Patent Application
20180086809
The present invention regards a new soluble chimeric receptor for interleukin 10 (IL10) characterized by low immunogenicity capable of blocking the interaction between IL-10 and its receptor which is situated on the cells of the host and in particular useful for treating tumors as well as in treating pathologies characterized by high levels of production of interleukin 10, such as systemic lupus erythematosus (SLE).
The conventional tumor therapy approaches include:
The approaches to the immunotherapy applied up to now comprise:
Nevertheless, the conventional therapies give rise to variable results, in relation to the histological type or to the tumor stage. Regarding the immunotherapy, independent of the type of therapy followed, unsatisfactory results were obtained (20-30% of the clinical responses in different clinical protocols, with the sole exception relative to the use of monoclonal antibodies in specific diseases such as B-cell lymphoma and breast tumor).
Overall, the therapeutic arsenal used up to now against tumors mainly consists of aggressive maneuvers via use of agents having the purpose of destroying cancer, which do not facilitate the normal process of immunological control which in healthy individuals prevents the appearance or the progression of tumors.
Since a complete deletion of the tumor is rarely achievable due to multiple reasons of biological nature, the surviving tumor cells remain in the body of most tumor patients, even though they are under therapy. These cells in fact maintain the capacity to evade an immune system still paralyzed both by tumor-dependent biological factors and by the aforesaid anti-tumor therapies: therefore they can induce a relapse and a progression of the tumor. Indeed, even if the tumors have aberrant genes that induce substantial modifications from a morphological, phenotypic and functional standpoint with respect to the normal autologous cells, these evade immunological surveillance. This phenomenon is even more surprising in consideration of the fact that tumors express tumor-associated antigens (TAAs) and are infiltrated by tumor-specific T-lymphocytes. Among the various known biological mechanisms that contribute to verifying the immune evasion by the tumor, the activity of the regulatory T-lymphocytes has a key role—these secrete IL10 in the tumor site. In order to neutralize the latter phenomenon, it would be necessary to provide a molecule capable of inhibiting the activity of the regulatory T-lymphocytes in the tumor site. The administration of such molecule would limit the immune evasion of the tumor and would allow the immune system of the host to recover an effective anti-tumor reactivity.
Regarding the current therapy of the systemic lupus erythematosus treatment, this consists of the administration of steroids and immunosuppressants, drugs which do not have a specificity with regard to the action mechanism and in addition they can cause serious, diverse side effects. A more recent therapy provides for the administration of Belimumab, an anti Blys human antibody, in other words a therapeutic agent capable of inhibiting the activation of the B-lymphocytes.
SLE, along with other autoimmune pathologies, is characterized by an abnormal immune response of the B-lymphocytes and by an increased secretion of IL-10 which causes a hyperproduction of autoantibodies with consequent activation of the systemic inflammatory process (Llorente et al., “In vivo production of interleukin-10 by non T-cell in rheumatoid arthritis, Sjögren' syndrome and systemic lupus erythematosus: a potential mechanism of B-lymphocyte hyperactivity and autoimmunity” Arthritis Rheum, 1994; 37: 1647-55”). It is interesting that the treatment of patients affected by SLE with an anti-IL10 monoclonal antibody had beneficial and favorable therapeutic effects. (Llorente L. et al., “Clinical and biological effects of antiinterleukin 10 monoclonal antibody administration in systemic lupus erythematosus. Arthritis Rheum.2000; 43: 1790-1800). There is therefore the need to provide a therapeutic agent capable of reducing the production of autoantibodies, for example through the neutralization of IL-10.
The generation of the anti-IL10 immunoadhesin, i.e. a fusion protein constituted by the portion Fc of the immunoglobulin (Ig) and by the alpha chain of the IL-10 receptor, has been previously described (Terai M. et al “Human intertleukin 10 receptor 1/IgG1-Fc fusion proteins for human IL-10 with therapeutic potential” Cancer Immunol. Immunother. 2009 August; 58(8): 1307-17 EPUB. 2009 Jan. 14).
