Alkaline proteases stable in heavy-duty detergent liquids

Abstract

Alkaline proteases that are stable in the presence of linear alkylbenzene sulfonates can be obtained from bacteria isolated from soil and by other means. The soils are collected from an alkaline environment which has been exposed to extremely high pH and/or detergent contamination. The proteases are at least twice as stable as Esperase.TM. when stored in commercial liquid detergents.

Description

BACKGROUND OF THE INVENTION

The present invention relates to a new group of alkaline proteases that are especially stable in the presence of detergents and bleaches. More particularly, the present invention relates to proteases that can be obtained, for example, from a particular class of soil bacteria and that are generally useful in heavy-duty detergent liquids (HDLs) which contain linear alkylbenzene sulfonate.

Alkaline proteases are commonly added to HDLs because of the ability of these enzymes to decompose proteinaceous stains. These enzymes perform at the high pHs which are beneficial to the detergency of the surfactants in these formulations. Exemplary of such alkaline proteases, which are generally from Bacillus species, are Esperase.TM., Savinase.TM. and Alcalase.TM. from Novo Nordisk Bioindustrials Inc. and Maxatase.TM. and Maxacal.TM. from Gist-Brocades N.V. Although these enzymes have an optimal pH for activity of from 9 to 11, they rapidly lose their activity when stored at pH 10 to 11 in HDLs. This is especially true in HDLs with a high concentration of alkylbenzene sulfonates, such as linear alkylbenzene sulfonate (LAS). While anionic surfactants such as LAS provide excellent detergency at a low cost, they appear to be particularly detrimental to enzyme stability as compared to nonionic surfactants. See, for example, Kravetz et al., Am. Oil Chem. Soc. 62: 943 (1985).

Several patents relate to the stabilization of alkaline proteases in HDLs. Stabilization agents which have been used include formate and alcohols (U.S. Pat. No. 4,318,818), boric acid (U.S. Pat. No. 4,537,706), a combination of boron compounds, glycerin and a carboxylic acid (U.S. Pat. No. 4,900,475) and dicarboxylic acids and boric acid (GB patent application No. 21 26 242). But these stabilization systems do not sufficiently extend the lifetime of proteases, especially in high performance formulations having both a high pH and a high concentration of anionic surfactants.

Other patents relate to bacteria which produce alkaline proteases characterized by one or more properties. See, for example, U.S. Pat. Nos. 4,797,362, 4,771,003, 4,764,470, 3,838,009, 3,827,643 and 3,674,643. All of these patents relate to alkaline proteases obtained from specific bacterial strains, yet none discloses how any disclosed bacterial strain was isolated or how desirable strains other than those deposited might be reproducibly obtained to produce an alkaline protease with advantageous properties.

SUMMARY OF THE INVENTION

It is therefore an object of the present invention to provide a bacteria producing an enzyme that is stable for long periods of time in detergent liquids.

It is a further object of this invention to provide an enzyme that is stable when stored at high pH and that has excellent stability when stored in the presence of anionic surfactants such as LAS.

It is another object of this invention to provide an enzyme that has high stability and performance in the presence of bleaches.

It is yet another object of the invention to provide a reproducible process for isolating bacteria that produce enzymes that are stable in detergent liquids.

It is a further object of the invention to provide an isolated polynucleotide molecule that encodes an enzyme having the above-described stability characteristics.

In accomplishing these and other objects there has been provided, in accordance with one aspect of the present invention, a composition containing a recoverable amount of an enzyme with alkaline protease activity, said enzyme retaining at least 50% of its activity, according to the azocasein assay, after 12 hours at 52.degree. C. in a stabilized aqueous solution having a pH of 9.8 and comprising 17.2 weight % of sodium C.sub.11-5 alkylbenzene sulfonate, 5.2 weight % of a condensation product of one mole of C.sub.12-15 linear alcohol and 7 moles of ethylene oxide, 5.8 weight % of sodium sulfate ester of the condensation product of one mole C.sub.12-18 linear alcohol and 4 moles of ethylene oxide, 4.0 weight % of sodium xylene sulfonate, 5.5 weight % of sodium citrate, 1.4 weight % of triethanolamine, 1.4 weight % of monoethanolamine, 3.2 weight % of propylene glycol, 1.4 weight % of borax, 1.0 weight % of ethanol, 500 ppm CaCl.sub.2, and the balance water. A bacterial culture consisting essentially of bacteria that produce an alkaline protease according to the invention is also provided, as well as an isolated polynucleotide molecule that encodes an enzyme with the aforementioned surprising stable alkaline protease activity.

A process for obtaining a bacterium that produces an alkaline protease that is stable at a pH greater than about 10 in the presence of linear alkylbenzene sulfonate is provided. In a first embodiment, this process comprises the steps of collecting soil from an alkaline environment which has been exposed to detergent contamination and selecting strains which have an alkaline protease that is stable in the presence of detergent. In a second embodiment, this process comprises the steps of collecting soil from an alkaline environment that has a pH greater than about 12 and selecting strains which have an alkaline protease that is stable in the presence of detergent.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. By way of example, it is apparent that enzymes according to the present invention would be useful in cheese manufacture and as dehairing enzymes for leather preparation. In addition, in accordance with teachings of the present invention, oxidatively stable enzymes, in particular enzymes resistant to chlorine bleach and to perborate-containing detergent powders, can be readily obtained.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the effect of pH on the activity of 164A-1, a protease within the present invention.

FIG. 2 shows the temperature stability of 164A-1 in the presence and absence of Ca.sup.++.

FIG. 3 compares the stability of a protease according to the present invention with that of two commercial proteases, Esperase.TM. and Savinase.TM., in Tide.TM. at 40.degree. C.

FIG. 4A shows the stability of several proteases according to the present invention in Wisk.TM. at 38.degree. C.

FIG. 4B shows the stability of Alcalase.TM., Savinase.TM. and Esperase in Wisk at 38.degree. C.

FIG. 5 shows the stability of various commercial proteases in a stabilized heavy-duty liquid detergent formulation containing 17 weight % LAS (Formula A) at 52.degree. C.

FIG. 6 shows the stability of several proteases according to the present invention in Formula A at 52.degree. C.

FIG. 7 shows the stability of Esperase.TM. and several proteases according to the present invention in Tide.TM. at 52.degree. C.

FIG. 8 shows the stability of protease 145F, a protease according to the present invention, in Formula A and Tide.TM. at 52.degree. C.

FIGS. 9A and 9B show the amino acid sequences for the protease of strain 164A-1 (Seq I1) No; 2) and four other proteases (SEQ I1) Nos. 3-6).

FIGS. 10A-10E show the DNA sequence (SEQ I1) NO: 1) encoding the amino acid sequence of the protease of strain 164A-1.

FIG. 11 shows the oxidative stability of 164A-1, Esperase.TM. and Savinase.TM..

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

Bacteria having alkaline proteases that are stable in the presence of linear alkylbenzene sulfonates can be isolated from soil. A "stable" protease, in the context of the present invention, is at least twice as stable as Esperase.TM. in the detergent tests described herein. A protease according to the invention also retains at least fifty percent of its activity, according to the azocasein assay, after 12 hours at 52.degree. C. in Formula A, a stabilized aqueous heavy-duty liquid detergent solution containing about 17 weight % LAS, as described herein. In this regard, "stabilized" refers to the incorporation of stabilizers of the type typically used in heavy-duty detergent liquids to prevent the rapid decomposition of enzymes. A particularly preferred protease according to the present invention retains at least fifty percent activity, according to the azocasein assay, after 12 days at 52.degree. C. in Formula A.

