ACETYL COENZYME A CARBOXYLASE INHIBITORS

FIELD OF THE INVENTION

The present invention relates to compounds that may be used to inhibit acetyl coenzyme-A carboxylase (“ACC”), as well as compositions of matter, kits and articles of manufacture comprising these compounds. The invention also relates to methods for inhibiting ACC and methods of using compounds according to the present invention to treat, for example, metabolic syndrome, diabetes, obesity, atherosclerosis, and cardiovascular disease in mammals, including humans. In addition, the invention relates to methods of making the compounds of the present invention, as well as intermediates useful in such methods. In particular, the present invention relates to ACC1 and/or ACC2 inhibitors, compositions of matter, kits and articles of manufacture comprising these compounds, methods for inhibiting ACC1 and/or ACC2, and methods of making the inhibitors.

BACKGROUND OF THE INVENTION

Acetyl coenzyme A carboxylases (ACC) catalyze the rate limiting reaction in fatty acid biosynthesis in plants and animals. ACC is a biotin containing enzyme which catalyzes the carboxylation of acetyl CoA to form malonyl CoA in a two-step reaction. Beaty and Lane, J. Biol. Chem. 1982, 257:924 929. The first step is the ATP-dependent carboxylation of biotin covalently linked to the enzyme. In the second step, a carboxyltransferase step, the carboxyl group is transferred to the substrate, acetyl CoA, to form malonyl CoA.

Malonyl-CoA is an intermediate substrate that plays an important role in the overall fatty acid metabolism: malonyl-CoA is utilized (as C2 donor) by fatty acid synthase for de novo synthesis of long chain fatty acids, and also acts as a potent allosteric inhibitor of carnitine palmitoyltransferase 1 (CPT1), a mitochondrial membrane protein that shuttles long chain fatty acyl CoAs into the mitochondria where they are oxidized. Ruderman N. and Prentki M, Nat Rev Drug Discov. 2004, 3:340-51. An inhibitor of ACC would thus limit de novo lipid synthesis, de-inhibit CPT1 and subsequently increase fat oxidation.

In mammals, there are two known isoforms of acetyl CoA carboxylase (ACC) that are encoded by distinct genes and share approximately 70% amino acids identity. ACC1 (ACCα.), a 265 KD protein, is highly expressed in the cytosol of lipogenic tissues such as liver and adipose tissue, where fatty acids are synthesized. ACC2 (ACCβ), a 280 KD protein, is expressed mainly in oxidative, non-lipogenic, tissues, such as skeletal muscle and heart muscle, although some is also found in liver. Mao J. et al., Proc Natl Acad Sci USA, 2003, 100:7515-20; Abu-Elheiga L. et al., J Biol Chem 1997, 272:10669-77. Malonyl CoA produced by ACC1 is preferentially converted into fatty acids by fatty acid synthase. Abu-Elheiga L. et al., Proc Natl Acad Sci USA 2000, 97:1444-9.

The malonyl CoA postulated to be formed by ACC2 locally on the mitochondrial surface regulates the palmitoyl CoA shuttle system. Abu-Elheiga L. et al., Proc Natl Acad Sci USA 2000; 97:1444-9. Malonyl CoA is a potent inhibitor of carnitine palmitoyl transferase 1 (CPT-1), and as a consequence, it decreases the fatty acid flux into the mitochondria. Thus, reduction of ACC2 activity would reduce local malonyl CoA levels and increase fatty acid β-oxidation concomitantly reducing triacylglycerol (TAG) synthesis. Munday, Biochem Soc Trans. 2001, 30:1059-64; Yamauchi T. et al. Nat Med 2001, 7:941-6.

ACC is a potential target in metabolic diseases, such as metabolic syndrome, obesity, insulin resistance, dyslipidemia, diabetes, atherosclerosis, and cardiovascular diseases, which are mediated by abnormal fatty acid metabolism. An inhibitor of ACC would potentially limit de novo lipid synthesis, de-inhibit CPT1 and subsequently increase fat oxidation. Increased rates of muscle fatty acid oxidation, a reduced fat content and a reduction in total body fat were observed in ACC-2 knock-out mice (Abu-Elheiga et al., Science 2001, 291:2613 2616; Abu-Elheiga et al., Proc. Natl. Acad. Sci. USA, 2003, 100:10207 10212). Harwood et al. reported that ACC inhibitors caused reduction in fatty acid synthesis, increase in fatty acid oxidation, and reduction of respiratory quotient in rats. Harwood et al. J. Biol. Chem. 2003, 278:37099 37111. Chronic dosing of these compounds resulted in the reduction of whole body fat mass and improvement of insulin sensitivity. Harwood et al. J. Biol. Chem. 2003, 278:37099 37111. These observations further validated the enzyme as a drug target.

Several non-natural product small molecule have been identified which target ACC for the prophylaxis or treatment of metabolic syndrome, atherosclerosis, diabetes, and obesity, see, U.S. Pat. No. 6,979,741, US Applications No. 2007/0219258, No. 2007/0219251, and No. 2003/0187254. There is a continuing need and a continuing search in this field of art for more potent therapeutic agents.

SUMMARY OF THE INVENTION

The present invention relates to compounds that inhibit ACC. The present invention also provides compositions, articles of manufacture and kits comprising these compounds. The invention further provides methods of using, and methods of preparing the compounds of the invention.

In one aspect, the invention relates to compounds of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

Ring A is selected from five or six membered, substituted or unsubstituted aryl and five or six membered, substituted or unsubstituted heteroaryl;

R¹is selected from the group consisting of oxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, imino, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-2)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted;

R²is substituted or unsubstituted alkyl; and

Y is CR³or N, where R³is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-2)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted.

In another aspect, the invention relates to pharmaceutical compositions that comprise an ACC inhibitor according to the present invention as an active ingredient. In one embodiment, the ACC inhibitor is a member selected from an ACC1 inhibitor and an ACC2 inhibitor. Pharmaceutical compositions according to the invention may optionally comprise 0.001%-100% of one or more inhibitors of this invention. These pharmaceutical compositions may be administered or coadministered by a wide variety of routes, including for example, orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposally, intraarticularly, or intrathecally. The compositions may also be administered or coadministered in slow release dosage forms.

In another aspect, the invention is related to kits and other articles of manufacture for treating disease states associated with ACC.

In one embodiment, a kit is provided that comprises a composition comprising at least one ACC inhibitor of the present invention in combination with instructions. In one embodiment, the ACC inhibitor is a member selected from an ACC1 inhibitor and an ACC2 inhibitor. The instructions may indicate the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition. The kit may also comprise packaging materials. The packaging material may comprise a container for housing the composition. The kit may also optionally comprise additional components, such as syringes for administration of the composition. The kit may comprise the composition in single or multiple dose forms.

In another embodiment, an article of manufacture is provided that comprises a composition comprising at least one ACC inhibitor of the present invention in combination with packaging materials. In one embodiment, the ACC inhibitor is a member selected from an ACC1 inhibitor and an ACC2 inhibitor. The packaging material may comprise a container for housing the composition. The container may optionally comprise a label indicating the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition. The kit may also optionally comprise additional components, such as syringes for administration of the composition. The kit may comprise the composition in single or multiple dose forms.

Also provided are methods for preparing compounds, compositions and kits according to the present invention. For example, several synthetic schemes are provided herein for synthesizing compounds according to the present invention.

Also provided are methods for using compounds, compositions, kits and articles of manufacture according to the present invention.

In one embodiment, the compounds, compositions, kits and articles of manufacture are used to inhibit ACC. In one embodiment, ACC is a member selected from ACC1 and ACC2.

In another embodiment, the compounds, compositions, kits and articles of manufacture are used to treat a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state. In one embodiment, the disease is treated by inhibiting ACC1. In another embodiment, the disease is treated by inhibiting ACC2.

In another embodiment, a compound is administered to a subject wherein ACC activity within the subject is altered, preferably reduced. In one embodiment, the administered compound alters and preferably reduces the activity of ACC1 in a subject. In another embodiment, the administered compound alters and preferably reduces the activity of ACC2 in a subject.

In another embodiment, a prodrug of a compound is administered to a subject that is converted to the compound in vivo where it inhibits ACC. In one embodiment, the prodrug inhibits ACC1. In another embodiment, the prodrug inhibits ACC2.

In another embodiment, a method of inhibiting ACC is provided that comprises contacting an ACC with a compound according to the present invention. In one embodiment, the invention provides a method of inhibiting ACC1 that comprises contacting ACC1 with a compound according to the present invention. In another embodiment, the invention provides a method of inhibiting ACC2 that comprises contacting ACC2 with a compound according to the present invention.

In another embodiment, a method of inhibiting ACC is provided that comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACC in vivo. In one embodiment, the invention provides a method of inhibiting ACC1 that comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACC1 in vivo. In another embodiment, the invention provides a method of inhibiting ACC2 that comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACC2 in vivo.

In another embodiment, a method of inhibiting an ACC is provided that comprises administering a first compound to a subject that is converted in vivo to a second compound wherein the second compound inhibits ACC in vivo. It is noted that the compounds of the present invention may be the first or second compounds. In one embodiment, the ACC is a member selected from ACC1 and ACC2.

In another embodiment, a therapeutic method is provided that comprises administering a compound according to the present invention.

In another embodiment, a method of treating a condition in a patient that is known to be mediated by ACC, or which is known to be treated by ACC inhibitors, comprising administering to the patient a therapeutically effective amount of a compound according to the present invention. In an exemplary embodiment, the ACC is a member selected from ACC1 and ACC2.

In another embodiment, a method is provided for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state, the method comprising: causing a compound according to the present invention to be present in a subject in a therapeutically effective amount for the disease state. In an exemplary embodiment, the ACC is a member selected from ACC1 and ACC2.

In another embodiment, a method is provided for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state, the method comprising: administering a first compound to a subject that is converted in vivo to a second compound such that the second compound is present in the subject in a therapeutically effective amount for the disease state. It is noted that the compounds of the present invention may be the first or second compounds. In an exemplary embodiment, the ACC is a member selected from ACC1 and ACC2.

In another embodiment, a method is provided for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state, the method comprising: administering a compound according to the present invention to a subject such that the compound is present in the subject in a therapeutically effective amount for the disease state. In an exemplary embodiment, the ACC is a member selected from ACC1 and ACC2.

It is noted in regard to all of the above embodiments that the present invention is intended to encompass all pharmaceutically acceptable ionized forms (e.g., salts) and solvates (e.g., hydrates) of the compounds, regardless of whether such ionized forms and solvates are specified since it is well know in the art to administer pharmaceutical agents in an ionized or solvated form. It is also noted that unless a particular stereochemistry is specified, recitation of a compound is intended to encompass all possible stereoisomers (e.g., enantiomers or diastereomers depending on the number of chiral centers), independent of whether the compound is present as an individual isomer or a mixture of isomers. Further, unless otherwise specified, recitation of a compound is intended to encompass all possible resonance forms and tautomers. With regard to the claims, the language “compound comprising the formula” is intended to encompass the compound and all pharmaceutically acceptable ionized forms and solvates, all possible stereoisomers, and all possible resonance forms and tautomers unless otherwise specifically specified in the particular claim.

It is further noted that prodrugs may also be administered which are altered in vivo and become a compound according to the present invention. The various methods of using the compounds of the present invention are intended, regardless of whether prodrug delivery is specified, to encompass the administration of a prodrug that is converted in vivo to a compound according to the present invention. It is also noted that certain compounds of the present invention may be altered in vivo prior to inhibit ACC and thus may themselves be prodrugs for another compound. Such prodrugs of another compound may or may not themselves independently have ACC inhibitory activity.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 illustrates SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, referred to in this application.

DEFINITIONS

Unless otherwise stated, the following terms used in the specification and claims shall have the following meanings for the purposes of this Application.

It is noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Further, definitions of standard chemistry terms may be found in reference works, including Carey and Sundberg “ADVANCED ORGANIC CHEMISTRY 5^THED.” Vols. A (2007) and B (2007), Springer Science and Business Media, New York. Also, unless otherwise indicated, conventional methods of mass spectroscopy, NMR, HPLC, protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the skill of the art are employed.

“Alicyclic” means a moiety comprising a non-aromatic ring structure. Alicyclic moieties may be saturated or partially unsaturated with one, two or more double or triple bonds. Alicyclic moieties may also optionally comprise heteroatoms such as nitrogen, oxygen and sulfur. The nitrogen atoms can be optionally quaternerized or oxidized and the sulfur atoms can be optionally oxidized. Examples of alicyclic moieties include, but are not limited to moieties with (C_3-8) rings such as cyclopropyl, cyclohexane, cyclopentane, cyclopentene, cyclopentadiene, cyclohexane, cyclohexene, cyclohexadiene, cycloheptane, cycloheptene, cycloheptadiene, cyclooctane, cyclooctene, and cyclooctadiene.

“Aliphatic” means a moiety characterized by a straight or branched chain arrangement of constituent carbon atoms and may be saturated or partially unsaturated with one, two or more double or triple bonds.

“Alkenyl” means a straight or branched, carbon chain that contains at least one carbon-carbon double bond (—CR═CR′— or —CR═CR′R″, wherein R, R′ and R″ are each independently hydrogen or further substituents). Examples of alkenyl include vinyl, allyl, isopropenyl, pentenyl, hexenyl, heptenyl, 1-propenyl, 2-butenyl, 2-methyl-2-butenyl, and the like. In particular embodiments, “alkenyl,” either alone or represented along with another radical, can be a (C_2-20)alkenyl, a (C_2-15)alkenyl, a (C_2-10)alkenyl, a (C_2-5)alkenyl, or a (C_2-3)alkenyl. Alternatively, “alkenyl,” either alone or represented along with another radical, can be a (C₂)alkenyl, a (C₃)alkenyl or a (C₄)alkenyl.

“Alkenylene” means a straight or branched, divalent carbon chain having one or more carbon-carbon double bonds (—CR═CR′—, wherein R and R′ are each independently hydrogen or further substituents). Examples of alkenylene include ethene-1,2-diyl, propene-1,3-diyl, methylene-1,1-diyl, and the like. In particular embodiments, “alkenylene,” either alone or represented along with another radical, can be a (C_2-20) alkenylene, a (C_2-15) alkenylene, a (C_2-10) alkenylene, a (C_2-5) alkenylene or a (C_2-3) alkenylene. Alternatively, “alkenylene,” either alone or represented along with another radical, can be a (C₂) alkenylene, a (C₃) alkenylene or a (C₄) alkenylene.

“Alkoxy” means an oxygen moiety having a further alkyl substituent. The alkoxy groups of the present invention can be optionally substituted.

“Alkyl” represented by itself means a straight or branched, saturated or unsaturated, aliphatic radical having a chain of carbon atoms, optionally with one or more of the carbon atoms being replaced with oxygen (See “oxaalkyl”), a carbonyl group (See “oxoalkyl”), sulfur (See “thioalkyl”), and/or nitrogen (See “azaalkyl”). (C_X)alkyl and (C_X-Y)alkyl are typically used where X and Y indicate the number of carbon atoms in the chain. For example, (C_1-6)alkyl includes alkyls that have a chain of between 1 and 6 carbons (e.g., methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, tert-butyl, vinyl, allyl, 1-propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl, 2-methylallyl, ethynyl, 1-propynyl, 2-propynyl, and the like). Alkyl represented along with another radical (e.g., as in arylalkyl, heteroarylalkyl and the like) means a straight or branched, saturated or unsaturated aliphatic divalent radical having the number of atoms indicated or when no atoms are indicated means a bond (e.g., (C_6-10)aryl(C_1-3)alkyl includes, benzyl, phenethyl, 1-phenylethyl, 3-phenylpropyl, 2-thienylmethyl, 2-pyridinylmethyl and the like). In particular embodiments, “alkyl,” either alone or represented along with another radical, can be a (C_1-20)alkyl, a (C_1-15)alkyl, a (C_1-10)alkyl, a (C_1-5)alkyl or a (C_1-3)alkyl. Alternatively, “alkyl,” either alone or represented along with another radical, can be a (C₁)alkyl, a (C₂)alkyl or a (C₃)alkyl.

“Alkylene”, unless indicated otherwise, means a straight or branched, saturated or unsaturated, aliphatic, divalent radical. (C_X)alkylene and (C_X-Y)alkylene are typically used where X and Y indicate the number of carbon atoms in the chain. For example, (C_1-6)alkylene includes methylene (—CH₂—), ethylene (—CH₂CH₂—), trimethylene (—CH₂CH₂CH₂—), tetramethylene (—CH₂CH₂CH₂CH₂—), 2-butenylene (—CH₂CH═CHCH₂—), 2-methyltetramethylene (—CH₂CH(CH₃)CH₂CH₂—), pentamethylene (—CH₂CH₂CH₂CH₂CH₂—), and the like. In particular embodiments, “alkylene,” either alone or represented along with another radical, can be a (C_1-20)alkylene, a (C_1-15)alkylene, a (C_1-10)alkylene, a (C_1-5)alkylene or a (C_1-3)alkylene. Alternatively, “alkylene,” either alone or represented along with another radical, can be a (C₁)alkylene, a (C₂)alkylene or a (C₃)alkylene.

“Alkylidene” means a straight or branched, saturated or unsaturated, aliphatic radical connected to the parent molecule by a double bond. (C_X)alkylidene and (C_X-Y)alkylidene are typically used where X and Y indicate the number of carbon atoms in the chain. For example, (C_1-6)alkylidene includes methylene (═CH₂), ethylidene (═CHCH₃), isopropylidene (═C(CH₃)₂), propylidene (═CHCH₂CH₃), allylidene (═CH—CH═CH₂), and the like. In particular embodiments, “alkylidene,” either alone or represented along with another radical, can be a (C_1-20)alkylidene, a (C_1-15)alkylidene, a (C_1-10)alkylidene, a (C_1-5)alkylidene or a (C_1-3)alkylidene. Alternatively, “alkylidene,” either alone or represented along with another radical, can be a (C₁)alkylidene, a (C₂)alkylidene or a (C₃)alkylidene.

“Alkynyl” means a straight or branched, carbon chain that contains at least one carbon-carbon triple bond (—C≡C— or —C≡CR, wherein R is hydrogen or a further substituent). Examples of alkynyl include ethynyl, propargyl, 3-methyl-1-pentynyl, 2-heptynyl and the like. In particular embodiments, “alkynyl,” either alone or represented along with another radical, can be a (C_2-20)alkynyl, a (C_2-15)alkynyl, a (C_2-10)alkynyl, a (C_2-5)alkynyl or a (C_2-3)alkynyl. Alternatively, “alkynyl,” either alone or represented along with another radical, can be a (C₂)alkynyl, a (C₃)alkynyl or a (C₄)alkynyl.

“Alkynylene” means a straight or branched, divalent carbon chain having one or more carbon-carbon triple bonds (—CR—CR′—, wherein R and R′ are each independently hydrogen or further substituents). Examples of alkynylene include ethyne-1,2-diyl, propyne-1,3-diyl, and the like. In particular embodiments, “alkynylene,” either alone or represented along with another radical, can be a (C_2-20) alkynylene, a (C_2-15) alkynylene, a (C_2-10) alkynylene, a (C_2-5) alkynylene or a (C_2-3) alkynylene. Alternatively, “alkynylene,” either alone or represented along with another radical, can be a (C₂) alkynylene, a (C₃) alkynylene or a (C₄) alkynylene.

“Amido” means the radical —C(═O)—NR—, —C(═O)—NRR′, —NR—C(═O)— and/or —NR—C(═O)R′, wherein each R and R′ are independently hydrogen or a further substituent.

“Amino” means a nitrogen moiety having two further substituents where, for example, a hydrogen or carbon atom is attached to the nitrogen. For example, representative amino groups include —NH₂, —NHCH₃, —N(CH₃)₂, —NH((C_1-10)alkyl), —N((C_1-10)alkyl)₂, —NH(aryl), —NH(heteroaryl), —N(aryl)₂, —N(heteroaryl)₂, and the like. Optionally, the two substituents together with the nitrogen may also form a ring. Unless indicated otherwise, the compounds of the invention containing amino moieties may include protected derivatives thereof. Suitable protecting groups for amino moieties include acetyl, tert-butoxycarbonyl, benzyloxycarbonyl, and the like.

“Animal” includes humans, non-human mammals (e.g., dogs, cats, rabbits, cattle, horses, sheep, goats, swine, deer, and the like) and non-mammals (e.g., birds, and the like).

“Aromatic” means a moiety wherein the constituent atoms make up an unsaturated ring system, all atoms in the ring system are sp²hybridized and the total number of pi electrons is equal to 4n+2. An aromatic ring may be such that the ring atoms are only carbon atoms or may include carbon and non-carbon atoms (See “heteroaryl”).

“Aryl” means a monocyclic or polycyclic ring assembly wherein each ring is aromatic or when fused with one or more rings forms an aromatic ring assembly. If one or more ring atoms is not carbon (e.g., N, S), the aryl is a heteroaryl. (C_X)aryl and (C_X-Y)aryl are typically used where X and Y indicate the number of carbon atoms in the ring. In particular embodiments, “aryl,” either alone or represented along with another radical, can be a (C_3-14)aryl, a (C_3-10)aryl, a (C_3-7)aryl, a (C_8-10)aryl or a (C_5-7)aryl. Alternatively, “aryl,” either alone or represented along with another radical, can be a (C₅)aryl, a (C₆)aryl, a (C₇)aryl, a (C₈)aryl, a (C₉)aryl or a (C₁₀)aryl.