This fusion protein has a series of disadvantages caused by the fact that it contains the portion Fc of the IgG1.
Indeed, the immunoglobulin can cause immune/inflammatory reactions mediated by the bond of the Fc to its receptors present on most of the cells of the immune system (antibody-dependent cellular cytotoxicity—ADCC) or to the complement (complement-dependent cytoxicity—CDC-). This can lead to collateral immune/inflammatory reactions that can have significant repercussions on the safety and tolerability of the product. (Antibody Fc: Linking Adaptive and Innate Immunity, Margaret Ackerman and Falk Nimmerjahn, Academic Press 2014; Kapur R, Einarsdottir H K, Vidarsson G: IgG-effector functions: “the good, the bad and the ugly”. Immunol Lett. 2014 August; 160(2):139-44; Karsten C M, Köhl J: The immunoglobulin, IgG Fc receptor and complement triangle in autoimmune diseases. Immunobiology. 2012 November; 217(11):1067-79; Dijstelbloem H M, van de Winkel J G, Kallenberg C G: Inflammation in autoimmunity: receptors for IgG revisited. Trends Immunol. 2001 Sepember; 22(9):510-6).
In US 20090111146, in which the inventors are some of the authors of the preceding publication, a fusion protein is described in which a constant region of the human antibody is fused with an extracellular region of the IL-10. By constant regions of the human antibody, it is intended constant regions of the IgG in particular selected from among the following classes;
Also this fusion polypeptide type can be used for correlated IL-10 diseases. In particular, the fusion proteins in which the extracellular region of the IL-10 receptor is fused with:
a1) a constant region of IgG1 in which a deletion of the hinge region has been executed, or
a2) a constant region of IgG1, having the hinge region mutated, generated by the mutation of the cysteine in the hinge region in a manner such to not form a dimer (these molecules can be employed for promoting the activation of the cytotoxic T cells).
This type of fusion proteins could be used for treating cancer, but their use is potentially subject to a high risk of induction of side effects tied to the presence of an essentially pro-inflammatory molecular portion, like the fragment Fc or the heavy changes CH1-CH3 contained in Fc (see above). The collateral and systemic immune/inflammatory reactions potentially induced by such molecules could have significant repercussions on the safety and tolerability of the product.
Object of the present invention is therefore the generation of an inhibitor of IL-10 in particular to be used as therapeutically effective agent for all types of pathologies in which IL-10 has a pathogenic valence and which does not have the drawbacks of the above-described known inhibitors of IL-10.
Object of the present invention is also the use of such inhibitor of IL-10 in the treatment of tumors.
Further object of the present invention is the use of such inhibitor of IL-10 in the treatment of SLE.
Further object of the invention is to generate an inhibitor of IL-10 that does not have molecular portions potentially capable of inducing inflammatory/immune phenomena, such as portions of antibodies or portions of amino acid sequences not contained in human molecules (hence substantially not carrying mutations or exogenous molecules). This in order to ensure the full tolerability thereof and eliminate risks tied to the induction of side effects.
The above-described objects of the present invention are achieved with the generation of a chimeric fusion protein albumin-IL10 receptor capable of antagonizing the bond of IL-10 to the natural receptor present on the cell surface.
The presence of albumin within the fusion polypeptide confers stability and solubility to this molecule. In addition, the molecule is little immunogenic in syngeneic individuals, so as to avoid risks of developing immune responses against the fusion protein, object of the present invention.
Further object of the present invention is the aforesaid fusion protein for use as medication, in particular for inhibiting the correlated IL-10 diseases.
Further object of the present invention is the aforesaid soluble chimeric fusion protein albumin-IL10 for use in the treatment of tumors.
Further object of the present invention is the aforesaid fusion protein for use in the treatment of SLE.
Further object of the present invention is a polynucleotide construct, preferably a gene, that encodes for this fusion protein.
