Aggrecanase molecules

Information

  • Patent Grant
  • 6689599
  • Patent Number
    6,689,599
  • Date Filed
    Thursday, October 18, 2001
    24 years ago
  • Date Issued
    Tuesday, February 10, 2004
    22 years ago
Abstract
Aggrecanase proteins and the nucleotides sequences encoding them as well as processes for producing them are disclosed. Methods for developing inhibitors of the aggrecanase enzymes and antibodies to the enzymes for treatment of conditions characterized by the degradation of aggrecan are also disclosed.
Description




The present invention relates to the discovery of nucleotide sequences encoding novel aggrecanase molecules, the aggrecanase proteins and processes for producing them. The invention further relates to the development of inhibitors of, as well as antibodies to the aggrecanase enzymes. These inhibitors and antibodies may be useful for the treatment of various aggrecanase-associated conditions including osteoarthritis.




BACKGROUND OF THE INVENTION




Aggrecan is a major extracellular component of articular cartilage. It is a proteoglycan responsible for providing cartilage with its mechanical properties of compressibility and elasticity. The loss of aggrecan has been implicated in the degradation of articular cartilage in arthritic diseases. Osteoarthritis is a debilitating disease which affects at least 30 million Americans (MacLean et al.


J Rheumatol


25:2213-8. (1998)). Osteoarthritis can severely reduce quality of life due to degradation of articular cartilage and the resulting chronic pain. An early and important characteristic of the osteoarthritic process is loss of aggrecan from the extracellular matrix (Brandt, K D. and Mankin H J.


Pathogenesis of Osteoarthritis


, Textbook of Rheumatology, W B Saunders Company, Philadelphia, Pa. pgs. 1355-1373. (1993)). The large, sugar-containing portion of aggrecan is thereby lost from the extra-cellular matrix, resulting in deficiencies in the biomechanical characteristics of the cartilage.




A proteolytic activity termed “aggrecanase” is thought to be responsible for the cleavage of aggrecan thereby having a role in cartilage degradation associated with osteoarthritis and inflammatory joint disease. Work has been conducted to identify the enzyme responsible for the degradation of aggrecan in human osteoarthritic cartilage. Two enzymatic cleavage sites have been identified within the interglobular domain of aggrecan. One (Asn


34


1-Phe


342


) is observed to be cleaved by several known metalloproteases (Flannery, C R et al.


J Biol Chem


267:1008-14. 1992; Fosang, A J et al.


Biochemical J


. 304:347-351. (1994)). The aggrecan fragment found in human synovial fluid, and generated by IL-1 induced cartilage aggrecan cleavage is at the Glu


373


-Ala3


74


bond (Sandy, J D, et al.


J Clin Invest


69:1512-1516. (1992); Lohmander L S, et al.


Arthritis Rheum


36: 1214-1222. (1993); Sandy J D et al.


J Biol Chem


. 266: 8683-8685. (1991)), indicating that none of the known enzymes are responsible for aggrecan cleavage in vivo.




Recently, identification of two enzymes, aggrecanase-1(ADAMTS 4) and aggrecanase-2(ADAMTS-11) within the “Disintegrin-like and Metalloprotease with Thrombospondin type 1 motif” (ADAM-TS) family have been identified which are synthesized by IL-1 stimulated cartilage and cleave aggrecan at the appropriate site (Tortorella M D, et al.


Science


284:1664-6. (1999); Abbaszade, I, et al.


J Biol Chem


274: 23443-23450. (1999)). It is possible that these enzymes could be synthesized by osteoarthritic human articular cartilage. It is also contemplated that there are other, related enzymes in the ADAM-TS family which are capable of cleaving aggrecan at the Glu


373


-Ala3


74


bond and could contribute to aggrecan cleavage in osteoarthritis.




SUMMARY OF THE INVENTION




The present invention is directed to the identification of aggrecanase protein molecules capable of cleaving aggrecanase, the nucleotide sequences which encode the aggrecanase enzymes, and processes for the production of aggrecanases. These enzymes are contemplated to be characterized as having proteolytic aggrecanase activity. The invention further includes compositions comprising these enzymes as well as antibodies to these enzymes. In addition, the invention includes methods for developing inhibitors of aggrecanase which block the enzyme's proteolytic activity. These inhibitors and antibodies may be used in various assays and therapies for treatment of conditions characterized by the degradation of articular cartilage.




The nucleotide sequence of the aggrecanase molecule of the present invention is set forth in SEQ ID NO: 3. In another embodiment, the nucleotide sequence of the aggrecanase molecule of the present invention is set forth SEQ ID NO: 1 from nucleotide #1 to #3766. In another embodiment the nucleotide sequence of the invention comprises nucleotide #1086(TCG) to #3396(CGC) of SEQ ID NO: 1. The invention further includes equivalent degenerative codon sequences of the sequences set forth in SEQ ID NO: 1, as well as fragments thereof which exhibit aggrecanase activity.




The amino acid sequence of an isolated aggrecanase molecule of the invention comprises the sequence set forth in SEQ ID NO: 4. The amino acid sequence of an isolated aggrecanase molecule comprises the sequence set forth in SEQ ID NO: 2. The invention further includes fragments of the amino acid sequence which encode molecules exhibiting aggrecanase activity.




The human aggrecanase protein or a fragment thereof may be produced by culturing a cell transformed with a DNA sequence of SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide #1 to #3766 of SEQ ID NO: 1 or comprising nucleotide #1086 to #3396 of SEQ ID NO: 1 and recovering and purifying from the culture medium a protein characterized by the amino acid sequence set forth in SEQ ID NO: 4 or SEQ ID NO: 2, respectively, substantially free from other proteinaceous materials with which it is co-produced. For production in mammalian cells, the DNA sequence further comprises a DNA sequence encoding a suitable propeptide 5′ to and linked in frame to the nucleotide sequence encoding the aggrecanase enzyme.




The invention includes methods for obtaining additional aggrecanase molecules, the DNA sequence obtained by this method and the protein encoded thereby. The method for isolation of the full length sequence involves utilizing the aggrecanase sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 1 from nucleotide #1086 to #3396 to design probes for screening using standard procedures known to those skilled in the art.




It is expected that other species have DNA sequences homologous to human aggrecanase enzyme. The invention, therefore, includes methods for obtaining the DNA sequences encoding other aggrecanase molecules, the DNA sequences obtained by those methods, and the protein encoded by those DNA sequences. This method entails utilizing the nucleotide sequence of the invention or portions thereof to design probes to screen libraries for the corresponding gene from other species or coding sequences or fragments thereof from using standard techniques. Thus, the present invention may include DNA sequences from other species, which are homologous to the human aggrecanase protein and can be obtained using the human sequence. The present invention may also include functional fragments of the aggrecanase protein, and DNA sequences encoding such functional fragments, as well as functional fragments of other related proteins. The ability of such a fragment to function is determinable by assay of the protein in the biological assays described for the assay of the aggrecanase protein.




The aggrecanase proteins of the present invention may be produced by culturing a cell transformed with the DNA sequence of SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide #1 to #3766 of SEQ ID NO: 1 or comprising nucleotide #1086 to #3396 of SEQ ID NO: 1 and recovering and purifying aggrecanase protein from the culture medium. In one embodiment the protein comprises amino acid sequence of SEQ ID NO: 4 or amino acid #1 to #770 of SEQ ID NO: 2. The purified expressed protein is substantially free from other proteinaceous materials with which it is co-produced, as well as from other contaminants. The recovered purified protein is contemplated to exhibit proteolytic aggrecanase activity cleaving aggrecan. Thus, the proteins of the invention may be further characterized by the ability to demonstrate aggrecan proteolytic activity in an asssay which determines the presence of an aggrecan-degrading molecule. These assays or the development thereof is within the knowledge of one skilled in the art. Such assays may involve contacting an aggrecan substrate with the aggrecanase molecule and monitoring the production of aggrecan fragments (see for example, Hughes et al.,


Biochem J


305: 799-804(1995); Mercuri et al.,


J. Bio Chem


. 274:32387-32395 (1999)).




In another embodiment, the invention includes methods for developing inhibitors of aggrecanase and the inhibitors produced thereby. These inhibitors prevent cleavage of aggrecan. The method may entail the determination of binding sites based on the three dimensional structure of aggrecanase and aggrecan and developing a molecule reactive with the binding site. Candidate molecules are assayed for inhibitory activity. Additional standard methods for developing inhibitors of the aggrecanase molecule are known to those skilled in the art. Assays for the inhibitors involve contacting a mixture of aggrecan and the inhibitor with an aggrecanase molecule followed by measurement of the aggrecanase inhibition, for instance by detection and measurement of aggrecan fragments produced by cleavage at an aggrecanase susceptible site.




Another aspect of the invention therefore provides pharmaceutical compositions containing a therapeutically effective amount of aggrecanase inhibitors, in a pharmaceutically acceptable vehicle. Aggrecanase-mediated degradation of aggrecan in cartilage has been implicated in osteoarthritis and other inflammatory diseases. Therefore, these compositions of the invention may be used in the treatment of diseases characterized by the degradation of aggrecan and/or an upregulation of aggrecanase. The compositions may be used in the treatment of these conditions or in the prevention thereof.




The invention includes methods for treating patients suffering from conditions characterized by a degradation of aggrecan or preventing such conditions. These methods, according to the invention, entail administering to a patient needing such treatment, an effective amount of a composition comprising an aggrecanase inhibitor which inhibits the proteolytic activity of aggrecanase enzymes.




Still a further aspect of the invention are DNA sequences coding for expression of an aggrecanase protein. Such sequences include the sequence of nucleotides in a 5′ to 3′ direction illustrated in SEQ ID NO: 1 comprising nucleotide #1 to #3766 or comprising nucleotide #1086 to #3396 of SEQ ID NO: 1 or SEQ ID NO: 3 and DNA sequences which, but for the degeneracy of the genetic code, are identical to the DNA sequence of SEQ ID NO: 1 and SEQ ID NO: 3, and encode an aggrecanase protein. Further included in the present invention are DNA sequences which hybridize under stringent conditions with the DNA sequence of SEQ ID NO: 1 and SEQ ID NO: 3 and encode a protein having the ability to cleave aggrecan. Preferred DNA sequences include those which hybridize under stringent conditions (see, T. Maniatis et al.,


Molecular Cloning


(A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389. It is generally preferred that such DNA sequences encode a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the sequence of set forth in SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide #1 to #3766 or comprising nucleotide #1086 to #3396 of SEQ ID NO: 1. Finally, allelic or other variations of the sequences of SEQ ID NO: 1 or SEQ ID NO: 3, whether such nucleotide changes result in changes in the peptide sequence or not, but where the peptide sequence still has aggrecanase activity, are also included in the present invention. The present invention also includes fragments of the DNA sequence shown in SEQ ID NO: 1 which encode a polypeptide which retains the activity of aggrecanase.