The inventive protease can be obtained in recoverable amounts, pursuant to the present invention, in substantially pure form; that is, in a form such that the protein preparation migrates as a single band on an SDS-PAGE gel. Substantially pure protease according to the present invention can be obtained in recoverable amounts by isolating the protease produced by soil bacteria acquired as described herein, as well as by genetic-engineering techniques discussed in greater detail below. A "recoverable" amount in this regard means that the isolated amount of the protein is detectable by a methodology less sensitive than radiolabeling, such as an immunoassay, and can be subjected to further manipulations involving transfer of the protein per se into solution.

A bacterial culture according to the present invention consists essentially of one or more strains of bacteria that produce one or more proteases exhibiting the desired stability. That is, such a culture primarily contains one or more strains of bacteria which produce stable proteases and does not contain amounts of any bacteria sufficient to affect the properties of the culture. In particular, the culture must not contain any bacterial strains that interfere with production of stable protease by the strain or strains according to the invention, or that interfere with purification of the stable protease according to the invention from the culture. A preferred embodiment is a culture of strain that, by virtue of the selection procedure described herein, is a biologically pure culture.

According to one aspect of the present invention, soils are collected from sites characterized by soil properties indicative of the presence of the desired microflora. In particular, the soils of interest are highly alkaline, having a pH greater than 10 and preferably greater than 12. Generally, this level of alkalinity is the result of industrial activity at the site. Industrial sites characterized by alkaline soils include, for example, a cement plant, a tannery and a plant which produces synthetic surfactants. Strains of bacteria that produce an alkaline protease characterized by excellent stability in the presence of high pH and LAS can be reproducibly isolated from soils collected at such sites.

In addition to a highly alkaline pH, the soils of interest preferably are characterized further by contamination with detergents, in particular by LAS or by alkylate, the raw material from which LAS is produced. This contamination provides an additional selection pressure on the indigenous population of microorganisms in the soil, increasing the probability of finding bacteria having a protease that is stable in the presence of LAS. Soils from a site contaminated by LAS or alkylate are preferred, particularly those sites contaminated by LAS.

After a soil sample is collected, an enrichment protocol can be used to distinguish strains producing alkaline proteases stable in HDLs. A suspension of the soil can be plated onto a Petri dish containing an agar medium buffered to pH 10.5 and containing proteins as the source of carbon and nitrogen. This procedure results in the identification of strains that produce a protease enzyme.

A suitable alkaline agar media for suspending and diluting the soil samples comprises 0.5% yeast extract, 0.05% polypeptone, 0.1% K.sub.2 HPO.sub.4, 0.02% MgSO.sub.4 and 1% Na.sub.2 CO.sub.3. A suitable agar media for enriching and identifying strains according to the invention comprises 1% skim milk, 0.025% yeast extract, 0.05% peptone, 1.5% agar and 1% Na.sub.2 CO.sub.3. Both the suspending and enriching media are buffered to pH 10.5.

The enriching media is an opaque agar. Microbes that produce extracellular enzymes frequently grow the most, and are easy to see as they degrade the milk casein suspended in the agar. Consequently, a zone around the growing colony becomes clear as the opaque substance is removed, indicating the presence of protease. Colonies are plucked from the clear zones and subcultivated on to a fresh Petri plate as part of the isolation procedure.

After this preliminary characterization by enrichment and isolation, strains can be cultivated in a liquid broth. A suitable broth comprises 1% skim milk, 0.025% yeast extract, 0.05% peptone and 1% Na.sub.2 CO.sub.3, buffered to pH 10.5. The proteases can be isolated from the culture broth by precipitation with ethanol, and then the activity of the proteases can be tested in detergent using various assays. Two assays which are useful are the azocasein assay and the peptidase assay.

The azocasein assay uses azocasein as the substrate and is based on the endoproteolytic activity of the enzyme. The peptidase assay uses chromogenic peptide substrate, and is based on the peptidase activity of the enzyme. Detergent interferes with both assays by reducing protease activity; however, the interference is less than 20% under the conditions used.

In the azocasein assay a solution of the enzyme is mixed with 2 ml of 0.4% azocasein in 1% Na.sub.2 CO.sub.3, pH 10.5 at 38.degree. C. At various time intervals, 0.5 ml of the reaction mixture is mixed with 0.1 ml of 60% perchloric acid. Precipitates are collected by centrifugation and the absorbance of the supernatant is measured at 440 nm. When the enzyme solution contains detergent, the maximal ratio between enzyme solution and substrate solution is set at 0.025 in order to minimize interference from the detergent.

In the peptidase assay a solution of the enzyme is mixed with 1 ml of 1% Na.sub.2 CO.sub.3, pH 10.5 buffer containing 5 microliters, dissolved in ethanol, of 13 mM of N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine-p-nitroanilide. The reaction is followed at 410 nm while the mixture is maintained at 38.degree. C. When the enzyme solution contains detergent, the maximal ratio between enzyme solution and substrate solution is 0.02 in order to minimize interference from the detergent.

The stability of the protease in various detergents then can be assessed. Depending on the amount of activity present, protease from the fermentation broth is either used directly or is concentrated by cold precipitation with ethanol (75%). One part enzyme is mixed with three parts detergent, and the protein content averages about 1-2 grams/liter in the test.

For example, the proteases can be tested in modified Advanced Action Wisk.TM.. (MAAW) at 38 and 52.degree. C. and in heavy-duty liquid Wisk.TM., a detergent that does not contain enzymes, at 38.degree. C. The proteases can also be tested in a heavy-duty detergent liquid formulation containing about 17 weight % LAS (Formula A) at various temperatures. MAAW is prepared by first denaturing the enzymes already present in Advanced Action Wisk.TM. and then fortifying it with 10 grams of 50% LAS per 90 ml of detergent. The activity of the proteases is then measured with the azocasein and peptidase assays.

In searching for a bacterial strain possessing such an alkaline protease, samples were initially collected from a variety of sites. Some of the sites had neutral soils, including, for example, several samples collected from the Brazilian rain forest. Other sites had relatively alkaline or acidic soils as a result of industrial activity at the site. Sites characterized by alkaline soils included, for example, a cement plant, a tannery, and a plant that produces synthetic surfactants.

In addition to being characterized by the pH of their soils, several of the sites had soils that had been subjected to contamination by detergents, in particular by LAS or by alkylate, the raw material from which LAS is produced. This contamination was discovered to provide an additional selection pressure on the indigenous population of microorganisms in the soil, increasing the probability of finding bacteria having a protease that is stable in the presence of LAS.

Eight preferred bacterial strains which produce stable proteases according to the present invention were isolated. The eight preferred bacterial strains were isolated from 67 soil samples taken from five sites, all of which were characterized by extremely high pH and/or the presence of detergent contamination. Four of the sites were characterized by both alkaline pH and the presence of detergent contamination. In particular, three of these sites were known to have been contaminated by either alkylate or LAS. While the existence of possible detergent contamination at the fifth site could not be verified, this site was characterized by an extremely high pH of greater than 12.

Surprisingly, it was discovered that strains of bacteria having an alkaline protease characterized by excellent stability in the presence of high pH and LAS were reproducibly isolated from soils characterized by high alkalinity and/or detergent contamination. A particularly preferred strain according to the present invention was isolated from alkaline soil samples collected around several LAS storage vessels and loading docks. The strain was denoted strain 164A.

For purposes of comparison, Tables 1 and 2 below set forth the general properties of this strain and known alkalophilic Bacillus strains Y, P, K and X, each of which is disclosed in U.S. Pat. No. 4,797,362; strain 221, disclosed by K. Horikoshi, Agr. Biol. Chem 35(9): 1407-1414; strain 58, which is mentioned in U.S. Pat. No. 4,052,262, and strain D-6, disclosed in Japanese patent publication No. 4236 (1981).