Further object of the present invention is the aforesaid gene for use as medication, in particular for inhibiting the diseases mediated by IL-10.
Further object of the present invention is the aforesaid gene for use in the treatment of tumors.
Further object of the present invention is the aforesaid gene for use in the treatment of SLE.
The data are expressed as percentage of inhibition of the T cell proliferation induced by an anti-CD3 mAb, measured through incorporation of 3H-Thymidine and reading through beta-counter of the counts per minute (cpm) emitted by the cocultures.
1×105 B16 melanoma cells (control mice),
1×105 B16 melanoma cells treated with dendritic cells (DC) pulsed with gp100 antigen of melanoma, inoculated through intramuscular injection (2×106 DC/mouse ×3 times every 7 days starting from the day of administration of the tumor).
1×105 B16 melanoma cells treated with DC pulsed with gp100 antigen, inoculated through intramuscular injection (2×106 cells/mouse ×3 times every 7 days and injected through subcutaneous injection with an anti-IL-10 mAb blocking biological activity of the cytokine (150 μg×3 times every 7 days starting from the day of administration of the tumor).
1×105 B16 melanoma cells (control mice),
1×105 B16 melanoma cells treated with a control plasmid (pcDNA 3.1) that was injected via intradermal injection (100 μg×3 times every 7 days starting from the day of administration of the tumor).
l 1×105 B16 melanoma cells treated with a plasmid that codes for the chimeric fusion protein according to the present invention (pcDNA3.1IL10R-murin serum albumin (MSA) which has been injected intradermally (100 μg×3 times every 7 days starting from the day of administration of the tumor). The figure also reports the significant differences between the groups.
1×105 B16 melanoma cells (control mice),
1×105 B16 melanoma cells treated with a plasmid that codes for the chimeric fusion protein according to the present invention (pcDNA3.1IL10R-MSA) that was intradermally injected (100 μg×3 times every 7 days starting from the day of administration of the tumor);
l1×105 B16 melanoma cells treated with a plasmid that codes for the chimeric fusion protein according to the present invention (pcDNA3.1IL10R-MSA) that was intradermally injected (100 μg×3 times every 7 days starting from the day of administration of the tumor) and intradermally injected with DC pulsed with antigen mgp100, that were injected via intramuscular injection (2×106 cells/mouse ×3 times 7 days, starting from the day of administration of the tumor).
1×105 B16 melanoma cells injected intradermally with DC pulsed with antigen mgp100, which were injected via intramuscular injection (2×106 cells/mouse ×3 times every 7 days starting from the day of administration of the tumor). The figure also reports the significant differences between the groups.
1×105 cells of syngeneic bladder tumor cell lines MB49 (control),
1×105 of syngeneic bladder tumor MB49 treated with a control plasmid (pcDNA 3.1) that was intradermally injected (100 μg×3 times at 7 days interval between one administration and the next starting from the day of administration of the tumor).
1×105 syngeneic bladder tumor cell MB49 treated with a plasmid that codes for the chimeric fusion protein according to the present invention (pcDNA3.1IL10R-MSA) which was intradermally (100 μg×3 times at 7 days interval between one administration and the next starting from the day of administration of the tumor). The figure also reports the significant differences between the groups.
For the purposes of the present invention, by chimeric protein it is intended a protein deriving from the fusion of peptide sequences of multiple different proteins.
For the purposes of the present invention, by polynucleotide construct it is intended a nucleotide sequence deriving from the fusion of multiple different genes that code for multiple proteins that are different from each other.
The albumin in the chimeric fusion protein according to the present invention is preferably mammal albumin, more preferably human and murine and still more preferably human.
The fusion protein albumin-interleukin 10 receptor according to the present invention is a chimeric gene product, which is also characterized in that the albumin is bonded to the extracellular domain of the alpha chain of the IL-10 receptor.
