gene of interest. In some embodiments, the antisense domain is intended to target a portion of the human IDUA gene, however other genes of interest may be targeted. In some embodiments, the antisense domain is designed such that nucleotides within the antisense domain base pair with corresponding nucleotides on the target sequence. In some embodiments, the antisense domain is perfectly complementary to the target gene sequencing. In other embodiments, one or more nucleotides in the antisense domain are mutated such that they do not base pair with the nucleotide in the corresponding location in the target sequence (i.e., the antisense domain is substantially, but not perfectly, complementary with the target sequence). In some embodiments, the antisense domain comprises a nucleotide sequence having at least 50% sequence identity to UUCGGCCCAGAGCUGCUC (SEQ ID NO: 2). For example, the antisense domain may comprise a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ I NO: 2. In some embodiments, the nucleotide at position 8 relative to SEQ ID NO: 2 (i.e., the nucleotide opposite from the target adenosine within the target-antisense duplex) is a cytidine. In some embodiments, the antisense domain comprises a nucleotide sequence as shown in Table 4. The nucleotides 3′ of position 8 (i.e., 3′ of the cytidine at position 8) are denoted herein as “−” followed by the number of nucleotides away from position 8, whereas the nucleotides 5′ of position 8 are denoted herein as “+” followed by the number of nucleotides away from position 8. In some embodiments, the antisense domain comprises a nucleotide sequence set forth in SEQ ID NO: 195.
In some embodiments, the antisense domain possesses more than 18 nucleotides. For example, the antisense domain may comprise additional nucleotides in addition to those present in the sequence having at least 50% identity to SEQ NO: 2. Such additional oligonucleotides may be present at the 3′ end or the 5′ end of the antisense domain. Exemplary such antisense domains are highlighted in
In some embodiments, the antisense domain comprises a sequence shown in Table 5. In some embodiments, the antisense domain comprises a nucleotide sequence of SEQ ID NO: 202. In some embodiments, the antisense domain comprises a nucleotide sequence shown in Table 6. In some embodiments, the antisense domain comprises a nucleotide sequence of SEQ ID NO: 303. In some embodiments, the antisense domain comprises a nucleotide sequence of SEQ ID NO: 304.
In some embodiments, the guide RNA sequence comprises a recruitment domain. The recruitment domain (also referred to herein as the ADAR-recruiting part), facilitates the interaction with the ADAR or ADAR fusion protein. The recruitment domain is configured to bind (i.e., recruit) one or more ADAR proteins or fusions thereof. For example, the recruitment domain may be configured to recruit an ADAR1, or an ADAR2 protein or a fusion thereof. In some embodiments, the recruitment domain recruits at least an ADAR2 protein. The recruitment domain may comprise any suitable number of nucleotides. For example, the recruitment domain may comprise 15-100 nucleotides. In some embodiments, the recruitment domain comprises about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, or about 100 nucleotides. In some embodiments, the recruitment domain is part of a construct that possesses a stem-loop secondary structure. In some embodiments, the recruitment domain forms a part of a stem-loop structure, wherein the loop portion of the stem loop structure consists of 5 nucleotides (i.e., a pentaloop).
In some embodiments, the recruitment domain comprises a first strand and a second strand that are substantially complementary or perfectly complementary to each other. In some embodiments, the first strand and the second strand are linked by a loop sequence. The loop structure may comprise any suitable number of nucleotides. In some embodiments, the loop structure comprises 3-50 nucleotides. In some embodiments, the loop structure comprises 3-50 nucleotides, 3-45 nucleotides, 3-40 nucleotides, 3-35 nucleotides, 3-30 nucleotides, 3-25 nucleotides, 3-20 nucleotides, 3-15 nucleotides, 3-10 nucleotides, or 3-7 nucleotides. In some embodiments, the loop structure is a pentaloop structure. Suitable sequences of a pentaloop structure are shown in Table 1. Any of the sequences shown in Table 1 may be used for a fusion construct as described herein. In some embodiments, the loop structure comprises SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, OR SEQ ID NO: 18.
In some embodiments, the recruitment domain is based upon the sequence of an endogenous (i.e., naturally occurring) ADAR target. The recruitment domain may possess one or more modifications compared to the endogenous ADAR target, which may enhance ADAR recruitment or interactions. For example, the recruitment domain may be based upon the sequence of the GRIA2 R/G site, an endogenous target for ADAR2.