The DNA sequences of the present invention are useful, for example, as probes for the detection of mRNA encoding aggrecanase in a given cell population. Thus, the present invention includes methods of detecting or diagnosing genetic disorders involving the aggrecanase, or disorders involving cellular, organ or tissue disorders in which aggrecanase is irregularly transcribed or expressed. The DNA sequences may also be useful for preparing vectors for gene therapy applications as described below.




A further aspect of the invention includes vectors comprising a DNA sequence as described above in operative association with an expression control sequence therefor. These vectors may be employed in a novel process for producing an aggrecanase protein of the invention in which a cell line transformed with a DNA sequence encoding an aggrecanase protein in operative association with an expression control sequence therefor, is cultured in a suitable culture medium and an aggrecanase protein is recovered and purified therefrom. This process may employ a number of known cells both prokaryotic and eukaryotic as host cells for expression of the polypeptide. The vectors may be used in gene therapy applications. In such use, the vectors may be transfected into the cells of a patient ex vivo, and the cells may be reintroduced into a patient. Alternatively, the vectors may be introduced into a patient in vivo through targeted transfection.




Still a further aspect of the invention are aggrecanase proteins or polypeptides. Such polypeptides are characterized by having an amino acid sequence including the sequence illustrated in SEQ ID NO: 2 or 4, variants of the amino acid sequence of SEQ ID NO: 2 or 4, including naturally occurring allelic variants, and other variants in which the protein retains the ability to cleave aggrecan characteristic of aggrecanase molecules. Preferred polypeptides include a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the amino acid sequence shown in SEQ ID NO: 2 or 4. Finally, allelic or other variations of the sequences of SEQ ID NO: 2 or 4, whether such amino acid changes are induced by mutagenesis, chemical alteration, or by alteration of DNA sequence used to produce the polypeptide, where the peptide sequence still has aggrecanase activity, are also included in the present invention. The present invention also includes fragments of the amino acid sequence of SEQ ID NO: 2 or 4 which retain the activity of aggrecanase protein.




The purified proteins of the present inventions may be used to generate antibodies, either monoclonal or polyclonal, to aggrecanase and/or other aggrecanase-related proteins, using methods that are known in the art of antibody production. Thus, the present invention also includes antibodies to aggrecanase or other related proteins. The antibodies may be useful for detection and/or purification of aggrecanase or related proteins, or for inhibiting or preventing the effects of aggrecanase. The aggrecanase of the invention or portions thereof may be utilized to prepare antibodies that specifically bind to aggrecanase.




DETAILED DESCRIPTION OF THE INVENTION




The human aggrecanase of the present invention comprises the nucleotide sequence set in SEQ ID NO: 3. In another embodiment, the human aggrecanase of the present invention comprises nucleotides #1 to #3766 or nucleotides #1086 to #3396 of SEQ ID NO: 1. The human aggrecanase protein sequence comprises the amino acid sequence set forth in SEQ ID NO: 4. In another embodiment, the human aggrecanase protein sequence comprises amino acids #1 to #770 set forth in SEQ ID NO: 2. Further sequences of the aggrecanase of the present invention may be obtained using the sequences of SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotides #1086 to #3396 to design probes for screening for the full sequence using standard techniques.




The aggrecanase proteins of the present invention, include polypeptides comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 and having the ability to cleave aggrecan.




The aggrecanase proteins recovered from the culture medium are purified by isolating them from other proteinaceous materials from which they are co-produced and from other contaminants present. The isolated and purified proteins may be characterized by the ability to cleave aggrecan substrate. The aggrecanase proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO: 3 or the sequence of SEQ ID NO: 1 comprising nucleotide #1 to #3766 or comprising nucleotide #1086 to #3396 of SEQ ID NO: 1, but into which modifications or deletions are naturally provided (e.g. allelic variations in the nucleotide sequence which may result in amino acid changes in the polypeptide) or deliberately engineered. For example, synthetic polypeptides may wholly or partially duplicate continuous sequences of the amino acid residues of SEQ ID NO: 2 or SEQ ID NO: 4. These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with aggrecanase molecules may possess biological properties in common therewith. It is know, for example that numerous conservative amino acid substitutions are possible without significantly modifying the structure and conformation of a protein, thus maintaining the biological properties as well. For example, it is recognized that conservative amino acid substitutions may be made among amino acids with basic side chains, such as lysine (Lys or K), arginine (Arg or R) and histidine (His or H); amino acids with acidic side chains, such as aspartic acid (Asp or D) and glutamic acid (Glu or E); amino acids with uncharged polar side chains, such as asparagine (Asn or N), glutamine (Gln or Q), serine (Ser or S), threonine (Thr or T), and tyrosine (Tyr or Y); and amino acids with nonpolar side chains, such as alanine (Ala or A), glycine (Gly or G), valine (Val or V), leucine (leu or L), isoleucine (Ile or I), proline (Pro or P), phenylalanine (Phe or F), methionine (Met or M), tryptophan (Trp or W) and cysteine (Cys or C). Thus, these modifications and deletions of the native aggrecanase may be employed as biologically active substitutes for naturally-occurring aggrecanase and in the development of inhibitors other polypeptides in therapeutic processes. It can be readily determined whether a given variant of aggrecanase maintains the biological activity of aggrecanase by subjecting both aggrecanase and the variant of aggrecanase, as well as inhibitors thereof, to the assays described in the examples.




Other specific mutations of the sequences of aggrecanase proteins described herein involve modifications of glycosylation sites. These modifications may involve O-linked or N-linked glycosylation sites. For instance, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at asparagine-linked glycosylation recognition sites. The asparagine-linked glycosylation recognition sites comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid. A variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and/or amino acid deletion at the second position) results in non-glycosylation at the modified tripeptide sequence. Additionally, bacterial expression of aggrecanase-related protein will also result in production of a non-glycosylated protein, even if the glycosylation sites are left unmodified.




The present invention also encompasses the novel DNA sequences, free of association with DNA sequences encoding other proteinaceous materials, and coding for expression of aggrecanase proteins. These DNA sequences include those depicted in SEQ ID NO: 1 or 3 in a 5′ to 3′ direction and those sequences which hybridize thereto under stringent hybridization washing conditions (for example, 0.1×SSC, 0.1% SDS at 65° C.; see, T. Maniatis et al.,


Molecular Cloning


(


A Laboratory Manual


), Cold Spring Harbor Laboratory (1982), pages 387 to 389) and encode a protein having aggrecanase proteolytic activity. These DNA sequences also include those which comprise the DNA sequence of SEQ ID NO: 1 and those which hybridize thereto under stringent hybridization conditions and encode a protein which maintain the other activities disclosed for aggrecanase.




Similarly, DNA sequences which code for aggrecanase proteins coded for by the sequences of SEQ ID NO: 1 comprising nucleotide #1 to #3766 or comprising nucleotide #1086 to #3396 of SEQ ID NO: 1 or the sequence of SEQ ID NO: 3 or aggrecanase proteins which comprise the amino acid sequence of SEQ ID NO: 2 or 4, but which differ in codon sequence due to the degeneracies of the genetic code or allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) also encode the novel factors described herein. Variations in the DNA sequences of SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide #1 to #3766 or comprising nucleotide #1086 to #3396 of SEQ ID NO: 1 which are caused by point mutations or by induced modifications (including insertion, deletion, and substitution) to enhance the activity, half-life or production of the polypeptides encoded are also encompassed in the invention.




Another aspect of the present invention provides a novel method for producing aggrecanase proteins. The method of the present invention involves culturing a suitable cell line, which has been transformed with a DNA sequence encoding a aggrecanase protein of the invention, under the control of known regulatory sequences. The transformed host cells are cultured and the aggrecanase proteins recovered and purified from the culture medium. The purified proteins are substantially free from other proteins with which they are co-produced as well as from other contaminants.




Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO). The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening, product production and purification are known in the art. See, e.g., Gething and Sambrook,


Nature


, 293:620-625 (1981), or alternatively, Kaufman et al.,


Mol. Cell. Biol


., 5(7): 1750-1759 (1985) or Howley et al., U.S. Pat. No. 4,419,446. Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey COS-1 cell line. The mammalian cell CV-1 may also be suitable.




Bacterial cells may also be suitable hosts. For example, the various strains of


E. coli


(e.g., HB101, MC1061) are well-known as host cells in the field of biotechnology. Various strains of


B. subtilis


, Pseudomonas, other bacilli and the like may also be employed in this method. For expression of the protein in bacterial cells, DNA encoding the propeptide of Aggrecanase is generally not necessary.




Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al.,


Genetic Engineering


, 8:277-298 (Plenum Press 1986) and references cited therein.




Another aspect of the present invention provides vectors for use in the method of expression of these novel aggrecanase polypeptides. Preferably the vectors contain the full novel DNA sequences described above which encode the novel factors of the invention. Additionally, the vectors contain appropriate expression control sequences permitting expression of the aggrecanase protein sequences. Alternatively, vectors incorporating modified sequences as described above are also embodiments of the present invention. Additionally, the sequence of SEQ ID NO: 3 or SEQ ID NO: 1 or other sequences encoding aggrecanase proteins could be manipulated to express composite aggrecanase molecules. Thus, the present invention includes chimeric DNA molecules encoding an aggrecanase protein comprising a fragment from SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide #1 to #3766 or comprising nucleotide #1086 to #3396 of SEQ ID NO: 1 linked in correct reading frame to a DNA sequence encoding another aggrecanase polypeptide.




The vectors may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative association with the DNA coding sequences of the invention which are capable of directing the replication and expression thereof in selected host cells. Regulatory sequences for such vectors are known to those skilled in the art and may be selected depending upon the host cells. Such selection is routine and does not form part of the present invention.




Various conditions such as osteoarthritis are known to be characterized by degradation of aggrecan. Therefore, an aggrecanase protein of the present invention which cleaves aggrecan may be useful for the development of inhibitors of aggrecanase. The invention therefore provides compositions comprising an aggrecanase inhibitor. The inhibitors may be developed using the aggrecanase in screening assays involving a mixture of aggrecan substrate with the inhibitor followed by exposure to aggrecan. The compositions may be used in the treatment of osteoarthritis and other conditions exhibiting degradation of aggrecan.




The invention further includes antibodies which can be used to detect aggrecanase and also may be used to inhibit the proteolytic activity of aggrecanase.