“Azaalkyl” means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with substituted or unsubstituted nitrogen atoms (—NR— or —NRR′, wherein R and R′ are each independently hydrogen or further substituents). For example, a (C_1-10)azaalkyl refers to a chain comprising between 1 and 10 carbons and one or more nitrogen atoms.

“Bicycloalkyl” means a saturated or partially unsaturated fused, spiro or bridged bicyclic ring assembly. In particular embodiments, “bicycloalkyl,” either alone or represented along with another radical, can be a (C_4-15)bicycloalkyl, a (C_4-10)bicycloalkyl, a (C_6-10)bicycloalkyl or a (C_8-10)bicycloalkyl. Alternatively, “bicycloalkyl,” either alone or represented along with another radical, can be a (C₈)bicycloalkyl, a (C₉)bicycloalkyl or a (C₁₀)bicycloalkyl.

“Bicycloaryl” means a fused, spiro or bridged bicyclic ring assembly wherein at least one of the rings comprising the assembly is aromatic. (C_X)bicycloaryl and (C_X-Y)bicycloaryl are typically used where X and Y indicate the number of carbon atoms in the bicyclic ring assembly and directly attached to the ring. In particular embodiments, “bicycloaryl,” either alone or represented along with another radical, can be a (a (C_4-15)bicycloaryl, a (C_4-10)bicycloaryl, a (C_6-10)bicycloaryl or a (C_8-10)bicycloaryl. Alternatively, “bicycloalkyl,” either alone or represented along with another radical, can be a (C₈)bicycloaryl, a (C₉)bicycloaryl, or a (C₁₀)bicycloaryl.

“Bridging ring” and “bridged ring” as used herein refer to a ring that is bonded to another ring to form a compound having a bicyclic or polycyclic structure where two ring atoms that are common to both rings are not directly bound to each other. Non-exclusive examples of common compounds having a bridging ring include borneol, norbornane, 7-oxabicyclo[2.2.1]heptane, and the like. One or both rings of the bicyclic system may also comprise heteroatoms.

“Carbamoyl” means the radical —OC(O)NRR′, wherein R and R′ are each independently hydrogen or further substituents.

“Carbocycle” means a ring consisting of carbon atoms.

“Carbonyl” means the radical —C(═O)— and/or —C(═O)R, wherein R is hydrogen or a further substituent. It is noted that the carbonyl radical may be further substituted with a variety of substituents to form different carbonyl groups including acids, acid halides, aldehydes, amides, esters, and ketones.

“Carboxy” means the radical —C(═O)—O— and/or —C(═O)—OR, wherein R is hydrogen or a further substituent. It is noted that compounds of the invention containing carboxy moieties may include protected derivatives thereof, i.e., where the oxygen is substituted with a protecting group. Suitable protecting groups for carboxy moieties include benzyl, tert-butyl, and the like.

“Cyano” means the radical —CN.

“Cycloalkyl” means a non-aromatic, saturated or partially unsaturated, monocyclic, bicyclic or polycyclic ring assembly. (C_X)cycloalkyl and (C_X-Y)cycloalkyl are typically used where X and Y indicate the number of carbon atoms in the ring assembly. For example, (C_3-10)cycloalkyl includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,5-cyclohexadienyl, bicyclo[2.2.2]octyl, adamantan-1-yl, decahydronaphthyl, oxocyclohexyl, dioxocyclohexyl, thiocyclohexyl, 2-oxobicyclo[2.2.1]hept-1-yl, and the like. In particular embodiments, “cycloalkyl,” either alone or represented along with another radical, can be a (C_3-14)cycloalkyl, a (C_3-10)cycloalkyl, a (C_3-7)cycloalkyl, a (C_8-10)cycloalkyl or a (C_5-7)cycloalkyl. Alternatively, “cycloalkyl,” either alone or represented along with another radical, can be a (C₅)cycloalkyl, a (C₆)cycloalkyl, a (C₇)cycloalkyl, a (C₈)cycloalkyl, a (C₉)cycloalkyl, or a (C₁₀)cycloalkyl.

“Cycloalkylene” means a divalent, saturated or partially unsaturated, monocyclic, bicyclic or polycyclic ring assembly. (C_X)cycloalkylene and (C_X-Y)cycloalkylene are typically used where X and Y indicate the number of carbon atoms in the ring assembly. In particular embodiments, “cycloalkylene,” either alone or represented along with another radical, can be a (C_3-14)cycloalkylene, a (C_3-10)cycloalkylene, a (C_3-7)cycloalkylene, a (C_8-10)cycloalkylene or a (C_5-7)cycloalkylene. Alternatively, “cycloalkylene,” either alone or represented along with another radical, can be a (C₅)cycloalkylene, a (C₆)cycloalkylene, a (C₇)cycloalkylene, a (C₈)cycloalkylene, a (C₉)cycloalkylene, or a (C₁₀)cycloalkylene.

“Disease” specifically includes any unhealthy condition of an animal or part thereof and includes an unhealthy condition that may be caused by, or incident to, medical or veterinary therapy applied to that animal, i.e., the “side effects” of such therapy.

“EC₅₀” means the molar concentration of an agonist that produces 50% of the maximal possible effect of that agonist. The action of the agonist may be stimulatory or inhibitory.

“Fused ring” as used herein refers to a ring that is bonded to another ring to form a compound having a bicyclic structure where the ring atoms that are common to both rings are directly bound to each other. Non-exclusive examples of common fused rings include decalin, naphthalene, anthracene, phenanthrene, indole, furan, benzofuran, quinoline, and the like. Compounds having fused ring systems may be saturated, partially saturated, carbocyclics, heterocyclics, aromatics, heteroaromatics, and the like.

“Halo” means fluoro, chloro, bromo or iodo.

“Heteroalicyclic” means an alicyclic moiety as defined in this Application where at least one of the ring atoms is a heteroatom. The heteroalicylic contemplated in this Application includes, but are not limited to, pyrroline, pyrrolidine, dioxiane, imidazoline, imidazolidine, pyrazoline, pyrazolidine, pyran, poperidine, dioxane, morpholine, dithiane, thiomorpholine, piperazine, trithiane, indoline, quinuclidine, indene, norbornane, fluorine, norbornane, adamantane, and the like.

“Heteroalkyl” means alkyl, as defined in this Application, provided that one or more of the atoms within the alkyl chain is a heteroatom. In particular embodiments, “heteroalkyl,” either alone or represented along with another radical, can be a hetero(C_1-20)alkyl, a hetero(C_1-15)alkyl, a hetero(C_1-10)alkyl, a hetero(C_1-5)alkyl, a hetero(C_1-3)alkyl or a hetero(C_1-2)alkyl. Alternatively, “heteroalkyl,” either alone or represented along with another radical, can be a hetero(C₁)alkyl, a hetero(C₂)alkyl or a hetero(C₃)alkyl.

“Heteroaryl” means a monocyclic, bicyclic or polycyclic aromatic group wherein at least one ring atom is a heteroatom and the remaining ring atoms are carbon. Monocyclic heteroaryl groups include, but are not limited to, cyclic aromatic groups having five or six ring atoms, wherein at least one ring atom is a heteroatom and the remaining ring atoms are carbon. The nitrogen atoms can be optionally quaternerized and the sulfur atoms can be optionally oxidized. Heteroaryl groups of this invention include, but are not limited to, those derived from furan, imidazole, isothiazole, isoxazole, oxadiazole, oxazole, 1,2,3-oxadiazole, pyrazine, pyrazole, pyridazine, pyridine, pyrimidine, pyrroline, thiazole, 1,3,4-thiadiazole, triazole and tetrazole. “Heteroaryl” also includes, but is not limited to, bicyclic or tricyclic rings, wherein the heteroaryl ring is fused to one or two rings independently selected from the group consisting of an aryl ring, a cycloalkyl ring, a cycloalkenyl ring, and another monocyclic heteroaryl or heterocycloalkyl ring. These bicyclic or tricyclic heteroaryls include, but are not limited to, those derived from benzo[b]furan, benzo[b]thiophene, benzimidazole, imidazo[4,5-c]pyridine, quinazoline, thieno[2,3-c]pyridine, thieno[3,2-b]pyridine, thieno[2,3-b]pyridine, indolizine, imidazo[1,2a]pyridine, quinoline, isoquinoline, phthalazine, quinoxaline, naphthyridine, quinolizine, indole, isoindole, indazole, indoline, benzoxazole, benzopyrazole, benzothiazole, imidazo[1,5-a]pyridine, pyrazolo[1,5-a]pyridine, imidazo[1,2-a]pyrimidine, imidazo[1,2-c]pyrimidine, imidazo[1,5-a]pyrimidine, imidazo[1,5-c]pyrimidine, pyrrolo[2,3-b]pyridine, pyrrolo[2,3-c]pyridine, pyrrolo[3,2-c]pyridine, pyrrolo[3,2-b]pyridine, pyrrolo[2,3-d]pyrimidine, pyrrolo[3,2-d]pyrimidine, pyrrolo[2,3-b]pyrazine, pyrazolo[1,5-a]pyridine, pyrrolo[1,2-b]pyridazine, pyrrolo[1,2-c]pyrimidine, pyrrolo[1,2-a]pyrimidine, pyrrolo[1,2-a]pyrazine, triazo[1,5-a]pyridine, pteridine, purine, carbazole, acridine, phenazine, phenothiazene, phenoxazine, 1,2-dihydropyrrolo[3,2,1-hi]indole, indolizine, pyrido[1,2-a]indole and 2(1H)-pyridinone. The bicyclic or tricyclic heteroaryl rings can be attached to the parent molecule through either the heteroaryl group itself or the aryl, cycloalkyl, cycloalkenyl or heterocycloalkyl group to which it is fused. The heteroaryl groups of this invention can be substituted or unsubstituted. In particular embodiments, “heteroaryl,” either alone or represented along with another radical, can be a hetero(C_1-13)aryl, a hetero(C_2-13)aryl, a hetero(C_2-6)aryl, a hetero(C_3-9)aryl or a hetero(C_5-9)aryl. Alternatively, “heteroaryl,” either alone or represented along with another radical, can be a hetero(C₃)aryl, a hetero(C₄)aryl, a hetero(C₅)aryl, a hetero(C₆)aryl, a hetero(C₇)aryl, a hetero(C₈)aryl or a hetero(C₉)aryl.

“Heteroatom” refers to an atom that is not a carbon atom. Particular examples of heteroatoms include, but are not limited to, nitrogen, oxygen, and sulfur.

“Heteroatom moiety” includes a moiety where the atom by which the moiety is attached is not a carbon. Examples of heteroatom moieties include —NR—, —N⁺(O⁻)═, —O—, —S— or —S(O)₂—, wherein R is hydrogen or a further substituent.

“Heterobicycloalkyl” means bicycloalkyl, as defined in this Application, provided that one or more of the atoms within the ring is a heteroatom. For example hetero(C_9-12)bicycloalkyl as used in this application includes, but is not limited to, 3-aza-bicyclo[4.1.0]hept-3-yl, 2-aza-bicyclo[3.1.0]hex-2-yl, 3-aza-bicyclo[3.1.0]hex-3-yl, and the like. In particular embodiments, “heterobicycloalkyl,” either alone or represented along with another radical, can be a hetero(C_1-14)bicycloalkyl, a hetero(C_4-14)bicycloalkyl, a hetero(C_4-9)bicycloalkyl, or a hetero(C_5-9)bicycloalkyl. Alternatively, “heterobicycloalkyl,” either alone or represented along with another radical, can be a hetero(C₅)bicycloalkyl, hetero(C₆)bicycloalkyl, hetero(C₇)bicycloalkyl, hetero(C₈)bicycloalkyl, or a hetero(C₉)bicycloalkyl.

“Heterobicycloaryl” means bicycloaryl, as defined in this Application, provided that one or more of the atoms within the ring is a heteroatom. For example, hetero(C_4-12)bicycloaryl as used in this Application includes, but is not limited to, 2-amino-4-oxo-3,4-dihydropteridin-6-yl, tetrahydroisoquinolinyl, and the like. In particular embodiments, “heterobicycloaryl,” either alone or represented along with another radical, can be a hetero(C_1-14)bicycloaryl, a hetero(C_4-14)bicycloaryl, a hetero(C_4-9)bicycloarylor a hetero(C_5-9)bicycloaryl. Alternatively, “heterobicycloaryl,” either alone or represented along with another radical, can be a hetero(C₅)bicycloaryl, hetero(C₆)bicycloaryl, hetero(C₇)bicycloaryl, hetero(C₈)bicycloaryl, or a hetero(C₉)bicycloaryl.

“Heterocycloalkyl” means cycloalkyl, as defined in this Application, provided that one or more of the atoms forming the ring is a heteroatom selected independently from N, O, or S. Non-exclusive examples of heterocycloalkyl include piperidyl, 4-morpholyl, 4-piperazinyl, pyrrolidinyl, perhydropyrrolizinyl, 1,4-diazaperhydroepinyl, 1,3-dioxanyl, 1,4-dioxanyl and the like. In particular embodiments, “heterocycloalkyl,” either alone or represented along with another radical, can be a hetero(C_1-13)cycloalkyl, a hetero(C_1-9)cycloalkyl, a hetero(C_1-6)cycloalkyl, a hetero(C_5-9)cycloalkyl or a hetero(C_2-6)cycloalkyl. Alternatively, “heterocycloalkyl,” either alone or represented along with another radical, can be a hetero(C₂)cycloalkyl, a hetero(C₃)cycloalkyl, a hetero(C₄)cycloalkyl, a hetero(C₅)cycloalkyl, a hetero(C₆)cycloalkyl, hetero(C₇)cycloalkyl, hetero(C₈)cycloalkyl, or a hetero(C₉)cycloalkyl.

“Heterocycloalkylene” means cycloalkylene, as defined in this Application, provided that one or more of the ring member carbon atoms is replaced by a heteroatom. In particular embodiments, “heterocycloalkylene,” either alone or represented along with another radical, can be a hetero(C_1-13)cycloalkylene, a hetero(C_1-9)cycloalkylene, a hetero(C_1-6)cycloalkylene, a hetero(C_5-9)cycloalkylene, or a hetero(C_2-6)cycloalkylene. Alternatively, “heterocycloalkylene,” either alone or represented along with another radical, can be a hetero(C₂)cycloalkylene, a hetero(C₃)cycloalkylene, a hetero(C₄)cycloalkylene, a hetero(C₅)cycloalkylene, a hetero(C₆)cycloalkylene, hetero(C₇)cycloalkylene, hetero(C₈)cycloalkylene, or a hetero(C₉)cycloalkylene.

“Hydroxy” means the radical —OH.

“IC₅₀” means the molar concentration of an inhibitor that produces 50% inhibition of the target enzyme.

“Imino” means the radical —CR(═NR′) and/or —C(═NR′)—, wherein R and R′ are each independently hydrogen or a further substituent.

“Iminoketone derivative” means a derivative comprising the moiety —C(NR)—, wherein R is hydrogen or a further substituent.

“Isomers” means compounds having identical molecular formulae but differing in the nature or sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereomers” and stereoisomers that are nonsuperimposable mirror images are termed “enantiomers” or sometimes “optical isomers.” A carbon atom bonded to four nonidentical substituents is termed a “chiral center.” A compound with one chiral center has two enantiomeric forms of opposite chirality. A mixture of the two enantiomeric forms is termed a “racemic mixture.” A compound that has more than one chiral center has 2^n-1enantiomeric pairs, where n is the number of chiral centers. Compounds with more than one chiral center may exist as ether an individual diastereomer or as a mixture of diastereomers, termed a “diastereomeric mixture.” When one chiral center is present a stereoisomer may be characterized by the absolute configuration of that chiral center. Absolute configuration refers to the arrangement in space of the substituents attached to the chiral center. Enantiomers are characterized by the absolute configuration of their chiral centers and described by the R- and S-sequencing rules of Cahn, Ingold and Prelog. Conventions for stereochemical nomenclature, methods for the determination of stereochemistry and the separation of stereoisomers are well known in the art (e.g., see “Advanced Organic Chemistry”, 5th edition, March, Jerry, John Wiley & Sons, New York, 2001).

“Leaving group” means the group with the meaning conventionally associated with it in synthetic organic chemistry, i.e., an atom or group displaceable under reaction (e.g., alkylating) conditions. Examples of leaving groups include, but are not limited to, halo (e.g., F, Cl, Br and I), alkyl (e.g., methyl and ethyl) and sulfonyloxy (e.g., mesyloxy, ethanesulfonyloxy, benzenesulfonyloxy and tosyloxy), thiomethyl, thienyloxy, dihalophosphinoyloxy, tetrahalophosphoxy, benzyloxy, isopropyloxy, acyloxy, and the like.

“Nitro” means the radical —NO₂.

“Oxaalkyl” means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with oxygen atoms (—O— or —OR, wherein R is hydrogen or a further substituent). For example, an oxa(C_1-10)alkyl refers to a chain comprising between 1 and 10 carbons and one or more oxygen atoms.

“Oxoalkyl” means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with carbonyl groups (—C(═O)— or —C(═O)—R, wherein R is hydrogen or a further substituent). The carbonyl group may be an aldehyde, ketone, ester, amide, acid or acid halide. For example, an oxo(C_1-10)alkyl refers to a chain comprising between 1 and 10 carbon atoms and one or more carbonyl groups.

“Oxy” means the radical —O— or —OR, wherein R is hydrogen or a further substituent. Accordingly, it is noted that the oxy radical may be further substituted with a variety of substituents to form different oxy groups including hydroxy, alkoxy, aryloxy, heteroaryloxy or carbonyloxy.

“Pharmaceutically acceptable” means that which is useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable and includes that which is acceptable for veterinary use as well as human pharmaceutical use.

“Pharmaceutically acceptable salts” means salts of compounds of the present invention which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as acetic acid, propionic acid, hexanoic acid, heptanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, o-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, p-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2.2.2]oct-2-ene-1-carboxylic acid, glucoheptonic acid, 4,4′-methylenebis(3-hydroxy-2-ene-1-carboxylic acid), 3-phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid and the like.

Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine and the like.

“Polycyclic ring” includes bicyclic and multi-cyclic rings. The individual rings comprising the polycyclic ring can be fused, spiro or bridging rings.

“Prodrug” means a compound that is convertible in vivo metabolically into an inhibitor according to the present invention. The prodrug itself may or may not also have activity with respect to a given target protein. For example, a compound comprising a hydroxy group may be administered as an ester that is converted by hydrolysis in vivo to the hydroxy compound. Suitable esters that may be converted in vivo into hydroxy compounds include acetates, citrates, lactates, phosphates, tartrates, malonates, oxalates, salicylates, propionates, succinates, fumarates, maleates, methylene-bis-b-hydroxynaphthoates, gentisates, isethionates, di-p-toluoyltartrates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, cyclohexylsulfamates, quinates, esters of amino acids, and the like. Similarly, a compound comprising an amine group may be administered as an amide that is converted by hydrolysis in vivo to the amine compound.

“Protected derivatives” means derivatives of inhibitors in which a reactive site or sites are blocked with protecting groups. Protected derivatives are useful in the preparation of inhibitors or in themselves may be active as inhibitors. A comprehensive list of suitable protecting groups can be found in P. G. M. Wuts and T. W. Greene, “Greene's Protecting Groups in Organic Synthesis, 4th edition, John Wiley & Sons, Inc. 2007.

“Ring” and “ring assembly” means a carbocyclic or a heterocyclic system and includes aromatic and non-aromatic systems. The system can be monocyclic, bicyclic or polycyclic. In addition, for bicyclic and polycyclic systems, the individual rings comprising the polycyclic ring can be fused, spiro or bridging rings.

“Subject” and “patient” includes humans, non-human mammals (e.g., dogs, cats, rabbits, cattle, horses, sheep, goats, swine, deer, and the like) and non-mammals (e.g., birds, and the like).

“Substituted or unsubstituted” means that a given moiety may consist of only hydrogen substituents through available valencies (unsubstituted) or may further comprise one or more non-hydrogen substituents through available valencies (substituted) that are not otherwise specified by the name of the given moiety. For example, isopropyl is an example of an ethylene moiety that is substituted by —CH₃—In general, a non-hydrogen substituent may be any substituent that may be bound to an atom of the given moiety that is specified to be substituted. Examples of substituents include, but are not limited to, aldehyde, alicyclic, aliphatic, (C_1-10)alkyl, alkylene, alkylidene, amide, amino, aminoalkyl, aromatic, aryl, bicycloalkyl, bicycloaryl, carbamoyl, carbocyclyl, carboxyl, carbonyl group, cycloalkyl, cycloalkylene, ester, halo, heterobicycloalkyl, heterocycloalkylene, heteroaryl, heterobicycloaryl, heterocycloalkyl, oxo, hydroxy, iminoketone, ketone, nitro, oxaalkyl, and oxoalkyl moieties, each of which may optionally also be substituted or unsubstituted. In one particular embodiment, examples of substituents include, but are not limited to, hydrogen, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, (C_1-10)azaalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-2)bicycloaryl(C_1-5)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl and hetero(C_4-12)bicycloaryl. In addition, the substituent is itself optionally substituted by a further substituent. In one particular embodiment, examples of the further substituent include, but are not limited to, hydrogen, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, (C_1-10)azaalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl and hetero(C_4-12)bicycloaryl.

“Sulfinyl” means the radical —SO— and/or —SO—R, wherein R is hydrogen or a further substituent. It is noted that the sulfinyl radical may be further substituted with a variety of substituents to form different sulfinyl groups including sulfinic acids, sulfinamides, sulfinyl esters, and sulfoxides.