In some embodiments, the recruitment domain comprises a first strand (i.e., a 5′ strand) and a second strand (i.e., a 3′ strand) connected by a loop structure (also referred to herein as a loop sequence). The first strand and the second strand exhibit complementary base pairing, thus assisting in the formation of the stem loop structure of the construct. In some embodiments, this base pairing is disrupted by one or more mutations within the first strand and/or the second strand of the recruitment domain. In some embodiments, an unmodified recruitment domain refers to a recruitment domain that exhibits base pairing with no disruptions (i.e., perfect complementarity), whereas a mutated recruitment domain refers to a domain comprising one or more mutations in the first strand or the second strand that disrupt base pairing. In other words, an unmodified recruitment domain comprises a first strand with perfect complementarily to a second strand, whereas a mutated recruitment domain comprises a first strand and a second strand with substantial (i.e., at least 60%), but not perfect complementarity.
In some embodiments the recruitment domain comprises a first strand and a second strand connected by a pentaloop structure. In some embodiments, the first strand (i.e., the 5′ strand) comprises a nucleotide sequence haying at least 50% sequence identity to GGUGUCGAGAAGAGGAGAACAAUAU (SEQ ID NO: 3). For example, the first strand may comprise a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3. In some embodiments, the first strand (i.e., the 5′ strand) comprises a sequence as shown in Table 2. In some embodiments, the first strand comprises a nucleotide sequence of SEQ ID NO: 108. In some embodiments, the first strand comprises a nucleotide sequence of SEQ ID NO: 109.
In some embodiments, the second strand comprises nucleotide sequence having at least 50% sequence identity to AUGUUGUUCUCGUCUCCUCGACACC (SEQ ID NO: 4). For example, the second strand may comprise a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4. In some embodiments, the second strand (i.e., 3′ strand) comprises a sequence as shown in Table 3. In some embodiments, the second strand comprises a nucleotide sequence of SEQ ID NO: 144. in some embodiments, the second strand comprises a nucleotide sequence of SEQ ID NO: 145. In some embodiments, the second strand comprises a nucleotide sequence of SEQ ID NO: 146.
In some embodiments, the first strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 3 and the second strand comprises a nucleotide sequence having at least 50% sequence identity to SEQ ID NO: 4, and the first and second strand are connected by a loop structure. The loop structure may comprise any suitable number of nucleotides. In some embodiments, the loop structure comprises 3-50 nucleotides. In some embodiments, the loop structure comprises 3-50 nucleotides, 3-45 nucleotides, 3-40 nucleotides, 3-35 nucleotides, 3-30 nucleotides, 3-25 nucleotides, 3-20 nucleotides, 3-15 nucleotides, 3-10 nucleotides, or 3-7 nucleotides. In some embodiments, the loop structure is a pentaloop (i.e., comprises 5 nucleotides). In some embodiments, the loop structure comprises a sequence set forth in Table 1. In some embodiments, the loop structure comprises SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, OR SEQ ID NO: 18.
In some embodiments, the guide RNA comprises a combination of mutations. In some embodiments, the guide RNA comprises at least 2 mutations (i.e., 2, 3, 4, 5, or more than 5) mutations. For example, the guide RNA may comprise one or more mutations within the antisense domain (i.e., one or more mutations that disrupt a given base pairing with a corresponding nucleotide in the target sequence) and one or more mutations within the recruitment domain of the guide RNA (i.e., one or more mutations that disrupt or restore base pairing between the first strand and the second strand of the recruitment domain). In some embodiments, the guide RNA comprises multiple mutations in the recruitment domain. In some embodiments the guide RNA comprises an antisense domain as set forth in Table 4, Table 5, or Table 6, and a loop sequence set forth in Table 1. In some embodiments, the guide RNA comprises an antisense domain as set forth in Table 4, Table 5, or Table 6, and a recruitment domain comprising a first sequence as set forth in Table 2 and/or a second sequence as set forth in Table 3. In some embodiments, the construct comprises an antisense domain as set forth in Table 4, Table 5, or Table 6, a loop sequence as set forth in Table 1, and recruitment domain comprising a first sequence as set forth in Table 2 and/or a second sequence as set forth in Table 3.
