.alpha.-1,4-glucan lyase from a fungus infected algae, its purification, gene cloning and expression in microorganisms

Abstract

A method of preparing .alpha.-1,4-glucan lyase enzymes is described. The method comprises isolating the enzymes from a fungally infected algae. The amino acid sequences of the enzymes have been determined. The nucleic acid sequences coding for the enzymes have also been determined.

Description

The present invention relates to an enzyme, in particular .alpha.-1,4-glucan lyase ("GL"). The present invention also relates to a method of extracting the same. The present invention also relates to nucleotide sequence(s) encoding for the same.

FR-A-2617502 and Baute et al in Phytochemistry [1988] vol. 27 No. 11 pp3401-3403 report on the production of 1,5-D-anhydrofructose ("AF") in Morchella vulgaris by an apparent enzymatic reaction. The yield of production of AF is quite low. Despite a reference to a possible enymatic reaction, neither of these two documents presents any amino acid sequence data for any enzyme, let alone any nucleotide sequence information. These documents say that AF can be a precursor for the preparation of the antibiotic pyrone microthecin.

Yu et al in Biochimica et Biophysica Acta [1993] vol 1156 pp313-320 report on the preparation of GL from red seaweed and its use to degrade .alpha.-1,4glucan to produce AF. The yield of production of AF is quite low. Despite a reference to the enzyme GL this document does not present any amino acid sequence data for that enzyme let alone any nucleotide sequence information coding for the same. This document also suggests that the source of GL is just algal.

According to the present invention there is provided a method of preparing the enzyme .alpha.-1,4-glucan lyase comprising isolating the enzyme from a fungally infected algae.

Preferably the enzyme is isolated and/or further purified using a gel that is not degraded by the enzyme.

Preferably the gel is based on dextrin, preferably beta-cyclodextrin, or derivatives thereof, preferably a cyclodextrin, more preferably beta-cyclo-dextrin.

According to the present invention there is also provided a GL enzyme prepared by the method of the present invention.

Preferably the enzyme comprises the amino acid sequence SEQ. ID. No. 1. or SEQ. ID. No. 2, or any variant thereof.

The term "any variant thereof" means any substitution of, variation of, modification of, replacement of, deletion of or addition of at least one amino acid from or to the sequence providing the resultant enzyme has lyase activity.

According to the present invention there is also provided a nucleotide sequence coding for the enzyme .alpha.-1,4-glucan lyase, preferably wherein the sequence is not in its natural environment (i.e. does not form part of the natural genome of a cellular organism expressing the enzyme).

Preferably the nucleotide sequence is a DNA sequence.

Preferably the DNA sequence comprises a sequence that is the same as, or is complementary to, or has substantial homology with, or contains any suitable codon substitution(s) for any of those of, SEQ. ID. No. 3 or SEQ. ID. No. 4.

The expression "substantial homology" covers homology with respect to structure and/or nucleotide components and/or biological activity.

The expression "contains any suitable codon substitutions" covers any codon replacement or substitution with another codon coding for the same amino acid or any addition or removal thereof providing the resultant enzyme has lyase activity.

In other words, the present invention also covers a modified DNA sequence in which at least one nucleotide has been deleted, substituted or modified or in which at least one additional nucleotide has been inserted so as to encode a polypeptide having the activity of a glucan lyase, preferably an enzyme having an increased lyase activity.

According to the present invention there is also provided a method of preparing the enzyme .alpha.-1,4-glucan lyase comprising expressing the nucleotide sequence of the present invention.

According to the present invention there is also provided the use of beta-cyclodextrin to purify an enzyme, preferably GL.

According to the present invention there is also provided a nucleotide sequence wherein the DNA sequence comprises a sequence that is the same as, or is complementary to, or has substantial homology with, or contains any suitable codon substitutions for any of those of, SEQ. ID. No. 3 or SEQ. ID. No. 4, preferably wherein the sequence is in isolated form.

A key aspect of the present invention is the recognition that GL is derived from a fungally infected algae. This is the first time that the amino acid sequence of GL has been determined in addition to the determination of the nucleic acid sequences that code for GL. A key advantage of the present invention is therefore that GL can now be made in large quantities by for example recombinant DNA techniques and thus enable compounds such as the antibiotic microthecin to be made easily and in larger amounts.

The enzyme should preferably be secreted to ease its purification. To do so the DNA encoding the mature enzyme is fused to a signal sequence, a promoter and a terminator from the chosen host.