“Sulfonyl” means the radical —SO₂— and/or —SO₂—R, wherein R is hydrogen or a further substituent. It is noted that the sulfonyl radical may be further substituted with a variety of substituents to form different sulfonyl groups including sulfonic acids, sulfonamides, sulfonate esters, and sulfones.

“Therapeutically effective amount” means that amount which, when administered to an animal for treating a disease, is sufficient to effect such treatment for the disease.

“Thio” denotes replacement of an oxygen by a sulfur and includes, but is not limited to, —SR, —S— and ═S containing groups.

“Thioalkyl” means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with sulfur atoms (—S— or —S—R, wherein R is hydrogen or a further substituent). For example, a thio(C_1-10)alkyl refers to a chain comprising between 1 and 10 carbons and one or more sulfur atoms.

“Thiocarbonyl” means the radical —C(═S)— and/or —C(═S)—R, wherein R is hydrogen or a further substituent. It is noted that the thiocarbonyl radical may be further substituted with a variety of substituents to form different thiocarbonyl groups including thioacids, thioamides, thioesters, and thioketones.

“Treatment” or “treating” means any administration of a compound of the present invention and includes:

(1) preventing the disease from occurring in an animal which may be predisposed to the disease but does not yet experience or display the pathology or symptomatology of the disease,

(2) inhibiting the disease in an animal that is experiencing or displaying the pathology or symptomatology of the diseased (i.e., arresting further development of the pathology and/or symptomatology), or

(3) ameliorating the disease in an animal that is experiencing or displaying the pathology or symptomatology of the diseased (i.e., reversing the pathology and/or symptomatology).

It is noted in regard to all of the definitions provided herein that the definitions should be interpreted as being open ended in the sense that further substituents beyond those specified may be included. Hence, a C₁alkyl indicates that there is one carbon atom but does not indicate what are the substituents on the carbon atom. Hence, a (C₁)alkyl comprises methyl (i.e., —CH₃) as well as —CRR′R″ where R, R′, and R″ may each independently be hydrogen or a further substituent where the atom attached to the carbon is a heteroatom or cyano. Hence, CF₃, CH₂OH and CH₂CN, for example, are all (C₁)alkyls. Similarly, terms such as alkylamino and the like comprise dialkylamino and the like.

A compound having a formula that is represented with a dashed bond is intended to include the formulae optionally having zero, one or more double bonds, as exemplified and shown below:

In addition, atoms making up the compounds of the present invention are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include ¹³C and ¹⁴C.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to compounds that may be used to inhibit acetyl-CoA carboxylase (ACC) and, in particular, ACC1 and/or ACC2. The present invention also relates to pharmaceutical compositions, kits and articles of manufacture comprising such compounds. In addition, the present invention relates to methods and intermediates useful for making the compounds. Further, the present invention relates to methods of using said compounds.

It is noted that the compounds of the present invention may also possess inhibitory activity for other ACC family members and thus may be used to address disease states associated with these other family members.

Compound of the Invention

In one of its aspects, the present invention relates to compounds that are useful as ACC inhibitors. In one embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

Ring A is selected from five or six membered, substituted or unsubstituted aryl and five or six membered, substituted or unsubstituted heteroaryl;

R²is substituted or unsubstituted alkyl; and

In another embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R²is substituted or unsubstituted alkyl;

the ring comprising V¹, V²and V⁴is selected from the group consisting of substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl;

V¹is selected from the group consisting of CR²⁰, NR²⁰, N, O and S;

V²is selected from the group consisting of CR²¹, NR²¹, N, O and S;

V⁴is selected from the group consisting of CR²², NR²², N, O and S;

- wherein
  - R²⁰, R²¹and R²²are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-2)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted,
    - or R²⁰and R²¹are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R²¹and R²²are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

In some variations of the above embodiments and variations, at least one of V¹, V²and V⁴is a sulfur atom.

In another embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R²is substituted or unsubstituted alkyl;

R²⁰and R²¹are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted, or R²⁰and R²¹are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

In some variations of the above embodiments and variations, R²⁰and R²¹, when present, are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

In another embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R²is substituted or unsubstituted alkyl;

Y is CR³or N, where R³is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted;

V⁵is selected from the group consisting of CR⁸R^8′ and NR^8′;

V⁶is selected from the group consisting of CR⁹R^9′ and NR^9′;

V⁷is selected from the group consisting of CR¹⁰R^10′ and NR^10′;

V⁸is selected from the group consisting of CR¹¹R^11′ and NR^11′;

- wherein
  - R⁸, R^8′, R⁹, R^9′, R¹⁰, R^10′, R¹¹and R^11′ are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-2)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted, provided that R^8′, R^9′, R^10′, and R^11′ may each be independently absent when the atom to which it is bound forms part of a double bond,
    - or R⁸and R⁹are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R⁹and R¹⁰are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R¹⁰and R¹¹are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

In another embodiment, the compounds of the invention consists of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R¹is selected from the group consisting of oxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, imino, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted;

R²is substituted or unsubstituted alkyl;

R⁸, R⁹, R¹⁰, and R¹¹are each independently selected from the group consisting of H, halo, nitro, cyano, hydroxy, (C_1-6)alkoxy, (C_1-6)alkyl, halo(C_1-6)alkyl, hydroxy(C_1-6)alkyl, aza(C_1-6)alkyl, (C_1-6)oxaalkyl, and (C_1-10)oxoalkyl, each substituted or unsubstituted.

In another embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R¹is selected from the group consisting of oxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, imino, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-2)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted;

R²is substituted or unsubstituted alkyl;

R⁸, R⁹and R¹⁰are each independently selected from the group consisting of H, halo, nitro, cyano, hydroxy, (C_1-6)alkoxy, (C_1-6)alkyl, halo(C_1-6)alkyl, hydroxy(C_1-6)alkyl, aza(C_1-6)alkyl, (C_1-6)oxaalkyl, and (C_1-10)oxoalkyl, each substituted or unsubstituted.

In another embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R²is substituted or unsubstituted alkyl;

the ring comprising V¹, V², V³, and V⁴is selected from the group consisting of substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl;

V¹is selected from the group consisting of CR⁴and N;

V²is selected from the group consisting of CR⁵and N;

V³is selected from the group consisting of CR⁶and N;

V⁴is selected from the group consisting of CR⁷and N;

- wherein
  - R⁴, R⁵, R⁶, and R⁷are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-2)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted,
    - or R⁴and R⁵are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R⁵and R⁶are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R⁶and R⁷are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

In another embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R¹is selected from the group consisting of oxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, imino, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted;

R²is substituted or unsubstituted alkyl;

V³is selected from the group consisting of CR⁶and N;

V⁴is selected from the group consisting of CR⁷and N;

V⁵is selected from the group consisting of CR⁸R^8′, NR^8′, O, and S;

V⁶is selected from the group consisting of CR⁹R^9′, NR^9′, O, and S;

V⁷is selected from the group consisting of CR¹⁰R^10′, NR^10′, O, and S;

V⁸is selected from the group consisting of CR¹¹R^11′, NR^11′, O, and S;

- wherein
  - R⁶, R⁷, R⁸, R^8′, R⁹, R^9′, R¹⁰, R^10′, R¹¹and R^11′ are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-2)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted, provided that R^8′, R^9′, R^10′, and R^11′ may each be independently absent when the atom to which it is bound forms part of a double bond,
    - or R⁸and R⁹are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R⁹and R¹⁰are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R¹⁰and R¹¹are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

In another embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R¹is selected from the group consisting of oxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, imino, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted;

R²is substituted or unsubstituted alkyl;

V⁵is selected from the group consisting of CR⁸R^8′, NR^8′, O, and S;

V⁶is selected from the group consisting of CR⁹R^9′, NR^9′, O, and S;

V⁷is selected from the group consisting of CR¹⁰R^10′, NR^10′, O, and S;

V⁸is selected from the group consisting of CR¹¹R^11′, NR^11′, O, and S;

- wherein
  - R⁸, R^8′, R⁹, R^9′, R¹⁰, R^10′, R¹¹and R^11′ are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted, provided that R^8′, R^9′, R^10′, and R^11′ may each be independently absent when the atom to which it is bound forms part of a double bond,
    - or R⁸and R⁹are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R⁹and R¹⁰are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl,
    - or R¹⁰and R¹¹are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

In another embodiment, the compounds of the invention consist of the formula:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

a is 1 or 2;

Q is a selected from the group consisting of —S—, —S(O)—, and —S(O)₂—;

R²is substituted or unsubstituted alkyl;

In some variations of the above embodiments of the compounds of the invention, a is 1. In some other variations, a is 2.

In some variations of the above embodiments and variations of the compounds of the invention, Q is —S—. In other variations, Q is —S(O)—. In still other variations, Q is —S(O)₂—.

R₂

In some variations of the above embodiments and variations of the compounds of the invention, R²is a substituted or unsubstituted (C_1-16)alkyl.

In some other variations, R²is a substituted or unsubstituted methyl.

In still other variations, R²is a substituted or unsubstituted ethyl.

R₁

In some variations of the above embodiments and variations of the compounds of the invention, R¹is selected from the group consisting of aminocarbonyl, (C_1-10)alkylamino, (C_1-10)alkyl, carbonyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted.

In other variations, R¹is selected from the group consisting of (C_1-10)alkyl, hetero(C_1-10)alkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloaryl and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted.

In still other variations, R¹is a (C_4-12)aryl or a hetero(C_1-10)aryl, each substituted or unsubstituted.

In all the above variations where R¹is a (C_4-12)aryl or hetero(C_1-10)aryl, R¹is selected from the group consisting of:

each substituted or unsubstituted.

In all the above variations where R¹is a (C_4-12)aryl or hetero(C_1-10)aryl, the (C_4-12)aryl and the hetero(C_1-10)aryl are each substituted with substituents each independently selected from the group consisting of chloro, bromo, —CN, methyl, methoxy, phenoxy, —C(O)OCH₃, —C(O)OH, —C(O)CH₃, —C(O)N(CH₂CH)₃, —C(O)O(CH₂CH)₃, —NHC(O)CH₃, —N(CH₂CH₃)₂, —N(CH₃)₂, —NO₂, —OCF₃, —SCH₃, —S(O)₂CH₃, —S(O)₂NH₂,

In the embodiments and variations where R¹is a (C_4-12)aryl or hetero(C_1-10)aryl, R¹is selected from the group consisting of:

In other embodiments and variations, R¹is a unsubstituted or substituted (C_9-12)bicycloaryl, or unsubstituted or substituted hetero(C_4-12)bicycloaryl. In some of these variations, the (C_9-12)bicycloaryl and hetero(C_4-12)bicycloaryl are selected from the group consisting of:

In other embodiments and variations, R¹is a substituted alkyl selected from the group consisting of methyl, isobutyl, —(CH₂)₂C(O)OCH₂CH₃, —(CH₂)₂C(O)N(CH₂CH₃)₂, —(CH₂)₂CF₃,

In still other embodiments and variations, R¹is a cycloalkyl or heterocycloalkyl which is selected from the group consisting of

In some variations of the above embodiments of the compounds of the invention, Y is N.

In other variations, Y is —CR³—, where R³is selected from the group consisting of hydrogen, methyl, ethyl, propyl, and isopropyl. In other variations, R³is hydrogen or methyl. In still other variations, R³is hydrogen or methyl.

Y is —CH—.

The still other embodiments, the compounds of the invention consist of a formula selected from the group consisting of:

or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof,

wherein

R¹is a selected from the group consisting of methyl, isobutyl, —(CH₂)₂CF₃, —(CH₂)₂C(O)OCH₂CH₃, —(CH₂)₂C(O)N(CH₂CH₃)₂,

R¹⁰and R¹¹are each independently selected from the group consisting of (C_1-6)alkyl and (C_1-6)alkoxy.

In some variations of the above embodiments, R¹is a selected from the group consisting of

In other variations of the above embodiments, R¹is a selected from the group consisting of

In still other variations of the above embodiments, R¹is a selected from the group consisting of

In any one of the above embodiments and variations, R¹⁰and R¹¹are each independently methyl or methoxy. In other variations, R¹⁰is methyl. In other variations, R¹⁰is methoxy. In still other variations, R¹¹is methyl. In yet other variations, R¹¹is methoxy.

Particular examples of compounds according to the present invention include, but are not limited to, the following:

2-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzonitrile;
1-(3-(4-(2-cyanophenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-ethyl-3-(3-(4-(phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-(benzo[d][1,3]dioxol-5-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-ethyl-3-(3-(4-(3-(methylsulfonyl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-(benzo[c][1,2,5]thiadiazol-5-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-ethyl-3-(3-(4-(3-methoxyphenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
N-(3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)phenyl)acetamide;
2-chloro-5-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzenesulfonamide;
1-ethyl-3-(3-(4-(3-(2-methylthiazol-4-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-(5-methyl-1,3,4-oxadiazol-2-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-(2-methylpyrimidin-4-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-(5-methyl-1,2,4-oxadiazol-3-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(6-morpholinopyridin-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-nitrophenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(1,1-dioxotetrahydrothiophen-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-(3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
N-(5-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)-2-methoxyphenyl)acetamide;
1-(3-(4-(3-acetylphenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-(3-(4-(benzo[d]thiazol-6-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-ethyl-3-(3-(4-(4-(2-oxopyrrolidin-1-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-(3,4-dimethoxyphenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
N-(4-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)phenyl)acetamide;
Ethyl 3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)propanoate;
1-ethyl-3-(3-(4-(isobutylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3,3,3-trifluoropropylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(methylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(4-(methylsulfonyl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(2-oxoindolin-6-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(2-oxo-2,3-dihydro-1H-benzo[d]imidazol-5-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(2-oxo-2,3-dihydrobenzo[d]oxazol-5-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(2-oxo-2,3-dihydrobenzo[d]thiazol-5-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
N,N-diethyl-3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)propanamide;
1-ethyl-3-(3-(4-(3-oxo-3-(pyrrolidin-1-yl)propylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-morpholino-3-oxopropylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-methoxyphenylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-(benzo[d][1,3]dioxol-5-ylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-ethyl-3-(3-(4-(3-methoxyphenylthio)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylthio)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-methoxyphenylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(pyridin-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(7-methoxy-3-(4-(6-methoxypyridin-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(6-phenoxypyridin-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-(5-(diethylamino)pyridin-3-ylsulfonyl)piperazine-1-carbonyl)thieno[2,3-b]pyridin-2-yl)-3-ethylurea;
1-(3-(4-(6-chloropyridin-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-(3-(4-(2-chloropyrimidin-5-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-(3-(4-(5-bromo-6-(diethylamino)pyridin-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-(7-cyano-3-(4-(6-(diethylamino)pyridin-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-(3-(4-(2-(diethylamino)pyrimidin-5-ylsulfonyl)piperazine-1-carbonyl)-6-methylthieno[2,3-b]pyridin-2-yl)-3-ethylurea;
1-ethyl-3-(3-(4-(quinolin-8-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(2-(naphthalen-1-yl)ethylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-((7,7-dimethyl-3-oxobicyclo[2.2.1]heptan-1-yl)methylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
methyl 2-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzoate;
2-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzoic acid;
N,N-diethyl-2-(4-(2-(3-ethylureido)-7-methoxybenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzamide;
3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzoic acid;
methyl 3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzoate;
N,N-diethyl-3-(4-(2-(3-ethylureido)-7-methoxybenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzamide;
N-(5-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)thiazol-2-yl)acetamide;
ethyl 2-(4-(2-(3-ethylureido)thieno[2,3-b]pyridine-3-carbonyl)piperazin-1-ylsulfonyl)-4-methylthiazole-5-carboxylate;
1-ethyl-3-(7-methoxy-3-(4-(5-(oxazol-5-yl)thiazol-2-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(2-methyl-4,5′-bithiazol-2′-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(6-methyl-3-(4-(4-methyl-3,4-dihydro-2H-benzo[b][1,4]oxazin-7-ylsulfonyl)piperazine-1-carbonyl)thieno[2,3-b]pyridin-2-yl)urea;
1-ethyl-3-(3-(4-(3-oxo-3,4-dihydro-2H-benzo[b][1,4]oxazin-6-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-(3,5-dimethoxyphenylsulfonyl)piperidine-1-carbonyl)-7-methoxybenzo[b]thiophen-2-yl)-3-ethylurea;
1-(3-(4-(3-(dimethylamino)phenylsulfonyl)piperidine-1-carbonyl)-6-methylthieno[2,3-b]pyridin-2-yl)-3-ethylurea;
1-(3-(4-(3,5-dimethoxyphenylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea;
1-ethyl-3-(3-(4-(3-(morpholinomethyl)phenylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-methoxyphenylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfonyl)piperidine-1-carbonyl)thieno[2,3-b]pyridin-2-yl)urea;
1-ethyl-3-(3-(4-(3-(methylthio)phenylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(pyridin-3-ylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-(3-(4-(benzo[d][1,3]dioxol-5-ylsulfinyl)piperidine-1-carbonyl)-7-methoxybenzo[b]thiophen-2-yl)-3-ethylurea;
1-ethyl-3-(3-(4-(3-methoxyphenylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(3-(4-(3-(methylthio)phenylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea;
1-ethyl-3-(6-methyl-3-(4-(3-(trifluoromethoxy)phenylsulfinyl)piperidine-1-carbonyl)thieno[2,3-b]pyridin-2-yl)urea; and
1-ethyl-3-(7-methoxy-3-(4-(pyridin-3-ylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea.

It is noted that the compounds of the present invention may be in the form of a pharmaceutically acceptable salt. It is further note that the compounds of the present invention may be in a mixture of stereoisomers, or the compound may comprise a single stereoisomer.

In another aspect, the present invention is related to a pharmaceutical composition comprising as an active ingredient a compound according to any one of the above embodiments and variations. In one embodiment, the composition is a solid formulation adapted for oral administration. In another embodiment, the composition is a liquid formulation adapted for oral administration. In yet another embodiment, the composition is a tablet. In still another embodiment, the composition is a liquid formulation adapted for parenteral administration.

In another embodiment, the pharmaceutical composition comprises a compound according to any one of the above embodiments and variations, wherein the composition is adapted for administration by a route selected from the group consisting of orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposally, intraarticularly, and intrathecally.

In another aspect, the invention is related to a kit which comprises a compound of any one of the above embodiments and variations, and instructions which comprise one or more forms of information selected from the group consisting of indicating a disease state for which the composition is to be administered, storage information for the composition, dosing information and instructions regarding how to administer the composition. In one particular variation, the kit comprises the compound in a multiple dose form.

In still another aspect, the invention is related to an article of manufacture comprising a compound of any one of the above embodiments and variations and packaging materials. In one embodiment, the packaging material comprises a container for housing the compound. In another embodiment, the container comprises a label indicating one or more members of the group consisting of a disease state for which the compound is to be administered, storage information, dosing information and/or instructions regarding how to administer the compound.

In another embodiment, the article of manufacture comprises the compound in a multiple dose form.

In a further aspect, the invention is related to a therapeutic method comprising administering a compound of any one of the above embodiments and variations to a subject.

In one embodiment, the method comprises contacting ACC with a compound of any one of the above embodiments and variations. In an exemplary embodiment, ACC is a member selected from ACC1 and ACC2.

In yet another embodiment is a method of inhibiting ACC which comprises causing a compound of any one of the above embodiments and variations to be present in a subject in order to inhibit ACC in vivo. In an exemplary embodiment, ACC is a member selected from ACC1 and ACC2.

A further embodiment is a method of inhibiting ACC which comprises administering a first compound to a subject that is converted in vivo to a second compound wherein the second compound inhibits ACC in vivo, the second compound being a compound according to any one of the above embodiments and variations. In an exemplary embodiment, ACC is a member selected from ACC1 and ACC2.

Another further embodiment is a method of treating a disease state for which ACC possesses activity contributes to the pathology and/or symptomology of the disease state. In one variation, the method comprises causing a compound of any one of the above embodiments and variations to be present in a subject in a therapeutically effective amount for the disease state. In another variation, the method comprises administering a compound of any one of the above embodiments and variations to a subject, wherein the compound is present in the subject in a therapeutically effective amount for the disease state. In a further variation, the method comprises administering a first compound to a subject that is converted in vivo to a second compound wherein the second compound inhibits ACC in vivo, the second compound being a compound according to any one of the above embodiments and variations.

In one variation of the above embodiments and variations, the disease state is selected from the group consisting of metabolic syndrome (also known as insulin resistance syndrome, syndrome X), visceral obesity, hyperlipidemia, dyslipidemia, hyperglycemia, hypertension, hyperuricemia renal dysfunction, atherosclerosis, type-2 diabetes, android obesity, Cushing's disease, cognitive function, and ocular function.

In a further embodiment of the method of the invention, the ACC is an ACC1. In another variation of the method, the ACC is an ACC2.

Another aspect of the invention is directed to methods of preparing the inhibitors of the invention. In one embodiment, the method comprising:

coupling a compound of the formula

to a compound of the formula R¹S(O)₂Cl, under conditions that form a reaction product of the formula

wherein

n is 4;

R is selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C_1-10)alkoxy, (C_4-12)aryloxy, hetero(C_1-10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C_1-10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C_1-10)alkyl, halo(C_1-10)alkyl, hydroxy(C_1-10)alkyl, carbonyl(C_1-10)alkyl, thiocarbonyl(C_1-10)alkyl, sulfonyl(C_1-10)alkyl, sulfinyl(C_1-10)alkyl, aza(C_1-10)alkyl, (C_1-10)oxaalkyl, (C_1-10)oxoalkyl, imino(C_1-10)alkyl, (C_3-12)cycloalkyl(C_1-5)alkyl, hetero(C_3-12)cycloalkyl(C_1-10)alkyl, aryl(C_1-10)alkyl, hetero(C_1-10)aryl(C_1-5)alkyl, (C_9-12)bicycloaryl(C_1-5)alkyl, hetero(C_8-12)bicycloaryl(C_1-5)alkyl, hetero(C_1-10)alkyl, (C_3-12)cycloalkyl, hetero(C_3-12)cycloalkyl, (C_9-12)bicycloalkyl, hetero(C_3-12)bicycloalkyl, (C_4-12)aryl, hetero(C_1-10)aryl, (C_9-12)bicycloaryl, and hetero(C_4-12)bicycloaryl, each substituted or unsubstituted,

R²is substituted or unsubstituted alkyl.