TABLE 1______________________________________ Bacillus strainsCharacteristic Y, P, K & X 164A______________________________________Gram strain + +Spores round - -Spore location terminal terminalSporangium Swollen + +Hydrolysis ofCasein + +Starch + +Gelatin + +Growth at pH 6 + - 7 + + 8 + + 9 + +10 + +11 + +12 + +Growth at20.degree. C. + +37.degree. C. + +47.degree. C. + +52.degree. C. nt +Growth in Sodium 1% + + 5% + + 7% + +10% + +Utilization ofammonia - -nitrate - -urea + -Production of Acid fromglucose + +sucrose + +mannitol + -mannose + +fructose + +xylose - -lactose - -starch + +arabinose - -galactose - -maltose + +______________________________________ TABLE 2__________________________________________________________________________Microbiological StrainsProperty Y, P, K & X #221 #58 #D-6 164A__________________________________________________________________________Utilization of Inorganic No Yes Yes Slightly NoNitrogen Sources(Ammonium salt)Growth Temperature 20-47.degree. C. -55.degree. C. -45.degree. C. -- 20-52.degree. C.RangeOptimal Temperature 33-35.degree. C. 37-40.degree. C. 37-40.degree. C. 35-40.degree. C. --RangeGrowth pH Range 6-12 7-11 7.5-11 7.5-11 7-12Optical pH Range around 10 around 10 around 10 around 10Saccharides as Sources glucose In addition sucrosefor Acid Production mannose to those mannose fructose described fructose maltose left, starch sucrose arabinose maltose trehalose xylose glucose mannitol galactose starch glycerolResistance to NaCl grow in grows little grows in grows in grows in 10% NaCl in 5% 7% NaCl 5% NaCl 10% NaCl NaCl__________________________________________________________________________

Like other alkalophilic Bacilli, strain 164A is gram positive and forms spores. It exhibits other properties common to the composition strains, indicating that strain 164A also is an alkalophilic Bacillus.

As the tables show, strain 164A grows well at pH 8-10 but only minimally at pH 7, and does not grow at pH 6. It grows well between 20.degree. C. and 47.degree. C. The strain hydrolyzes casein, starch and gelatin, and produces acids from glucose, sucrose, mannose and fructose, but not from mannitol, xylose and lactose. It has no ability to use ammonia, nitrate or urea as a sole source of nitrogen for growth. It is resistant to sodium chloride, displaying good growth in a medium containing 1-10% sodium chloride.

Strain 164A was found to produce several proteases, one of which bound to carboxymethylcellulose (CM-cellulose) at pH 7.5. This protease, which was designated protease 164A-1, was eluted from the CM-cellulose column by applying a linear gradient of 0 to 0.3M salt. It was further purified on a G75 column which separates proteins on the basis of size. Protease 164A-1 eluted in substantially pure form as the first peak out of the G75 column.

Purified protease 164A-1 was shown to have a molecular weight around 28,000 based on SDS gel electrophoresis. Protease 164A-1 was inactivated by either PMSF or DFP, an indication that it had serine in the active site. It did not lose activity in the presence of EDTA.

The total amino acid compositions of protease 164A-1 and other known Bacillus alkaline proteases are shown in Tables 3 and 4.

TABLE 3______________________________________Amino Acid Composition of Alkaline Proteases(expressed as mols of amino acid/mol of enzyme)Amino Subtilisin SubtilisinAcid Ya.sup.1 Yb.sup.1 Alcalase.sup.2 BPN'.sup.3 NOVO.sup.4 164A-1______________________________________Trypto- 5 11 1 3 3 2phaneLysine 7 6 9 11 6 7Histidine 5 13 5 6 5 7Arginine 5 10 4 2 3 8Aspartate 20 53 28 28 20 30Threonine 11 18 19 13 14 17Serine 22 32 32 37 37 31Glutamate 9 17 12 15 12 11Proline 9 14 9 14 10 9Glycine 22 46 35 33 25 35Alanine 20 50 41 37 27 40Valine 9 35 31 30 20 30Methionine 2 4 5 5 3 5Isoleucine 6 15 10 13 12 13Leucine 10 21 16 15 12 16Tyrosine 6 14 13 10 9 11Pheny- 4 4 4 3 2 3lalanineCysteine 0 0 0 0 0 0______________________________________ .sup.1 Strains Ya and Yb are disclosed in U.S. Pat. No. 4,797,362. .sup.2 Alcalase is disclosed in E. L. Smith, et al., J. Biol. Chem., 243:2181 (1968). .sup.3 Subtilisin BPN' is disclosed in F. S. Merkland, J. Biol. Chem., 242:5198 (1967). .sup.4 Subtilisin NOVO is disclosed in D. Turu, Agr. Biol Chem., 31:330 (1967). TABLE 4______________________________________Amino Acid Composition of Alkaline Proteases(expressed as mol % of residues) ATCC SubtilisinAmino Acid Kp1239.sup.1 21522.sup.2 221.sup.3 carlsberg.sup.4 164A-1______________________________________Tryptophan -- -- 1.7 0.36 0.73Lysine 2.4 2.6 2.0 3.3 2.55Histidine 2.4 2.6 2.8 1.8 2.55Arginine 2.7 2.8 2.8 1.5 2.91Aspartate 9.8 11.5 10.1 10.2 10.9Threonine 6.8 6.9 6.3 6.9 6.18Serine 11.7 11.6 8.0 11.7 11.27Glutamate 6.1 5.8 5.6 4.4 4.0Proline 5.0 3.6 5.6 3.3 3.27Glycine 12.6 13.7 13.6 12.8 12.73Alanine 15.2 16.5 15.6 15.0 14.55Valine 10.5 10.1 9.4 11.3 10.9Methionine 1.3 1.2 1.3 1.8 1.82Isoleucine 2.8 2.7 3.1 3.6 4.73Leucine 7.3 6.0 7.7 5.8 5.82Tyrosine 2.8 2.4 3.1 4.7 4.00Phenylalanine 0.68 0.84 0.7 1.5 1.09Cysteine 0 0 0 0 0______________________________________ .sup.1 Kp1239 is disclosed in Y. Takii et al., Appl. Microbiol. Biotechnol., 34:57 (1990). .sup.2 ATCC 21522 is disclosed in Y. Suzuki, et al., Eur. J. Biochem., 158:77 (1986). .sup.3 Strain 221 is disclosed in K. Horikoshi, Agr. Biol. Chem., 35(9): 1407 (1971). .sup.4 Subtilisin carlsberg is disclosed in R. J. Delange, et al., J. Biol. Chem., 243:2134 (1968).

The complete amino acid sequence of protease 164A-1 (SEQ I1) NO; 2) is shown in FIGS. 9A and 9B, and the nucleotide sequence encoding the amino acid sequence (SEQ I1) NO: 1) is shown in FIGS. 10A-10E. The single-letter symbols for the amino acids are defines as follows:

______________________________________ One-letterAmino acid abbreviation______________________________________Alanine AArginine RAsparagine NAspartic acid DCysteine CGlutamic acid EGlutamine QGlycine GHistidine HIsoleucine ILeucine LLysine KMethionine MPhenylalanine FProline PSerine SThreonine TTryptophan WTyrosine YValine VTermination *______________________________________

The mature protein, lacking a 100-residue signal peptide sequence, has a molecular weight of 28,000, based on SDS electrophoresis, and is made up of 274 amino acids with an N-terminal sequence of Ala-Gln-Thr-Thr (amino acid residues 1-4 of SEQ ID NO:2). The beginning of the mature enzyme is indicated by " ". FIGS. 9A and 9B also presents the amino acid sequences of four other alkalophilic Bacillus: alkaline elastase ("a") (SEQ I1) NO:3), Carlsberg ("b") (SEQ I1) NO:4), B. subtilis ("c") (SEQ I1) NO:5) and B. amyloliquefaciens BPN'. The degree of homology between 164A-1 and these other strain ranged from about 60% to 75%. These percent homology with alkaline elastase was 61.1%, the percent homology with Carlsberg was 72.7%, the percent homology with B. subtilis was 67.3% and the percent homology with B. amyloliquefaciens BPN' was 69.8%. Amino acids that are conserved in all but 164A-1 are indicated with " ". Seven of the amino acids were conserved in all but protease 164A-1; these amino acids were at positions 4, 19, 50, 81, 85, 266 and 271. The boxed sequences show amino acids that are the same in 164A-1 and at least two of the other proteases.