For expression in Aspergillus niger the gpdA (from the Glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans) promoter and signal sequence is fused to the 5' end of the DNA encoding the mature lyase--such as SEQ I.D. No. 3 or SEQ. I.D. No.4. The terminator sequence from the A. niger trpC gene is placed 3' to the gene (Punt, P. J. et al (1991): J. Biotech. 17, 19-34). This construction is inserted into a vector containing a replication origin and selection origin for E. coli and a selection marker for A. niger. Examples of selection markers for A. niger are the amdS gene, the argB gene, the pyrG gene, the hygB gene, the BmlR gene which all have been used for selection of transformants. This plasmid can be transformed into A. niger and the mature lyase can be recovered from the culture medium of the transformants.

The construction can be transformed into a protease deficient strain to reduce the proteolytic degradation of the lyase in the culture medium (Archer D. B. et al (1992): Biotechnol. Lett. 14, 357-362).

Other advantages will become apparent in the light of the following description.

The present invention therefore relates to the isolation of the enzyme .alpha.-1,4-glucan lyase from a fungus infected algae--preferably a fungus infected red algae such as the type that can be collected in China--such as Gracilariopsis lemaneiformis. An example of a fungally infected algae has been deposited in accordance with the Budapest Treaty (see below).

By using in situ hybridisation technique it was established that the enzyme GL was detected in the fungally infected red algae Gracilariopsis lemaneiformis. Further evidence that supports this observation was provided by the results of Southern hybridisation experiments. Thus GL enzyme activity can be obtained from fungally infected algae, rather than just from the algae as was originally thought.

Of particular interest is the finding that there are two natural DNA sequences, each of which codes for an enzyme having GL characteristics. These DNA nucleic acid sequences have been sequenced and they are presented as SEQ. I.D. No. 3 and SEQ. I.D. No. 4 (which are discussed and presented later).

An initial enzyme purification can be performed by the method as described by Yu et al (ibid). However, it is preferred that the initial enzyme purification includes the use of a solid support that does not decompose under the purification step. This gel support has the advantage that it is compatible with standard laboratory protein purification equipment. The details of this preferred purification process are given later on. The purification is terminated by known standard techniques for protein purification. The purity of the enzyme was established using complementary electroforetic techniques.

The purified lyase was characterized according to pI, temperature- and pH-optima. In this regard, it was found that the enzyme has the following characteristics: an optimium substrate specificity and a pH optimum at 3.5-7.5 when amylopectin is used; a temperature optimum at 50.degree. C. and a pI of 3.9.

As mentioned above, the enzymes according to the present invention have been determined (partially by amino-acid sequencing techniques) and their amino acid sequences are provided later. Likewise the nucleotide sequences coding for the enzymes according to the present invention (i.e. GL) have been sequenced and the DNA sequences are provided later.

The following samples were deposited in accordance with the Budapest Treaty at the recognised depositary The National Collections of Industrial and Marine Bacteria Limited (NCIMB) at 23 St. Machar Drive, Aberdeen, Scotland, United Kingdom, AB2 1RY on Jun. 20, 1994:

E. Coli containing plasmid pGL1 (NCIMB 40652)--[ref. DH5alpha-pGL1]; and

E. Coli containing plasmid pGL2 (NCIMB 40653)--[ref. DH5alpha-pGL2].

The following sample was accepted as a deposit in accordance with the Budapest Treaty at the recognised depositary The Culture Collection of Algae and Protozoa (CCAP) at Dunstaffnage Marine Laboratory PO Box 3, Oban, Argyll, Scotland, United Kingdom, PA34 4AD on Oct. 11, 1994:

Fungally infected Gracilariopsis lemaneiformis (CCAP 1373/1)--[ref. GLQ-1 (Qingdao)].

Thus highly preferred embodiments of the present invention include a GL enzyme obtainable from the expression of the GL coding sequences present in plasmids that are the subject of either deposit NCIMB 40652 or deposit NCIMB 40653; and a GL enzyme obtainable from the fungally infected algae that is the subject of deposit CCAP 1373/1.

The present invention will now be described only by way of example.

In the following Examples reference is made to the accompanying figures in which:

FIGS. 1a and 1b shows stained fungally infected algae;

FIG. 2 shows stained fungally infected algae;

FIGS. 3a-d shows sections of fungally infected algae;

FIG. 4 shows a section of fungally infected algae;

FIG. 5 shows a plasmid map of pGL1;

FIG. 6 shows a plasmid map of pGL2;

FIG. 7 shows the amino acid sequence represented as SEQ. I.D. No.3 showing positions of the peptide fragments that were sequenced;.

FIGS. 8a-c shows the alignment of SEQ. I.D. No. 1 with SEQ. I.D. No.2;

FIG. 9 is a microphotograph.

In more detail, FIGS. 1a and 1b shows Calcoflour White stainings revealing fungi in upper part and lower part of Gracilariopsis lemaneiformis (108.times. and 294.times.).