In some variation of the above method of preparation, R¹is selected from the group consisting of methyl, isobutyl, —(CH₂)₂C(O)OCH₂CH₃, —(CH₂)₂C(O)N(CH₂CH₃)₂, —(CH₂)₂CF₃,

In some other variations, R²is ethyl.

Salts, Hydrates, and Prodrugs of ACC Inhibitors

It should be recognized that the compounds of the present invention may be present and optionally administered in the form of salts, hydrates and prodrugs that are converted in vivo into the compounds of the present invention. For example, it is within the scope of the present invention to convert the compounds of the present invention into and use them in the form of their pharmaceutically acceptable salts derived from various organic and inorganic acids and bases in accordance with procedures well known in the art.

When the compounds of the present invention possess a free base form, the compounds can be prepared as a pharmaceutically acceptable acid addition salt by reacting the free base form of the compound with a pharmaceutically acceptable inorganic or organic acid, e.g., hydrohalides such as hydrochloride, hydrobromide, hydroiodide; other mineral acids and their corresponding salts such as sulfate, nitrate, phosphate, etc.; and alkyl and monoarylsulfonates such as ethanesulfonate, toluenesulfonate and benzenesulfonate; and other organic acids and their corresponding salts such as acetate, tartrate, maleate, succinate, citrate, benzoate, salicylate and ascorbate. Further acid addition salts of the present invention include, but are not limited to: adipate, alginate, arginate, aspartate, bisulfate, bisulfite, bromide, butyrate, camphorate, camphorsulfonate, caprylate, chloride, chlorobenzoate, cyclopentanepropionate, digluconate, dihydrogenphosphate, dinitrobenzoate, dodecylsulfate, fumarate, galacterate (from mucic acid), galacturonate, glucoheptonate, gluconate, glutamate, glycerophosphate, hemisuccinate, hemisulfate, heptanoate, hexanoate, hippurate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, iodide, isethionate, iso-butyrate, lactate, lactobionate, malate, malonate, mandelate, metaphosphate, methanesulfonate, methylbenzoate, monohydrogenphosphate, 2-naphthalenesulfonate, nicotinate, nitrate, oxalate, oleate, pamoate, pectinate, persulfate, phenylacetate, 3-phenylpropionate, phosphate, phosphonate and phthalate. It should be recognized that the free base forms will typically differ from their respective salt forms somewhat in physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free base forms for the purposes of the present invention.

When the compounds of the present invention possess a free acid form, a pharmaceutically acceptable base addition salt can be prepared by reacting the free acid form of the compound with a pharmaceutically acceptable inorganic or organic base. Examples of such bases are alkali metal hydroxides including potassium, sodium and lithium hydroxides; alkaline earth metal hydroxides such as barium and calcium hydroxides; alkali metal alkoxides, e.g., potassium ethanolate and sodium propanolate; and various organic bases such as ammonium hydroxide, piperidine, diethanolamine and N-methylglutamine. Also included are the aluminum salts of the compounds of the present invention. Further base salts of the present invention include, but are not limited to: copper, ferric, ferrous, lithium, magnesium, manganic, manganous, potassium, sodium and zinc salts. Organic base salts include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, e.g., arginine, betaine, caffeine, chloroprocaine, choline, N,N′-dibenzylethylenediamine (benzathine), dicyclohexylamine, diethanolamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, iso-propylamine, lidocaine, lysine, meglumine, N-methyl-D-glucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethanolamine, triethylamine, trimethylamine, tripropylamine and tris-(hydroxymethyl)-methylamine (tromethamine). It should be recognized that the free acid forms will typically differ from their respective salt forms somewhat in physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid forms for the purposes of the present invention.

Compounds of the present invention that comprise basic nitrogen containing groups may be quaternized with such agents as (C_1-4) alkyl halides, e.g., methyl, ethyl, iso-propyl and tert-butyl chlorides, bromides and iodides; di(C_1-4) alkyl sulfates, e.g., dimethyl, diethyl and diamyl sulfates; (C_10-18) alkyl halides, e.g., decyl, dodecyl, lauryl, myristyl and stearyl chlorides, bromides and iodides; and aryl (C_1-4) alkyl halides, e.g., benzyl chloride and phenethyl bromide. Such salts permit the preparation of both water-soluble and oil-soluble compounds of the present invention.

N-oxides of compounds according to the present invention can be prepared by methods known to those of ordinary skill in the art. For example, N-oxides can be prepared by treating an unoxidized form of the compound with an oxidizing agent (e.g., trifluoroperacetic acid, permaleic acid, perbenzoic acid, peracetic acid, meta-chloroperoxybenzoic acid, or the like) in a suitable inert organic solvent (e.g., a halogenated hydrocarbon such as dichloromethane) at approximately 0° C. Alternatively, the N-oxides of the compounds can be prepared from the N-oxide of an appropriate starting material.

Prodrug derivatives of compounds according to the present invention can be prepared by modifying substituents of compounds of the present invention that are then converted in vivo to a different substituent. It is noted that in many instances, the prodrugs themselves also fall within the scope of the range of compounds according to the present invention. For example, prodrugs can be prepared by reacting a compound with a carbamylating agent (e.g., 1,1-acyloxyalkylcarbonochloridate, para-nitrophenyl carbonate, or the like) or an acylating agent. Further examples of methods of making prodrugs are described in Saulnier et al. (1994), Bioorganic and Medicinal Chemistry Letters, Vol. 4, p. 1985.

Protected derivatives of compounds of the present invention can also be made. Examples of techniques applicable to the creation of protecting groups and their removal can be found in P. G. M. Wuts and T. W. Greene in “Greene's Protective Groups in Organic Synthesis” 4th edition, John Wiley and Sons, 2007.

Compounds of the present invention may also be conveniently prepared, or formed during the process of the invention, as solvates (e.g., hydrates). Hydrates of compounds of the present invention may be conveniently prepared by recrystallization from an aqueous/organic solvent mixture, using organic solvents such as dioxin, tetrahydrofuran or methanol.

A “pharmaceutically acceptable salt”, as used herein, is intended to encompass any compound according to the present invention that is utilized in the form of a salt thereof, especially where the salt confers on the compound improved pharmacokinetic properties as compared to the free form of compound or a different salt form of the compound. The pharmaceutically acceptable salt form may also initially confer desirable pharmacokinetic properties on the compound that it did not previously possess, and may even positively affect the pharmacodynamics of the compound with respect to its therapeutic activity in the body. An example of a pharmacokinetic property that may be favorably affected is the manner in which the compound is transported across cell membranes, which in turn may directly and positively affect the absorption, distribution, biotransformation and excretion of the compound. While the route of administration of the pharmaceutical composition is important, and various anatomical, physiological and pathological factors can critically affect bioavailability, the solubility of the compound is usually dependent upon the character of the particular salt form thereof, which it utilized. One of skill in the art will appreciate that an aqueous solution of the compound will provide the most rapid absorption of the compound into the body of a subject being treated, while lipid solutions and suspensions, as well as solid dosage forms, will result in less rapid absorption of the compound.

Uses for the Compounds of the Invention

Compounds of the invention are ACC inhibitors useful in the treatment, control and/or prevention of metabolic diseases and conditions that are mediated by abnormal fatty acid metabolism. These diseases and conditions include obesity, an overweight condition, hypertriglyceridemia, hyperlipidemia, hypoalphalipoproteinemia, metabolic syndrome, diabetes mellitus (especially Type II), hyperinsulinemia, impaired glucose tolerance, insulin resistance, diabetic complication, atherosclerosis, hypertension, coronary heart disease, hypercholesterolemia, stroke, polycystic ovary disease, cerebrovascular disease and congestive heart failure. In particularly, metabolic syndrome, atherosclerosis, and non-insulin dependent diabetes mellitus (NIDDM).

Metabolic syndrome (also known as insulin resistance syndrome, syndrome X) is a common clinical disorder that is defined as the presence of increased insulin concentrations in association with other disorders including visceral obesity, hyperlipidemia and dyslipidemia, hyperglycemia, hypertension, and sometimes hyperuricemia and renal dysfunction. Recent studies have suggested that abnormal fatty acid metabolism may be at the core of metabolic syndrome. It is now well established that the development of insulin resistance and type 2 diabetics are tightly associated with excess intramyocellular triacylglyceride (TAG) in nonadipose tissues such as in skeletal muscle, liver and pancreas. Krissak et al., Diabetologia 1999, 42:113-6; Hulver, M. W. et al., Am J Physiol Endocrinol Metab 2003; 284:E741-7; Sinha R. et al., Diabetes 2002; 51:1022-7. The precise mechanism of how increased intracellular lipid content exacerbates whole body insulin sensitivity is unclear at present but it has been postulated that increased long chain fatty acyl-CoAs, ceramide or diacylglycerol, whose contents are proportional to the accumulation of intramyocellular triglyceride, antagonizes metabolic actions of insulin, reduces muscle glucose uptake and inhibits hepatic glucose production. Sinha R. et al., Diabetes 2002; 51:1022-7; Friedman J. Nature 2002; 415:268-9). As muscle is the primary site of metabolic action of insulin, the development of muscle insulin resistance along with liver insulin resistance are thus inherently linked to the development of whole body insulin resistance.

Inhibiting the activity of acetyl CoA carboxylase (ACC) would reduce the production of malonyl-CoA from acetyl-CoA. Malonyl-CoA plays an important role in the overall fatty acid metabolism: malonyl-CoA is an intermediate utilized by fatty acid synthase for de novo lipogenesis, and it also acts as a potent allosteric inhibitor of carnitine palmitoyltransferase 1 (CPT1), a mitochondrial membrane protein that shuttles long chain fatty acyl CoAs into the mitochondria for β-oxidization. Ruderman N. and Prentki M. Nat Rev Drug Discov 2004; 3: 340-51. A small molecule inhibitor of ACC would thus limit de novo lipid synthesis and increase muscle and liver fat oxidation; thus reduce the accumulation of long chain fatty acids.

The compounds of the invention are also useful for the prophylaxis or treatment of atherosclerosis, a disease of the arteries. The pathological sequence leading to atherosclerosis and occlusive heart disease is well known. The earliest stage in this sequence is the formation of “fatty streaks” in the carotid, coronary and cerebral arteries and in the aorta. These lesions are yellow in color due to the presence of lipid deposits found principally within smooth-muscle cells and in macrophages of the intima layer of the arteries and aorta. Further, it is postulated that most of the cholesterol found within the fatty streaks, in turn, gives rise to development of the “fibrous plaque,” which consists of accumulated intimal smooth muscle cells laden with lipid and surrounded by extra-cellular lipid, collagen, elastin and proteoglycans. These cells plus matrix form a fibrous cap that covers a deeper deposit of cell debris and more extracellular lipid. The lipid is primarily free and esterified cholesterol. The fibrous plaque forms slowly, and is likely in time to become calcified and necrotic, advancing to the “complicated lesion,” which accounts for the arterial occlusion and tendency toward mural thrombosis and arterial muscle spasm that characterize advanced atherosclerosis. The ACC inhibitors reduce the formation of the fatty streaks and lower the chance of atherosclerosis.

Combination Therapy

The ACC inhibitors according to the present invention may have a therapeutic additive or synergistic effect with a wide variety of therapeutic agents. Combination therapies that comprise one or more compounds of the present invention with one or more other therapeutic agents can be used, for example, to: 1) enhance the therapeutic effect(s) of the one or more compounds of the present invention and/or the one or more other therapeutic agents; 2) reduce the side effects exhibited by the one or more compounds of the present invention and/or the one or more other therapeutic agents; and/or 3) reduce the effective dose of the one or more compounds of the present invention and/or the one or more other therapeutic agents. It is noted that combination therapy is intended to cover when agents are administered before or after each other (sequential therapy) as well as when the agents are administered at the same time.

Examples of such therapeutic agents that may be used in combination with ACC inhibitors include, but are not limited to, antiatherosclerosis agents, a diabetes treating agents, obesity treating agents, and cardiovascular agents.

Antiatherosclerosis agents being contemplated for combination therapy with the compounds of the invention include, but are not limited to, lipase inhibitors, HMG-CoA reductase inhibitors, HMG-CoA synthase inhibitors, HMG-CoA reductases, gene expression inhibitors, HMG-CoA synthase gene expression inhibitors, microsomal triglyceride transfer protein (MTP)/Apo B secretion inhibitors, cholesterol ester transfer protein (CETP) inhibitors, bile acid absorption inhibitors, cholesterol absorption inhibitors, cholesterol synthesis inhibitors, squalene synthetase inhibitors, squalene epoxidase inhibitors, squalene cyclase inhibitors, combined squalene epoxidase/squalene cyclase inhibitors, fibrates, niacin, PPAR agonists, ion-exchange resins, antioxidants, acyl-CoA:cholesterol acyl transferase (ACAT) inhibitors, bile acid sequestrants, antiplatelet agents, antithrombotic agents or estrogen receptor modulators. HMG-CoA reductases and CETP inhibitors are preferred antiatherosclerosis agents for use with the compounds of the invention. Examples of HMG-CoA reductase inhibitor which may be used with the compounds of the invention include lovastatin, rosuvastatin, itavastatin, simvastatin, pravastatin, fluvastatin, atorvastatin (and its hemicalcium salt) or rivastatin.

Diabetes treating agent being contemplated for combination therapy with the compounds of the invention include, but are not limited to, aldose reductase inhibitors, glucocorticoid receptor antagonists, glycogenolysis inhibitors, glycogen phosphorylase inhibitors, sorbitol dehydrogenase inhibitors, insulin, insulin analogs, insulinotropin, sulfonylureas, sulfonylureas analogs, biguanides, imidazolines, insulin secretagogues, linogliride, glitazones, glucosidase inhibitors, acarbose, miglitol, emiglitate, voglibose, camiglibose, β-agonists, phosphodiesterase inhibitors (e.g., PDE5 or PDE11), vanadate, vanadium complexes (e.g. Naglivan®), peroxovanadium complexes, amylin antagonists, amylase inhibitors, glucagon antagonists, gluconeogenesis inhibitors, somatostatin analogs, antilipolytic agents, nicotinic acid, acipimox, pramlintide (Symlin™), nateglinide, activators of AMP-activated protein kinase, PPARδ agonists, duel PPARα or/PPAR-δ agonists, protein kinase C-B inhibitors, PTP1B inhibitors, glycogen synthase kinase-3 inhibitors, GLP-1 agonists or soluble guanylate cyclase (sGc) activators. Specific diabetes treating agents include, but are not limited to, chlorpropamide, glibenclamide, tolbutamide, tolazamide, acetohexamide, Glypizide®, glimepiride, repaglinide, meglitinide, metformin, phenformin, buformin, midaglizole, isaglidole, deriglidole, idazoxan, efaroxan, fluparoxan, ciglitazone, pioglitazone, englitazone, darglitazone, clomoxir or etomoxir.

Obesity treating agent being contemplated for combination therapy with the compounds of the invention include, but are not limited to, phenylpropanolamine, ephedrine, pseudoephedrine, phentermine, a neuropeptide Y antagonist, a β-adrenergic receptor agonist, a cholecystokinin-A agonist, a monoamine reuptake inhibitor, a sympathomimetic agent, a serotonin modulator, a dopamine agonist, a melanocortin receptor modulator, a cannabinoid receptor antagonist, a melanin concentrating hormone antagonist, leptin, a leptin analog, a leptin receptor agonist, a galanin antagonist, a lipase inhibitor, a phosphatase 1B inhibitor, a bombesin agonist, dehydroepiandrosternone or analogs thereof, thyroxine, a thyromimetic agent, dehydroepiandrosterone or an analog thereof, a glucocorticoid receptor modulator, an orexin receptor antagonist, a urocortin binding protein antagonist, a glucagon-like peptide-1 receptor agonist, an eating behavior modifying agent, a ciliary neurotrophic factor, a neurokinin receptor antagonist, a noradrenalin transport modulator or a dopamine transport modulator. Specific examples of obesity treating agents include orlistat, sibutramine or bromocriptine.

Cardiovascular agents being contemplated for combination therapy with the compounds of the invention include, but are not limited to, calcium channel blockers, angiotensin converting enzyme (ACE) inhibitors or diuretics.

Compositions Comprising ACC Inhibitors

A wide variety of compositions and administration methods may be used in conjunction with the compounds of the present invention. Such compositions may include, in addition to the compounds of the present invention, conventional pharmaceutical excipients, and other conventional, pharmaceutically inactive agents. Additionally, the compositions may include active agents in addition to the compounds of the present invention. These additional active agents may include additional compounds according to the invention, and/or one or more other pharmaceutically active agents.

The compositions may be in gaseous, liquid, semi-liquid or solid form, formulated in a manner suitable for the route of administration to be used. For oral administration, capsules and tablets are typically used. For parenteral administration, reconstitution of a lyophilized powder, prepared as described herein, is typically used.

Compositions comprising compounds of the present invention may be administered or coadministered orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposally, intraarticularly, or intrathecally. The compounds and/or compositions according to the invention may also be administered or coadministered in slow release dosage forms.

The ACC inhibitors and compositions comprising them may be administered or coadministered in any conventional dosage form. Co-administration in the context of this invention is intended to mean the administration of more than one therapeutic agent, one of which includes an ACC inhibitor, in the course of a coordinated treatment to achieve an improved clinical outcome. Such co-administration may also be coextensive, that is, occurring during overlapping periods of time.

Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application may optionally include one or more of the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent; antimicrobial agents, such as benzyl alcohol and methyl parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetates, citrates and phosphates; agents for the adjustment of tonicity such as sodium chloride or dextrose, and agents for adjusting the acidity or alkalinity of the composition, such as alkaline or acidifying agents or buffers like carbonates, bicarbonates, phosphates, hydrochloric acid, and organic acids like acetic and citric acid. Parenteral preparations may optionally be enclosed in ampules, disposable syringes or single or multiple dose vials made of glass, plastic or other suitable material.

When compounds according to the present invention exhibit insufficient solubility, methods for solubilizing the compounds may be used. Such methods are known to those of skill in this art, and include, but are not limited to, using cosolvents, such as dimethylsulfoxide (DMSO), using surfactants, such as TWEEN, or dissolution in aqueous sodium bicarbonate. Derivatives of the compounds, such as prodrugs of the compounds may also be used in formulating effective pharmaceutical compositions.

Upon mixing or adding compounds according to the present invention to a composition, a solution, suspension, emulsion or the like may be formed. The form of the resulting composition will depend upon a number of factors, including the intended mode of administration, and the solubility of the compound in the selected carrier or vehicle. The effective concentration needed to ameliorate the disease being treated may be empirically determined.

Compositions according to the present invention are optionally provided for administration to humans and animals in unit dosage forms, such as tablets, capsules, pills, powders, dry powders for inhalers, granules, sterile parenteral solutions or suspensions, and oral solutions or suspensions, and oil-water emulsions containing suitable quantities of the compounds, particularly the pharmaceutically acceptable salts, preferably the sodium salts, thereof. The pharmaceutically therapeutically active compounds and derivatives thereof are typically formulated and administered in unit-dosage forms or multiple-dosage forms. Unit-dose forms, as used herein, refers to physically discrete units suitable for human and animal subjects and packaged individually as is known in the art. Each unit-dose contains a predetermined quantity of the therapeutically active compound sufficient to produce the desired therapeutic effect, in association with the required pharmaceutical carrier, vehicle or diluent. Examples of unit-dose forms include ampoules and syringes individually packaged tablet or capsule. Unit-dose forms may be administered in fractions or multiples thereof. A multiple-dose form is a plurality of identical unit-dosage forms packaged in a single container to be administered in segregated unit-dose form. Examples of multiple-dose forms include vials, bottles of tablets or capsules or bottles of pint or gallons. Hence, multiple dose form is a multiple of unit-doses that are not segregated in packaging.

In addition to one or more compounds according to the present invention, the composition may comprise: a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose; a lubricant, such as magnesium stearate, calcium stearate and talc; and a binder such as starch, natural gums, such as gum acaciagelatin, glucose, molasses, polyvinylpyrrolidine, celluloses and derivatives thereof, povidone, crospovidones and other such binders known to those of skill in the art. Liquid pharmaceutically administrable compositions can, for example, be prepared by dissolving, dispersing, or otherwise mixing an active compound as defined above and optional pharmaceutical adjuvants in a carrier, such as, for example, water, saline, aqueous dextrose, glycerol, glycols, ethanol, and the like, to form a solution or suspension. If desired, the pharmaceutical composition to be administered may also contain minor amounts of auxiliary substances such as wetting agents, emulsifying agents, or solubilizing agents, pH buffering agents and the like, for example, acetate, sodium citrate, cyclodextrine derivatives, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, and other such agents. Actual methods of preparing such dosage forms are known in the art, or will be apparent, to those skilled in this art; for example, see Remington: The Science and Practices of Pharmacy, Lippincott Williams, and Wilkins Publisher, 21^stedition, 2005. The composition or formulation to be administered will, in any event, contain a sufficient quantity of an inhibitor of the present invention to reduce ACC activity in vivo, thereby treating the disease state of the subject.