The therapeutic methods of the invention includes administering the aggrecanase inhibitor compositions topically, systemically, or locally as an implant or device. The dosage regimen will be determined by the attending physician considering various factors which modify the action of the aggrecanase protein, the site of pathology, the severity of disease, the patient's age, sex, and diet, the severity of any inflammation, time of administration and other clinical factors. Generally, systemic or injectable administration will be initiated at a dose which is minimally effective, and the dose will be increased over a preselected time course until a positive effect is observed. Subsequently, incremental increases in dosage will be made limiting such incremental increases to such levels that produce a corresponding increase in effect, while taking into account any adverse affects that may appear. The addition of other known factors, to the final composition, may also effect the dosage.




Progress can be monitored by periodic assessment of disease progression. The progress can be monitored, for example, by x-rays, MRI or other imaging modalities, synovial fluid analysis, and/or clinical examination.











The following examples illustrate practice of the present invention in isolating and characterizing human aggrecanase and other aggrecanase-related proteins, obtaining the human proteins and expressing the proteins via recombinant techniques.




EXAMPLES




Example 1




Isolation of DNA




Potential novel aggrecanase family members were identified using a database screening approach. Aggrecanase-1 (


Science


284:1664-1666 (1999) has at least six domains: signal, propeptide, catalytic domain, disintegrin, tsp and c-terminal. The catalytic domain contains a zinc binding signature region, TAAHELGHVKF (SEQ ID NO: 5) and a “MET turn”which are responsible for protease activity. Substitutions within the zinc binding region in the number of the positions still allow protease activity, but the histidine (H) and glutamic acid (E) residues must be present. The thrombospondin domain of Aggrecanase-1 is also a critical domain for substrate recognition and cleavage. It is these two domains that determine our classification of a novel aggrecanase family member. The protein sequence of the Aggrecanase-1 DNA sequence was used to query against the GeneBank ESTs focusing on human ESTs using TBLASTN. The resulting sequences were the starting point in the effort to identify full length sequence for potential family members. The nucleotide sequence of the aggrecanase of the present invention is comprised of one EST (AA588434) that contains homology over the catalytic domain and zinc binding motif of Aggrecanase-1 (ADAMTS4).




This human aggrecanase sequence was isolated from a dT-primed cDNA library constructed in the plasmid vector pED6-dpc2. cDNA was made from human testes RNA purchased from Clontech. The probe to isolate the aggrecanase of the present invention was generated from the sequence obtained from the database search. The sequence of the probe was as follows: 5′-GGTCAAATCGCGTCAGTGTAAATACGGG-3′ (SEQ ID NO: 6). The DNA probe was radioactively labeled with


32


P and used to screen the human testes dT-primed cDNA library, under high stringency hybridization/washing conditions, to identify clones containing sequences of the human candidate #8.




Fifty thousand library transformants were plated at a density of approximately 5000 transformants per plate on 10 plates. Nitrocellulose replicas of the transformed colonies were hybridized to the


32


P labeled DNA probe in standard hybridization buffer (1×Blotto(25×Blotto=%5 nonfat dried milk, 0.02% azide in dH2O)+1% NP-40+6×SSC+0.05% Pyrophosphate) under high stringency conditions (65° C. for 2 hours shaking). After 2 hours hybridization, the radioactively labeled DNA probe containing hybridization solution was removed and the filters were washed under high stringency conditions (3×SSC, 0.05% Pyrophosphate for 5 minutes at RT; followed by 2.2×SSC, 0.05% Pyrophosphate for 15 minutes at RT; followed by 2.2×SSC, 0.05% Pyrophosphate for 1-2 minutes at 65° C.). The filters were wrapped in Saran wrap and exposed to X-ray film for overnight. The autoradiographs were developed and positively hybridizing transformants of various signal intensities were identified. These positive clones were picked; grown for 12 hours in selective medium(L-broth plus 100 μg/ml ampicillin) and plated at low density (approximately 100 colonies per plate). Nitrocellulose replicas of the colonies were hybridized to the


32


P labeled probe in standard hybridization buffer ((1×Blotto(25×Blotto=%5 nonfat dried milk, 0.02% azide in dH2O)+1% NP-40+6×SSC+0.05% Pyrophosphate) under high stringency conditions (65° C. for 2 hours). After 2 hours hybridization, the radioactively labeled DNA probe containing hybridization solution was removed and the filters were washed under high stringency conditions (3×SSC, 0.05% Pyrophosphate for 5 minutes at RT; followed by 2.2×SSC, 0.05% Pyrophosphate for 15 minutes at RT; followed by 2.2×SSC, 0.05% Pyrophosphate for 1-2 minutes at 65° C.). The filters were wrapped in Saran wrap and exposed to X-ray film for overnight. The autoradiographs were developed and positively hybridizing transformants were identified. Bacterial stocks of purified hybridization positive clones were made and plasmid DNA was isolated. The sequence of the cDNA insert was determined and is set forth in SEQ ID NO: 1 from nucleotide #1086(TCG) through #3396(CGC). This sequence has been deposited in the American Type Culture Collection—10801 University Blvd. Manassas, Va. 20110-2209 USA as PTA-2284. The cDNA insert contained the sequences of the DNA probe used in the hybridization. The 5′(prime) and 3′(prime) sequences of this isolated sequence was then extracted using the RACE protocol. The fully determined sequence is set forth in SEQ ID NO: 1 from nucleotide #1 to #3766.




The human candidate #8 sequence obtained aligns with several ESTs in the public database. Candididate #8 shows homology with ADAMTS 7 and 6. The aggrecanase of the present invention contains the zinc binding signature region, a “MET turn”, and tsp type-1 motif, however is missing the signal and propeptide regions and c-terminal spacer regions. It is with these criteria that candidate #8 is considered a novel Aggrecanase family member.




The aggrecanase sequence of the invention can be used to design probes for further screening for full length clones containing the isolated sequence.




The 5P (signal and propeptide) and 3P (C-terminal spacer regions) ends of the full-length version of EST8 were determined by RACE PCR using the Clontech Marathon cDNA Amplification Kit. The testes and stomach Marathon cDNA sources were used as substrates for the RACE reactions. 5P RACE primers used in the reactions were; GSP1—AGTCTAGAAAGCTGGTGATGTAGTCACGGC (SEQ ID NO: 7) and GSP2—TAGATGCATATGTCATAGCGTGTGATGAGCACTGC (SEQ ID NO: 8) (contains a NsiI site). The Advantage-2 PCR Kit from Clontech was used to set up nested RACE reactions following instructions in the user manual for the Marathon cDNA Amplification Kit; the amount the GSP primers used was 0.2 pmol/ul of each PCR primer/ul of reaction mix. GSP1 primer was used for the first round of PCR and GSP2 primer was used for the nested reaction. Products from the nested RACE reactions were digested with NsiI (on the GSP2 primer) and NotI (on the AP2 primer provided in the Clontech kit and used in the nested RACE PCR) and ligated into the CS2+ vector cut with NsiI and NotI. Ligated products were transformed into ElectroMAX DH10B cells from Life Technologies. Cloned RACE products were plated at low density (approximately 300 colonies per plate). Nitrocellulose replicas of the transformed colonies were hybridized to a


32


P labeled DNA probe in standard hybridization buffer (1×Blotto (25×Blotto=5% nonfat dried milk, 0.02% azide), 1% NP-40, 6×SSC, 0.05% pyrophosphate) under high stringency conditions (65° C. for 2 hours shaking). Sequence at the 5P end of candidate 8-1 was used as a DNA probe: CTCGAGTCTGGGAAGCACCGTTAACATCC (SEQ ID NO: 9).




After 2 hours, the hybridization solution (hybridization buffer containing 1×10


6


cpm


32


P labeled DNA probe) was removed and the filters were washed under high stringency conditions (3×SSC, 0.05% pyrophosphate for 5 minutes at RT standing; followed by 2.2×SSC, 0.05% pyrophosphate for 15 minutes shaking at RT; followed by 2.2×SSC, 0.05% pyrophosphate for 1-2 minutes shaking at 65° C.). The filters were covered with Saran Wrap and exposed to X-ray film overnight. The autoradiographs were developed and positively hybridizing transformants of various signal intensities were identified. These positive clones were picked and then grown for 12 hours in selective medium (L-broth plus 100 ug/ml ampicillin). Plasmid DNA was prepared and sent for DNA sequence analysis. A second round of hybridizations was performed using a probe that was made to sequence more 5P than candidate 8-1. The DNA probe sequence was deduced from the 5P RACE products. The second probe sequence was as follows: GAAGGCGATCTCATAGCTCTCCAGACT (SEQ ID NO: 10). Cloned RACE products were again plated and the same hybridization protocol was followed, except using the more 5P probe. The initiator Met was deduced from a consensus sequence derived from the 5P RACE products generated from both the testes and the stomach cDNAs. 3P RACE primers used were; GSP1—GCTCTAGACTGGTCTGAGTGCACCCCCAGCT (SEQ ID NO: 11) and GSP2—GTCCTTTGCAAGAGCGCAGACCAC (SEQ ID NO: 12). The Advantage GC-2 PCR Kit from Clontech was used to set up nested RACE reactions. Reactions were set up following the instructions in the user manual for the Marathon cDNA Amplification Kit; with the exception that the amount of GC melt used was 5 ul per 50 ul reaction; the amount the GSP primers used was 0.2 pmol/ul of each PCR primer/ul of reaction mix. GSP1 primer was used for the first round of PCR and GSP2 primer was used for the nested reaction. Products from the nested RACE reactions were ligated into the pT-Adv vector using the AdvanTAge PCR Cloning Kit, per manufacturer's instructions. Ligated products were transformed into ElectroMAX DH10B cells from Life Technologies. Cloned RACE products were plated at low density (approximately 300 colonies per plate). Nitrocellulose replicas of the transformed colonies were hybridized to a


32


P labeled DNA probe in standard hybridization buffer (1×Blotto (25×Blotto=5% nonfat dried milk, 0.02% azide), 1% NP-40, 6×SSC, 0.05% pyrophosphate) under high stringency conditions (65° C. for 2 hours shaking). Sequence at the 3P end of candidate 8-1 was used as a DNA probe: GCACTGTGCAGAGCACTCACCCCA (SEQ ID NO: 13). After 2 hours, the hybridization solution (hybridization buffer containing 1×10


6


cpm


32


P labeled DNA probe) was removed and the filters were washed under high stringency conditions (3×SSC, 0.05% pyrophosphate for 5 minutes at RT standing; followed by 2.2×SSC, 0.05% pyrophosphate for 15 minutes shaking at RT; followed by 2.2×SSC, 0.05% pyrophosphate for 1-2 minutes shaking at 65° C.). The filters were covered with Saran Wrap and exposed to X-ray film overnight. The autoradiographs were developed and positively hybridizing transformants of various signal intensities were identified. The positive clones were picked and then grown for 12 hours in selective medium (L-broth plus 100 ug/ml ampicillin). Plasmid DNA was prepared and sent for DNA sequence analysis. The stop codon was deduced from a consensus sequence derived from the 3P RACE products generated from both the testes and the stomach cDNAs.