The fact that the fusion protein, object of the invention, only contains the extracellular domain (ECD) is an advantageous aspect since this does not contain the intracytoplasmic portion of the IL-10 receptor alpha chain, i.e a portion rich in hydrophobic amino acids. Hence, the absence of the intracytoplasmic domain renders the fusion protein, object of the present invention, more stable, more soluble and obtainable with a higher yield during the productions steps (cloning) due to the limited size with respect to an analogous fusion protein containing the entire alpha chain of the IL-10 receptor. Finally, the absence of the intracytoplasmic domain renders the protein less immunogenic, thus preventing the risk that the host initiates an immune response against the fusion protein of the invention.
The receptor for interleukin 10 (IL10R) is constituted by two chains: the alpha chain that mediates the bond with the IL10 and the beta chain that transmits the signal to the cell interior. Since the object of the invention is to block the IL-10 such that it is no longer available inside the tumor microenvironment, only the alpha subunit was cloned in the chimeric construct.
The albumin is bonded to the extracellular domain of the alpha chain of the IL-10 receptor, by means of a spacer, and preferably said spacer is the hinge region of the IgG (immunogammaglobulins).
The IgG is preferably mammal IgG1, more preferably of human and murine type, still more preferably coming from lymphocytes of the peripheral blood.
The presence of the hinge region of the IgG, and preferably IgG1 confers flexibility to the portion constituted by the extracellular domain of the alpha chain of the IL 10 receptor, thus stabilizing the bond with its relative ligand (IL-10) and increasing the affinity/avidity of this interaction.
The chimeric fusion protein albumin-IL-10 receptor, object of the present invention, for use as medication, in particular for inhibiting the correlated IL-10 diseases can be parenterally administered, preferably intravenously, or even topically preferably by means of intradermal administration, subcutaneous administration etc.
Also the gene that codes for the aforesaid chimeric fusion protein albumin-interleukin 10 receptor can be employed for use as medication in particular for inhibiting the correlated IL-10 diseases and it can be parenterally administered, preferably intravenously or topically, preferably by means of intradermal administration, subcutaneous administration etc.
When the chimeric fusion protein or the relative gene in particular are employed for treating tumors, they can be parenterally administered, even topically, according to the abovementioned administration methods.
In any case, in cancer therapy, the chimeric fusion protein or the relative gene can be employed:
In the treatment of systemic lupus erythematosus, the chimera fusion protein albumin-IL 10R according to the present invention can be administered through systemic intravenous administration on its own or in combination with the treatments of conventional type.
Reported hereinbelow are the following experimental examples, which demonstrate the key role of interleukin 10 inhibition in reducing the immunosuppressant effects of the regulatory lymphocytes which infiltrate the tumor, through the administration of the gene encoding the fusion protein according to the present invention and such protein's anti-tumor effectiveness in vivo.
After having received informed consent from each patient, bioptic samples were obtained from a group of 42 patients affected by cancer of various origin, whose characteristics are reported in the following table 1, with whom a series of experiments was conducted adapted to demonstrate the key role of the tumor-infiltrating regulatory T-lymphocytes and of the IL-10 cytokine released thereby in the tumor microenvironment.