Dosage forms or compositions may optionally comprise one or more compounds according to the present invention in the range of 0.005% to 100% (weight/weight) with the balance comprising additional substances such as those described herein. For oral administration, a pharmaceutically acceptable composition may optionally comprise any one or more commonly employed excipients, such as, for example pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, talcum, cellulose derivatives, sodium crosscarmellose, glucose, sucrose, magnesium carbonate, sodium saccharin, talcum. Such compositions include solutions, suspensions, tablets, capsules, powders, dry powders for inhalers and sustained release formulations, such as, but not limited to, implants and microencapsulated delivery systems, and biodegradable, biocompatible polymers, such as collagen, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid and others. Methods for preparing these formulations are known to those skilled in the art. The compositions may optionally contain 0.01%-100% (weight/weight) of one or more ACC inhibitors, optionally 0.1-95%, and optionally 1-95%.

Salts, preferably sodium salts, of the inhibitors may be prepared with carriers that protect the compound against rapid elimination from the body, such as time release formulations or coatings. The formulations may further include other active compounds to obtain desired combinations of properties.

A. Formulations for Oral Administration

Oral pharmaceutical dosage forms may be as a solid, gel or liquid. Examples of solid dosage forms include, but are not limited to tablets, capsules, granules, and bulk powders. More specific examples of oral tablets include compressed, chewable lozenges and tablets that may be enteric-coated, sugar-coated or film-coated. Examples of capsules include hard or soft gelatin capsules. Granules and powders may be provided in non-effervescent or effervescent forms. Each may be combined with other ingredients known to those skilled in the art.

In certain embodiments, compounds according to the present invention are provided as solid dosage forms, preferably capsules or tablets. The tablets, pills, capsules, troches and the like may optionally contain one or more of the following ingredients, or compounds of a similar nature: a binder; a diluent; a disintegrating agent; a lubricant; a glidant; a sweetening agent; and a flavoring agent.

Examples of binders that may be used include, but are not limited to, microcrystalline cellulose, gum tragacanth, glucose solution, acacia mucilage, gelatin solution, sucrose and starch paste.

Examples of lubricants that may be used include, but are not limited to, talc, starch, magnesium or calcium stearate, lycopodium and stearic acid.

Examples of diluents that may be used include, but are not limited to, lactose, sucrose, starch, kaolin, salt, mannitol and dicalcium phosphate.

Examples of glidants that may be used include, but are not limited to, colloidal silicon dioxide.

Examples of disintegrating agents that may be used include, but are not limited to, crosscarmellose sodium, sodium starch glycolate, alginic acid, corn starch, potato starch, bentonite, methylcellulose, agar and carboxymethylcellulose.

Examples of coloring agents that may be used include, but are not limited to, any of the approved certified water-soluble FD and C dyes, mixtures thereof, and water insoluble FD and C dyes suspended on alumina hydrate.

Examples of sweetening agents that may be used include, but are not limited to, sucrose, lactose, mannitol and artificial sweetening agents such as sodium cyclamate and saccharin, and any number of spray-dried flavors.

Examples of flavoring agents that may be used include, but are not limited to, natural flavors extracted from plants such as fruits and synthetic blends of compounds that produce a pleasant sensation, such as, but not limited to peppermint and methyl salicylate.

Examples of wetting agents that may be used include, but are not limited to, propylene glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate and polyoxyethylene lauryl ether.

Examples of anti-emetic coatings that may be used include, but are not limited to, fatty acids, fats, waxes, shellac, ammoniated shellac and cellulose acetate phthalates.

Examples of film coatings that may be used include, but are not limited to, hydroxyethylcellulose, sodium carboxymethylcellulose, polyethylene glycol 4000 and cellulose acetate phthalate.

If oral administration is desired, the salt of the compound may optionally be provided in a composition that protects it from the acidic environment of the stomach. For example, the composition can be formulated in an enteric coating that maintains its integrity in the stomach and releases the active compound in the intestine. The composition may also be formulated in combination with an antacid or other such ingredient.

When the dosage unit form is a capsule, it may optionally additionally comprise a liquid carrier such as a fatty oil. In addition, dosage unit forms may optionally additionally comprise various other materials that modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents.

Compounds according to the present invention may also be administered as a component of an elixir, suspension, syrup, wafer, sprinkle, chewing gum or the like. A syrup may optionally comprise, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors.

The compounds of the present invention may also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, such as antacids, H2 blockers, and diuretics. For example, if a compound is used for treating asthma or hypertension, it may be used with other bronchodilators and antihypertensive agents, respectively.

Examples of pharmaceutically acceptable carriers that may be included in tablets comprising compounds of the present invention include, but are not limited to binders, lubricants, diluents, disintegrating agents, coloring agents, flavoring agents, and wetting agents. Enteric-coated tablets, because of the enteric-coating, resist the action of stomach acid and dissolve or disintegrate in the neutral or alkaline intestines. Sugar-coated tablets may be compressed tablets to which different layers of pharmaceutically acceptable substances are applied. Film-coated tablets may be compressed tablets that have been coated with polymers or other suitable coating. Multiple compressed tablets may be compressed tablets made by more than one compression cycle utilizing the pharmaceutically acceptable substances previously mentioned. Coloring agents may also be used in tablets. Flavoring and sweetening agents may be used in tablets, and are especially useful in the formation of chewable tablets and lozenges.

Examples of liquid oral dosage forms that may be used include, but are not limited to, aqueous solutions, emulsions, suspensions, solutions and/or suspensions reconstituted from non-effervescent granules and effervescent preparations reconstituted from effervescent granules.

Examples of aqueous solutions that may be used include, but are not limited to, elixirs and syrups. As used herein, elixirs refer to clear, sweetened, hydroalcoholic preparations. Examples of pharmaceutically acceptable carriers that may be used in elixirs include, but are not limited to solvents. Particular examples of solvents that may be used include glycerin, sorbitol, ethyl alcohol and syrup. As used herein, syrups refer to concentrated aqueous solutions of a sugar, for example, sucrose. Syrups may optionally further comprise a preservative.

Emulsions refer to two-phase systems in which one liquid is dispersed in the form of small globules throughout another liquid. Emulsions may optionally be oil-in-water or water-in-oil emulsions. Examples of pharmaceutically acceptable carriers that may be used in emulsions include, but are not limited to non-aqueous liquids, emulsifying agents and preservatives.

Examples of pharmaceutically acceptable substances that may be used in non-effervescent granules, to be reconstituted into a liquid oral dosage form, include diluents, sweeteners and wetting agents.

Examples of pharmaceutically acceptable substances that may be used in effervescent granules, to be reconstituted into a liquid oral dosage form, include organic acids and a source of carbon dioxide.

Coloring and flavoring agents may optionally be used in all of the above dosage forms.

Particular examples of preservatives that may be used include glycerin, methyl and propylparaben, benzoic add, sodium benzoate and alcohol.

Particular examples of non-aqueous liquids that may be used in emulsions include mineral oil and cottonseed oil.

Particular examples of emulsifying agents that may be used include gelatin, acacia, tragacanth, bentonite, and surfactants such as polyoxyethylene sorbitan monooleate.

Particular examples of suspending agents that may be used include sodium carboxymethylcellulose, pectin, tragacanth, Veegum and acacia. Diluents include lactose and sucrose. Sweetening agents include sucrose, syrups, glycerin and artificial sweetening agents such as sodium cyclamate and saccharin.

Particular examples of wetting agents that may be used include propylene glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate and polyoxyethylene lauryl ether.

Particular examples of organic acids that may be used include citric and tartaric acid.

Sources of carbon dioxide that may be used in effervescent compositions include sodium bicarbonate and sodium carbonate. Coloring agents include any of the approved certified water soluble FD and C dyes, and mixtures thereof.

Particular examples of flavoring agents that may be used include natural flavors extracted from plants such fruits, and synthetic blends of compounds that produce a pleasant taste sensation.

For a solid dosage form, the solution or suspension, in for example propylene carbonate, vegetable oils or triglycerides, is preferably encapsulated in a gelatin capsule. Such solutions, and the preparation and encapsulation thereof, are disclosed in U.S. Pat. Nos. 4,328,245; 4,409,239; and 4,410,545. For a liquid dosage form, the solution, e.g., for example, in a polyethylene glycol, may be diluted with a sufficient quantity of a pharmaceutically acceptable liquid carrier, e.g., water, to be easily measured for administration.

Alternatively, liquid or semi-solid oral formulations may be prepared by dissolving or dispersing the active compound or salt in vegetable oils, glycols, triglycerides, propylene glycol esters (e.g., propylene carbonate) and other such carriers, and encapsulating these solutions or suspensions in hard or soft gelatin capsule shells. Other useful formulations include those set forth in U.S. Pat. Nos. Re 28,819 and 4,358,603.

B. Injectables, Solutions, and Emulsions

The present invention is also directed to compositions designed to administer the compounds of the present invention by parenteral administration, generally characterized by subcutaneous, intramuscular or intravenous injection. Injectables may be prepared in any conventional form, for example as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.

Examples of excipients that may be used in conjunction with injectables according to the present invention include, but are not limited to water, saline, dextrose, glycerol or ethanol. The injectable compositions may also optionally comprise minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, and other such agents, such as for example, sodium acetate, sorbitan monolaurate, triethanolamine oleate and cyclodextrins. Implantation of a slow-release or sustained-release system, such that a constant level of dosage is maintained (see, e.g., U.S. Pat. No. 3,710,795) is also contemplated herein. The percentage of active compound contained in such parenteral compositions is highly dependent on the specific nature thereof, as well as the activity of the compound and the needs of the subject.

Parenteral administration of the formulations includes intravenous, subcutaneous and intramuscular administrations. Preparations for parenteral administration include sterile solutions ready for injection, sterile dry soluble products, such as the lyophilized powders described herein, ready to be combined with a solvent just prior to use, including hypodermic tablets, sterile suspensions ready for injection, sterile dry insoluble products ready to be combined with a vehicle just prior to use and sterile emulsions. The solutions may be either aqueous or nonaqueous.

When administered intravenously, examples of suitable carriers include, but are not limited to physiological saline or phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents, such as glucose, polyethylene glycol, and polypropylene glycol and mixtures thereof.

Examples of pharmaceutically acceptable carriers that may optionally be used in parenteral preparations include, but are not limited to aqueous vehicles, nonaqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants, local anesthetics, suspending and dispersing agents, emulsifying agents, sequestering or chelating agents and other pharmaceutically acceptable substances.

Examples of aqueous vehicles that may optionally be used include Sodium Chloride Injection, Ringers Injection, Isotonic Dextrose Injection, Sterile Water Injection, Dextrose and Lactated Ringers Injection.

Examples of nonaqueous parenteral vehicles that may optionally be used include fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil and peanut oil.

Antimicrobial agents in bacteriostatic or fungistatic concentrations may be added to parenteral preparations, particularly when the preparations are packaged in multiple-dose containers and thus designed to be stored and multiple aliquots to be removed. Examples of antimicrobial agents that may be used include phenols or cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride and benzethonium chloride.

Examples of isotonic agents that may be used include sodium chloride and dextrose. Examples of buffers that may be used include phosphate and citrate. Examples of antioxidants that may be used include sodium bisulfate. Examples of local anesthetics that may be used include procaine hydrochloride. Examples of suspending and dispersing agents that may be used include sodium carboxymethylcellulose, hydroxypropyl methylcellulose and polyvinylpyrrolidone. Examples of emulsifying agents that may be used include Polysorbate 80 (TWEEN 80). A sequestering or chelating agent of metal ions includes EDTA.

Pharmaceutical carriers may also optionally include ethyl alcohol, polyethylene glycol and propylene glycol for water miscible vehicles and sodium hydroxide, hydrochloric acid, citric acid or lactic acid for pH adjustment.

The concentration of an inhibitor in the parenteral formulation may be adjusted so that an injection administers a pharmaceutically effective amount sufficient to produce the desired pharmacological effect. The exact concentration of an inhibitor and/or dosage to be used will ultimately depend on the age, weight and condition of the patient or animal as is known in the art.

Unit-dose parenteral preparations may be packaged in an ampoule, a vial or a syringe with a needle. All preparations for parenteral administration should be sterile, as is known and practiced in the art.

Injectables may be designed for local and systemic administration. Typically a therapeutically effective dosage is formulated to contain a concentration of at least about 0.1% w/w up to about 90% w/w or more, preferably more than 1% w/w of the ACC inhibitor to the treated tissue(s). The inhibitor may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment will be a function of the location of where the composition is parenterally administered, the carrier and other variables that may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the age of the individual treated. It is to be further understood that for any particular subject, specific dosage regimens may need to be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the formulations. Hence, the concentration ranges set forth herein are intended to be exemplary and are not intended to limit the scope or practice of the claimed formulations.

The ACC inhibitor may optionally be suspended in micronized or other suitable form or may be derivatized to produce a more soluble active product or to produce a prodrug. The form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle. The effective concentration is sufficient for ameliorating the symptoms of the disease state and may be empirically determined.

C. Lyophilized Powders

The compounds of the present invention may also be prepared as lyophilized powders, which can be reconstituted for administration as solutions, emulsions and other mixtures. The lyophilized powders may also be formulated as solids or gels.

Sterile, lyophilized powder may be prepared by dissolving the compound in a sodium phosphate buffer solution containing dextrose or other suitable excipient. Subsequent sterile filtration of the solution followed by lyophilization under standard conditions known to those of skill in the art provides the desired formulation. Briefly, the lyophilized powder may optionally be prepared by dissolving dextrose, sorbitol, fructose, corn syrup, xylitol, glycerin, glucose, sucrose or other suitable agent, about 1-20%, preferably about 5 to 15%, in a suitable buffer, such as citrate, sodium or potassium phosphate or other such buffer known to those of skill in the art at, typically, about neutral pH. Then, a ACC inhibitor is added to the resulting mixture, preferably above room temperature, more preferably at about 30-35° C., and stirred until it dissolves. The resulting mixture is diluted by adding more buffer to a desired concentration. The resulting mixture is sterile filtered or treated to remove particulates and to insure sterility, and apportioned into vials for lyophilization. Each vial may contain a single dosage or multiple dosages of the inhibitor.

D. Formulation for Topical Administration

The compounds of the present invention may also be administered as topical mixtures. Topical mixtures may be used for local and systemic administration. The resulting mixture may be a solution, suspension, emulsions or the like and are formulated as creams, gels, ointments, emulsions, solutions, elixirs, lotions, suspensions, tinctures, pastes, foams, aerosols, irrigations, sprays, suppositories, bandages, dermal patches or any other formulations suitable for topical administration.

The ACC inhibitors may be formulated as aerosols for topical application, such as by inhalation (see, U.S. Pat. Nos. 4,044,126, 4,414,209, and 4,364,923, which describe aerosols for delivery of a steroid useful for treatment of inflammatory diseases, particularly asthma). These formulations for administration to the respiratory tract can be in the form of an aerosol or solution for a nebulizer, or as a microfine powder for insufflation, alone or in combination with an inert carrier such as lactose. In such a case, the particles of the formulation will typically have diameters of less than 50 microns, preferably less than 10 microns.

The inhibitors may also be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye or for intracisternal or intraspinal application. Topical administration is contemplated for transdermal delivery and also for administration to the eyes or mucosa, or for inhalation therapies. Nasal solutions of the ACC inhibitor alone or in combination with other pharmaceutically acceptable excipients can also be administered.

E. Formulations for Other Routes of Administration

Depending upon the disease state being treated, other routes of administration, such as topical application, transdermal patches, and rectal administration, may also be used. For example, pharmaceutical dosage forms for rectal administration are rectal suppositories, capsules and tablets for systemic effect. Rectal suppositories are used herein mean solid bodies for insertion into the rectum that melt or soften at body temperature releasing one or more pharmacologically or therapeutically active ingredients. Pharmaceutically acceptable substances utilized in rectal suppositories are bases or vehicles and agents to raise the melting point. Examples of bases include cocoa butter (theobroma oil), glycerin-gelatin, carbowax, (polyoxyethylene glycol) and appropriate mixtures of mono-, di- and triglycerides of fatty acids. Combinations of the various bases may be used. Agents to raise the melting point of suppositories include spermaceti and wax. Rectal suppositories may be prepared either by the compressed method or by molding. The typical weight of a rectal suppository is about 2 to 3 gm. Tablets and capsules for rectal administration may be manufactured using the same pharmaceutically acceptable substance and by the same methods as for formulations for oral administration.

F. Examples of Formulations

The following are particular examples of oral, intravenous and tablet formulations that may optionally be used with compounds of the present invention. It is noted that these formulations may be varied depending on the particular compound being used and the indication for which the formulation is going to be used.

ORAL FORMULATION

Compound of the Present Invention
10-100
mg

Citric Acid Monohydrate
105
mg

Sodium Hydroxide
18
mg

Flavoring

Water
q.s. to 100 mL

INTRAVENOUS FORMULATION

Compound of the Present Invention
0.1-10
mg

Dextrose Monohydrate
q.s. to make isotonic

Citric Acid Monohydrate
1.05
mg

Sodium Hydroxide
0.18
mg

Water for Injection
q.s. to 1.0 mL

TABLET FORMULATION

Compound of the Present Invention
1%

Microcrystalline Cellulose
73%

Stearic Acid
25%

Colloidal Silica
1%.

Dosage, Host and Safety

The compounds of the present invention are stable and can be used safely. In particular, the compounds of the present invention are useful as ACC inhibitors for a variety of subjects (e.g., humans, non-human, mammals, and non-mammals).

The optimal dose may vary depending upon such conditions as, for example, the type of subject, the body weight of the subject, on the severity of the condition, the route of administration, and specific properties of the particular compound being used. Generally, acceptable and effective daily doses are amounts sufficient to effectively slow or eliminate the condition being treated. Typically, the daily dose for oral administration to an adult (body weight of about 60 kg) is about 1 to 1000 mg, about 3 to 300 mg, or about 10 to 200 mg. It will be appreciated that the daily dose can be given in a single administration or in multiple (e.g., 2 or 3) portions a day.

Kits and Articles of Manufacture Comprising ACC Inhibitors

The invention is also directed to kits and other articles of manufacture for treating diseases associated with ACC. It is noted that diseases are intended to cover all conditions for which ACC inhibitors possess activity that contributes to the pathology and/or symptomology of the condition.

In one embodiment, a kit is provided that comprises a composition comprising at least one inhibitor of the present invention in combination with instructions. The instructions may indicate the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition. The kit may also comprise packaging materials. The packaging material may comprise a container for housing the composition. The kit may also optionally comprise additional components, such as syringes for administration of the composition. The kit may comprise the composition in single or multiple dose forms.

In another embodiment, an article of manufacture is provided that comprises a composition comprising at least one inhibitor of the present invention in combination with packaging materials. The packaging material may comprise a container for housing the composition. The container may optionally comprise a label indicating the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition. The kit may also optionally comprise additional components, such as syringes for administration of the composition. The kit may comprise the composition in single or multiple dose forms.

It is noted that the packaging material used in kits and articles of manufacture according to the present invention may form a plurality of divided containers such as a divided bottle or a divided foil packet. The container can be in any conventional shape or form as known in the art which is made of a pharmaceutically acceptable material, for example a paper or cardboard box, a glass or plastic bottle or jar, a re-sealable bag (for example, to hold a “refill” of tablets for placement into a different container), or a blister pack with individual doses for pressing out of the pack according to a therapeutic schedule. The container that is employed will depend on the exact dosage form involved, for example a conventional cardboard box would not generally be used to hold a liquid suspension. It is feasible that more than one container can be used together in a single package to market a single dosage form. For example, tablets may be contained in a bottle that is in turn contained within a box. Typically the kit includes directions for the administration of the separate components. The kit form is particularly advantageous when the separate components are preferably administered in different dosage forms (e.g., oral, topical, transdermal and parenteral), are administered at different dosage intervals, or when titration of the individual components of the combination is desired by the prescribing physician.

One particular example of a kit according to the present invention is a so-called blister pack. Blister packs are well known in the packaging industry and are being widely used for the packaging of pharmaceutical unit dosage forms (tablets, capsules, and the like). Blister packs generally consist of a sheet of relatively stiff material covered with a foil of a preferably transparent plastic material. During the packaging process recesses are formed in the plastic foil. The recesses have the size and shape of individual tablets or capsules to be packed or may have the size and shape to accommodate multiple tablets and/or capsules to be packed. Next, the tablets or capsules are placed in the recesses accordingly and the sheet of relatively stiff material is sealed against the plastic foil at the face of the foil which is opposite from the direction in which the recesses were formed. As a result, the tablets or capsules are individually sealed or collectively sealed, as desired, in the recesses between the plastic foil and the sheet. Preferably the strength of the sheet is such that the tablets or capsules can be removed from the blister pack by manually applying pressure on the recesses whereby an opening is formed in the sheet at the place of the recess. The tablet or capsule can then be removed via said opening.

Another specific embodiment of a kit is a dispenser designed to dispense the daily doses one at a time in the order of their intended use. Preferably, the dispenser is equipped with a memory-aid, so as to further facilitate compliance with the regimen. An example of such a memory-aid is a mechanical counter that indicates the number of daily doses that has been dispensed. Another example of such a memory-aid is a battery-powered micro-chip memory coupled with a liquid crystal readout, or audible reminder signal which, for example, reads out the date that the last daily dose has been taken and/or reminds one when the next dose is to be taken.