With sequence information, like that shown in FIGS. 9A-10E, for a bacterially-evolved enzyme of the present invention, other protease-active polypeptides also can be produced which display the characteristic of high stability described above. These protease-active polypeptides are referred to here generically as "protease variants" and are exemplified by high-stability 164A-1 muteins and molecules which correspond to portions of 164A-1.

In this regard, a "164A-1 mutein" is a polypeptide that retains the basic functional attribute of protease 164A-1--namely, the stability in the presence of LAS--and that is homologous to protease 164A-1. For purposes of this description, "homology" between two sequences connotes a likeness short of identity indicative of a derivation of the first sequence from the second. In particular, a polypeptide is "homologous" to protease 164A-1 if a comparison of amino-acid sequences between the polypeptide and 164A-1 reveals an identity of greater than about 85%. Such a sequence comparison can be performed via known algorithms, such as the one described by Lipman and Pearson, Science 227: 1435 (1985), which are readily implemented by computer.

Muteins of bacterially-evolved enzymes like protease 164A-1 can be produced, in accordance with the present invention, by conventional site-directed mutagenesis, which is one avenue for routinely identifying residues of the natural protease molecule that can be modified without rendering the resulting polypeptide biologically inactive. See CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Wiley-Interscience 1987, 1990), at Section 8 (hereafter "Ausubel et al."). Oligonucleotide-directed mutagenesis, comprising [i] synthesis of an oligonucleotide with a sequence that contains the desired nucleotide substitution (mutation), [ii] hybridizing the oligonucleotide to a template comprising a structural sequence coding for protease 164A-1 and [iii] using T4 DNA polymerase to extend the oligonucleotide as a primer, is preferred because of its ready utility in determining the effects of particular changes to the structural sequence of the bacterial enzyme. Its relative expense may militate in favor of an alternative, known direct-mutagenesis method.

Likewise within the present invention would be synthetic polypeptides that (i) correspond to a portion of the natural protease amino-acid sequence and (ii) retain an activity characteristic of the natural protease. In particular, such molecules might include a sequence in addition to a sequence that is homologous with the mature enzyme, which sequence may be cleaved.

Whether a synthetic polypeptide meeting criterion (i), such as one produced based on knowledge of the protease 164A-1 sequence shown in FIGS. 9A and 9B, also satisfies criterion (ii) can be routinely determined by means of detergent stability assays as described herein.

Variants of bacterially-evolved enzymes within the present invention could be produced by known techniques of de novo synthesis, as well as by producing a genetically-engineered host cell that expresses a protease variant encoded by a heterologous polynucleotide used to transform the host. To be used in recombinant expression of a protease 164A-1 or a 164A-1 variant, for example, a polynucleotide molecule encoding the natural or variant polypeptide preferably would comprise a nucleotide sequence, corresponding to the desired amino-acid sequence, that is optimized for the host of choice (see below) in terms of codon usage, initiation of translation, most suitable glycosylation, and expression of commercially useful amounts of protease 164A-1 or a desired variant. Also, the vector selected for transforming the chosen host organism with such a polynucleotide molecule should allow for efficient maintenance and transcription of the sequence encoding the polypeptide.

Preferred among the hosts generally available for transformation, pursuant to the present invention, are prokaryotes, as exemplified by Bacillus subtilis. For such expression systems, there are conventional transformation and screening protocols which can be employed pursuant to the present invention. See Hardy, "Bacillus Cloning Methods" in 2 DNA CLONING 1-17 (IRL Press 1985), and Lovett & Ambulos, "Genetic Manipulation of Bacillus subtilis" in BACILLUS 115-54 (Plenum Press 1989), among others. For example, transformants can be selected for expression of functional protease 164A-1 or a 164A-1 variant by use of agar plates containing skim milk, by looking for clearing of the milk plates around the colonies.

For introducing a polynucleotide of the present invention into a B. subtilis cell, the most commonly used protocol is transformation of competent cells with plasmid DNA (see Hardy, loc. cit.). An alternate method, protoplast transformation, can also be used.

Protease 164A-1 was found to have excellent stability at high pH and in high concentrations of anionic surfactants such as LAS. It also displayed high resistance to oxidation from bleaches, and excellent high temperature stability. This stability exceeded that of any known protease. The protease also improved detergency when blended with heavy-duty detergent liquids.

The pH profile of protease 164A-1 is shown in FIG. 1. It is a true alkaline protease. The temperature stability of protease 164A-1 after a ten-minute incubation in the presence (.DELTA. . . . .DELTA.) and absence (x--x) of 5 mM CaCl.sub.2 is presented in FIG. 2 which shows significantly improved temperature stability of protease 164A-1 in the presence of 5 mM CaCl.sub.2.

The stability of the protease 164A-1 in an HDL formulation was tested in a commercial sample of Tide.TM. (manufactured by The Procter and Gamble Co., Cincinnati, Ohio) obtained in Chicago, Ill. This formulation had enzyme stabilizers and a pH of 8.3. The protease activity of this formulation was measured by the azocasein assay. The enzymes already contained in this formulation were first denatured by heating to 65.degree. C. until no further enzyme activity was measurable in the sample.

A freeze-dried powder sample of the purified protease 164A-1 was then dissolved in a minimum volume of 50% propylene glycol/50% 0.2M Tris, pH 8.5 (approximately 0.05 mL) and this was then added to mL of the detergent formulation. Commercial enzyme samples from Novo Nordisk Bioindustrials were added at activity levels identical to that of the protease of this invention. The enzyme activity was chosen to provide a level of proteolytic activity equal to that of the freshest obtainable commercial HDL. The formulations were incubated at 40.degree. C., sampled at regular intervals and assayed for protease activity.

The loss of activity versus time is shown in FIG. 3. After three days, protease 164A-1 had only lost about 35% of its activity, whereas both Novo enzymes had lost at least 70% of their activity.

The stability of protease 164A-1 in other HDL formulations containing high concentrations of LAS was determined in a test similar to that conducted with liquid Tide.TM.. The formulations used were Advanced Action Wisk.TM. (manufactured by Lever Brothers Co., Edgewater, N.J.), a modification of Advanced Action Wisk.TM. by fortification with LAS (MAAW), Formula A and Wisk.TM., a detergent liquid with no enzymes. As described above, MAAW was prepared by first denaturing any enzymes already present by heating to 65.degree. C. for 4 hours, and then adding 50 g of SA-597 LAS (available from Vista Chemical) to 1 liter of the formulation and readjusting the pH to 9.8 with 50% NaOH, to achieve a final LAS concentration of 14 weight percent. The non-enzyme Wisk.TM. formulation was also modified by first lowering the pH from 10.9 to 9.8 by adding concentration HCl, and then adding 500 ppm of CaCl.sub.2, before adding the enzyme.

Formula A was a stabilized aqueous detergent composition comprising:

______________________________________17.2 weight % of sodium C.sub.11.5 alkylbenzene sulfonate (a mixture of sodium alkylbenzene sulfonates having alkyl chains of various lengths, the average number of carbon atoms in the alkyl chains being 11.5),5.2 weight % of a condensation product of one mole of C.sub.12-15 linear alcohol and 7 moles of ethylene oxide,5.8 weight % of sodium sulfate ester of the condensation product of one mole C.sub.12-18 linear alcohol and 4 moles of ethylene oxide,4.0 weight % of sodium xylene sulfonate,5.5 weight % of sodium citrate,1.4 weight % of triethanolamine,1.4 weight % of monoethanolamine,3.2 weight % of propylene glycol,1.4 weight % of borax,1.0 weight % of ethanol,500 ppm CaCl.sub.2, andthe balance water, the pH being adjusted to 9.8.______________________________________

The LAS contents of Formula A, Advanced Action Wisk.TM., MAAW and Wisk.TM. were determined by the methylene blue active substances test as described in American Public Health Association, STANDARD METHODS FOR THE EXAMINATION OF WATER AND WASTEWATER (17th ed.), American Public Health Association, Washington, D.C., 1989. The results are shown in Table 5.