A phenotype and functional analysis was conducted of the tumor-infiltrating cells derived from bioptic samples drawn from 22 patients whose characteristics are reported in Table 1. For such purpose, the tumor samples were finely fragmented by using suitable sterile filters. Subsequently, the obtained cell suspensions were stratified and centrifuged on Ficoll gradient. Finally, the different lymphocyte subpopulations were purified through immunomagnetic “sorting” procedures by using suitable magnetic balls conjugated with specific antibodies (Miltenyi Biotech). The immunophenotype of the infiltrating lymphocytes executed with anti CD4, anti CD8, anti CD25, anti CD28 monoclonal antibodies conjugated with fluorochromes. (BD Biosciences) made possible the characterization of two populations of regulatory T lymphocytes (Treg) i.e. Treg lymphocytes CD4+CD25+ and CD8+CD28− from among the tumor-infiltrating lymphocytes, as reported in
The immunosuppressive activity of the tumor-infiltrating T cells was measured in an assay of inhibition of the proliferation of peripheral blood T lymphocytes activated with anti-CD3 mAb antibody and evaluated through incorporation of the 3H-Thymidine proliferating cells and measured in beta-counter reading as counts per minute (cpm). The data is expressed in
The regulatory function of the cell population T CD8+CD28− derived from oncological samples was also evaluated regarding the cytotoxic capacity of a human cell line CTL specific for the peptide p540 of telomerase. For such purpose, the cytotoxic activity of this line CTL was tested against cells belonging to the T2 lymphoblast tumor line pulsed with the peptide p540 in the presence or in the absence of T reg cells CD8+CD28− isolated from primary tumor masses of two patients affected by HLA-A2-positive prostate tumor. The co-cultures in the presence of the intratumoral Treg lymphocytes CD28+CD28− were conducted in “transwell” plates suitable for physically separating the Treg lymphocytes from the target cells of the T2 tumor lines and from the CTL p540-specific lymphocytes. The following co-cultures were then carried out:
a) CTL+non-pulsed T2 target cells, b) CTL+T2 target cells pulsed with peptide p540 c) CTL+T2 target cells pulsed with peptide p540+intratumoral Treg CD28+CD28− d) CTL+T2 target cells pulsed with peptide p540+intratumoral Treg CD28+CD28−+anti-IL10mAb; e) CTL+ T2 target cells pulsed with peptide p540+intratumoral Treg CD28+CD28 + −mAb of isotype control with insignificant specificity.
The results of this experiment reported in
The immunosuppressive activities of the population of tumor-infiltrating Treg cells are opposed by anti-IL10 monoclonal antibodies, hence demonstrating to be strictly dependent on the secretion of this cytokine. The accumulation of Treg CD8+CD28− and Treg CD4+CD25+ seems to be strictly tumor-dependent since it is only verified where the infiltration of the tumor is present both in the site of the primary tumor and in the sites of the metastasis. Indeed, only the metastatic lymph nodes, and not those free of metastasis, were found to be infiltrated by the aforesaid populations of regulatory T cells. (see
C57 black mice subcutaneously injected with 1×105 cells of B16 syngeneic melanoma develop a very aggressive melanoma characterized by devastating local invasion and metastatic spreading via contiguity with the abdominal visceral organs, if the injection occurs in the abdominal area. For the purpose of identifying an effective immunotherapy, different strategies were conducted comprising:
Both in a syngeneic and xenogeneic context, the vaccination with dendritic cells pulsed with the peptide gp100 resulted the most protective treatment that induced >50% reduction of the tumor mass. In a subsequent experiment, the mice subjected to the “challenge” with B16 melanoma cells were immunized according to the protocol (c) in association with the administration of an anti-IL10 mAb: such strategy was effective in inhibiting the entire tumor growth in 100% of the treated mice, as reported in
Since the preceding studies had already demonstrated that IL-10 causes the intratumoral differentiation of the tolerogenic dendritic cells, capable of inducing further regulatory T cells (Guiducci et al., Cancer Res. 2005; 65;3437-3446), in its entirety this data supports the innovative idea that the IL10 has an important role in determining the evasion of the tumor from immune surveillance and that the strategies aimed to block the effects of the intratumoral IL-10 at the functional/molecular level can be effective approaches for the treatment of tumors.