Preparation of ACC Inhibitors

Synthetic Schemes for Compounds of the Present Invention

Various methods may be developed for synthesizing compounds according to the present invention. The following reaction schemes may be used for the preparation of the compounds according to the present invention. Representative methods for synthesizing these compounds are provided in the Examples. It should be appreciated that a variety of different solvents, temperatures and other reaction conditions can be varied to optimize the yields of the reactions. It should also be appreciated that compounds of the present invention may also be synthesized by other synthetic routes that others may devise.

In the reactions described hereinafter it may be necessary to protect reactive functional groups, for example hydroxy, amino, imino, thio or carboxy groups, where these are desired in the final product, to avoid their unwanted participation in the reactions. Conventional protecting groups may be used in accordance with standard practice, for examples see T. W. Greene and P. G. M. Wuts in “Protective Groups in Organic Chemistry” John Wiley and Sons, 1991.

A general synthetic route for producing compounds of the present invention is shown in Scheme 1. Coupling of a 2-aminobenzo[b]thiophene-3-carboxylic acid to tert-butyl piperazine-1-carboxylate would afford the tertiary amide, which could then be converted to the urea by treatment with the corresponding alkyl isocyanate in the presence of pyridine. Removal of the tert-butyl carbamate protecting group with TFA would afford the ammonium trifluoroacetate, which would subsequently be converted to the desired sulfonamide under standard conditions.

A solution of tert-butyl piperazine-1-carboxylate (1.2 equivalents) and a 2-aminobenzo[b]thiophene-3-carboxylic acid (1.0 equivalent) in DMF (0.2 M) was treated with EDCI (1.5 equivalents) and HOBt (1.1 equivalents) at rt. The reaction mixture was stirred until the reaction was complete as determined by LCMS analysis and then partitioned between ethyl acetate and water. The organics were subsequently washed with 1.0 M H₃PO₄, water, NaHCO₃(sat. aq.), and brine, then dried over Na₂SO₄, filtered, and the volatiles removed under reduced pressure. The residue was purified by SiO₂chromatography (25%-50%-75% ethyl acetate/hexanes gradient) to afford the tert-butyl 4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazine-1-carboxylates (76%).

A solution of a tert-butyl 4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazine-1-carboxylate (1.0 equivalent), the requisite alkyl isocyanate (10 equivalents), and pyridine (0.5 M) was prepared in a sealed tube and warmed to 61° C. for 17 h. The reaction mixture was then cooled to rt, the volatiles removed under reduced pressure, and the residue purified by SiO₂chromatography (25%-30%-40%-75% ethyl acetate/hexanes gradient) to afford the tert-butyl 4-(2-(3-alkylureido)benzo[b]thiophene-3-carbonyl)piperazine-1-carboxylates (63%).

The tert-butyl 4-(2-(3-alkylureido)benzo[b]thiophene-3-carbonyl)piperazine-1-carboxylate (1.0 equivalent) was dissolved in CH₂Cl₂and slowly treated with a 2:1 solution of CH₂Cl₂/TFA (3:1 final ratio, 0.17 M) and stirred at rt until the reaction was complete as determined by LCMS analysis. The volatiles were removed under reduced pressure and the 1-alkyl-3-(3-(piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea TFA salts were used without further purification. ESI-MS: m/z 332.1 (M+H)⁺.

A mixture of the 1-alkyl-3-(3-(piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea TFA salt (1 equivalent) and the corresponding sulfonyl chloride (1-1.2 equivalents) in either CH₂Cl₂or DMF (0.1-0.2 M) was treated with N,N-diisopropylethylamine (4 equivalents) at rt. After the reaction was complete as determined by LCMS analysis, the reaction mixture was diluted with ethyl acetate, washed with 1.0 M H₃PO₄, NaHCO₃(sat. aq.), and brine, dried over Na₂SO₄, filtered, concentrated under reduced pressure, and purified by SiO₂chromatography (ethyl acetate/hexanes gradient or CH₂Cl₂/MeOH gradient) to afford the desired sulfonamide (10-80% yield).

Alternatively, compounds presented in this invention could be synthesized as outlined in Scheme 2 below. The monoprotected piperazine can be sulfonylated and the carbamate function unmasked by the action of trifluoroacetic acid to afford the piperazinesulfonamide as its TFA salt. Amide bond formation can be affected by treatment with the desired carboxylic acid in the presence of EDCI. The resultant amino amide can be converted to the corresponding urea by treatment with an isocyanate under standard conditions.

A solution of tert-butyl piperazine-1-carboxylate (1.0 equivalent) and the corresponding sulfonyl chloride (1.0 equivalent) in ethyl acetate (0.25 M in sulfonyl chloride) was treated with triethylamine (1.1 equivalents) at rt. Once the reaction was complete as determined by TLC or LCMS analysis, the reaction mixture was washed with water, brine, dried over MgSO₄, filtered, and the volatiles removed under reduced pressure. The residue obtained was used without further purification.

A solution of the tert-butyl 4-(arylsulfonyl)piperazine-1-carboxylate (1.00 equivalents) and methylene chloride was treated with a trifluoroacetic acid/methylene chloride solution (10 equivalents TFA; 3:1 CH₂Cl₂/TFA final ratio). Once the deprotection was complete, the volatiles were removed under reduced pressure and the TFA salt of the 1-(arylsulfonyl)piperazine carried on to the next step as is.

A solution of the 1-(arylsulfonyl)piperazine TFA salt (1.00 equivalents), 2-aminobenzo[b]thiophene-3-carboxylic acid (1.00 equivalents), DMF (0.2 M), EDCI (1.50 equivalents), and HOBt (1.05 equivalents) was treated with N,N-diisopropylethylamine (5.00 equivalents) and the reaction mixture stirred until the reaction was complete, as determined by LCMS analysis. The reaction mixture was then partitioned between ethyl acetate and water and the separated organics washed with water, brine, dried over Na₂SO₄, filtered, and concentrated under reduced pressure to afford a pale brown solid. Purification by silica gel chromatography (ethyl acetate/hexanes gradient) afforded the desired (2-aminobenzo[b]thiophen-3-yl)(4-(alkylsulfonyl)piperazin-1-yl)methanone.

A solution of the (2-aminobenzo[b]thiophen-3-yl)(4-(alkylsulfonyl)piperazin-1-yl)methanone (1.0 equivalents) and pyridine (0.05 M) was treated with an alkylisocyanate (10 equivalents) in a sealed tube and the reaction mixture warmed to 60° C. for 18 h. The volatiles were removed under reduced pressure and the residue purified by silica gel chromatography to afford the desired 1-alkyl-3-(3-(4-(alkylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea.

Propionamide-containing sulfonamides can be prepared as outlined in Scheme 3. The protected piperazine can be sulfonylated under standard conditions, the Boc group removed by the action of TFA, and the secondary amine TFA salt coupled with the 2-aminobenzo[b]thiophene-3-carboxylic acid. Hydrolysis of the ester function, followed by coupling with a secondary amine, would furnish the penultimate amide which, upon treatment with an isocyanate in the presence of pyridine, would afford the desired urea.

A solution of the alkyl-3-(chlorosulfonyl)propionate (1.00 equivalent) in ethyl acetate (0.6 M) was treated with tert-butyl piperazine-1-carboxylate (1.25 equivalents) in the presence of N,N-diisopropylethylamine (2.50 equivalents) at rt. After 14 h, the reaction mixture was washed consecutively with water, 1.0 M H₃PO₄(2×), water (2×), NaHCO₃(sat. aq., 2×), water, and brine, dried over Na₂SO₃, filtered, and concentrated under reduced pressure to afford the tert-butyl 4-(3-alkoxy-3-oxopropylsulfonyl)piperazine-1-carboxylate (80%) as a pale yellow solid, which was used without further purification.

A solution of tert-butyl 4-(3-alkoxy-3-oxopropylsulfonyl)piperazine-1-carboxylate (1.0 equivalent) in CH₂Cl₂was treated with a 1:1 solution of CH₂Cl₂/TFA (2:1 final ratio of CH₂Cl₂/TFA, 0.3 M) and the reaction mixture stirred for 2 h. The volatiles were removed under reduced pressure to afford the tert-butyl 4-(3-alkoxy-3-oxopropylsulfonyl)piperazine-1-carboxylate TFA salt, which was carried on without further purification.

A solution of the tert-butyl 4-(3-alkoxy-3-oxopropylsulfonyl)piperazine-1-carboxylate (1.2 equivalents), N,N-diisopropylethylamine (3.6 equivalents), and DMF, was added to a solution of the 2-aminobenzo[b]thiophene-3-carboxylic acid (1.0 equivalent), EDCI (1.20 equivalents), HOBt (1.05 equivalents), and DMF (0.15 M). The reaction mixture was stirred at rt until the reaction was complete as determined by LCMS analysis. The reaction mixture was then partitioned between water and ethyl acetate and the organics washed with 1.0 M H₃PO₄, water, NaHCO₃(sat. aq., 2×), water, and brine, dried over Na₂SO₄, filtered, and concentrated under reduced pressure. Recrystallization from hot ethanol afforded the alkyl 3-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)propionate (55%).

A solution of alkyl 3-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)propionate (1.0 equivalent) in 1:1 EtOH/THF (3.6 mL/mmol) was treated with 2.0 M LiOH (11 equivalents). Once the reaction was complete as determined by LCMS analysis, the reaction mixture was acidified (pH 4-6) with 1.0 M H₃PO₄, extracted with EtOAc, and the combined organic extracts dried over Na₂SO₄, filtered, and concentrated under reduced pressure to afford the 3-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)propionic acid.

The 3-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)propionic acid (1.00 equivalent) was dissolved in DMF (0.14-0.19 M), treated with EDCI (1.2 equiv), stirred at rt for 5 min, treated with HOBt (1.05 equiv), stirred for 10 min, and then treated with the corresponding secondary amine (2.00-3.00 equivalents). Once the reaction was complete as determined by LCMS analysis, the reaction mixture was partitioned between water and EtOAc, the organics washed with 1.0 M H₃PO₄(2×), water, NaHCO₃(sat. aq.), and brine, dried over Na₂SO₄, filtered, and concentrated under reduced pressure. The residue was purified by SiO₂chromatography (CH₂Cl₂/MeOH gradient) to afford the desired 3-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)-N,N-dialkylpropionamide (43-77%).

A solution of the 3-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)-N,N-dialkylpropionamide (1.00 equivalent) and pyridine (0.05 M-0.14 M) was treated with an alkylisocyanate (10.0 equivalents) in a sealed tube and warmed to 62° C. for 12 h. The residue was purified by SiO₂chromatography (CH₂Cl₂/MeOH gradient) to afford the desired 3-(4-(2-(3-alkylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)-N,N-dialkylpropionamide (22%-77%).

For example, the above reaction schemes, and variations thereof, can be used to prepare the following:

Another general synthetic route for producing compounds of the present invention is shown in Scheme 4. Alkylation of a thiophenol with tert-butyl 4-bromopiperidine-1-carboxylate would furnish sulfide 2. Oxidation with one equivalent of an oxidant such as m-CPBA will produce the sulfoxide 3A while 2 equivalents of oxidant will result in formation of the sulfone 3B.

A solution of tert-butyl 4-bromopiperidine-1-carboxylate (1.0 equivalent), the requisite thiophenol (1.2 equivalents), and acetonitrile (0.5 M) was treated with K₂CO₃(1.6 equivalents) and warmed to 50° C. for 24 h. The reaction mixture was cooled to rt and partitioned between brine and ethyl acetate. The organics were then washed with NaHCO₃(sat. aq.), water, 1.0 M H₃PO₄, water, and brine and dried (Na₂SO₄), filtered, and concentrated under reduced pressure to afford the desired tert-butyl 4-(arylthio)piperidine-1-carboxylate 2 as a yellow to brown oil, which was used without further purification.

The tert-butyl 4-(arylthio)piperidine-1-carboxylate (2, 1.0 equivalent) was dissolved in CH₂Cl₂(0.25 M), cooled to 0° C., then treated with M-CPBA (1.1 equivalents [for the sulfoxide] or 2.2 equivalents [for the sulfone]). After the reaction was complete as determined by LCMS analysis, the reaction mixture was diluted with ethyl acetate and washed with NaHCO₃(sat. aq.), water, and brine. The organics were then dried over Na₂SO₄, filtered, and concentrated under reduced pressure to afford either the sulfoxide 3A or the sulfone 3B, each of which was carried on to the next step without further purification.

Either the sulfoxide (3A) or sulfone (3B) could be elaborated to the desired urea end products using the protocol shown in Scheme 5. Removal of the tert-butyl carbamate protecting group with TFA would afford the corresponding secondary amine TFA salt (4A or 4B), which could then be coupled with the 2-aminobenzo[b]thiophene-3-carboxylic acid to afford the desired amide 5A or 5B. Urea formation with an isocyanate could then produce the desired sulfoxide (6A) or sulfone (6B) products.

A solution of either the sulfoxide (3A, 1 equivalent) or sulfone (3B, 1 equivalent) in CH₂Cl₂was treated with a 1:1 solution of TFA/CH₂Cl₂(1:2 final ratio of TFA/CH₂Cl₂, 0.10-0.20 M). After the reaction was complete as determined by LCMS analysis, the volatiles were removed under reduced pressure to afford either the tert-butyl 4-(arylsulfinyl)piperidine-1-carboxylate TFA salt (4A) or the tert-butyl 4-(arylsulfonyl)piperidine-1-carboxylate TFA salt (4B), which were used without further purification.

A solution of the sulfone TFA salt 4B (1.00 equivalent), the 2-aminobenzo[b]thiophene-3-carboxylic acid (1.00 equivalent), EDCI (1.60 equivalents), HOBt (1.20 equivalents), N,N-diisopropylethylamine (4.00 equivalents), and DMF (0.20 M) was stirred at rt until the reaction was complete as determined by LCMS analysis. The reaction mixture was then partitioned between ethyl acetate and water and the organics washed with NaHCO₃(sat. aq.), water, and brine and then dried (Na₂SO₄), filtered, and concentrated under reduced pressure to afford a residue, which was purified by silica gel chromatography (ethyl acetate/hexanes gradient) to provide the (2-aminobenzo[b]thiophen-3-yl)(4-(arylsulfonyl)piperidin-1-yl)methanone 5B.

A solution of the (2-aminobenzo[b]thiophen-3-yl)(4-(arylsulfonyl)piperidin-1-yl)methanone (5B, 1.00 equivalent), pyridine (0.13 M), and the corresponding alkyl isocyanate (3.00 equivalents) was placed in a sealed tube and warmed to 62° C. for 18 h. The reaction mixture was then cooled to rt and the volatiles removed under reduced pressure. The residue was purified by silica gel chromatography (ethyl acetate/hexanes gradient) to afford the 1-ethyl-3-(3-(4-(arylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea 6B.

Compounds presented in this invention could also be prepared as outlined in the general synthetic scheme presented below (Scheme 6). Alkylation of an appropriate thiophenol with tert-butyl 4-bromopiperidine-1-carboxylate could provide the corresponding sulfide, which could then be deprotected with TFA. The resultant amino function could be coupled with a 2-aminobenzo[b]thiophene-3-carboxylic acid to provide the corresponding amide. Urea formation would furnish the fully elaborated sulfide, which could then be oxidized to provide the desired sulfoxide or sulfone.

A solution of a thiophenol (0.9-1.1 equivalents), tert-butyl 4-bromopiperidine-1-carboxylate, and acetonitrile (0.5 M) was treated with K₂CO₃and the reaction mixture warmed to 50-55° C. for 12-24 h. The reaction mixture was cooled to rt, partitioned between water and ethyl acetate, and the organics washed with brine, dried over sodium sulfate, filtered, and concentrated under reduced pressure to afford the crude tert-butyl 4-(arylthio)piperidine-1-carboxylate, which was used without further purification.

A solution of the tert-butyl 4-(arylthio)piperidine-1-carboxylate (1.0 equiv) and methylene chloride (½ of total volume used) was treated with a solution of 1:1 TFA/methylene chloride (such that final ration of TFA/methylene chloride was 1:2 and TFA equivalents are >10). The reaction mixture was stirred at rt until the reaction was complete, as determined by LCMS analysis. The volatiles were then removed under reduced pressure, the residue dissolved in ethyl acetate and washed with NaHCO₃(sat. aq., 2×), water, and brine, and the organic solution dried over Na₂SO₄, filtered, and concentrated under reduced pressure to afford the desired 4-(arylthio)piperidine, which was used in the next step as is.

A solution of the 2-aminobenzo[b]thiophene-3-carboxylic acid (1.0 equivalent) and acetonitrile was treated with EDCI (1.2 equivalents) and acetonitrile, stirred for 5 min, treated with HOBt (1.2 equivalents), stirred for 5 min, then treated with a solution of the 4-(arylthio)piperidine (1.2 equivalents) and acetonitrile (0.5 M final concentration). The reaction progress was monitored by LCMS analysis and, once the reaction was complete, the reaction mixture was partitioned between ethyl acetate and water. The organics were separated and washed with NaHCO₃(sat. aq.), water, and brine then dried (Na₂SO₄), filtered, and concentrated under reduced pressure. The residue was purified by silica gel chromatography (25%-50%-75%-100% ethyl acetate/hexanes gradient) to afford the (2-aminobenzo[b]thiophen-3-yl)(4-(arylylthio)piperidin-1-yl)methanone as an off white to pale brown solid.

A solution of the (2-aminobenzo[b]thiophen-3-yl)(4-(arylylthio)piperidin-1-yl)methanone (1.00 equivalents) and pyridine (0.25M) was treated with an alkyl isocyanate (4.00 equivalents) and the reaction mixture warmed to 60° C. for 16 h then cooled to rt. The volatiles were removed under reduced pressure and the residue was purified by silica gel chromatography (0%-25%-50% ethyl acetate/hexanes gradient) to afford the 1-alkyl-3-(3-(4-(arylthio)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea as a pale brown solid.

A solution of the 1-alkyl-3-(3-(4-(arylthio)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea (1.00 equivalent) in methylene chloride (0.10 M) was cooled to −5° C. and treated with m-CPBA (1.00-1.10 equivalents). The reaction mixture was allowed to warm to rt slowly over 1 h, after which TLC analysis indicated the reaction was complete. The reaction was quenched by the addition of NaHCO₃(sat. aq.). The organics were subsequently washed with NaHCO₃(sat. aq.), water, and brine, dried over Na₂SO₄, filtered, and concentrated under reduced pressure and the residue purified by silica gel chromatography (50%-75%-100% ethyl acetate hexanes gradient) to afford the desired 1-alkyl-3-(3-(4-(arylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea.

The 1-alkyl-3-(3-(4-(arylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea compounds were prepared from the corresponding 1-alkyl-3-(3-(4-(arylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)ureas following the procedure given above for preparation of the latter or from the 1-alkyl-3-(3-(4-(arylthio)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)ureas following the procedure given in Scheme 4 using 2.20 equivalents of m-CPBA.

For example, the above reaction schemes, and variations thereof, can be used to prepare the following:

In each of the above reaction procedures or schemes, the various substituents may be selected from among the various substituents otherwise taught herein.

General Procedures

It will be readily recognized that certain compounds according to the present invention have atoms with linkages to other atoms that confer a particular stereochemistry to the compound (e.g., chiral centers). It is recognized that synthesis of compounds according to the present invention may result in the creation of mixtures of different stereoisomers (i.e., enantiomers and diastereomers). Unless a particular stereochemistry is specified, recitation of a compound is intended to encompass all of the different possible stereoisomers.

Compounds according to the present invention can be prepared as their individual stereoisomers by reacting a racemic mixture of the compound with an optically active resolving agent to form a pair of diastereoisomeric compounds, separating the diastereomers and recovering the optically pure enantiomer. While resolution of enantiomers can be carried out using covalent diastereomeric derivatives of compounds, dissociable complexes are preferred (e.g., crystalline diastereoisomeric salts).

Compounds according to the present invention can also be prepared as a pharmaceutically acceptable acid addition salt by reacting the free base form of the compound with a pharmaceutically acceptable inorganic or organic acid. Alternatively, a pharmaceutically acceptable base addition salt of a compound can be prepared by reacting the free acid form of the compound with a pharmaceutically acceptable inorganic or organic base. Inorganic and organic acids and bases suitable for the preparation of the pharmaceutically acceptable salts of compounds are set forth in the definitions section of this Application. Alternatively, the salt forms of the compounds can be prepared using salts of the starting materials or intermediates.

The free acid or free base forms of the compounds can be prepared from the corresponding base addition salt or acid addition salt form. For example, a compound in an acid addition salt form can be converted to the corresponding free base by treating with a suitable base (e.g., ammonium hydroxide solution, sodium hydroxide, and the like). A compound in a base addition salt form can be converted to the corresponding free acid by treating with a suitable acid (e.g., hydrochloric acid, etc).

The N-oxides of compounds according to the present invention can be prepared by methods known to those of ordinary skill in the art. For example, N-oxides can be prepared by treating an unoxidized form of the compound with an oxidizing agent (e.g., trifluoroperacetic acid, permaleic acid, perbenzoic acid, peracetic acid, meta-chloroperoxybenzoic acid, or the like) in a suitable inert organic solvent (e.g., a halogenated hydrocarbon such as dichloromethane) at approximately 0° C. Alternatively, the N-oxides of the compounds can be prepared from the N-oxide of an appropriate starting material.