With the exception of the region from base pair 1332 to 1517(for this description base pair #1 is A of the initiator Met (ATG), the full-length sequence of EST8 was confirmed. A search of the public databases revealed a partial sequence for EST8, termed ADAMTS10. We used the sequence from this partial clone to construct the contiguous region of our EST8 (base pair 1332 to 1517) with synthetic oligonucleotides.




The full-length sequence for EST8 (SEQ ID NO: 3) was the consensus sequence derived from the hybridization positive candidate 8-1, the publicly available sequences representing EST8, and the PCR products from the Clontech testes and stomach cDNAs. The final EST8 expression construct was assembled from 4 EST8 specific fragments. The 5P portion of EST8, from base pair 1-1342, was PCR amplified from a pool of stomach and testes cDNAs and will be termed fragment 1. The following primers were used; 5P PCR primer—AAATGGGCGAATTCCCACCATGGCTCCCGCCTGCCAGATCCTCCG (SEQ ID NO: 14) (contains an 8 base pair linker (AAATGGGC) an EcoRI cloning site (GAATTC) and a Kozak sequence (CCACC) upstream of the initiator Met) and 3P PCR primer—CCGAGTCTAGAAAGCTGGTGATGTAG (SEQ ID NO: 15) (contains an XbaI site (TCTAGA)). This PCR product was digested with EcoRI and XbaI using standard digestion conditions. The next portion of the gene, fragment 2, was constructed using synthetic oligonucleotides. The synthetic fragment stretched from an XbaI site to a BsrFI site representing base pair 1333 to 1517 of EST8. The synthetic oligonucleotides consisted of the following sequence: the top strand consisted of—CTAGACTCGGGCCTGGGGCTCTGCCTGAACAACCGACCCCCCAGACAGGACT TTGTGTACCCGACAGTGGCACCGGGCCAAGCCTACGATGCAGATGAGCAATG CCGCTTTCAGCATGGAGTCAAATCGCGTCAGTGTAAATACGGGGAGGTCTGC AGCGAGCTGTGGTGTCTGAGCAAGAGCAA (SEQ ID NO: 16); the bottom strand consisted of—CCGGTTGCTCTTGCTCAGACACCACAGCTCGCTGCAGACCTCCCCGTATTTAC ACTGACGCGATTTGACTCCATGCTGAAAGCGGCATTGCTCATCTGCATCGTAG GCTTGGCCCGGTGCCACTGTCGGGTACACAAAGTCCTGTCTGGGGGGTCGGTT GTTCAGGCAGAGCCCCAGGCCCGAGT (SEQ ID NO: 17). The next portion of EST8, fragment 3, was a BsrFI to SphI fragment digested from candidate 8-1. This represented from base pair 1518 to 2783 of the full-length version of EST8. The 3P portion of EST8, termed fragment 4 (base pair 2663 to 3314), was PCR amplified. The following primers were used; 5P—GGGTTGTAGGGAACTGGTCGCTCTG (SEQ ID NO: 18) (located within fragment 3, upstream of the SphI site) and 3P—AAATGGGCCTCGAGCCCTAGTGGCCCTGGCAGGTTTTGC (SEQ ID NO: 19) (contains an 8 base pair linker (AAATGGGC) and a XhoI site (CTCGAG) downstream of the stop codon (TAG)). This PCR product was digested with SphI and XhoI using standard digestion conditions. A full-length version of EST8 was constructed by ligating these 4 described fragments, 5P fragment 1 (EcoRI/XbaI), internal fragment 2 (XbaI/BsrFI), internal fragment 3 (BsrFI/SphI), and 3P fragment 4 (SphI/XhoI) into the Cos expression vector pED6-dpc2 (digested with EcoRI and XhoI). The final construct had a mutation in the XhoI cloning site, which was destroyed in the ligation. This did not effect the EST8 coding sequence and was left in the construct.




Example 2




Expression of Aggrecanase




In order to produce murine, human or other mammalian aggrecanase-related proteins, the DNA encoding it is transferred into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts including insect host cell culture systems by conventional genetic engineering techniques. Expression system for biologically active recombinant human aggrecanase is contemplated to be stably transformed mammalian cells, insect, yeast or bacterial cells.




One skilled in the art can construct mammalian expression vectors by employing the sequence of SEQ ID NO: 3 or the sequence of SEQ ID NO: 1 comprising nucleotide #1 to #3766 or comprising nuclotide #1086 to #3396 of SEQ ID NO: 1 or other DNA sequences encoding aggrecanase-related proteins or other modified sequences and known vectors, such as pCD (Okayama et al.,


Mol. Cell Biol


., 2:161-170 (1982)), pJL3, pJL4 (Gough et al.,


EMBO J


., 4:645-653 (1985)) and pMT2 CXM.




The mammalian expression vector pMT2 CXM is a derivative of p91023(b) (Wong et al.,


Science


228:810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene in place of the tetracycline resistance gene and further contains a XhoI site for insertion of cDNA clones. The functional elements of pMT2 CXM have been described (Kaufman, R. J., 1985, Proc. Natl. Acad. Sci. USA 82:689-693) and include the adenovirus VA genes, the SV40 origin of replication including the 72 bp enhancer, the adenovirus major late promoter including a 5′ splice site and the majority of the adenovirus tripartite leader sequence present on adenovirus late mRNAs, a 3′ splice acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40), and pBR322 sequences needed for propagation in


E. coli.






Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATCC), Rockville, Md. (USA) under accession number ATCC 67122. EcoRI digestion excises the cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to transform


E. coli


HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then constructed using loopout/in mutagenesis (Morinaga, et al.,


Biotechnology


84: 636 (1984)). This removes bases 1075 to 1145 relative to the Hind III site near the SV40 origin of replication and enhancer sequences of pMT2. In addition it inserts the following sequence:




5′PO-CATGGGCAGCTCGAG-3′(SEQ ID NO: 20) at nucleotide 1145. This sequence contains the recognition site for the restriction endonuclease Xho I. A derivative of pMT2CXM, termed pMT23, contains recognition sites for the restriction endonucleases PstI, Eco RI, SalI and XhoI. Plasmid pMT2 CXM and pMT23 DNA may be prepared by conventional methods.




pEMC2β1 derived from pMT21 may also be suitable in practice of the invention. pMT21 is derived from pMT2 which is derived from pMT2-VWF. As described above EcoRI digestion excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear form which can be ligated and used to transform


E. coli


HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods.




pMT21 is derived from pMT2 through the following two modifications. First, 76 bp of the 5′ untranslated region of the DHFR cDNA including a stretch of 19 G residues from G/C tailing for cDNA cloning is deleted. In this process, a XhoI site is inserted to obtain the following sequence immediately upstream from DHFR:












(SEQ ID NO: 21)






5′-ctgcagGCGAGCCTgaattcctcgagCCATCatg-3′






              PstI             Eco RI XhoI











Second, a unique ClaI site is introduced by digestion with EcoRV and XbaI, treatment with Klenow fragment of DNA polymerase I, and ligation to a ClaI linker (CATCGATG). This deletes a 250 bp segment from the adenovirus associated RNA (VAI) region but does not interfere with VAI RNA gene expression or function. pMT21 is digested with EcoRI and XhoI, and used to derive the vector pEMC2B1.




A portion of the EMCV leader is obtained from pMT2-ECAT1 (S. K. Jung, et al.,


J. Virol


63:1651-1660 (1989) by digestion with Eco RI and PstI, resulting in a 2752 bp fragment. This fragment is digested with TaqI yielding an Eco RI-TaqI fragment of 508 bp which is purified by electrophoresis on low melting agarose gel. A 68 bp adapter and its complementary strand are synthesized with a 5′TaqI protruding end and a 3′XhoI protruding end which has the following sequence:












(SEQ ID NO: 22)






5′-cgaGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTT






   TaqI













TCCTTTGAAAAACACGattgc-3′






                XhoI











This sequence matches the EMC virus leader sequence from nucleotide 763 to 827. It also changes the ATG at position 10 within the EMC virus leader to an ATT and is followed by a XhoI site. A three way ligation of the pMT21 Eco RI-16hoI fragment, the EMC virus EcoRI-TaqI fragment, and the 68 bp oligonucleotide adapter TaqI-16hoI adapter resulting in the vector pEMC2β1.




This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VAI gene, DHFR and β-lactamase markers and an EMC sequence, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells.




The construction of vectors may involve modification of the aggrecanase-related DNA sequences. For instance, aggrecanase cDNA can be modified by removing the non-coding nucleotides on the 5′ and 3′ ends of the coding region. The deleted non-coding nucleotides may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into appropriate host cells for expression of aggrecanase-related proteins. Additionally, the sequence of SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide #1 to #3766 or comprising nuclotide #1086 to #3396 of SEQ ID NO: 1 or other sequences encoding aggrecanase-related proteins can be manipulated to express a mature aggrecanase-related protein by deleting aggrecanase encoding propeptide sequences and replacing them with sequences encoding the complete propeptides of other aggrecanase proteins.




One skilled in the art can manipulate the sequences of SEQ ID NO: 3 or SEQ ID NO: 1 by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding sequences could be further manipulated (e.g. ligated to other known linkers or modified by deleting non-coding sequences therefrom or altering nucleotides therein by other known techniques). The modified aggrecanase-related coding sequence could then be inserted into a known bacterial vector using procedures such as described in T. Taniguchi et al.,


Proc. Natl Acad. Sci. USA


, 77:5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a aggrecanase-related protein expressed thereby. For a strategy for producing extracellular expression of aggrecanase-related proteins in bacterial cells, see, e.g. European patent application EP 177,343.




Similar manipulations can be performed for the construction of an insect vector (See, e.g. procedures described in published European patent application 155,476) for expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present invention by yeast cells. (See, e.g., procedures described in published PCT application WO 86/00639 and European patent application EP 123,289).




A method for producing high levels of a aggrecanase-related protein of the invention in mammalian, bacterial, yeast or insect host cell systems may involve the construction of cells containing multiple copies of the heterologous Aggrecanase-related gene. The heterologous gene is linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing increased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp,


J. Mol. Biol


., 159:601-629 (1982). This approach can be employed with a number of different cell types.