TABLE 5__________________________________________________________________________ Protease Half-Life (days)Formulation Wt. % LAS T.degree. C. 164A-1 Esperase Savinase Alcalase__________________________________________________________________________Advanced 9 40 >60 >60 25 7.5Action Wisk .TM.Formula A 17 40 >50 33 5 4Formula A 17 45 30 7 ND NDLAS 14 52 14 1 0.5 0.1FortifiedA.A. Wisk .TM.(MAAW)Wisk .TM. 17 40 7 1 0.75 1.5__________________________________________________________________________

At all temperatures in the various formulations, protease 164A-1 was significantly more stable than Esperase.TM., Savinase.TM. and Alcalase.TM., respectively.

The benefit of maintaining enzyme activity on storage in HDL was determined by measuring the detergency performance of the protease stored in the MAAW. Two inch by three inch pieces of cotton (EMPA 116) stained with blood, milk and ink were washed in a 250 mL Erlenmeyer flask at 40.degree. C. in 75 mL of synthetic tap-water (150 ppm hardness, 3/2 Ca:Mg) and 200 .mu.L of containing the experimental protease added activity level identical to freshly manufactured commercial HDL. At time zero, the cloth was added and the flask agitated for 30 minutes. After this treatment, the cloths were rinsed in distilled water and allowed to dry in air and the reflectances were redetermined (average of measurements). The detergency of the fresh and heat-treated Esperase.TM. and protease 164A-1 samples on EMPA 116 cloth is reported in Table 6 as the change in reflectance relative to the clean cloth after the treatment (% stain remission).

TABLE 6______________________________________ 164A-1 EsperaseNo After 4 h at After 4 h atEnzyme Initial 65.degree. C. Initial 65.degree. C.______________________________________% Relative 0 100 68 100 0Activity% Stain 31.1 63.5 49.8 65.4 29.8Remission______________________________________

The relative stability of commercial enzymes and protease 164A-1 in the presence of perborate bleach-containing powder (Tide with Bleach.TM.) was evaluated at typical use concentrations (1.5 g/L) at 40.degree. C. for 15 minutes. The loss of activity in the presence of peroxide was determined by incubating the enzymes with 1 M H.sub.2 O, at 40.degree. C. for 15 minutes as previously described by Estell et aI., J. Biol. Chem. 243: 6518 (1985). The results are reported in Table 7.

TABLE 7______________________________________ % Relative Activity After TreatmentOxidant 164A-1 Esperase Savinase Alcalase______________________________________Tide with Bleach .TM. 99 90 71 811M H.sub.2 O.sub.2 94 62 ND 55______________________________________

The effect of chlorine bleach on Esperase.TM., Savinase.TM. and 164A-1 was determined by treating the enzymes with various concentrations of sodium hypochlorite (Clorox.TM. Bleach). Equal activities of each protease were added to 100 mL of synthetic tap-water (150 ppm hardness, Ca/Mg=3/2) containing the indicated amount of bleach. The solutions were incubated for 10 minutes at 25.degree. C., and then a 1 mL aliquot was removed and assayed for protease activity using the azocasein assay. The results are shown in FIG. 11.

Table 8 summarizes information about protease 164A-1 and various known alkaline proteases from alkalophilic Bacillus species. Table 9 provides a comparison of the N-terminal amino acid sequences among protease 164A-1 and known Bacillus alkaline proteases.

TABLE 8__________________________________________________________________________ OptimalTypes of Optimal Temp. Thermal Stability Molecular IsoelectricProtease pH (.degree.C.) None 5 mM Ca+ + Weight Point__________________________________________________________________________164A-1 11 65 60 70 27,600 7.4Ya 10-12.5 70 55 60 21,000 10.1Yb.sup.1 9-10 65-70 50 60 40,000 5.1Alcalase 10-11 60 40 50 27,300 9.4No. 221.sup.2 11-12 60 50 60 30,000 9.4E-1.sup.3 10-11 75 55 55 20,000 10.0API-21.sup.4 10-11 45-50 40 22,000 7.4KP1239.sup.5 11.5 60 55 54 29,000 8.8HS.sup.6 9-9.5 70 36,000 4.2Q5.sup.6 9.5 60 27,500 5.2Elastase 26,600 10.6YaB.sup.7__________________________________________________________________________ .sup.1 Strains Ya and Yb are disclosed in U.S. Pat. No. 4,797,362. .sup.2 Strain disclosed in K. Horikoshi, Agr. Biol. Chem. 35(9): 1407 (1971). .sup.3 Disclosed in Japanese patent publication No. 4236 (1981). .sup.4 Disclosed in Japanese patent publication No. 134990 (1983). .sup.5 Disclosed in Y. Takii et al., Appl. Microbiol. Biotechnol. 34: 57 (1990). .sup.6 Strains HS and Q5 are disclosed in U.S. Pat. No. 4,771,003. .sup.7 Disclosed in R. Kaneko et al., J. Bacteriol. 171: 5232 (1989). TABLE 9______________________________________Types of Protease N-terminal Amino Acid Sequence______________________________________164A-1 Ala--Gln--Thr--Thr-- (amino acid residues 1-4 of SEQ ID NO: 2)Subtilisin from Ala--Gln--Ser--Val--B. amyloliquefaciens (amino acid residues 108-111 of SEQ ID NO: 6)B. subtilis Ala--Gln--Ser--Val-- (amino acid residues 107-110 of SEQ ID NO: 5)B. licheniformis (Alcalase) Ala--Gln--Thr--Val-- (SEQ ID NO: 7)KP1239 from B. alcalophilus Ala--Gln--Ser--Val-- (SEQ ID NO: 8)Elastase YaB Gln--Thr--Val--Pro-- (amino acid residues 111-114 of SEQ ID NO: 3)______________________________________

The results reported in Tables 1, 2, 8 and 9, as well as the lipid composition of strain 164A, indicate that strain 164A belongs to genus Bacillus. Its lipid pattern does not match the lipid composition of any known Bacillus species, however. In addition, the N-terminal amino acid sequence, molecular weight, thermal stability, and total amino acid composition of 164A were quite different from that of other known alkaline proteases from alkalophilic Bacillus. It was concluded that strain 164A is a new species of Bacillus.

While protease 164A-1 is the most preferred enzyme according to the present invention, crude proteases from the other seven isolates also displayed a much better stability in both Wisk.TM. and Formula A than Esperase.TM., Savinase.TM., and Alcalase from Novo Nordisk Bioindustrials Inc. and Maxatase.TM. and Maxacal.TM. from Gist-Brocades N.V. FIG. 4A shows the stability of several proteases according to the present invention in Wisk.TM. at 38.degree. C. FIG. 4B shows the stability of Alcalase.TM., Savinase.TM., and Esperase.TM. in Wisk.TM. at 38.degree. C. The proteases according to the invention were significantly more stable than either the Novo or Gist-Brocades enzymes. The crude proteases from isolates 8E, 12E and 64E were further purified to produce protease fractions 8E-2, 64E-1, 64E-2, 64E-3 64E-4, 12E-1, all of which showed a much better stability than commercial proteases in Formula A and Tide.TM. at 52.degree. C. See FIGS. 5, 6 and 7. In particular, as shown in FIG. 7, proteases according to the invention retain at least 25% of their activity in Tide.TM. at 52.degree. C. Another purified protease, 145F, was actually activated in both Formula A and Tide.TM.. In other words, the activity of this enzyme actually increased over time in the presence of Formula A and Tide.TM.. See FIG. 8.