Compounds in an unoxidized form can be prepared from N-oxides of compounds by treating with a reducing agent (e.g., sulfur, sulfur dioxide, triphenyl phosphine, lithium borohydride, sodium borohydride, phosphorus trichloride, tribromide, or the like) in an suitable inert organic solvent (e.g., acetonitrile, ethanol, aqueous dioxane, or the like) at 0 to 80° C.

Prodrug derivatives of the compounds can be prepared by methods known to those of ordinary skill in the art (e.g., for further details see Saulnier et al. (1994), Bioorganic and Medicinal Chemistry Letters, Vol. 4, p. 1985). For example, appropriate prodrugs can be prepared by reacting a non-derivatized compound with a suitable carbamylating agent (e.g., 1,1-acyloxyalkylcarbonochloridate, para-nitrophenyl carbonate, or the like).

Protected derivatives of the compounds can be made by methods known to those of ordinary skill in the art. A detailed description of the techniques applicable to the creation of protecting groups and their removal can be found in P. G. M. Wuts and T. W. Greene, “Greene's Protecting Groups in Organic Synthesis”, 4th edition, John Wiley & Sons, Inc. 2007.

Compounds according to the present invention may be conveniently prepared, or formed during the process of the invention, as solvates (e.g., hydrates). Hydrates of compounds of the present invention may be conveniently prepared by recrystallization from an aqueous/organic solvent mixture, using organic solvents such as dioxin, tetrahydrofuran or methanol.

As used herein the symbols and conventions used in these processes, schemes and examples are consistent with those used in the contemporary scientific literature, for example, the Journal of the American Chemical Society or the Journal of Biological Chemistry. Standard single-letter or three-letter abbreviations are generally used to designate amino acid residues, which are assumed to be in the L-configuration unless otherwise noted. Unless otherwise noted, all starting materials were obtained from commercial suppliers and used without further purification. Specifically, the following abbreviations may be used in the examples and throughout the specification:

μL (microliters)
Ac (acetyl)

atm (atmosphere)
ATP (Adenosine Triphophatase)

BOC (tert-butyloxycarbonyl)
BOP (bis(2-oxo-3-oxazolidinyl)phosphinic chloride)

BSA (Bovine Serum Albumin)
CBZ (benzyloxycarbonyl)

CDI (1,1-carbonyldiimidazole)
DCC (dicyclohexylcarbodiimide)

DCE (dichloroethane)
DCM (dichloromethane)

DMAP (4-dimethylaminopyridine)
DME (1,2-dimethoxyethane)

DMF (N,N-dimethylformamide)
DMPU (N,N′-dimethylpropyleneurea)

DMSO (dimethylsulfoxide)
EDCI (ethylcarbodiimide hydrochloride)

EDTA (Ethylenediaminetetraacetic acid)
Et (ethyl)

Et₂O (diethyl ether)
EtOAc (ethyl acetate)

FMOC (9-fluorenylmethoxycarbonyl)
g (grams)

hr (hour)
HOAc or AcOH (acetic acid)

HOBT (1-hydroxybenzotriazole)
HOSu (N-hydroxysuccinimide)

HPLC (high pressure liquid chromatography)
Hz (Hertz)

i.v. (intravenous)
IBCF (isobutyl chloroformate)

i-PrOH (isopropanol)
L (liters)

M (molar)
mCPBA (meta-chloroperbenzoic acid)

Me (methyl)
MeOH (methanol)

mg (milligrams)
MHz (megahertz)

min (minutes)
mL (milliliters)

mM (millimolar)
mmol (millimoles)

mol (moles)
MOPS (Morpholinepropanesulfonic acid)

mp (melting point)
NaOAc (sodium acetate)

OMe (methoxy)
psi (pounds per square inch)

RP (reverse phase)
RT (ambient temperature)

SPA (Scintillation Proximity Assay)
TBAF (tetra-n-butylammonium fluoride)

TBS (t-butyldimethylsilyl)
tBu (tert-butyl)

TEA (triethylamine)
TFA (trifluoroacetic acid)

TFAA (trifluoroacetic anhydride)
THF (tetrahydrofuran)

TIPS (triisopropylsilyl)
TLC (thin layer chromatography)

TMS (trimethylsilyl)
TMSE (2-(trimethylsilyl)ethyl)

Tr (retention time)
Brij35 (polyoxyethyleneglycol dodecyl ether)

All references to ether or Et₂O are to diethyl ether; and brine refers to a saturated aqueous solution of NaCl. Unless otherwise indicated, all temperatures are expressed in ° C. (degrees Centigrade). All reactions are conducted under an inert atmosphere at RT unless otherwise noted.

¹H NMR spectra were recorded on a Bruker Avance 400. Chemical shifts are expressed in parts per million (ppm). Coupling constants are in units of Hertz (Hz). Splitting patterns describe apparent multiplicities and are designated as s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br (broad).

Low-resolution mass spectra (MS) and compound purity data were acquired on a Waters ZQ LC/MS single quadrupole system equipped with electrospray ionization (ESI) source, UV detector (220 and 254 nm), and evaporative light scattering detector (ELSD). Thin-layer chromatography was performed on 0.25 mm E. Merck silica gel plates (60F-254), visualized with UV light, 5% ethanolic phosphomolybdic acid, Ninhydrin orp-anisaldehyde solution. Flash column chromatography was performed on silica gel (230-400 mesh, Merck).

The starting materials and reagents used in preparing these compounds are either available from commercial suppliers such as the Aldrich Chemical Company (Milwaukee, Wis.), Bachem (Torrance, Calif.), Sigma (St. Louis, Mo.), or may be prepared by methods well known to a person of ordinary skill in the art, following procedures described in such standard references as Fieser and Fieser's Reagents for Organic Synthesis, vols. 1-23, John Wiley and Sons, New York, N.Y., 2006; Rodd's Chemistry of Carbon Compounds, vols. 1-5 and supps., Elsevier Science Publishers, 1998; Organic Reactions, vols. 1-68, John Wiley and Sons, New York, N.Y., 2007; March J.: Advanced Organic Chemistry, 5th ed., 2001, John Wiley and Sons, New York, N.Y.; and Larock: Comprehensive Organic Transformations, 2nd edition, John Wile and Sons, New York, 1999. The entire disclosures of all documents cited throughout this application are incorporated herein by reference.

Various methods for separating mixtures of different stereoisomers are known in the art. For example, a racemic mixture of a compound may be reacted with an optically active resolving agent to form a pair of diastereoisomeric compounds. The diastereomers may then be separated in order to recover the optically pure enantiomers. Dissociable complexes may also be used to resolve enantiomers (e.g., crystalline diastereoisomeric salts). Diastereomers typically have sufficiently distinct physical properties (e.g., melting points, boiling points, solubilities, reactivity, etc.) and can be readily separated by taking advantage of these dissimilarities. For example, diastereomers can typically be separated by chromatography or by separation/resolution techniques based upon differences in solubility. A more detailed description of techniques that can be used to resolve stereoisomers of compounds from their racemic mixture can be found in Jean Jacques, Andre Collet, and Samuel H. Wilen, Enantiomers, Racemates and Resolutions, John Wiley & Sons, Inc. (1981).

Diastereomers have distinct physical properties (e.g., melting points, boiling points, solubilities, reactivity, etc.) and can be readily separated by taking advantage of these dissimilarities. The diastereomers can be separated by chromatography or, preferably, by separation/resolution techniques based upon differences in solubility. The optically pure enantiomer is then recovered, along with the resolving agent, by any practical means that would not result in racemization. A more detailed description of the techniques applicable to the resolution of stereoisomers of compounds from their racemic mixture can be found in Jean Jacques, Andre Collet, and Samuel H. Wilen, Enantiomers, Racemates and Resolutions, John Wiley & Sons, Inc. (1981).

Chiral components can be separated and purified using any of a variety of techniques known to those skilled in the art. For example, chiral components can be purified using supercritical fluid chromatography (SFC). In one particular variation, chiral analytical SFC/MS analyses are conducted using a Berger analytical SFC system (AutoChem, Newark, Del.) which consists of a Berger SFC dual pump fluid control module with a Berger FCM 1100/1200 supercritical fluid pump and FCM 1200 modifier fluid pump, a Berger TCM 2000 oven, and an Alcott 718 autosampler. The integrated system can be controlled by BI-SFC Chemstation software version 3.4. Detection can be accomplished with a Waters ZQ 2000 detector operated in positive mode with an ESI interface and a scan range from 200-800 Da with 0.5 second per scan. Chromatographic separations can be performed on a ChiralPak AD-H, ChiralPak AS-H, ChiralCel OD-H, or ChiralCel OJ-H column (5μ, 4.6×250 mm; Chiral Technologies, Inc. West Chester, Pa.) with 10 to 40% methanol as the modifier and with or without ammonium acetate (10 mM). Any of a variety of flow rates can be utilized including, for example, 1.5 or 3.5 mL/min with an inlet pressure set at 100 bar. Additionally, a variety of sample injection conditions can be used including, for example, sample injections of either 5 or 10 μL in methanol at 0.1 mg/mL in concentration.

In another variation, preparative chiral separations are performed using a Berger MultiGram TI SFC purification system. For example, samples can be loaded onto a ChiralPak AD column (21×250 mm, 10μ). In particular variations, the flow rate for separation can be 70 mL/min, the injection volume up to 2 mL, and the inlet pressure set at 130 bar. Stacked injections can be applied to increase the efficiency.

Descriptions of the syntheses of particular compounds according to the present invention based on the above reaction schemes and variations thereof are set forth in the Example section.

Assaying the Biological Activity of the Compounds of the Invention

The inhibitory effect of the compound of the invention on ACC may be evaluated by a variety of in vitro and in vivo binding assays and functional assays, e.g., Harwood H J Jr. et al. J Biol. Chem. 2003 278(39):37099-111; Liu Y. et al. Assay Drug Dev Technol. 2007 5(2):225-35; and Seethala R. et al. Anal Biochem. 2006 358(2):257-65.

Provided in Example A is an in vitro enzymatic ACC activity assay for activity against ACC. The binding affinity of the test compound to ACC1 or ACC2 is determined by the changes in absorbance (at 620 nm); the absorbance is proportional to the fraction of bound inhibitor. It should be noted that a variety of other expression systems and hosts are also suitable for the expression of ACC, as would be readily appreciated by one of skill in the art.

Using the procedure described in Example A, some of the exemplified compounds were shown to have ACC inhibitory activity at an IC₅₀of less than 10 μM, some others less than about 1 μM. The IC₅₀values of the exemplified compounds of the present invention are given in Table 1.

EXAMPLE

The present invention is further exemplified, but not limited by, the following examples that describe the synthesis of particular compounds according to the invention. It will be readily recognized that certain compounds according to the present invention have atoms with linkages to other atoms that confer a particular stereochemistry to the compound (e.g., chiral centers). It is recognized that synthesis of compounds according to the present invention may result in the creation of mixtures of different stereoisomers (i.e., enantiomers and diastereomers). Unless a particular stereochemistry is specified, recitation of a compound is intended to encompass all of the different possible stereoisomers.

Example 1
2-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzonitrile

The title compound was prepared as described in Scheme 2. ¹H NMR (400 MHz, chloroform-d) δ ppm 3.12 (ddd, J=12.00, 8.59, 2.91 Hz, 2H), 3.48 (td, J=8.53, 3.41 Hz, 2H), 3.54-3.64 (m, 2H), 3.74-3.84 (m, 2H), 5.44 (s, 2H), 7.10 (ddd, J=8.02, 6.38, 2.02 Hz, 1H), 7.21-7.31 (m, 2H), 7.51 (d, J=7.83 Hz, 1H), 7.74 (dq, J=13.45, 6.80 Hz, 2H), 7.89 (dd, J=7.45, 1.39 Hz, 1H), 8.04 (dd, J=7.83, 1.26 Hz, 1H); ESI-MS: m/z 426.1 (M+H)⁺.

Example 2
1-(3-(4-(2-cyanophenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea

The title compound was prepared as described in Scheme 2. ¹H NMR (400 MHz, chloroform-d) δ ppm 1.18 (t, J=6.69 Hz, 3H), 3.10-3.22 (m, 2H), 3.26-3.36 (m, 2H), 3.45-3.56 (m, 2H), 3.61-3.70 (m, 2H), 3.71-3.82 (m, 2H), 5.60 (d, J=5.31 Hz, 1H), 7.17-7.26 (m, 1H), 7.30-7.39 (m, 2H), 7.67-7.84 (m, 3H), 7.87-7.96 (m, 1H), 8.05-8.13 (m, 1H), 9.36 (br. s., 1H); ESI-MS: m/z 497.1 (M+H)⁺.

Example 3
ethyl-3-(3-(4-(phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, chloroform-d) δ ppm 0.90 (t, J=7.07 Hz, 3H), 2.83-2.99 (m, 2H), 3.09 (dq, J=7.07, 5.56 Hz, 2H), 3.17-3.27 (m, 2H), 3.56-3.67 (m, 2H), 3.67-3.80 (m, 2H), 5.49 (br. s., 1H), 7.20 (td, J=5.31, 3.03 Hz, 1H), 7.25-7.30 (m, 2H), 7.54-7.62 (m, 2H), 7.62-7.73 (m, 2H), 7.74-7.80 (m, 2H), 9.27 (br. s., 1H); ESI-MS: m/z 472.1 (M+H)⁺.

Example 4
1-(3-(4-(benzo[d][1,3]dioxol-5-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, chloroform-d) δ ppm 1.00 (t, J=7.20 Hz, 3H), 2.90 (t, J=8.08 Hz, 2H), 3.13-3.23 (m, 2H), 3.27 (dd, J=11.62, 4.80 Hz, 2H), 3.59-3.68 (m, 2H), 3.71-3.84 (m, 2H), 5.40 (br. s., 1H), 6.13 (s, 2H), 6.96 (d, J=8.34 Hz, 1H), 7.19 (d, J=1.77 Hz, 1H), 7.23 (ddd, J=8.02, 4.29, 4.11 Hz, 1H), 7.30-7.38 (m, 3H), 7.73 (d, J=7.83 Hz, 1H), 9.36 (br. s., 1H); ESI-MS: m/z 516.1 (M+H)⁺.

Example 5
ethyl-3-(3-(4-(3-(methylsulfonyl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d6) δ ppm 1.04 (t, J=7.20 Hz, 3H), 2.91 (br. s., 2H), 3.05-3.15 (m, 2H), 3.16-3.24 (m, 2H), 3.35 (s, 3H), 3.40-3.81 (m, 4H), 6.90 (t, J=5.56 Hz, 1H), 7.14-7.19 (m, 1H), 7.25 (td, J=7.52, 1.14 Hz, 1H), 7.30-7.36 (m, 1H), 7.78 (d, J=7.33 Hz, 1H), 7.97 (t, J=7.96 Hz, 1H), 8.08-8.12 (m, 1H), 8.17 (t, J=1.64 Hz, 1H), 8.32 (ddd, J=8.21, 1.39, 1.01 Hz, 1H), 9.19 (s, 1H); ESI-MS: m/z 550.1 (M+H)⁺.

Example 6
1-(3-(4-(benzo[c][1,2,5]thiadiazol-5-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 0.97 (t, J=7.20 Hz, 3H), 2.86-3.00 (m, 2H), 3.00-3.09 (m, 2H), 3.40-3.91 (m, 6H), 6.74 (t, J=5.43 Hz, 1H), 7.12-7.18 (m, 1H), 7.21 (td, J=7.45, 1.26 Hz, 1H), 7.32 (d, J=7.33 Hz, 1H), 7.77 (d, J=7.33 Hz, 1H), 7.96 (dd, J=9.09, 1.77 Hz, 1H), 8.36 (d, J=8.59 Hz, 1H), 8.55 (d, J=1.01 Hz, 1H), 9.06 (s, 1H); ESI-MS: m/z 530.1 (M+H)⁺.

Example 7
ethyl-3-(3-(4-(3-methoxyphenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.05 (t, J=7.20 Hz, 3H), 2.84 (br. s., 2H), 3.05-3.20 (m, 4H), 3.52 (br. s., 2H), 3.58-3.74 (m, 2H), 3.84 (s, 3H), 6.91 (t, J=5.43 Hz, 1H), 7.12-7.20 (m, 2H), 7.25 (td, J=7.45, 1.26 Hz, 1H), 7.28-7.35 (m, 3H), 7.58 (d, J=8.08 Hz, 1H), 7.78 (d, J=7.33 Hz, 1H), 9.20 (s, 1H); ESI-MS: m/z 502.1 (M+H)⁺.

Example 8
N-(3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)phenyl)acetamide

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.04 (t, J=7.20 Hz, 3H), 2.07 (s, 3H), 2.82 (br. s., 2H), 3.05-3.16 (m, 4H), 3.40-3.59 (m, 2H), 3.79 (br. s., 2H), 6.88 (t, J=5.43 Hz, 1H), 7.17 (t, J=6.82 Hz, 1H), 7.24 (td, J=7.52, 1.14 Hz, 1H), 7.28-7.32 (m, 1H), 7.37 (d, J=8.59 Hz, 1H), 7.58 (t, J=7.96 Hz, 1H), 7.78 (d, J=7.83 Hz, 1H), 7.86-7.92 (m, 1H), 8.03 (t, J=1.89 Hz, 1H), 9.20 (s, 1H), 10.34 (s, 1H); ESI-MS: m/z 529.2 (M+H)⁺.

Example 9
2-chloro-5-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)benzenesulfonamide

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.05 (t, J=7.20 Hz, 3H), 2.90 (br. s., 2H), 3.12 (ddd, J=7.26, 5.37, 3.03 Hz, 2H), 3.17-3.26 (m, 2H), 3.40-3.59 (m, 2H), 3.59-3.88 (m, 2H), 6.86-6.92 (m, 1H), 7.14-7.21 (m, 1H), 7.26 (td, J=7.58, 1.26 Hz, 1H), 7.35 (d, J=7.83 Hz, 1H), 7.78 (d, J=7.58 Hz, 1H), 7.92-7.96 (m, 4H), 8.22 (t, J=1.26 Hz, 1H), 9.20 (s, 1H); ESI-MS: m/z 585.1 (M+H)⁺.

Example 10
ethyl-3-(3-(4-(3-(2-methylthiazol-4-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 0.99 (t, J=7.20 Hz, 3H), 2.74 (s, 3H), 2.76-2.97 (m, 2H), 3.05 (dd, J=7.20, 5.68 Hz, 2H), 3.14-3.27 (m, 2H), 3.51 (br. s., 2H), 3.66 (q, J=7.07 Hz, 2H), 6.81 (t, J=5.31 Hz, 1H), 7.16 (td, J=7.83, 1.26 Hz, 1H), 7.21 (td, J=7.52, 1.14 Hz, 1H), 7.27-7.32 (m, 1H), 7.66-7.70 (m, 1H), 7.73 (t, J=7.71 Hz, 1H), 7.77 (d, J=7.83 Hz, 1H), 8.21 (s, 1H), 8.25-8.27 (m, 1H), 8.30 (ddd, J=7.71, 1.52, 1.39 Hz, 1H), 9.16 (s, 1H); ESI-MS: m/z 569.1 (M+H)⁺.

Example 11
ethyl-3-(3-(4-(3-(5-methyl-1,3,4-oxadiazol-2-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.01 (t, J=7.20 Hz, 3H), 2.62 (s, 3H), 2.88 (br. s., 2H), 2.99-3.12 (m, 2H), 3.20 (br. s, 2H), 3.38-3.57 (m, 2H), 3.57-3.87 (m, 2H), 6.84 (t, J=5.31 Hz, 1H), 7.12-7.19 (m, 1H), 7.23 (td, J=7.45, 1.26 Hz, 1H), 7.28-7.34 (m, 1H), 7.77 (d, J=7.33 Hz, 1H), 7.90 (t, J=7.58 Hz, 1H), 7.94-8.01 (m, 1H), 8.19 (t, J=1.52 Hz, 1H), 8.34 (dt, J=7.77, 1.42 Hz, 1H), 9.13 (s, 1H); ESI-MS: m/z 554.1 (M+H)⁺.

Example 12
ethyl-3-(3-(4-(3-(2-methylpyrimidin-4-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 0.99 (t, J=7.20 Hz, 3H), 2.72 (s, 3H), 2.87 (br. s., 2H), 2.97-3.13 (m, 2H), 3.20 (br. s., 2H), 3.40-3.57 (m, 2H), 3.56-3.90 (m, 2H), 6.81 (t, J=5.43 Hz, 1H), 7.16 (td, J=7.83, 1.26 Hz, 1H), 7.21 (td, J=7.45, 1.26 Hz, 1H), 7.26-7.33 (m, 1H), 7.77 (d, J=7.83 Hz, 1H), 7.85 (t, J=7.96 Hz, 1H), 7.89-7.94 (m, 1H), 8.04 (d, J=4.80 Hz, 1H), 8.48 (t, J=1.64 Hz, 1H), 8.55 (dt, J=7.83, 1.52 Hz, 1H), 8.84 (d, J=5.31 Hz, 1H), 9.14 (s, 1H); ESI-MS: m/z 564.2 (M+H)⁺.

Example 13
ethyl-3-(3-(4-(3-(5-methyl-1,2,4-oxadiazol-3-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.00 (t, J=7.20 Hz, 3H), 2.71 (s, 3H), 2.75-2.94 (m, 2H), 2.97-3.12 (m, 2H), 3.18 (br. s., 2H), 3.39-3.57 (m, 2H), 3.75 (br. s., 2H), 6.80 (t, J=5.56 Hz, 1H), 7.17 (td, J=7.83, 1.26 Hz, 1H), 7.22 (td, J=7.58, 1.26 Hz, 1H), 7.28-7.33 (m, 1H), 7.77 (d, J=7.83 Hz, 1H), 7.88 (t, J=7.83 Hz, 1H), 7.93-7.98 (m, 1H), 8.24 (t, J=1.52 Hz, 1H), 8.36 (dt, J=7.58, 1.39 Hz, 1H), 9.13 (s, 1H); ESI-MS: m/z 554.1 (M+H)⁺.