The guide RNAs described herein find use in methods of site directed RNA editing (e.g., site directed A-to-I RNA editing) in a cell or a subject. For example, RNA editing may be performed to treat a disease or condition in a subject. For example, the guide RN As described herein may be used in methods of treating diseases or conditions characterized by G to A point mutations in a gene expressed by the subject. In some embodiments, the disease is Hurler Syndrome.
In some embodiments, the guide RNA or construct comprising the same may be formulated into a composition for delivery to the cell or subject. For example, the construct may be formulated into a composition for parenteral administration. The term “parenteral” refers to any suitable non-oral route of administration, including subcutaneous, intramuscular, intravenous, intrathecal, intracisternal, intraarterial, intraspinal, intraepidural, intradermal, and the like. The construct may be formulated with any suitable excipients, stabilizers, preservatives, and the like. In some embodiments, the composition may be provided to a subject suffering from Hurler Syndrome. Accordingly, in some embodiments provided herein are methods for treating Hurler Syndrome, comprising providing to a subject in need thereof a composition comprising a gRNA as described herein (i.e., an optimized gRNA). The gRNA may he identified using a high-throughput screening method as described herein.
It is understood that endogenous ADARs and/or engineered ADAR fusions may be suitable for use in the methods for site-directed RNA editing described herein. For example, the guide RNAs (including optimized guide RNAs) identified by a screening method described herein may be well suited for use with ADAR fusion proteins in the methods described herein.
All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Overview on the screening platform: Efficient editing generally depends on many factors, such as substrate sequence and the length and structure of the gRNA/target duplex.48,49 The present knowledge does not allow conclusions how to design a gRNA which enables ADAR enzymes to edit a certain site with the highest possible efficiency. To overcome this hurdle, next-generation sequencing (NGS) may be used to screen gRNA library sequences for their ability to edit the G-to-A point mutations. In a real scenario, editing is performed in a target transcript when it is bound by the gRNA which is able to recruit the ADAR, enzyme. For the NGS-based screen, the target sequence and the ASO sequence are expressed in the same transcript, such that they may be identified on a single sequencing read to know which editing level is mediated by which ASO sequence. In order to achieve this, target regions, containing the pathogenic G-to-A point mutations, may be obtained from the full-length transcripts and fused to the ASO library sequences, resulting in hairpin structures which simulate the duplex between the target RNA and a transacting gRNA. The design of the target RNA/gRNA libraries is described in more detail in Example 2.
For screening experiments, target RNA/gRNA fusion libraries may be ordered as DNA oligonucleotides and ligated into an expression vector. For example, libraries may be ligated into an expression vector using a well-established clone-and-use strategy.50,51 The resulting plasmid libraries may be delivered to human ADAR-expressing cells by a suitable method, such as via lipofection. After the incubation with the plasmid library, RNA may be isolated from the cells and cDNA of the target RNA/gRNA fusions may be prepared for their subsequent sequencing with NGS (Illumina sequencing). For the sequencing library preparation, NGS adapters with different indexes may be used, which allows the concurrent analysis of multiple experiments. To analyze the sequencing data, a computational pipeline may be used which enables the detection of editing levels within the target RNA sequences and the identification of the corresponding gRNAs. Alternatively, target/gRNA fusions may be in-vitro transcribed and transfected into the cells without the need of a plasmid.
The comparison between the induced editing levels at the target site reveals which gRNA sequences can direct ADARs for efficient RNA editing. Additionally, examining the extent of editing of off-site adenosines within the target RNA/gRNA fusions shows how precisely the gRNAs mediate RNA editing. The impact of the target RNA/gRNA duplex structure and sequence on the editing efficiency and specificity may be also evaluated by the analysis.
gRNAs that enable ADARs to catalyze site-directed RNA editing comprise two parts: an antisense domain for binding to the target sequence, and an imperfect double-stranded ADAR-recruiting part, which ensures the interaction with the ADAR enzyme (
Since RNA editing can be influenced by multiple factors, it appears likely that maximum editing requires a tailored gRNA sequence for each site. In order to find those optimal gRNA sequences, screening the gRNA antisense and ADAR-recruiting part with every target of interest may be performed.