FIG. 5 shows the stability of several proteases according to the present invention in Formula A at 52.degree. C. All of the proteases retained at least 50% of their activity for 25 days. FIGS. 6 and 7 show the stability of Esperase.TM. and several proteases according to the present invention in Formula A and Tide.TM. at 52.degree. C., respectively. Esperase.TM. lost all activity after 4 days in Formula A at 52.degree. C. and in less than ten hours in Tide.TM. at 52.degree. C. The proteases according to the present invention displayed significantly better stability than Esperase.TM..

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 8(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1867 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:( B) STRAIN: 164A-1(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 716..1849(D) OTHER INFORMATION: /product="mature protein of164A-1"(ix) FEATURE:(A) NAME/KEY: sigpeptide(B) LOCATION: 716..1021(ix) FEATURE:(A) NAME/KEY: matpeptide(B) LOCATION: 1022..1846(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:TCTAGTATTTGTTGTTTTACCTGCTGTTTTTAACGAGCTACCTTTTGGTGGATTTTTCTT60AGTTCTATTTTTAATACTATTACTTTTTGCTACACTTACTTCTGCTTTTTCCATTTTAGA120AATAATTGTAGCAGCTTTAATCAAAGGGGATAAAGAAAAGAGGA AAAGACTTTCATGGAT180AACTGGTAGCCTTATTTTTCTTATAGGAATCCCATCTGCATTATCTTTCGGTATTCTTTC240ACATATTACTTTATTAGATCGCACCATTTTTGATGTAGCAGATTTTTTCGTAAGTAATGT300GGCACTGCGCTTGGAGCGTTA CTTATTTCTATTTTTGTAGGGTACAGGGTACGATAGAAT360ATTTTAGAAGATGAGTTTTTCCAAGGGTCAAAAGCTAAAAAGTCCTTATTTACTATTTGG420TATTTTACAATTAGATATATTGTTCCAGTTGGGATAGCGGTCGTATTTATTTATTCCATC480GGAAATTTCGATTAACTAAAAACACTGAAGCCTTGCTTCAGTTTTTTTTATTAGATTTTC540AAGTTATTTCTTTTTATTACATTTATTACTATTGGGAAAATACATACAACAAAATGATTT600CTTTACTCTATTTTGCACCTTACTTTCCCAATAGGTAAAATAGG TTTTCTATGCTAATAT660CTTGGGTAATAGTTCTAATGTTTAGAATTATTAAAAAATGCCAAGGAGTGGTGTAGTG718Val - 102TTGAAGAAGTGGATGAAAGTATTATCAGTAGTTTGTATTACGATTTTA766LeuLysLysTrpMetLysValLeuSerValValCysIleThrIleLeu100 -95-90ACTTTATCATTAGCAATCGGTTCTGTCGAAGCAAGTGGGAAAAATGCT814ThrLeuSerLeuAlaIleGlySerValGluAlaSerGlyLysAsnAla85-80 -75-70GAAATTAAGAAAGATTACTTAGTTGGTTTTAAAACGAATGTAACCAAT862GluIleLysLysAspTyrLeuValGlyPheLysThrAsnValThrAsn65 -60-55GAATCTAAAAATATAGTAAACTCACTAGGTGGAAGTGTACATCATCAA910GluSerLysAsnIleValAsnSerLeuGlyGlySerValHisHisGln50 -45- 40TATAAGTATATGGACGTATTGCATGTATCTCTCCCAGAAAAAGCAGCA958TyrLysTyrMetAspValLeuHisValSerLeuProGluLysAlaAla35- 30-25GAAGCATTAAAAAACAATCCGAATGTAGCATTTGTCGATTTAGATGCT1006GluAlaLeuLysAsnAsnProAsnValAlaPheValAspLeuAspAla20-15 -10GAAGTTCAAGCATTTGCACAAACTACTCCTTGGGGAATTACGCATATT1054GluValGlnAlaPheAlaGlnThrThrProTrpGlyIleThrHisIle515 10AATGCGCATAAAGCACACAGCTCTAGCGTTACTGGATCTGGTGTGAAA1102AsnAlaHisLysAlaHisSerSerSerValThrGlySerGlyValLys1520 25GTTGCCGTTCTTGATACTGGAATTGATGCTAGTCATCCAGATTTAAAT1150ValAlaValLeuAspThrGlyIleAspAlaSerHisProAspLeuAsn3035 40GTAAAAGGTGGAGCAAGTTTTATCTCTGGTGAGCCCAATGCACTTGTT1198ValLysGlyGlyAlaSerPheIleSerGlyGluProAsnAlaLeuVal455055GATAC AAATGGTCATGGTACACATGTAGCTGGTACGGTAGCTGCATTA1246AspThrAsnGlyHisGlyThrHisValAlaGlyThrValAlaAlaLeu60657075A ACAATACAATCGGTGTTGTAGGAGTTGCATACAATGCAGATTTATAT1294AsnAsnThrIleGlyValValGlyValAlaTyrAsnAlaAspLeuTyr808590 GCTGTTAAAGTATTAAGTGCTTCAGGAAGTGGAACGTTAAGTGGAATT1342AlaValLysValLeuSerAlaSerGlySerGlyThrLeuSerGlyIle95100105GCT CAAGGTGTTGAATGGGCAATTGCTAATAATATGGATGTAATTAAC1390AlaGlnGlyValGluTrpAlaIleAlaAsnAsnMetAspValIleAsn110115120ATGAGTCT TGGTGGGAGTTCTGGATCTACAGCATTAAAGCAAGCTGTT1438MetSerLeuGlyGlySerSerGlySerThrAlaLeuLysGlnAlaVal125130135GATAATGCTTATGCTA GCGGAATTGTTGTAGTAGCAGCGGCTGGTAAT1486AspAsnAlaTyrAlaSerGlyIleValValValAlaAlaAlaGlyAsn140145150155AGCGGAACAAGA GGAAGACAGAACACAATGGGCTACCCAGCAAGATAT1534SerGlyThrArgGlyArgGlnAsnThrMetGlyTyrProAlaArgTyr160165170AGTTCAGTAATT GCTGTTGGTGCGGTAGACTCAAATAACAATCGTGCA1582SerSerValIleAlaValGlyAlaValAspSerAsnAsnAsnArgAla175180185TCATTCTCTAGCGT AGGTGCTGAACTAGAAGTAATGGCTCCTGGTGTA1630SerPheSerSerValGlyAlaGluLeuGluValMetAlaProGlyVal190195200AGTGTTTTAAGTACAGTAC CAGGTGGTGGTTATGCTTCTTATAATGGA1678SerValLeuSerThrValProGlyGlyGlyTyrAlaSerTyrAsnGly205210215ACATCAATGGCTTCTCCACATGTAGCA GGAGCAGCAGCTTTAATTAAA1726ThrSerMetAlaSerProHisValAlaGlyAlaAlaAlaLeuIleLys220225230235GCTAAATACCCAAGTCTTTCTGCT TCGCAAATTCGTGATAGATTAAGA1774AlaLysTyrProSerLeuSerAlaSerGlnIleArgAspArgLeuArg240245250AACACAGCTACTTACTTAGGTGA TCCATTCTATTATGGAAACGGAGTT1822AsnThrAlaThrTyrLeuGlyAspProPheTyrTyrGlyAsnGlyVal255260265ATAAATGTAGAGAGAGCATTACAAT AATAAATAATAATTGTAAGC1867IleAsnValGluArgAlaLeuGln270275(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 377 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:ValLeuLysLysTrpMetLysValLeuSerValValCysIleThrIle102-100-95-90LeuThrLeuSerLeuAlaIleGlySerValGluAlaSerGlyLysAs n85-80-75AlaGluIleLysLysAspTyrLeuValGlyPheLysThrAsnValThr70-65-60-55AsnGluSerLys AsnIleValAsnSerLeuGlyGlySerValHisHis50-45-40GlnTyrLysTyrMetAspValLeuHisValSerLeuProGluLysAla35 -30- 25AlaGluAlaLeuLysAsnAsnProAsnValAlaPheValAspLeuAsp20-15-10AlaGluValGlnAlaPheAlaGlnThrThrProT rpGlyIleThrHis51510IleAsnAlaHisLysAlaHisSerSerSerValThrGlySerGlyVal1520 25LysValAlaValLeuAspThrGlyIleAspAlaSerHisProAspLeu303540AsnValLysGlyGlyAlaSerPheIleSerGlyGluProAsnAlaLeu 455055ValAspThrAsnGlyHisGlyThrHisValAlaGlyThrValAlaAla606570LeuAsnAsnThrIleGlyValVa lGlyValAlaTyrAsnAlaAspLeu75808590TyrAlaValLysValLeuSerAlaSerGlySerGlyThrLeuSerGly95 100105IleAlaGlnGlyValGluTrpAlaIleAlaAsnAsnMetAspValIle110115120AsnMetSerLeuGlyGlySerSerGlySerThrAlaL euLysGlnAla125130135ValAspAsnAlaTyrAlaSerGlyIleValValValAlaAlaAlaGly140145150AsnSerGlyThr ArgGlyArgGlnAsnThrMetGlyTyrProAlaArg155160165170TyrSerSerValIleAlaValGlyAlaValAspSerAsnAsnAsnArg175 180185AlaSerPheSerSerValGlyAlaGluLeuGluValMetAlaProGly190195200ValSerValLeuSerThrValProGl yGlyGlyTyrAlaSerTyrAsn205210215GlyThrSerMetAlaSerProHisValAlaGlyAlaAlaAlaLeuIle220225230 LysAlaLysTyrProSerLeuSerAlaSerGlnIleArgAspArgLeu235240245250ArgAsnThrAlaThrTyrLeuGlyAspProPheTyrTyrGlyAsnGly 255260265ValIleAsnValGluArgAlaLeuGln270275(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 378 amino acids(B) TYPE: amino acid (D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Bacillus(B) STRAIN: alkaline elastase(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:MetAsnLysLysMetGlyLysIleValAlaGlyThrAlaLeuIleIle15 1015SerValAlaPheSerSerSerIleAlaGlnAlaAlaGluGluAlaLys202530GluLysTyrLeuIleGlyPheLysGluG lnGluValMetSerGlnPhe354045ValAspGlnIleAspGlyAlaGluTyrSerIleSerSerGlnAlaGlu5055 