Example 14
ethyl-3-(3-(4-(6-morpholinopyridin-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.05 (t, J=7.20 Hz, 3H), 2.80 (br. s., 2H), 3.05-3.18 (m, 5H), 3.51 (br. s., 2H), 3.61-3.67 (m, 5H), 3.67-3.74 (m, 4H), 6.92-6.98 (m, 1H), 7.18 (t, J=6.95 Hz, 1H), 7.26 (td, J=7.52, 1.14 Hz, 1H), 7.32-7.37 (m, 1H), 7.71-7.83 (m, 2H), 8.19-8.28 (m, 1H), 8.38 (d, J=2.53 Hz, 1H), 9.22 (s, 1H); ESI-MS: m/z 558.2 (M+H)⁺.

Example 15
ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfonyl) piperazine-1-carbonyl)benzo[f]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.05 (t, J=7.20 Hz, 3H), 2.89 (br. s., 2H), 3.02-3.26 (m, 4H), 3.41-3.74 (m, 4H), 6.91 (t, J=5.43 Hz, 1H), 7.18 (td, J=7.83, 1.26 Hz, 1H), 7.24 (td, J=7.45, 1.26 Hz, 1H), 7.29-7.34 (m, 1H), 7.69 (s, 1H), 7.74-7.88 (m, 4H), 9.18 (s, 1H); ESI-MS: m/z 556.1 (M+H)⁺.

Example 16
ethyl-3-(3-(4-(3-nitrophenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.04 (t, J=7.20 Hz, 3H), 2.89 (br. s., 2H), 3.04-3.14 (m, 2H), 3.22 (br. s., 2H), 3.41-4.05 (m, 4H), 6.87 (t, J=5.43 Hz, 1H), 7.17 (td, J=6.95, 1.26 Hz, 1H), 7.24 (td, J=7.58, 1.26 Hz, 1H), 7.30-7.36 (m, 1H), 7.78 (d, J=7.33 Hz, 1H), 7.97 (t, J=8.08 Hz, 1H), 8.19 (ddd, J=8.21, 1.39, 1.01 Hz, 1H), 8.39 (t, J=1.89 Hz, 1H), 8.59 (dd, J=7.71, 1.89 Hz, 1H), 9.11 (s, 1H); ESI-MS: m/z 517.1 (M+H)⁺.

Example 17
ethyl-3-(3-(4-(1,1-dioxotetrahydrothiophen-3-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.08 (t, J=7.20 Hz, 3H), 2.14-2.32 (m, 1H), 3.06-3.21 (m, 4H), 3.22-3.40 (m, 7H), 3.41-3.56 (m, 2H), 3.56-3.65 (m, 1H), 3.69 (dd, J=13.52, 8.97 Hz, 1H), 4.23-4.33 (m, 1H), 7.15-7.23 (m, 2H), 7.33 (t, J=7.07 Hz, 1H), 7.49 (d, J=7.83 Hz, 1H), 7.81 (d, J=8.08 Hz, 1H), 9.31 (s, 1H); ESI-MS: m/z 514.1 (M+H)⁺.

Example 18
1-(3-(4-(3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.06 (t, J=7.20 Hz, 3H), 2.10-2.24 (m, 2H), 2.79 (br. s., 2H), 2.99-3.23 (m, 4H), 3.50 (br. s., 2H), 3.75 (br. s., 2H), 4.24 (t, J=5.68 Hz, 2H), 4.28 (t, J=5.56 Hz, 2H), 6.94 (t, J=5.43 Hz, 1H), 7.13-7.20 (m, 2H), 7.24 (d, J=2.27 Hz, 1H), 7.25-7.35 (m, 3H), 7.78 (d, J=7.83 Hz, 1H), 9.20 (s, 1H); ESI-MS: m/z 544.2 (M+H)⁺.

Example 19
N-(5-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)-2-methoxyphenyl)acetamide

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.04 (t, J=7.20 Hz, 3H), 2.13 (s, 3H), 2.82 (br. s., 2H), 3.04 (br. s., 2H), 3.06-3.15 (m, 2H), 3.54 (br. s., 4H), 3.95 (s, 3H), 6.97 (t, J=5.43 Hz, 1H), 7.17 (td, J=7.96, 1.39 Hz, 1H), 7.20-7.33 (m, 3H), 7.43 (dd, J=8.72, 2.40 Hz, 1H), 7.78 (d, J=7.83 Hz, 1H), 8.44 (d, J=2.02 Hz, 1H), 9.21 (s, 1H), 9.49 (s, 1H); ESI-MS: m/z 559.2 (M+H)⁺.

Example 20
1-(3-(4-(3-acetylphenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.03 (t, J=7.20 Hz, 3H), 2.67 (s, 3H), 2.84 (br. s., 2H), 3.04-3.14 (m, 2H), 3.15 (br. s., 2H), 3.53 (br. s., 2H), 3.70 (br. s., 2H), 6.89 (t, J=5.43 Hz, 1H), 7.17 (td, J=7.83, 1.26 Hz, 1H), 7.23 (td, J=7.58, 1.26 Hz, 1H), 7.28-7.34 (m, 1H), 7.78 (d, J=7.83 Hz, 1H), 7.83 (t, J=7.71 Hz, 1H), 7.99 (dd, J=7.33, 2.53 Hz, 1H), 8.16 (t, J=1.64 Hz, 1H), 8.32 (ddd, J=7.96, 1.39, 1.26 Hz, 1H), 9.16 (s, 1H); ESI-MS: m/z 514.1 (M+H)⁺.

Example 21
1-(3-(4-(benzo[d]thiazol-6-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 0.97 (t, J=7.20 Hz, 3H), 2.84 (br. s., 2H), 2.98-3.09 (m, 2H), 3.20 (br. s., 2H), 3.50 (br. s., 2H), 3.68 (br. s., 2H), 6.73 (t, J=5.43 Hz, 1H), 7.09-7.24 (m, J=18.76, 7.39, 7.20, 1.26 Hz, 2H), 7.28 (d, J=7.58 Hz, 1H), 7.77 (d, J=7.58 Hz, 1H), 7.85 (dd, J=8.59, 1.77 Hz, 1H), 8.32 (d, J=8.59 Hz, 1H), 8.73 (d, J=1.52 Hz, 1H), 9.10 (s, 1H), 9.68 (s, 1H); ESI-MS: m/z 529.1 (M+H)⁺.

Example 22
ethyl-3-(3-(4-(4-(2-oxopyrrolidin-1-yl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.03 (t, J=7.20 Hz, 3H), 1.99-2.17 (quintet, J=7.52 Hz, 2H), 2.56 (t, J=8.08 Hz, 2H), 2.81 (br. s., 2H), 3.10 (dd, J=7.07, 5.56 Hz, 4H), 3.52 (br. s., 2H), 3.67 (br. s., 2H), 3.89 (t, J=6.95 Hz, 2H), 6.94 (t, J=5.31 Hz, 1H), 7.17 (t, J=7.45 Hz, 1H), 7.25 (t, J=6.95 Hz, 1H), 7.28-7.35 (m, 1H), 7.73 (d, J=8.84 Hz, 2H), 7.78 (d, J=7.83 Hz, 1H), 7.94 (d, J=8.84 Hz, 2H), 9.21 (s, 1H); ESI-MS: m/z 555.2 (M+H)⁺.

Example 23
1-(3-(4-(3,4-dimethoxyphenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.04 (t, J=7.20 Hz, 3H), 2.82 (br. s., 2H), 3.02-3.19 (m, 4H), 3.37-3.77 (m, 4H), 3.83 (s, 3H), 3.86 (s, 3H), 6.94 (t, J=5.43 Hz, 1H), 7.14 (d, J=2.02 Hz, 1H), 7.16-7.21 (m, 2H), 7.25 (td, J=7.52, 1.14 Hz, 1H), 7.30 (d, J=2.02 Hz, 2H), 7.78 (d, J=7.58 Hz, 1H), 9.19 (s, 1H); ESI-MS: m/z 532.2 (M+H)⁺.

Example 24
N-(4-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)phenyl)acetamide

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, DMSO-d₆) δ ppm 1.03 (t, J=7.20 Hz, 3H), 2.10 (s, 3H), 2.77 (br. s., 2H), 3.02-3.19 (m, 4H), 3.46 (br. s., 2H), 3.64 (br. s., 2H), 6.86 (t, J=5.43 Hz, 1H), 7.16 (dt, 1H), 7.24 (dt, J=7.52, 1.14 Hz, 1H), 7.30 (d, 1H), 7.63-7.70 (m, 2H), 7.78 (d, J=7.58 Hz, 1H), 7.80-7.87 (m, 2H), 9.19 (s, 1H), 10.42 (s, 1H); ESI-MS: m/z 529.2 (M+H)⁺.

Example 25
Ethyl 3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)propanoate

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, chloroform-d) δ ppm 1.05 (t, J=7.20 Hz, 3H), 1.29 (t, J=7.07 Hz, 3H), 2.82 (t, J=7.45 Hz, 2H), 3.07-3.35 (m, 6H), 3.41-3.52 (m, 2H), 3.54-3.67 (m, 2H), 3.68-3.94 (m, 2H), 4.19 (q, J=7.07 Hz, 2H), 5.39 (t, J=5.18 Hz, 1H), 7.19-7.29 (m, 1H), 7.37 (dt, J=15.92, 7.45 Hz, 2H), 7.74 (d, J=8.08 Hz, 1H), 9.42 (br. s., 1H); ESI-MS: m/z 496.2 (M+H)⁺.

Example 26
ethyl-3-(3-(4-(isobutylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, chloroform-d) δ ppm 0.95 (t, J=7.20 Hz, 3H), 1.11 (d, J=6.82 Hz, 6H), 2.21-2.36 (m, 1H), 2.79 (d, J=6.57 Hz, 2H), 3.05-3.29 (m, 4H), 3.33-3.49 (m, 2H), 3.58-3.70 (m, 2H), 3.79 (br. s., 2H), 5.68 (br. s., 1H), 7.20-7.26 (m, 1H), 7.32-7.37 (m, 1H), 7.37-7.42 (m, 1H), 7.73 (d, J=8.08 Hz, 1H), 9.38 (br. s., 1H); ESI-MS: m/z 452.2 (M+H)⁺.

Example 27
ethyl-3-(3-(4-(3,3,3-trifluoropropylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, CHLOROFORM-d) δ ppm 0.98 (t, J=7.07 Hz, 3H), 2.55-2.72 (m, 2H), 3.09-3.21 (m, 4H), 3.22-3.35 (m, 2H), 3.38-3.53 (m, 2H), 3.59-3.71 (m, 2H), 3.75 (q, J=6.91 Hz, 2H), 5.59-5.71 (m, 1H), 7.24 (t, J=7.45 Hz, 1H), 7.32-7.42 (m, 2H), 7.73 (d, J=8.08 Hz, 1H), 9.41 (br. s., 1H); ESI-MS: m/z 492.1 (M+H)⁺.

Example 28
ethyl-3-(3-(4-(methylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ¹H NMR (400 MHz, chloroform-d) δ ppm 1.08 (t, J=7.20 Hz, 3H), 2.82 (s, 3H), 3.05-3.17 (m, 2H), 3.18-3.31 (m, 2H), 3.32-3.48 (m, 2H), 3.58-3.71 (m, 2H), 3.79 (br. s., 2H), 5.52 (t, J=5.43 Hz, 1H), 7.23 (t, J=6.95 Hz, 1H), 7.32-7.42 (m, 2H), 7.74 (d, J=7.83 Hz, 1H), 9.44 (br. s., 1H).

Example 29
ethyl-3-(3-(4-(4-(methylsulfonyl)phenylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ESI-MS: m/z 550.1 (M+H)⁺.

Example 30
ethyl-3-(3-(4-(2-oxoindolin-6-ylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ESI-MS: m/z 527.1 (M+H)⁺.

Example 31
ethyl-3-(3-(4-(2-oxo-2,3-dihydro-1H-benzo[d]imidazol-5-ylsulfonyl) piperazine-1-carbon yl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ESI-MS: m/z 528.1 (M+H)⁺.

Example 32
ethyl-3-(3-(4-(2-oxo-2,3-dihydrobenzo[d]oxazol-5-ylsulfonyl)piperazine-1-carbon yl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ESI-MS: m/z 529.1 (M+H)⁺.

Example 33
ethyl-3-(3-(4-(2-oxo-2,3-dihydrobenzo[d]thiazol-5-ylsulfonyl)piperazine-1-carbon yl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 1. ESI-MS: m/z 545.1 (M+H)⁺.

Example 34
N,N-diethyl-3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-1-ylsulfonyl)propanamide

The title compound was prepared as described in Scheme 3. ¹H NMR (400 MHz, chloroform-d) δ ppm 1.12 (t, J=7.07 Hz, 6H), 1.20 (t, J=7.07 Hz, 3H), 2.85 (t, J=7.33 Hz, 2H), 3.07-3.22 (m, 2H), 3.26 (dd, J=7.07, 5.56 Hz, 2H), 3.29-3.36 (m, 4H), 3.39 (q, J=7.16 Hz, 2H), 3.46 (td, J=8.15, 3.66 Hz, 2H), 3.57 (td, J=8.21, 5.18 Hz, 2H), 3.81 (d, J=12.63 Hz, 2H), 5.55 (t, J=5.31 Hz, 1H), 7.17-7.25 (m, 1H), 7.35 (td, J=7.58, 1.26 Hz, 1H), 7.38-7.45 (m, 1H), 7.73 (d, J=7.83 Hz, 1H), 9.36 (br. s., 1H); ESI-MS: m/z 523.2 (M+H)⁺.

Example 35
ethyl-3-(3-(4-(3-oxo-3-(pyrrolidin-1-yl)propylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 3. ¹H NMR (400 MHz, CHLOROFORM-d) δ ppm 1.13 (t, J=7.20 Hz, 3H), 1.83-1.93 (m, 2H), 1.98 (q, J=6.48 Hz, 2H), 2.80 (t, J=7.33 Hz, 2H), 3.10-3.25 (m, 4H), 3.25-3.35 (m, 4H), 3.40-3.50 (m, 4H), 3.55 (td, J=8.34, 5.05 Hz, 2H), 3.79 (br. s., 2H), 6.22 (br. s., 1H), 7.21 (t, J=6.95 Hz, 1H), 7.33 (t, J=7.07 Hz, 1H), 7.38-7.44 (m, 1H), 7.72 (d, J=8.08 Hz, 1H), 9.42 (br. s., 1H); ESI-MS: m/z 521.2 (M+H)⁺.

Example 36
ethyl-3-(3-(4-(3-morpholino-3-oxopropylsulfonyl)piperazine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 3. ¹H NMR (400 MHz, chloroform-d) δ ppm 1.08 (t, J=7.20 Hz, 3H), 2.80-2.89 (m, 2H), 3.13-3.24 (m, 4H), 3.26-3.33 (m, 2H), 3.35-3.45 (m, 2H), 3.48 (m, 2H), 3.57-3.65 (m, 4H), 3.65-3.72 (m, 4H), 3.79 (br. s., 2H), 6.31 (br. s., 1H), 7.16-7.24 (m, 1H), 7.30-7.37 (m, 1H), 7.37-7.44 (m, 1H), 7.72 (d, J=8.08 Hz, 1H), 9.47 (br. s., 1H); ESI-MS: m/z 537.2 (M+H)⁺.

Example 37
ethyl-3-(3-(4-(3-methoxyphenylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Schemes 4 and 5. ESI-MS: m/z 501.1 (M+H)⁺.

Example 38
1-(3-(4-(benzo[d][1,3]dioxol-5-ylsulfonyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea

The title compound was prepared as described in Schemes 4 and 5. ESI-MS: m/z 515.1 (M+H)⁺.

Example 39
ethyl-3-(3-(4-(3-methoxyphenylthio)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 6. ESI-MS: m/z 469.2 (M+H)⁺.

Example 40
ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylthio)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 6. ESI-MS: m/z 523.1 (M+H)⁺.

Example 41
ethyl-3-(3-(4-(3-methoxyphenylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 6. ESI-MS: m/z 485.1 (M+H)⁺.

Example 42
ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfinyl)piperidine-1-carbonyl)benzo[b]thiophen-2-yl)urea

The title compound was prepared as described in Scheme 6. ESI-MS: m/z 539.1 (M+H)⁺.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

Example A
Enzyme Binding Assay for Hsp90 Inhibitors
A. Purification of Human ACC1

Human ACC1 cDNA was amplified from human liver cDNA by polymerase chain reaction using primers; 5′AAAAGTCGACCCACCATGGATGAACCTTCTCCCTTGGCCC3′ (SEQ ID NO: 1) and 5′AAAAGCGGCCGCCTACGTAGAAGGGGAGTCCATAGTG3′ (SEQ ID NO: 2). The amplified DNA fragment was digested by restriction enzyme SalI and NotI, and cloned into pFAST-BacHTc (Invitrogen). This plasmid DNA was used for preparation of recombinant vaculovirus with BAC-TO-BAC Baculovirus Expression System (Invitrogen).

SF-9 cells were infected with the vaculovirus and cultured at 27° C. for 3 days. Harvested cells were homogenized in buffer A (25 mM HEPES (pH7.5), 130 mM NaCl, 1 mM EDTA, 25 mM sodium glycerophosphate, 1 mM sodium orthovanadate, 10% glycerol, complete protease inhibitor), and subjected to ultracentrifuge at 185700×g for 50 min at 4° C. ACC1 protein with 6×His-tag at the N-terminal was purified from the supernatant using Ni-NTA Super Flow Gel (QIAGEN). Eluted protein was dialysed against buffer B (50 mM HEPES (pH 7.5), 300 mM NaCl, 10 mM MgCl₂, 10 mM tripotassium citrate, 2 mM dithiothreitol) and concentrated using Vivaspin20 ultrafiltration tube (Sartorius).

B. Purification of Human ACC2

Human ACC2 cDNA except coding region for mitochondria localization sequence was amplified from human skeletal muscle cDNA by polymerase chain reaction using primers; 5′CCAGGTCGACCCGCCAACGGGACTGGGACACAAGG3′ (SEQ ID NO: 3) and 5′CGCACTCTCAGTTTCCCGGATTCCC3′ (SEQ ID NO: 4). The amplified DNA fragment was digested by SalI and AflII, and cloned into pFAST-BacHTa (Invitrogen). Preparation of recombinant vaculovirus, infection of the virus to SF-9 cells and purification of recombinant ACC2 protein with 6×His-tag at the N-terminal were performed in the same method as described above.

C. Measurement of ACC Activity

Malachite green solution was prepared by mixing 100 mL of solution A (0.12% malachite green in 5NH₂SO₄), 25 mL of solution B (7.5% ammonium molybdate) and 2 mL of solution C (11% TWEEN-20).

ACC1 was diluted to 8 μg/mL in reaction buffer (50 mM HEPES pH7.5, 10 mM MgCl₂, 10 mM tripotassium citrate, 2 mM DTT, 0.75 mg/mL fatty acid free BSA) and 10 μL diluted enzyme solution was pored into each well of 384-well clear bottom plate. Test compound was diluted in the reaction buffer and 5 μL of the compound solution was added into each well, and the mixture was incubated at 30° C. for 60 minutes. Reaction was initiated by addition of 5 μL substrate solution (50 mM KHCO₃, 200 μM ATP, 200 μM acetyl-CoA). After incubation at 30° C. for 20 minutes, reaction was terminated by addition of 5 μL malachite green solution and absorbance at 620 nm was measured.

ACC2 was diluted to 6.4 μg/mL in reaction buffer, and the activity was measured by the same method as described for ACC1.

Percent activity at each concentration of compound was calculated from the following equation:

$\frac{{Abs}_{(enzyme + inhibitor)} - Avg {Abs}_{(no enzyme)}}{Avg {Abs}_{(no inhibitor)} - Avg {Abs}_{(no enzyme)}} \times 100$

where Abs is absorbance, Avg is average.

Data were subjected to nonlinear regression analysis using GraphPad Prism Software (GraphPad Software Inc.) to obtain IC₅₀values. Enzymatic activities of selected compounds are reported in TABLE 1.

TABLE 1

ACC1
ACC2

EXAMPLE
(μM)
(μM)

2
>50
>50

3
>50
>50

4
>50
5-50

5
5-50
5-50

6
>50
>50

7
>50
<5

8
5-50
<5

9
<5
<5

10
>50
5-50

11
5-50
5-50

12
5-50
<5

13
<5
<5

14
<5
<5

15
>50
>50

16
>50
>50

17
5-50
5-50

18
<5
<5

19
<5
<5

20
<5
<5

21
<5
<5

22
>50
<5

23
<5
<5

24
<5
<5

25
5-50
5-50

26
5-50
5-50

27
>50
5-50

28
>50
>50

29
>50
5-50

30
5-50
<5

31
<5
<5

32
>50
5-50

34
5-50
5-50

35
5-50
5-50

36
5-50
5-50

37
>50
<5

38
>50
>50

39
<5
<5

40
>50
5-50

41
5-50
5-50

42
>50
5-50

ACETYL COENZYME A CARBOXYLASE INHIBITORS

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

RELATED APPLICATION

Provisional Applications (1)