Target RNA/gRNA libraries for the identification gRNA sequences that maximize RNA editing may be designed. Single point mutations or a stretch of degenerate nucleotides may be introduced in both gRNA parts (antisense and recruitment domains), leading to mismatches, Watson-Crick base pairs or wobble base pairs in the target RNA/gRNA duplex structure and in the recruitment domain (
The methods described herein may be used to identify mismatches at certain positions, which increase the editing level at the target site. Additionally, single nucleotides may be removed (or inserted) to introduce bulges which might also improve the editing yield. Stepwise reduction (ADAR-recruiting part) or prolongation (antisense and ADAR-recruiting part) of the RNA stems may also be tested (
Furthermore, other ADAR-recruiting parts derived from known editing substrates (
The optimized gRNA sequences identified by the methods described herein may be combined in a modular fashion with other guide designs known to enhance the efficiency and/or specificity of editing. For example, mismatches in the antisense region that are shown to enhance editing in the screen may be incorporated into circular guides or into guides consisting of a long antisense domain without a recruitment domain.
Designing and testing the ASO library prototype: The ASO library prototype was based on the published ASO design ‘v9.4’32, with the key distinction that an 18-nucleotide (nt) region of the target sequence was included as part of a fusion construct mimicking the guide/target complex (
The target sequence probed in the pilot screen comprised an 18-nt region from the human IDUA gene, containing the G-to-A mutation observed in Hider syndrome patients, flanked by 10 upstream and 7 downstream residues from the wild-type IDUA sequence. The guide RNA portion of the fusion construct comprised a recruitment domain, followed by an 18-nt antisense sequence. The recruitment domain was based on ADAR's endogenous GRIA2 R/G site, and included several sequence substitutions to suppress editing within the recruitment domain32. The antisense sequence was complementary to the target sequence, except for a C mismatch opposite from the editing site, which was previously found to increase editing49.
Prior to screening, it was important to ensure that the library prototype was edited detectably, but not to completion under the screening conditions, to provide sufficient dynamic range for identifying enhancer variants. Thus, the editing of the prototype was first tested in Flp-In T-REx 293 cells with and without inducible ADAR1 p150 expression. The prototype was restriction-cloned into a pcDNA5 vector, as a spacer region between mCherry and EGFP coding sequences (see details in the Cloning section). Flp-In T-REx 293 cells with integrated ADAR1 p150 were seeded in a 24-well tissue culture plate (350,000 cells/well), in the presence or absence of 10 ng/ml doxycycline (Dox). After 20 h, 500 ng plasmid was transfected with 2.5 μL Lipofectamine 2000 by pipetting dropwise. 24 h later, the total RNA was isolated and purified using an RNeasy MinElute kit (Qiagen) and reverse-transcribed with an mCherry-specific primer using the M-MuLV reverse transcriptase (NEB). The PCR-amplified, agarose gel-purified cDNA was Sanger-sequenced to determine the editing level. The observed editing was ˜50% in the presence of endogenous ADAR only (no Dox induction), and 100% with Dox induction (
To obtain appropriate baseline editing level for other prototypes (i.e., detectable, but <<100%), many variables can be manipulated, including prototype design, cell type, doxycycline concentration, knock out of endogenous ADAR proteins, or time. Several variations of the guide/target fusion have been tested. For example, the recruitment domain can be omitted, instead using longer target and antisense sequences that are connected by a short loop (
To expedite identification of one or more prototypes for a new target, to be used as reference sequence for subsequent high-throughput library design, a small initial screen may be performed by using an oligonucleotide pool containing different prototype designs. Such a pool of 10 s or 100 s of designs could include systematic variation of the following parameters: length of the target and antisense regions; position of the editing site within the construct; identity of the recruitment domain (if present). The oligonucleotide pool could be obtained, e.g., as an IDT oPool or a small Twist/Agilent oligonucleotide library. The oligos could be cloned and screened analogous to the full-scale screening procedure below, scaled down appropriately.
Library design—To obtain a library of antisense variants targeting the IDUA W402X mutation, the antisense region in
Cloning—The ASO library based on the prototype in
Prior to cloning, the ASO library insert was PCR-assembled from two single-stranded DNA oligonucleotides, partially overlapping in the recruitment domain and containing either the target or the randomized antisense region (
To prevent PCR byproducts and to eliminate the need for gel purification, here and below, all PCR reactions were performed for a number of cycles corresponding to half-saturation, as determined by qRT-PCR. The purity of all PCR products was evaluated by polyacrylamide gel electrophoresis (PAGE, Novex 6% acrylamide gels with TBE; Invitrogen; post-stained with 1× SYBR-Gold).