60AspValGluIleAspLeuLeuHisGluPheAspPheIleProValLeu65707580SerValGluLeuAspProGluAspValAspAlaL euGluLeuAspPro859095AlaIleAlaTyrIleGluGluAspAlaGluValThrThrMetGlnThr100105 110ValProTrpGlyIleAsnArgValGlnAlaProIleAlaGlnSerArg115120125GlyPheThrGlyThrGlyValArgValAlaValLeu AspThrGlyIle130135140SerAsnHisAlaAspLeuArgIleArgGlyGlyAlaSerPheValPro145150155 160GlyGluProAsnIleSerAspGlyAsnGlyHisGlyThrGlnValAla165170175GlyThrIleAlaAlaLeuAsnAsnSerIleGly ValLeuGlyValAla180185190ProAsnValAspLeuTyrGlyValLysValLeuGlyAlaSerGlySer195200 205GlySerIleSerGlyIleAlaGlnGlyLeuGlnTrpAlaAlaAsnAsn210215220GlyMetHisIleAlaAsnMetSerLeuGlySerSerAlaGlyS erAla225230235240ThrMetGluGlnAlaValAsnGlnAlaThrAlaSerGlyValLeuVal245250 255ValAlaAlaSerGlyAsnSerGlyAlaGlyAsnValGlyPheProAla260265270ArgTyrAlaAsnAlaMetAlaValGlyAlaThrAs pGlnAsnAsnAsn275280285ArgAlaThrPheSerGlnTyrGlyAlaGlyLeuAspIleValAlaPro290295300GlyValGlyValGlnSerThrValProGlyAsnGlyTyrAlaSerPhe305310315320AsnGlyThrSerMetAlaThrProHisValAlaGlyVal AlaAlaLeu325330335ValLysGlnLysAsnProSerTrpSerAsnValGlnIleArgAsnHis340345 350LeuLysAsnThrAlaThrAsnLeuGlyAsnThrThrGlnPheGlySer355360365GlyLeuValAsnAlaGluAlaAlaThrArg37 0375(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 378 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Bacillus(B) STRAIN: Carlsberg(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetMetArgLys LysSerPheTrpLeuGlyMetLeuThrAlaPheMet151015LeuValPheThrMetAlaPheSerAspSerAlaSerAlaAlaGlnPro 202530AlaLysAsnValGluLysAspTyrIleValGlyPheLysSerGlyVal354045LysThrAlaSerVal LysLysAspIleLysGluSerGlyGlyLysVal505560AspLysGlnPheArgIleIleAsnAlaAlaLysAlaLysLeuAspLys6570 7580GluAlaLeuLysGluValLysAsnAspProAspValAlaTyrValGlu859095GluAspHisValAla HisAlaLeuAlaGlnThrValProTyrGlyIle100105110ProLeuIleLysAlaAspLysValGlnAlaGlnGlyPheLysGlyAla115 120125AsnValLysValAlaValLeuAspThrGlyIleGlnAlaSerHisPro130135140AspLeuAsnValValGlyGlyAla SerPheValAlaGlyGluAlaTyr145150155160AsnThrAspGlyAsnGlyHisGlyThrHisValAlaGlyThrValAla165 170175AlaLeuAspAsnThrThrGlyValLeuGlyValAlaProSerValSer180185190LeuTyrAlaValLysV alLeuAsnSerSerGlySerGlyThrTyrSer195200205GlyIleValSerGlyIleGluTrpAlaThrThrAsnGlyMetAspVal210 215220IleAsnMetSerLeuGlyGlyProSerGlySerThrAlaMetLysGln225230235240AlaValAspAsnAlaTyrAl aArgGlyValValValValAlaAlaAla245250255GlyAsnSerGlySerSerGlyAsnThrAsnThrIleGlyTyrProAla260 265270LysTyrAspSerValIleAlaValGlyAlaValAspSerAsnSerAsn275280285ArgAlaSerPheSerSerVal GlyAlaGluLeuGluValMetAlaPro290295300GlyAlaGlyValTyrSerThrTyrProThrSerThrTyrAlaThrLeu305310 315320AsnGlyThrSerMetAlaSerProHisValAlaGlyAlaAlaAlaLeu325330335IleLeuSerLysHisPro AsnLeuSerAlaSerGlnValArgAsnArg340345350LeuSerSerThrAlaThrTyrLeuGlySerSerPheTyrTyrGlyLys355 360365GlyLeuIleAsnValGluAlaAlaAlaGln370375(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 381 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii ) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Bacillus(B) STRAIN: B. subtilis(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:MetArgSerLysLysLeuTrpIleSerLeuLeuPheAlaLeuThrLeu1510 15IlePheThrMetAlaPheSerAsnMetSerAlaGlnAlaAlaGlyLys202530SerSerThrGluLysLysTyrIleValGlyPheLysGlnThr MetSer354045AlaMetSerSerAlaLysLysLysAspValIleSerGluLysGlyGly505560Lys ValGlnLysGlnPheLysTyrValAsnAlaAlaAlaAlaThrLeu65707580AspGluLysAlaValLysGluLeuLysLysAspProSerValAlaTyr 859095ValGluGluAspHisIleAlaHisGluTyrAlaGlnSerValProTyr100105110 GlyIleSerGlnIleLysAlaProAlaLeuHisSerGlnGlyTyrThr115120125GlySerAsnValLysValAlaValIleAspSerGlyIleAspSerSer 130135140HisProAspLeuAsnValArgGlyGlyAlaSerPheValProSerGlu145150155160 ThrAsnProTyrGlnAspGlySerSerHisGlyThrHisValAlaGly165170175ThrIleAlaAlaLeuAsnAsnSerIleGlyValLeuGlyValSerPro180185190SerAlaSerLeuTyrAlaValLysValLeuAspSerThrGlySerGly195200205G lnTyrSerTrpIleIleAsnGlyIleGluTrpAlaIleSerAsnAsn210215220MetAspValIleAsnMetSerLeuGlyGlyProThrGlySerThrAla225 230235240LeuLysThrValValAspLysAlaValSerSerGlyIleValValAla245250255 AlaAlaAlaGlyAsnGluGlySerSerGlySerThrSerThrValGly260265270TyrProAlaLysTyrProSerThrIleAlaValGlyAlaValAsnSer 275280285SerAsnGlnArgAlaSerPheSerSerAlaGlySerGluLeuAspVal290295300MetAlaPro GlyValSerIleGlnSerThrLeuProGlyGlyThrTyr305310315320GlyAlaTyrAsnGlyThrSerMetAlaThrProHisValAlaGlyAla 325330335AlaAlaLeuIleLeuSerLysHisProThrTrpThrAsnAlaGlnVal340345350 ArgAspArgLeuGluSerThrAlaThrTyrLeuGlyAsnSerPheTyr355360365TyrGlyLysGlyLeuIleAsnValGlnAlaAlaAlaGln370 375380(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 381 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Bacillus(B) STRAIN: B. amyloliquefaciens(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:M etArgGlyLysLysValTrpIleSerLeuLeuPheAlaLeuAlaLeu151015IlePheThrMetAlaPheGlySerThrSerSerAlaGlnAlaAlaGly 202530LysSerAsnGlyGluLysLysTyrIleValGlyPheLysGlnThrMet354045SerT hrMetSerAlaAlaLysLysLysAspValIleSerGluLysGly505560GlyLysValGlnLysGlnPheLysTyrValAspAlaAlaSerAlaThr65 707580LeuAsnGluLysAlaValLysGluLeuLysLysAspProSerValAla859095TyrV alGluGluAspHisValAlaHisAlaTyrAlaGlnSerValPro100105110TyrGlyValSerGlnIleLysAlaProAlaLeuHisSerGlnGlyTyr 115120125ThrGlySerAsnValLysValAlaValIleAspSerGlyIleAspSer130135140SerHisProAspLe uLysValAlaGlyGlyAlaSerMetValProSer145150155160GluThrAsnProPheGlnAspAsnAsnSerHisGlyThrHisValAla 165170175GlyThrValAlaAlaLeuAsnAsnSerIleGlyValLeuGlyValAla180185190ProSer AlaSerLeuTyrAlaValLysValLeuGlyAlaAspGlySer195200205GlyGlnTyrSerTrpIleIleAsnGlyIleGluTrpAlaIleAlaAsn210 215220AsnMetAspValIleAsnMetSerLeuGlyGlyProSerGlySerAla225230235240AlaLeuLys AlaAlaValAspLysAlaValAlaSerGlyValValVal245250255ValAlaAlaGlyAsnGlnGlyThrSerGlySerSerSerThrValGly 260265270TyrProGlyLysTyrProSerValIleAlaValGlyAlaValAspSer275280285SerAsnGlnA rgAlaSerPheSerSerValGlyProGluLeuAspVal290295300MetAlaProGlyValSerIleGlnSerThrLeuProGlyAsnLysTyr305 310315320GlyAlaTyrAsnGlyThrSerMetAlaSerProHisValAlaGlyAla325330335AlaAlaLe uIleLeuSerLysHisProAsnTrpThrAsnThrGlnVal340345350ArgSerSerLeuGluAsnThrThrThrLysLeuGlyAspSerPheTyr 355360365TyrGlyLysGlyLeuIleAsnValGlnAlaAlaAlaGln370375380(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(vi) ORIGINAL SOURCE:(A) ORGANISM: Bacillus(B) STRAIN: B. licheniformis(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:AlaGlnThrVal(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4 amino acids (B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Bacillus(B) STRAIN: KP1239 from B. alcalophilis(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:AlaGlnSerVal1