The expression plasmid pcDNA-V5-His (Life Technologies), which was employed for the study, contains the promoter of the genes of the cytomegalovirus (CMV) and the fragment of polyadenylation SV40 required for terminating the transcription and translation; in addition, it also contains the epitope V5 and a His tag useful for the evaluation and purification of the expression of the gene product. The stable selection of clones in eukaryotic cells is possible due to the presence of the gene of the resistance to G418. Two fusion proteins, respectively one human and one murine, have been engineered by bonding the cDNA of the extracellular domain (ECD) of the alpha chain of the interleukin 10 receptor derived from PBMC, respectively human and murine, to clones of respectively human and murine serum albumin cDNA acquired from ATCC. The two cDNA were bonded by means of only the hinge region of the respectively human and murine IgG1 derived from PBMCs. The cloning was carried out by using the following strategy: the cDNA of the extracellular domain (ECD) of the alpha chain of the murine interleukin 10 receptor was cloned by PCR by using the following pair of primers with the restriction sites inserted: mIL10R-Kpnl for 5′-TTAGGTACCATGTTGTCGCGTTTGCTCC-3′ and mIL10R NotI rev 5′-GCGGCCGCCTGTACATATGCAAGGCTTACAACC-3′, the cDNA of the murine serum albumin was cloned by PCR by using the following pair of primers with the restriction sites inserted: MSA-NotI for 5′ AAGGAAAAAAGCGGCCGCGAAGCACACAAGAG 3′ and MSA-Xbal rev 5′ GCTCTAGAGGCTAAGGCGTCTTTG-3′. The cDNA of the ECD of the alpha chain of the human interleukin 10 receptor was cloned by PCR by using the following pair of primers with the restriction sites inserted: hIL10R-KpnI for 5′-GGTACCATGCTGCCGTGCCTCGTAG 3′ and hIL10R NotI rev 5′-GCGGCCGC TGGGCATGTGTGAGTTTTGTCACAA and the cDNA of the human serum albumin was cloned by PCR by using the following pair of primers with the restriction sites inserted: HSA-NotI for 5′-GCGGCCGCGGATGCACACAAGAGTG-3′ and HSA-ApaI rev 5′ GGGCCCTTATAAGCCTAAGGCA-3′. The PCR was executed on the Biorad T100 instrument.
In order to confirm the exact alignment of the two genes, the chimeric construct was sequenced with automatic sequencer (ABI 3100, Applied Biosystem)
Subsequently, the gene products were analyzed and evaluated by means of Western Blot analysis according to the following operating modes: 293T or HEK293 cells were transfected with the two plasmids respectively murine pcDNA3.1 IL10R-albumin and human pcDNA3.1 IL10R-albumin. The relative lysates and supernatants from the aforesaid cell cultures were analyzed by means of 12.5% SDS-PAGE gel in reducing conditions and analyzed via Western blot, by employing antibodies specific for the gene products (e.g. murine anti-CD210 monoclonal antibody and human anti-IL10R alpha monoclonal antibody, murine/human anti albumin monoclonal antibody).
Cell lysates and supernatants of non-transfected cells and/or transfected with “empty” plasmid (i.e. not containing the chimeric gene) were analyzed in parallel as negative controls: as expected, no presence of the chimeric product was encountered herein. The results of this analysis are respectively reported in
3 groups of C57 black mice were respectively injected with:
1×105 B16 melanoma cells (control mice);
1×105 B16 melanoma cells treated with a control plasmid (pcDNA 3.1) that was intradermally injected (100 μg×3 times at 7 days interval between one administration and the next, starting from the day of administration of the tumor);
1×105 B16 melanoma cells treated with a plasmid that codes for the chimeric fusion protein according to the present invention (pcDNA3.1IL10R-MSA) which was intradermally injected (100 μg×3 times at 7 days interval between one administration and the next, starting from the day of administration of the tumor);
In the course of the experiment, the areas of the tumor lesions were monitored and the animals were sacrificed, in respect of ethical norms, when the greater diameter of the neoplastic mass reached 2 cm dimensions. The results are reported in
4 groups of C57 black mice were respectively treated with:
1×105 of B16 melanoma cells (control mice);
1×105 of B16 melanoma cells and administration of the plasmid which codes for the chimeric fusion protein according to the present invention (pcDNA3.1IL10R-MSA) which was intradermally injected (100 μg×3 times at 7 days interval between one administration and the next, starting from the day of administration of the tumor);