The dsDNA product was purified with the Macherey-Nagel PCR purification kit and restriction-cloned into the pcDNA5 vector between mCherry and EGFP coding sequences, using ClaI and NheI restriction enzymes and T4 DNA ligase. The ligation reaction was performed using a 5-fold molar excess of insert over vector, as determined with NEBioCalculator. After a 30 min incubation at room temperature and a 3-h incubation at 16° C., the reaction was heat-inactivated for 10 min at 65° C., and the DNA was purified and concentrated using the Macherey-Nagel PCR purification kit. To obtain a ˜10,000 variant library, 50 ng of DNA (in a 2 μL volume) was transformed into 25 μL of TOP10 competent cells (Invitrogen). The cells were plated on two 15-cm LB-Carb 100 plates (Teknova) and incubated overnight at 37° C. To obtain larger libraries, the amount of ligated DNA, the cell volume, and the number of plates should be increased proportionally.
Approximately 10,000 colonies were harvested from LB-Carb plates by gently scraping the plate with a razor blade and washing with LB-broth. The plasmid DNA was purified on a HiSpeed Plasmid Midi column (Qiagen).
To achieve higher-throughput, on the scale of 100,000 colonies, electrocompetent cells (such as Lucigen Endura) should be used, and the cells can be plated on 245 mm×245 mm LB-Carb plates. The plasmid DNA should be isolated using a Maxi prep (e.g., HiSpeed Plasmid Maxi kit from Qiagen).
Cell culture—Flp-In T-REx 293 cells with an integrated empty pcDNA5 vector were maintained in DMEM medium (Gibeo), supplemented with 10% FBS, 100 μg/ml Hygromycin B, 15 μg/ml blasticidin, and 100 U/ml Gibco™ Penicillin-Streptomycin. It was found that inducible ADAR1 expression in Flp-In T-REx cells with integrated ADAR1 p150 was unnecessary to observe sufficient editing levels (
Screening procedure—One and a half million 293 Flp-In T-REx cells with an integrated empty pcDNA5 vector were seeded per well of a 6-well tissue-culture coated plate and incubated at 37° C. Twenty two hours later (corresponding to ˜70% cell confluency), the plasmid library (2.75 μg) and Lipofectamine 2000 (8.25 μL) were separately diluted in OptiMEM (550 μL final volume) and were incubated at room temperature for 5 min. The two solutions were mixed and incubated for 20 min, and 1 ml of the mix was added dropwise to the plated cells, 24 h later, the media was removed, and the cells were harvested by pipetting up and down. The screening results were unaffected by changing the transfection scale to 10 μg DNA, transfected into 5 million cells seeded on a 10 cm plate. The time between library transfection and harvesting the cells also did not affect screening outcomes, when varied between 7 h and 48.5 h.
Total RNA was purified on a single RNeasy Mini column (Qiagen). For larger-scale transfections, multiple RNeasy Mini columns or an RNeasy Midi column may be required, as determined by the cell type and number, and the column capacity stated in the manual. Total RNA (150 ng/μL) was treated with Turbo DNase (Invitrogen) for 30 min at 37° C., and the reaction was stopped with 1/10th volume of DNase Inactivating reagent (Invitrogen), following the manufacturer's protocol. Reverse transcription (RT) was performed with the TGIRT III enzyme (InGex), which is optimized for highly structured RNA templates. Comparable performance was achieved with the WarmStart RTx Reverse Transcriptase (NEB). Other reverse transcriptases may lead to the loss of library variants with the most stable secondary structures and distorted editing measurements due to truncated reverse transcription products. The TGIRT reaction (20 μL) included 9.7 μL of Turbo DNase-treated total RNA, 10 mM dithiothreitol (DTT), 0.1 μM barcoded RT primer (
The RT primer contains a unique molecular identifier (UMI), which is essential for accurate quantification of editing levels (
To improve the sequencing quality, sequence diversity was increased by mixing the cDNA library with about 40% of PhiX Sequencing Control V3 (Illumina). To rigorously distinguish between real editing events and unintended A-to-G mutations at the DNA level, the plasmid DNA library was also sequenced. The DNA library was prepared for sequencing by using the same primers as those used for cDNA library preparation, starting with the ‘PCR amplification’ step (
Analysis-Paired-end reads were merged using FLASH-1.2.11, truncated reads were removed, and the UMI sequence, as well as the library variant sequence in each read were identified based on their positions relative to the constant mCherry and EGFP sequence regions. Reads containing non-redundant UMIs (i.e., UMIs present in a single read) were removed from further analysis. The remaining reads were grouped by their respective UMI sequence, and a consensus sequence of the target-guide fusion was determined, based on the sequence observed in two or more reads containing the same UMI. Alternatively, more stringent criteria could be used for consensus determination, requiring, e.g., that at least half of the reads feature the same variable sequence (Buenrostro et al., 2014). If all reads containing a given UMI had distinct sequences in the target-guide fusion region, no consensus was available and the corresponding reads were discarded. Since errors are unlikely to simultaneously occur both in the UMI and in the variable guide RNA region, this consensus-based procedure allows to reliably identify library variants and edited residues even in the presence of sequencing or PCR errors. These and subsequent analyses were performed using custom Python scripts.