For example, a plasmid containing a DNA sequence for an aggrecanase-related protein of the invention in operative association with other plasmid sequences enabling expression thereof and the DHFR expression plasmid pAdA26SV(A)3 (Kaufman and Sharp,


Mol. Cell. Biol


., 2:1304 (1982)) can be co-introduced into DHFR-deficient CHO cells, DUKX-BII, by various methods including calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion. DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5 uM MTX) as described in Kaufman et al.,


Mol Cell Biol


., 5:1750 (1983). Transformants are cloned, and biologically active aggrecanase expression is monitored by the assays described above. Aggrecanase protein expression should increase with increasing levels of MTX resistance. Aggrecanase polypeptides are characterized using standard techniques known in the art such as pulse labeling with (35S) methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can be followed to produce other related aggrecanase-related proteins.




In one example the aggrecanase gene of the present invention set forth in SEQ ID NO: 3 is cloned into the expression vector pED6 (Kaufman et al., Nucleic Acid Res. 19:4885-4490(1991)). COS and CHO DUKX B11 cells are transiently transfected with the aggrecanase sequence of the invention (+/− co-transfection of PACE on a separate pED6 plaasmid) by lipofection(LF2000, Invitrogen). Duplicate tranfections are performed for each gene of interest: (a) one for harvesting conditioned media for activity assay and (b) one for 35-S-methionine/cysteine metabolic labeling.




On day one media is changed to DME(COS) or alpha(CHO) media+1% heat-inactivated fetal calf serum+/−100 μg/ml heparin on wells(a) to be harvested for activity assay. After 48 h (day4), conditioned media is harvested for activity assay.




On day 3, the duplicate wells(b) were changed to MEM (methiooine-free/cyysteine free) media+1% heat-inactivated fetal callf serum+100 μg/ml heparin+100 μCi/ml 35S-methioine/cysteine (Redivue Pro mix, Amersham). Following 6 h incubation at 37° C., conditioned media was harvested and run on SDS-PAGE gels under reducing conditions. Proteins are visualized by autoradiography.




Example 3




Biological Activity of Expressed Aggrecanase




To measure the biological activity of the expressed aggrecanase-related proteins obtained in Example 2 above, the proteins are recovered from the cell culture and purified by isolating the aggrecanase-related proteins from other proteinaceous materials with which they are co-produced as well as from other contaminants. The purified protein may be assayed in accordance with assays described above. Purification is carried out using standard techniques known to those skilled in the art.




Protein analysis is conducted using standard techniques such as SDS-PAGE acrylamide (Laemmli,


Nature


227:680 (1970)) stained with silver (Oakley, et al.


Anal. Biochem


. 105:361 (1980)) and by immunoblot (Towbin, et al.


Proc. Natl. Acad. Sci. USA


76:4350 (1979)).




The foregoing descriptions detail presently preferred embodiments of the present invention. Numerous modifications and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these descriptions. Those modifications and variations are believed to be encompassed within the claims appended hereto.







22




1


3766


DNA


Unknown Organism




Description of Unknown Organism Nucleotide
sequence of the aggrecanase molecule






1
gcggccgctg aattctaggg aggccccggg cgcggcgcag gctccaaaga agaagaaacc 60
aaggcccaga gagggaggcc caggtgcagg gagcaggcga gggaaggatc cgtacagggg 120
cccaacacta ctccaccaac cgaagccccc aaaaggagcc cggtgatgct gcgaaggctg 180
tgaacagggg aggcggcact gtgggggctg ccggcagccg gggctgggga gagacatgtg 240
gacacgtggc ctctatggct cccgcctgcc agatcctccg ctgggccctc gccctggggc 300
tgggcctcat gttcgaggtc acgcacgcct tccggtctca agatgagttc ctgtccagtc 360
tggagagcta tgagatcgcc ttccccaccc gcgtggacca caacggggca ctgctggcct 420
tctcgccacc tcctccccgg aggcagcgcc gcggcacggg ggccacagcc gagtcccgcc 480
tcttctacaa agtggcctcg cccagcaccc acttcctgct gaacctgacc cgcagctccc 540
gtctactggc agggcacgtc tccgtggagt actggacacg ggagggcctg gcctggcaga 600
gggcggcccg gccccactgc ctctacgctg gtcacctgca gggccaggcc agcagctccc 660
atgtggccat cagcacctgt ggaggcctgc acggcctgat cgtggcagac gaggaagagt 720
acctgattga gcccctgcac ggtgggccca agggttctcg gagcccggag gaaagtggac 780
cacatgtggt gtacaagcgt tcctctctgc gtcaccccca cctggacaca gcctgtggag 840
tgagagatga gaaaccgtgg aaagggcggc catggtggct gcggaccttg aagccaccgc 900
ctgccaggcc cctggggaat gaaacagagc gtggccagcc aggcctgaag cgatcggtca 960
gccgagagcg ctacgtggag accctggtgg tggctgacaa gatgatggtg gcctatcacg 1020
ggcgccggga tgtggagcag tatgtcctgg ccatcatgaa cattgttgcc aaacttttcc 1080
aggactcgag tctgggaagc accgttaaca tcctcgtaac tcgcctcatc ctgctcacgg 1140
aggaccagcc cactctggag atcacccacc atgccgggaa gtccctggac agcttctgta 1200
agtggcagaa atccatcgtg aaccacagcg gccatggcaa tgccattcca gagaacggtg 1260
tggctaacca tgacacagca gtgctcatca cacgctatga catctgcatc tacaagaaca 1320
aaccctgcgg cacactaggc ctggccccgg tgggcggaat gtgtgagcgc gagagaagct 1380
gcagcgtcaa tgaggacatt ggcctggcca cagcgttcac cattgcccac gagatcgggc 1440
acacattcgg catgaaccat gacggcgtgg gaaacagctg tggggcccgt ggtcaggacc 1500
cagccaagct catggctgcc cacattacca tgaagaccaa cccattcgtg tggtcatcct 1560
gcagccgtga ctacatcacc agctttctag actcagggcc tggggctctg cctgaacaac 1620
cggcccccca gacaggactt tgtgtacccg acagtggcac cgggccaagc ctacgatgca 1680
gatgagcaat gccgctttca gcatggagtc aaatcgcgtc agtgtaaata cgggaggtct 1740
gcagcgagct gtggtgtctg agcaagagca accggtgcat caccaacagc atcccggccg 1800
ccgagggcac gctgtgccag acgcacacca tcgacaaggg gtggtgctac aaacgggtct 1860
gtgtcccctt tgggtcgcgc ccagagggtg tggacggagc ctgggggccg tggactccat 1920
ggggcgactg cagccggacc tgtggcggcg gcgtgtcctc ttctagccgt cactgcgaca 1980
gccccaggcc aaccatcggg ggcaagtact gtctgggtga gagaaggcgg caccgctcct 2040
gcaacacgga tgactgtccc cctggctccc aggacttcag agaagtgcag tgttctgaat 2100
ttgacagcat ccctttccgt gggaaattct acaagtggaa aacgtaccgg ggagggggcg 2160
tgaaggcctg ctcgctcacg tgcctagcgg aaggcttcaa cttctacacg gagagggcgg 2220
cagccgtggt ggacgggaca ccctgccgtc cagacacggt ggacatttgc gtcagtggcg 2280
aatgcaagca cgtgggctgc gaccgagtcc tgggctccga cctgcgggag gacaagtgcc 2340
gagtgtgtgg cggtgacggc agtgcctgcg agaccatcga gggcgtcttc agcccagcct 2400
cacctggggc cgggtacgag gatgtcgtct ggattcccaa aggctccgtc cacatcttca 2460
tccaggatct gaacctctct ctcagtcact tggccctgaa gggagaccag gagtccctgc 2520
tgctggaggg gctgcccggg accccccagc cccaccgtct gcctctagct gggaccacct 2580
ttcaactgcg acaggggcca gaccaggtcc agagcctcga agccctggga ccgattaatg 2640
catctctcat cgtcatggtg ctggcccgga ccgagctgcc tgccctccgc taccgcttca 2700
atgcccccat cgcccgtgac tcgctgcccc cctactcctg gcactatgcg ccctggacca 2760
agtgctcggc ccagtgtgca ggcggtagcc aggtgcaggc ggtggagtgc cgcaaccagc 2820
tggacagctc cgcggtcgcc ccccactact gcagtgccca cagcaagctg cccaaaaggc 2880
agcgcgcctg caacacggag ccttgccctc cagactgggt tgtagggaac tggtcgctct 2940
gcagccgcag ctgcgatgca ggcgtgcgca gccgctcggt cgtgtgccag cgccgcgtct 3000
ctgccgcgga ggagaaggcg ctggacgaca gcgcatgccc gcagccgcgc ccacctgtac 3060
tggaggcctg ccacggcccc acttgccctc cggagtgggc ggccctcgac tggtctgagt 3120
gcacccccag ctgcgggccg ggcctccgcc accgcgtggt cctttgcaag agcgcagacc 3180
accgcgccac gctgcccccg gcgcactgct cacccgccgc caagccaccg gccaccatgc 3240
gctgcaactt gcgccgctgc cccccggccc gctgggtggc tggcgagtgg ggtgagtgct 3300
ctgcacagtg cggcgtcggg cagcggcagc gctcggtgcg ctgcaccagc cacacgggcc 3360
aggcgtcgca cgagtgcacg gaggccctgc ggccgcccac cacgcagcaa tgtgaggcca 3420
agtgcgacag cccaaccccc gggggcggcc ctgaagagtg caaggatgtg aacaaggtcg 3480
cctactgccc cctggtgctc aaatttcagt tctgcagccg agcctacttc cgccagatgt 3540
gctgcaaaac ctgccagggc cactaggggg cgcgcggcac ccggagccac agctggcggg 3600
gtctccgccg ccagtcctgc agcgggccgg ccagaggggg ccccgggggg gcgggaactg 3660
ggagggaagg gtgagacgga gccggaagtt atttattggg aacccctgca gggccctggc 3720
tggggggatg gagaggggct ggctatccac ctgcccgggc ggccgc 3766