1×105 of B16 melanoma cells and administration of the plasmid which codes for the chimeric fusion protein according to the present invention (pcDNA3.1IL10R-MSA) which was intradermally injected (100 μg×3 times at 7 days interval between one administration and the next, starting from the day of administration of the tumor) associated with the intradermal inoculation of DC (dendritic cells) pulsed with peptide mgp10025-33, which were injected intramuscularly (2×106 cells/mouse×3 times at 7 days interval between one administration and the next, starting from the day of administration of the tumor);
1×105 of B16 melanoma cells and intradermal administration of DC (dendritic cells) pulsed with peptide mgp10025-33, which were intramuscularly injected (2×106cells/mouse×3 times at 7 days interval between one administration and the next, starting from the day of administration of the tumor);
In the course of the experiment, the areas of the tumor lesions were monitored and the animals were sacrificed, in respect of ethical norms, when the greater diameter of the neoplastic mass reached 2 cm dimensions. The results are reported in
3 groups of C57 black mice were respectively treated with:
1×105 cells of syngeneic bladder tumor cell lines MB49 (control),
1×105 syngeneic bladder tumor cell lines MB49 and administration of the “empty” control plasmid (pcDNA 3.1) that was intradermally injected (100 μg×3 times at 7 days interval between one administration and the next, starting from the day of administration of the tumor)
1×105 syngeneic bladder tumor cell lines MB49 and administration of the plasmid which codes for the chimeric fusion protein according to the present invention (pcDNA3.1IL10R-MSA) which was intradermally injected (100 μg×3 times at 7 days interval between one administration and the next, starting from the day of administration of the tumor)
In the course of the experiment, the areas of the tumor lesions were monitored and the animals were sacrificed, in respect of ethical norms, when the greater diameter of the neoplastic mass reached 2 cm dimensions. The results are reported in
As inferred from this figure, the data obtained with the tumor cell lines M49 reproduce the data obtained by using the melanoma cells. Indeed, the administration of the plasmid empty did not induce any significant different with respect to the untreated control group (survival times <2 weeks). On the contrary, the mice immunized with the plasmid construct which codes for the chimeric fusion protein according to the present invention showed a drastic and significant change of the melanoma growth curve so as to have survival times 20 days greater than those of the control mice.
For the purpose of evaluating the persistence and tissue distribution of the transgene, the cell DNA was extracted from the PBMCs and from the organs (spleen, kidney, liver, lung) of 4 vaccinated mice with high reperfusion speed, intravenously with polynucleotide construct that encodes murine albumin—murine hinge region of murine IgG1—extracellular domain of the alpha chain of the murine IL 10 receptor and of 1 non-vaccinated mouse (control) 24 hours, 14 days and 20 days after vaccination. The results are reported in
The two human and murine chimeric proteins, object of the present invention, were purified from the supernatant of HEK293 and EXPI-293 cells, transfected with the plasmid that encodes the human and murine fusion protein.
The two human and murine proteins were validated by conducting the ELISA test respectively on two separate batches, for human proteins, and on three separate batches for the murine proteins.
The ELISA test conducted on the human chimeric protein demonstrated that the human chimeric protein specifically recognizes the human IL-10 and it is in turn recognized by an anti albumin human antibody marked with HRP (radish peroxidase).
The results of such test are respectively reported in
This experiment demonstrates that the protein produced by the transfected cells is a chimeric protein having receptor capacity specific for IL-10 associated with an albumin structure.
Analogously, the results obtained with ELISA test on the murine fusion protein reported in
Reported hereinbelow are the sequences of the human and murine fusion protein according to the present invention relative to the fragments of the ECD domain of the alpha unit of the IL10 interceptor, of the hinge region of the immunogammaglobulin, of the albumin and of the fragments of the corresponding polynucleotide constructs.
Sequence
| Number | Date | Country | Kind |
|---|---|---|---|
| 102015000013548 | Apr 2015 | IT | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IB2016/052359 | 4/26/2016 | WO | 00 |