After identifying the UMI consensus, editing levels associated with each guide RNA variant were quantified as follows. Sequences with non-A-to-G changes in the target sequence or in the recruitment domain were removed from further analysis. Only guide RNA variants (including variants of the antisense or recruitment domain regions) that were represented by at least 10 UMIs were propagated to further analysis to ensure accurate quantification. For each guide RNA sequence, UMIs were counted for each of the following versions of the target sequence: (1) intact target sequence (‘Unedited’); (2) target sequence with A-to-G change at the intended site, regardless of any additional off-target editing (‘Edited’); (3) target sequence featuring only unintended A-to-G changes, without on-target editing (‘Off-target’).The fraction of variants edited at the intended site was calculated as follows:
By counting UMIs (which signify unique cDNAs), rather than analyzing raw sequencing reads, this quantification method reduces the effects of potentially uneven sequence representation, arising from PCR bias or other technical artifacts.
While off-target editing was rare in the case of IDUA, it may he more prevalent for A-rich. target sequences (or recruitment domains). In these cases, detailed analysis of variants with unintended editing events should be performed, as it can inform efforts to design more specific guides and strategic positioning of chemical modifications.
To account for spurious editing events arising from A to-G mutations at the DNA level (within the target sequence or guide RNA), the cDNA library was cross-referenced against the parallelly sequenced plasmid DNA library. A-to-G mutation rates observed in the DNA library were subtracted from the corresponding editing levels for each antisense variant. Sequencing the DNA library may also allow distinguishing between real antisense variants featuring G mutations and rare A-to-G editing events in the antisense region, as the relative representation of such variants would differ between cDNA and DNA libraries.
Exemplary guide RNA variants (i.e., ASOs) that may be selected and/or optimized by a platform described herein, such as the methods described in Example 3, are shown in the following figures and tables.
Following the methods described herein, various categories of mutations that enhance editing efficiency were identified. In particular, by screening >200,000 constructs targeting the human IDUA W402X mutation, the following features that enhance editing in target-ASO fusion. libraries were identified. We have also successfully applied the screening method to >10 other targets of therapeutic interest.
Category 1: Recruitment domain mutations. Because the recruitment domain constitutes a target-independent portion of the guide RNA, the below improvements should be universally applicable. Suitable mutations include replacing a mismatch in the original recruitment domain with a Watson-Crick or wobble base-pair (
Examples of guide sequences with Category 1 mutations are listed in Tables 1-3.
Category 2: Mismatches in the target:antisense duplex. Mismatches and wobble base-pairs in the antisense region can enhance editing of the IDUA W402X target (Tables 4-6). Certain mismatches or combinations thereof are enriched in antisense variants that give the most efficient editing (
Combinations of individual guide features, such as a combination of a mismatch in the antisense region and a substitution of the recruitment domain loop, or a combination of several mismatches in the antisense region, tend to have additive effects on editing (
This application claims priority to U.S. Non-Provisional Patent Application. No. 63/094,614, filed Oct. 21, 2020, the entire contents of which are incorporated herein by reference.
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/US2021/056064 | 10/21/2021 | WO |
Number | Date | Country | |
---|---|---|---|
63094614 | Oct 2020 | US |