2


770


PRT


Unknown Organism




Description of Unknown Organism Amino acid
sequence of the aggrecanase molecule






2
Ser Ser Leu Gly Ser Thr Val Asn Ile Leu Val Thr Arg Leu Ile Leu
1 5 10 15
Leu Thr Glu Asp Gln Pro Thr Leu Glu Ile Thr His His Ala Gly Lys
20 25 30
Ser Leu Asp Ser Phe Cys Lys Trp Gln Lys Ser Ile Val Asn His Ser
35 40 45
Gly His Gly Asn Ala Ile Pro Glu Asn Gly Val Ala Asn His Asp Thr
50 55 60
Ala Val Leu Ile Thr Arg Tyr Asp Ile Cys Ile Tyr Lys Asn Lys Pro
65 70 75 80
Cys Gly Thr Leu Gly Leu Ala Pro Val Gly Gly Met Cys Glu Arg Glu
85 90 95
Arg Ser Cys Ser Val Asn Glu Asp Ile Gly Leu Ala Thr Ala Phe Thr
100 105 110
Ile Ala His Glu Ile Gly His Thr Phe Gly Met Asn His Asp Gly Val
115 120 125
Gly Asn Ser Cys Gly Ala Arg Gly Gln Asp Pro Ala Lys Leu Met Ala
130 135 140
Ala His Ile Thr Met Lys Thr Asn Pro Phe Val Trp Ser Ser Cys Ser
145 150 155 160
Arg Asp Tyr Ile Thr Ser Phe Leu Asp Ser Gly Pro Gly Ala Leu Pro
165 170 175
Glu Gln Pro Ala Pro Gln Thr Gly Leu Cys Val Pro Asp Ser Gly Thr
180 185 190
Gly Pro Ser Leu Arg Cys Arg Xaa Ala Met Pro Leu Ser Ala Trp Ser
195 200 205
Gln Ile Ala Ser Val Xaa Ile Arg Glu Val Cys Ser Glu Leu Trp Cys
210 215 220
Leu Ser Lys Ser Asn Arg Cys Ile Thr Asn Ser Ile Pro Ala Ala Glu
225 230 235 240
Gly Thr Leu Cys Gln Thr His Thr Ile Asp Lys Gly Trp Cys Tyr Lys
245 250 255
Arg Val Cys Val Pro Phe Gly Ser Arg Pro Glu Gly Val Asp Gly Ala
260 265 270
Trp Gly Pro Trp Thr Pro Trp Gly Asp Cys Ser Arg Thr Cys Gly Gly
275 280 285
Gly Val Ser Ser Ser Ser Arg His Cys Asp Ser Pro Arg Pro Thr Ile
290 295 300
Gly Gly Lys Tyr Cys Leu Gly Glu Arg Arg Arg His Arg Ser Cys Asn
305 310 315 320
Thr Asp Asp Cys Pro Pro Gly Ser Gln Asp Phe Arg Glu Val Gln Cys
325 330 335
Ser Glu Phe Asp Ser Ile Pro Phe Arg Gly Lys Phe Tyr Lys Trp Lys
340 345 350
Thr Tyr Arg Gly Gly Gly Val Lys Ala Cys Ser Leu Thr Cys Leu Ala
355 360 365
Glu Gly Phe Asn Phe Tyr Thr Glu Arg Ala Ala Ala Val Val Asp Gly
370 375 380
Thr Pro Cys Arg Pro Asp Thr Val Asp Ile Cys Val Ser Gly Glu Cys
385 390 395 400
Lys His Val Gly Cys Asp Arg Val Leu Gly Ser Asp Leu Arg Glu Asp
405 410 415
Lys Cys Arg Val Cys Gly Gly Asp Gly Ser Ala Cys Glu Thr Ile Glu
420 425 430
Gly Val Phe Ser Pro Ala Ser Pro Gly Ala Gly Tyr Glu Asp Val Val
435 440 445
Trp Ile Pro Lys Gly Ser Val His Ile Phe Ile Gln Asp Leu Asn Leu
450 455 460
Ser Leu Ser His Leu Ala Leu Lys Gly Asp Gln Glu Ser Leu Leu Leu
465 470 475 480
Glu Gly Leu Pro Gly Thr Pro Gln Pro His Arg Leu Pro Leu Ala Gly
485 490 495
Thr Thr Phe Gln Leu Arg Gln Gly Pro Asp Gln Val Gln Ser Leu Glu
500 505 510
Ala Leu Gly Pro Ile Asn Ala Ser Leu Ile Val Met Val Leu Ala Arg
515 520 525
Thr Glu Leu Pro Ala Leu Arg Tyr Arg Phe Asn Ala Pro Ile Ala Arg
530 535 540
Asp Ser Leu Pro Pro Tyr Ser Trp His Tyr Ala Pro Trp Thr Lys Cys
545 550 555 560
Ser Ala Gln Cys Ala Gly Gly Ser Gln Val Gln Ala Val Glu Cys Arg
565 570 575
Asn Gln Leu Asp Ser Ser Ala Val Ala Pro His Tyr Cys Ser Ala His
580 585 590
Ser Lys Leu Pro Lys Arg Gln Arg Ala Cys Asn Thr Glu Pro Cys Pro
595 600 605
Pro Asp Trp Val Val Gly Asn Trp Ser Leu Cys Ser Arg Ser Cys Asp
610 615 620
Ala Gly Val Arg Ser Arg Ser Val Val Cys Gln Arg Arg Val Ser Ala
625 630 635 640
Ala Glu Glu Lys Ala Leu Asp Asp Ser Ala Cys Pro Gln Pro Arg Pro
645 650 655
Pro Val Leu Glu Ala Cys His Gly Pro Thr Cys Pro Pro Glu Trp Ala
660 665 670
Ala Leu Asp Trp Ser Glu Cys Thr Pro Ser Cys Gly Pro Gly Leu Arg
675 680 685
His Arg Val Val Leu Cys Lys Ser Ala Asp His Arg Ala Thr Leu Pro
690 695 700
Pro Ala His Cys Ser Pro Ala Ala Lys Pro Pro Ala Thr Met Arg Cys
705 710 715 720
Asn Leu Arg Arg Cys Pro Pro Ala Arg Trp Val Ala Gly Glu Trp Gly
725 730 735
Glu Cys Ser Ala Gln Cys Gly Val Gly Gln Arg Gln Arg Ser Val Arg
740 745 750
Cys Thr Ser His Thr Gly Gln Ala Ser His Glu Cys Thr Glu Ala Leu
755 760 765
Arg Pro
770




3


3377


DNA


Unknown Organism




Description of Unknown Organism Nucleotide
sequence of the aggrecanase molecule






3
gaattcccac catggctccc gcctgccaga tcctccgctg ggccctcgcc ctggggctgg 60
gcctcatgtt cgaggtcacg cacgccttcc ggtctcaaga tgagttcctg tccagtctgg 120
agagctatga gatcgccttc cccacccgcg tggaccacaa cggggcactg ctggccttct 180
cgccacctcc tccccggagg cagcgccgcg gcacgggggc cacagccgag tcccgcctct 240
tctacaaagt ggcctcgccc agcacccact tcctgctgaa cctgacccgc agctcccgtc 300
tactggcagg gcacgtctcc gtggagtact ggacacggga gggcctggcc tggcagagag 360
cggcccggcc ccactgcctc tacgctggtc acctgcaggg ccaggccagc agctcccatg 420
tggccatcag cacctgtgga ggcctgcacg gcctgatcgt ggcagacgag gaagagtacc 480
tgattgagcc cctgcacggt gggcccaagg gttctcggag cccggaggaa agtggaccac 540
atgtggtgta caagcgttcc tctctgcgtc acccccacct ggacacagcc tgtggagtga 600
gagatgagaa accgtggaaa gggcggccat ggtggctgcg gaccttgaag ccaccgcctg 660
ccaggcccct ggggaatgaa acagagcgtg gccagccagg cctgaagcga tcggtcagcc 720
gagagcgcta cgtggagacc ctggtggtgg ctgacaagat gatggtggcc tatcacgggc 780
gccgggatgt ggagcagtat gtcctggcca tcatgaacat tgttgccaaa cttttccagg 840
actcgagtct gggaagcacc gttaacatcc tcgtaactcg cctcatcctg ctcacggagg 900
accagcccac tctggagatc acccaccatg ccgggaagtc cctggacagc ttctgtaagt 960
ggcagaaatc catcgtgaac cacagcggtc atggcaatgc cattccagag aacggtgtgg 1020
ctaaccatga cacagcagtg ctcatcacac gctatgacat ctgcatctac aagaacaaac 1080
cctgcggcac actaggcctg gccccggtgg gcggaatgtg tgagcgcgag agaagctgca 1140
gcgtcaatga ggacattggc ctggccacag cgttcaccat tgcccacgag atcgggcaca 1200
cattcggcat gaaccatgac ggcgtgggaa acagctgtgg ggcccgtggt caggacccag 1260
ccaagctcat ggctgcccac attaccatga agaccaaccc gttcgtgtgg tcatcctgca 1320
gccgtgacta catcaccagc tttctagact cgggcctggg gctctgcctg aacaaccgac 1380
cccccagaca ggactttgtg tacccgacag tggcaccggg ccaagcctac gatgcagatg 1440
agcaatgccg ctttcagcat ggagtcaaat cgcgtcagtg taaatacggg gaggtctgca 1500
gcgagctgtg gtgtctgagc aagagcaacc ggtgcatcac caacagcatc ccggccgccg 1560
agggcacgct gtgccagacg cacaccatcg acaaggggtg gtgctacaaa cgggtctgtg 1620
tcccctttgg gtcgcgccca gagggtgtgg acggagcctg ggggccgtgg actccatggg 1680
gcgactgcag ccggacctgt ggcggcggcg tgtcctcttc tagccgtcac tgcgacagcc 1740
ccaggccaac catcgggggc aagtactgtc tgggtgagag aaggcggcac cgctcctgca 1800
acacggatga ctgtccccct ggctcccagg acttcagaga agtgcagtgt tctgaatttg 1860
acagcatccc tttccgtggg aaattctaca agtggaaaac gtaccgggga gggggcgtga 1920
aggcctgctc gctcacgtgc ctagcggaag gcttcaactt ctacacggag agggcggcag 1980
ccgtggtgga cgggacaccc tgccgtccag acacggtgga catttgcgtc agtggcgaat 2040
gcaagcacgt gggctgcgac cgagtcctgg gctccgacct gcgggaggac aagtgccgag 2100
tgtgtggcgg tgacggcagt gcctgcgaga ccatcgaggg cgtcttcagc ccagcctcac 2160
ctggggccgg gtacgaggat gtcgtctgga ttcccaaagg ctccgtccac atcttcatcc 2220
aggatctgaa cctctctctc agtcacttgg ccctgaaggg agaccaggag tccctgctgc 2280
tggaggggct gcccgggacc ccccagcccc accgtctgcc tctagctggg accacctttc 2340
aactgcgaca ggggccagac caggtccaga gcctcgaagc cctgggaccg attaatgcat 2400
ctctcatcgt catggtgctg gcccggaccg agctgcctgc cctccgctac cgcttcaatg 2460
cccccatcgc ccgtgactcg ctgcccccct actcctggca ctatgcgccc tggaccaagt 2520
gctcggccca gtgtgcaggc ggtagccagg tgcaggcggt ggagtgccgc aaccagctgg 2580
acagctccgc ggtcgccccc cactactgca gtgcccacag caagctgccc aaaaggcagc 2640
gcgcctgcaa cacggagcct tgccctccag actgggttgt agggaactgg tcgctctgca 2700
gccgcagctg cgatgcaggc gtgcgcagcc gctcggtcgt gtgccagcgc cgcgtctctg 2760
ccgcggagga gaaggcgctg gacgacagcg catgcccgca gccgcgccca cctgtactgg 2820
aggcctgcca cggccccact tgccctccgg agtgggcggc cctcgactgg tctgagtgca 2880
cccccagttg cgggccgggc ctccgccacc gcgtggtcct ttgcaagagc gcagaccacc 2940
gcgccacgct gcccccggcg cactgctcac ccgccgccaa gccaccggcc accatgcgct 3000
gcaacttgcg ccgctgcccc ccggcccgct gggtggctgg cgagtggggt gagtgctctg 3060
cacagtgcgg cgtcgggcag cggcagcgct cggtgcgctg caccagccac acgggccagg 3120
cgtcgcacga gtgcacggag gccctgcggc cgcccaccac gcagcagtgt gaggccaagt 3180
gcgacagccc aacccccggg gacggccctg aagagtgcaa ggatgtgaac aaggtcgcct 3240
actgccccct ggtgctcaaa tttcagttct gcagccgagc ctacttccgc cagatgtgct 3300
gcaaaacctg ccagggccac tagggtcgag gcccatttaa gccgaattct gcagatatcc 3360
atcacactgg cggccgc 3377