Claims

1. A composition containing a recoverable amount of an enzyme selected from the group consisting of purified protease enzyme 164A-1 or a purified mutein of protease enzyme 164-A1.

2. A composition as claimed in claim 1, wherein said enzyme is protease enzyme 164A-1.

3. A composition as claimed in claim 1, wherein said enzyme is a mutein of protease enzyme 164A-1.

4. A composition as claimed in claim 3, wherein said enzyme is an enzyme retaining at least 50% of its activity, according to the azocasein assay, after 12 hours at 52.degree. C. in a stabilized aqueous solution having a pH of 9.8 and comprising 17.2 weight % of sodium C.sub.11.5 alkylbenzene sulfonate, 5.2 weight % of a condensation product of one mole of C.sub.12-15 linear alcohol and 7 moles of ethylene oxide, 5.8 weight % of sodium sulfate ester of the condensation product of one mole C.sub.12-18 linear alcohol and 4 moles of ethylene oxide, 4.0 weight % of sodium xylene sulfonate, 5.5 weight % of sodium citrate, 1.4 weight % of triethanolamine, 1.4 weight % of monoethanolamine, 3.2 weight % of propylene glycol, 1.4 weight % of borax, 1.0 weight % of alcohol, 500 ppm CaCl.sub.2, and the balance water.

5. A composition according to claim 4, wherein said enzyme retains at least 50% of its activity after 12 days.

6. An isolated polynucleotide molecule that encodes protease enzyme 164A-1 or a mutein of protease enzyme 164A-1.

7. An isolated polynucleotide molecule according to claim 6 that encodes protease enzyme 164A-1.

8. An isolated polynucleotide molecule according to claim 6 that encodes a mutein of protease enzyme 164A-1.

9. An isolated polynucleotide molecule as claimed in claim 8, wherein the enzyme encoded by the polynucleotide molecule is an enzyme that retains at least 50% of its activity, according to the azocasein assay, after 12 hours at 52.degree. C. in a stabilized solution having a pH of 9.8 and comprising 17.2 weight % of sodium C.sub.11.5 alkylbenzene sulfonate, 5.2 weight % of a condensation product of one mole of C.sub.12-15 linear alcohol and 7 moles of ethylene oxide, 5.8 weight % of sodium sulfate ester of the condensation product of one mole C.sub.12-18 linear alcohol and 4 moles of ethylene oxide, 4.0 weight % of sodium xylene sulfonate, 5.5 weight % of sodium citrate, 1.4 weight % of triethanolamine, 1.4 weight % of monoethanolamine, 3.2 weight % of propylene glycol, 1.4 weight % of borax, 1.0 weight % of ethanol, 500 ppm CaCl.sub.2, and the balance water.

10. An isolated polynucleotide molecule as claimed in claim 9, wherein the enzyme encoded by the polynucleotide molecule is an enzyme that retains at least 50% of its activity after 12 days.

11. A genetically-engineered host cell that expresses an enzyme encoded by a heterologous polynucleotide as recited in claim 6.

12. A genetically-engineered host cell that expresses an enzyme encoded by a heterologous polynucleotide as recited in claim 7.

13. A genetically-engineered host cell that expresses an enzyme encoded by a heterologous polynucleotide as recited in claim 8.

14. A genetically-engineered host cell that expresses an enzyme encoded by a heterologous polynucleotide as recited in claim 9.

15. A genetically-engineered host cell that expresses an enzyme encoded by a heterologous polynucleotide as recited in claim 10.