4


1104


PRT


Unknown Organism




Description of Unknown Organism Amino acid
sequence of the aggrecanase molecule






4
Met Ala Pro Ala Cys Gln Ile Leu Arg Trp Ala Leu Ala Leu Gly Leu
1 5 10 15
Gly Leu Met Phe Glu Val Thr His Ala Phe Arg Ser Gln Asp Glu Phe
20 25 30
Leu Ser Ser Leu Glu Ser Tyr Glu Ile Ala Phe Pro Thr Arg Val Asp
35 40 45
His Asn Gly Ala Leu Leu Ala Phe Ser Pro Pro Pro Pro Arg Arg Gln
50 55 60
Arg Arg Gly Thr Gly Ala Thr Ala Glu Ser Arg Leu Phe Tyr Lys Val
65 70 75 80
Ala Ser Pro Ser Thr His Phe Leu Leu Asn Leu Thr Arg Ser Ser Arg
85 90 95
Leu Leu Ala Gly His Val Ser Val Glu Tyr Trp Thr Arg Glu Gly Leu
100 105 110
Ala Trp Gln Arg Ala Ala Arg Pro His Cys Leu Tyr Ala Gly His Leu
115 120 125
Gln Gly Gln Ala Ser Ser Ser His Val Ala Ile Ser Thr Cys Gly Gly
130 135 140
Leu His Gly Leu Ile Val Ala Asp Glu Glu Glu Tyr Leu Ile Glu Pro
145 150 155 160
Leu His Gly Gly Pro Lys Gly Ser Arg Ser Pro Glu Glu Ser Gly Pro
165 170 175
His Val Val Tyr Lys Arg Ser Ser Leu Arg His Pro His Leu Asp Thr
180 185 190
Ala Cys Gly Val Arg Asp Glu Lys Pro Trp Lys Gly Arg Pro Trp Trp
195 200 205
Leu Arg Thr Leu Lys Pro Pro Pro Ala Arg Pro Leu Gly Asn Glu Thr
210 215 220
Glu Arg Gly Gln Pro Gly Leu Lys Arg Ser Val Ser Arg Glu Arg Tyr
225 230 235 240
Val Glu Thr Leu Val Val Ala Asp Lys Met Met Val Ala Tyr His Gly
245 250 255
Arg Arg Asp Val Glu Gln Tyr Val Leu Ala Ile Met Asn Ile Val Ala
260 265 270
Lys Leu Phe Gln Asp Ser Ser Leu Gly Ser Thr Val Asn Ile Leu Val
275 280 285
Thr Arg Leu Ile Leu Leu Thr Glu Asp Gln Pro Thr Leu Glu Ile Thr
290 295 300
His His Ala Gly Lys Ser Leu Asp Ser Phe Cys Lys Trp Gln Lys Ser
305 310 315 320
Ile Val Asn His Ser Gly His Gly Asn Ala Ile Pro Glu Asn Gly Val
325 330 335
Ala Asn His Asp Thr Ala Val Leu Ile Thr Arg Tyr Asp Ile Cys Ile
340 345 350
Tyr Lys Asn Lys Pro Cys Gly Thr Leu Gly Leu Ala Pro Val Gly Gly
355 360 365
Met Cys Glu Arg Glu Arg Ser Cys Ser Val Asn Glu Asp Ile Gly Leu
370 375 380
Ala Thr Ala Phe Thr Ile Ala His Glu Ile Gly His Thr Phe Gly Met
385 390 395 400
Asn His Asp Gly Val Gly Asn Ser Cys Gly Ala Arg Gly Gln Asp Pro
405 410 415
Ala Lys Leu Met Ala Ala His Ile Thr Met Lys Thr Asn Pro Phe Val
420 425 430
Trp Ser Ser Cys Ser Arg Asp Tyr Ile Thr Ser Phe Leu Asp Ser Gly
435 440 445
Leu Gly Leu Cys Leu Asn Asn Arg Pro Pro Arg Gln Asp Phe Val Tyr
450 455 460
Pro Thr Val Ala Pro Gly Gln Ala Tyr Asp Ala Asp Glu Gln Cys Arg
465 470 475 480
Phe Gln His Gly Val Lys Ser Arg Gln Cys Lys Tyr Gly Glu Val Cys
485 490 495
Ser Glu Leu Trp Cys Leu Ser Lys Ser Asn Arg Cys Ile Thr Asn Ser
500 505 510
Ile Pro Ala Ala Glu Gly Thr Leu Cys Gln Thr His Thr Ile Asp Lys
515 520 525
Gly Trp Cys Tyr Lys Arg Val Cys Val Pro Phe Gly Ser Arg Pro Glu
530 535 540
Gly Val Asp Gly Ala Trp Gly Pro Trp Thr Pro Trp Gly Asp Cys Ser
545 550 555 560
Arg Thr Cys Gly Gly Gly Val Ser Ser Ser Ser Arg His Cys Asp Ser
565 570 575
Pro Arg Pro Thr Ile Gly Gly Lys Tyr Cys Leu Gly Glu Arg Arg Arg
580 585 590
His Arg Ser Cys Asn Thr Asp Asp Cys Pro Pro Gly Ser Gln Asp Phe
595 600 605
Arg Glu Val Gln Cys Ser Glu Phe Asp Ser Ile Pro Phe Arg Gly Lys
610 615 620
Phe Tyr Lys Trp Lys Thr Tyr Arg Gly Gly Gly Val Lys Ala Cys Ser
625 630 635 640
Leu Thr Cys Leu Ala Glu Gly Phe Asn Phe Tyr Thr Glu Arg Ala Ala
645 650 655
Ala Val Val Asp Gly Thr Pro Cys Arg Pro Asp Thr Val Asp Ile Cys
660 665 670
Val Ser Gly Glu Cys Lys His Val Gly Cys Asp Arg Val Leu Gly Ser
675 680 685
Asp Leu Arg Glu Asp Lys Cys Arg Val Cys Gly Gly Asp Gly Ser Ala
690 695 700
Cys Glu Thr Ile Glu Gly Val Phe Ser Pro Ala Ser Pro Gly Ala Gly
705 710 715 720
Tyr Glu Asp Val Val Trp Ile Pro Lys Gly Ser Val His Ile Phe Ile
725 730 735
Gln Asp Leu Asn Leu Ser Leu Ser His Leu Ala Leu Lys Gly Asp Gln
740 745 750
Glu Ser Leu Leu Leu Glu Gly Leu Pro Gly Thr Pro Gln Pro His Arg
755 760 765
Leu Pro Leu Ala Gly Thr Thr Phe Gln Leu Arg Gln Gly Pro Asp Gln
770 775 780
Val Gln Ser Leu Glu Ala Leu Gly Pro Ile Asn Ala Ser Leu Ile Val
785 790 795 800
Met Val Leu Ala Arg Thr Glu Leu Pro Ala Leu Arg Tyr Arg Phe Asn
805 810 815
Ala Pro Ile Ala Arg Asp Ser Leu Pro Pro Tyr Ser Trp His Tyr Ala
820 825 830
Pro Trp Thr Lys Cys Ser Ala Gln Cys Ala Gly Gly Ser Gln Val Gln
835 840 845
Ala Val Glu Cys Arg Asn Gln Leu Asp Ser Ser Ala Val Ala Pro His
850 855 860
Tyr Cys Ser Ala His Ser Lys Leu Pro Lys Arg Gln Arg Ala Cys Asn
865 870 875 880
Thr Glu Pro Cys Pro Pro Asp Trp Val Val Gly Asn Trp Ser Leu Cys
885 890 895
Ser Arg Ser Cys Asp Ala Gly Val Arg Ser Arg Ser Val Val Cys Gln
900 905 910
Arg Arg Val Ser Ala Ala Glu Glu Lys Ala Leu Asp Asp Ser Ala Cys
915 920 925
Pro Gln Pro Arg Pro Pro Val Leu Glu Ala Cys His Gly Pro Thr Cys
930 935 940
Pro Pro Glu Trp Ala Ala Leu Asp Trp Ser Glu Cys Thr Pro Ser Cys
945 950 955 960
Gly Pro Gly Leu Arg His Arg Val Val Leu Cys Lys Ser Ala Asp His
965 970 975
Arg Ala Thr Leu Pro Pro Ala His Cys Ser Pro Ala Ala Lys Pro Pro
980 985 990
Ala Thr Met Arg Cys Asn Leu Arg Arg Cys Pro Pro Ala Arg Trp Val
995 1000 1005
Ala Gly Glu Trp Gly Glu Cys Ser Ala Gln Cys Gly Val Gly Gln Arg
1010 1015 1020
Gln Arg Ser Val Arg Cys Thr Ser His Thr Gly Gln Ala Ser His Glu
1025 1030 1035 1040
Cys Thr Glu Ala Leu Arg Pro Pro Thr Thr Gln Gln Cys Glu Ala Lys
1045 1050 1055
Cys Asp Ser Pro Thr Pro Gly Asp Gly Pro Glu Glu Cys Lys Asp Val
1060 1065 1070
Asn Lys Val Ala Tyr Cys Pro Leu Val Leu Lys Phe Gln Phe Cys Ser
1075 1080 1085
Arg Ala Tyr Phe Arg Gln Met Cys Cys Lys Thr Cys Gln Gly His Xaa
1090 1095 1100




5


11


PRT


Artificial Sequence




Description of Artificial Sequence Synthetic
zinc binding signature sequence






5
Thr Ala Ala His Glu Leu Gly His Val Lys Phe
1 5 10




6


28


DNA


Artificial Sequence




Description of Artificial Sequence Probe





6
ggtcaaatcg cgtcagtgta aatacggg 28




7


30


DNA


Artificial Sequence




Description of Artificial Sequence Primer





7
agtctagaaa gctggtgatg tagtcacggc 30




8


35


DNA


Artificial Sequence




Description of Artificial Sequence Primer





8
tagatgcata tgtcatagcg tgtgatgagc actgc 35




9


29


DNA


Artificial Sequence




Description of Artificial Sequence Probe





9
ctcgagtctg ggaagcaccg ttaacatcc 29




10


27


DNA


Artificial Sequence




Description of Artificial Sequence Probe





10
gaaggcgatc tcatagctct ccagact 27




11


31


DNA


Artificial Sequence




Description of Artificial Sequence Primer





11
gctctagact ggtctgagtg cacccccagc t 31




12


24


DNA


Artificial Sequence




Description of Artificial Sequence Primer





12
gtcctttgca agagcgcaga ccac 24




13


24


DNA


Artificial Sequence




Description of Artificial Sequence Probe





13
gcactgtgca gagcactcac ccca 24




14


45


DNA


Artificial Sequence




Description of Artificial Sequence Primer





14
aaatgggcga attcccacca tggctcccgc ctgccagatc ctccg 45




15


26


DNA


Artificial Sequence




Description of Artificial Sequence Primer





15
ccgagtctag aaagctggtg atgtag 26




16


185


DNA


Artificial Sequence




Description of Artificial Sequence Synthetic
oligonucleotide






16
ctagactcgg gcctggggct ctgcctgaac aaccgacccc ccagacagga ctttgtgtac 60
ccgacagtgg caccgggcca agcctacgat gcagatgagc aatgccgctt tcagcatgga 120
gtcaaatcgc gtcagtgtaa atacggggag gtctgcagcg agctgtggtg tctgagcaag 180
agcaa 185




17


185


DNA


Artificial Sequence




Description of Artificial Sequence Synthetic
oligonucleotide






17
ccggttgctc ttgctcagac accacagctc gctgcagacc tccccgtatt tacactgacg 60
cgatttgact ccatgctgaa agcggcattg ctcatctgca tcgtaggctt ggcccggtgc 120
cactgtcggg tacacaaagt cctgtctggg gggtcggttg ttcaggcaga gccccaggcc 180
cgagt 185




18


25


DNA


Artificial Sequence




Description of Artificial Sequence Primer





18
gggttgtagg gaactggtcg ctctg 25




19


39


DNA


Artificial Sequence




Description of Artificial Sequence Primer





19
aaatgggcct cgagccctag tggccctggc aggttttgc 39




20


15


DNA


Artificial Sequence




Description of Artificial Sequence Synthetic
oligonucleotide






20
catgggcagc tcgag 15




21


34


DNA


Artificial Sequence




Description of Artificial Sequence Synthetic
oligonucleotide






21
ctgcaggcga gcctgaattc ctcgagccat catg 34




22


68


DNA


Artificial Sequence




Description of Artificial Sequence Synthetic
oligonucleotide






22
cgaggttaaa aaacgtctag gccccccgaa ccacggggac gtggttttcc tttgaaaaac 60
acgattgc 68






Claims
  • 1. A purified aggrecanase polypeptide comprising the amino acid sequence of SEQ ID NO:4.
  • 2. A purified aggrecanase polypeptide produced by the steps of(a) culturing a cell transformed with a DNA molecule comprising SEQ ID NO:3; and (b) recovering and purifying a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:4.
Parent Case Info

This application claims the benefit of U.S. Provisional Application No. 60/242,317 filed Oct. 20, 2000.

US Referenced Citations (1)
Number Name Date Kind
4419446 Howley et al. Dec 1983 A
Foreign Referenced Citations (7)
Number Date Country
0 123 289 Oct 1984 EP
0 155 476 Sep 1985 EP
0 177 343 Apr 1986 EP
WO 8600639 Jan 1986 WO
WO 0111074 Feb 2001 WO
WO 0123561 Apr 2001 WO
WO2000183782 Nov 2001 WO
Non-Patent Literature Citations (27)
Entry
Abbaszade, Ilgar, et al., “Cloning and Characterization of ADAMTS11, an Aggrecanase from the ADAMTS Family,” J. Biol. Chem., 274(33), 1999, pp. 23443-23450.
Flannery, Carl R., et al., “Identification of a Stromelysin Cleavage Site within the Interglobular Domain of Human Aggrecan,” J. Biol. Chem., 267(2), 1992, pp. 1008-1014.
Fosang, Amanda J., “Neutrophil collagenase (MMP-8) cleaves at the aggrecanase site E373-A374 in the interglobular domain of cartilage aggrecan,” Biochem. J., 304, 1994, pp. 347-351.
Gething, Mary-Jane, et al., “Cell-surface expression of influenza haemagglutinin from a cloned DNA copy of the RNA gene,” Nature, 293, 1981, pp. 620-625.
Gough, Nicholas M., et al., “Structure and expression of the mRNA for murine granulocyte-macrophage colony stimulating factor,” The EMBO Journal, 4(3), 1985, pp. 645-653.
Hughes, Clare E., et al., “Monoclonal antibodies that specifically recognize neoepitope sequences generated by ‘aggrecanase’ and matrix metalloproteinase cleavage of aggrecan: application to catabolism in situ and in vitro,” Biochem. J., 305, 1995, pp. 799-804.
Jang, Sung K., et al., “Initiation of Protein Synthesis by Internal Entry of Ribosomes into the 5′ Nontranslated Region of Encephalomyocarditis Virus RNA In Vivo,” J. of Virology, 63(4), 1989, pp. 1651-1660.
Kaufman, Randal J., et al., “Amplification and Expression of Sequences Cotransfected with a Modular Dihydrofolate Reductase Complementary DNA Gene,” J. Mol. Biol., 159, 1982, pp. 601-621.
Kaufman, Randal J., et al., “Coamplification and Coexpression of Human Tissue-Type Plasminogen Activator and Murine Dihydrofolate Reductase Sequences in Chinese Hamster Ovary Cells,” Mol. Cell. Biol., 5(7), 1985, pp. 1750-1759.
Kaufman, Randal J., et al., “Construction of a Modular Dihydrofolate Reductase cDNA Gene: Analysis of Signals Utilized for Efficient Expression,” Mol. Cell. Biol., 2(11), 1982, pp. 1304-1319.
Kaufman, Randal J., “Identification of the components necessary for adenovirus translational control and their utilization in cDNA expression vectors,” Proc. Natl. Acad. Sci. USA, 82, 1985, pp. 689-693.
Kaufman, Randal J., et al., “Improved vectors for stable expression of foreign genes in mammalian cells by use of the untranslated leader sequence from EMC virus,” Nucleic Acids Research, 19(16), 1991, pp. 4485-4490.
Laemmli, U.K., “Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4,” Nature, 227, 1970, pp. 680-685.
Lohmander, J. Stefan, et al., “The Structure of Aggrecan Fragments in Human Synovial Fluid: Evidence that Aggrecanase Mediates Cartilage Degradation in Inflammatory Joint Disease, Joint Injury, and Osteoarthritis,” Arthritis & Rheumatism, 36(9), 1993, pp. 1214-1222.
Maniatis, T., et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 1982, pp. 387-389.
Mercuri, Francesca A., et al., “Recombinant Human Aggrecan G1-G2 Exhibits Native Binding Properties and Substrate Specificity for Matrix Metalloproteinases and Aggrecanase,” J. Biol. Chem., 274(45), 1999, pp. 32387-32395.
Miller, David W., et al., “An Insect Baculovirus Host-Vector System for High-Level Expression of Foreign Genes,” Genetic Engineering: Principles and Methods, 8, 1986, pp. 277-298.
Oakley, Berl R., et al., “A Simplified Ultrasensitive Silver Stain for Detecting Proteins in Polyacrylamide Gels,” Analytical Biochemistry, 105, 1980, pp. 361-363.
Okayama, Hiroto, et al., “High-Efficiency Cloning of Full-Length cDNA,” Molecular and Cellular Biology, 2(2), 1982, pp. 161-170.
Sandy, John D., et al., “Catabolism of Aggrecan in Cartilage Explants,” J. Biol. Chem., 266(14), 1991, pp. 8683-8685.
Sandy, John D., et al., “The Structure of Aggrecan Fragments in Human Synovial Fluid: Evidence for the involvement in Osteoarthritis of a Novel Proteinase Which Cleaves the Glu 373-Ala 374 Bond of the Interglobular Domain,” J. Clin. Invest., 89, 1992, pp. 1512-1516.
Taniguchi, Tadatsugu, et al., “Expression of the human fibroblast interferon gene in Escherichia coli,” Proc. Natl. Acad. Sci. USA, 77(9), 1980, pp. 5230-5233.
Tortorella, M.D., et al., “Purification and Cloning of Aggrecanase-1: A Member of the ADAMTS Family of Proteins,” Science, 284, 1999, pp. 1664-1666.
Towbin, Harry, et al., “Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications,” Proc. Natl. Acad. Sci. USA, 76(9), 1979, pp. 4350-4354.
Apte, S.S., “ADAM-TS10: A Novel Member of the ADAM-TS Family Containing Multiple Thrombospondin Type 1 Repeats,” Abstract, XP-002208327, submitted to EMBL/GenBank/DDBJ databases on Jun. 29, 1999.
Hurskainen, Tina L., et al., “ADAM-TS5, ADAM-TS6, and ADAM-TS7, Novel Members of a New Family of Zinc Metalloproteases,” The Journal of Biological Chemistry, 274(36):25555-25563 (1999).
Shimkets, R.A., et al., “Novel Polynucleotides Encoding Proteins Containing Thrombospondin Type 1 Repeats,” Abstract of WO 01/23561 (Apr. 5, 2001).
Provisional Applications (1)
Number Date Country
60/242317 Oct 2000 US