FIG. 2 shows PAS/Anilinblue Black staining of Gracilariopsis lemaneiformis with fungi. The fungi have a significant higher content of carbohydrates.

FIGS. 3a-d shows the antisense detections with clone 2 probe (a and b) appear to be restricted to the fungi illustrated by Calcoflour White staining of the succeeding section (c and d) (46.times. and 108.times.).

FIG. 4 shows intense antisense detections with clone 2 probe are found over the fungi in Gracilariopsis lemaneiformis (294.times.).

FIG. 5 shows a map of plasmid pGL1--which is a pBluescript II KS containing a 3.8 kb fragment isolated from a genomic library constructed from fungal infected Gracilariopsis lemaneiformis. The fragment contains a gene coding for alpha-1,4-glucan lyase.

FIG. 6 shows a map of plasmid pGL2--which is a pBluescript II SK containing a 3.6 kb fragment isolated from a genomic library constructed from fungal infected Gracilariopsis lemaneiformis. The fragment contains a gene coding for alpha-1,4-glucan lyase.

FIGS. 8a-c shows the alignment of SEQ. I.D. No. 1 (GL1) with SEQ. I.D. No.2 (GL2). The total number of residues for GL1 is 1088; and the total number of residues for GL2 is 1091. In making the comparison, a structure-genetic matrix was used (Open gap cost: 10; Unit gap cost: 2). In FIGS. 8a-c the character to show that two aligned residues are identical is `:`; and the character to show that two aligned residues are similar is `.`. Amino acids said to be `similar` are: A,S,T; D,E; N,Q; R,K; I,L,M,V; F,Y,W. Overall there is an identity of 845 amino acids (i.e. 77.67%); a similarity of 60 amino acids (5.51%). The number of gaps inserted in GL1 are 3 and the number of gaps inserted in GL2 are 2.

FIG. 9 is a microphotograph of a fungal hypha (f) growing between the algal walls (w). Note grains of floridean starch (s) and thylakoids (arrows) in the algal cell.

The following sequence information was used to generate primers for the PCR reactions mentioned below and to check the amino acid sequence generated by the respective nucleotide sequences.

Amino acid sequence assembled from peptides from fungus infected Gracilariopsis lemaneiformisTyr Arg Trp Gln Glu Val Leu Tyr Thr Ala Met Tyr Gln Asn Ala (SEQ ID NO:5) - Ala Phe Gly Lys Pro Ile Ile Lys Ala Ala Ser Met Tyr Asn Asn - Asp Ser Asn Val Arg Arg Ala Gln Asn Asp His Phe Leu Leu Gly - Gly His Asp Gly Tyr Arg Ile Leu Cys Ala Pro Val Val Trp Glu - Asn Ser Thr Glu Arg Glu Leu Tyr Leu Pro Val Leu Thr Gln Trp - Tyr Lys Phe Gly Pro Asp Phe Asp Thr Lys Pro Leu Glu Gly Ala -The Amino acid sequence (27-34) used to generate primer A and B (Met Tyr Asn Asn Asp Ser Asn Val) (SEQ ID NO:21) -Primer A - ATG TA(TC) AA(CT) AA(CT) GA(CT) TC(GATC) AA(CT) GT (SEQ ID NO:6) 128 mix - Primer B - ATG TA(TC) AA(CT) AA(CT) GA(CT) AG(CT) AA(CT) GT (SEQ ID NO:7) 64 mix -The Amino acid sequence (45-50) used to generate primer C (Gly Gly His Asp Gly Tyr) (SEQ ID NO:22) -Primer C - TA (GATC)CC (GA)TC (GA)TG (GATC)CC (GATC)CC (SEQ ID NO:8) 256 mix -[The sequence corresponds to the complementary strand.] The Amino acid sequence (74-79) used to generate primer E (Gln Trp Tyr Lys Phe Gly) (SEQ ID No: 23) Primer E - GG(GATC) CC(GA) AA(CT) TT(GA) TAC CA(CT) TG (SEQ ID NO:9) 64 mix -[The sequence corresponds to the complementary strand.] -The Amino acid sequence (1-6) used to generate primer F1 and F2 (Tyr Arg Trp Gln Glu Val) (SEQ ID NO:24)Primer F1 - TA(TC) CG(GATC) TGG CA(GA) GA(GA) GT (SEQ ID NO:10) 32 mix - Primer F2 - TA(TC) AG(GA) TGG CA(GA) GA(GA) GT (SEQ ID NO:11) 16 mix -The sequence obtained from the first PCR amplification (clone 1)ATGTACAACA ACGACTCGAA CGTTCGCAGG GCGCAGAACG ATCATTTCCT (SEQ ID NO:12) - TCTTGGCGGC CACGACGGTT A - Met Tyr Asn Asn Asp Ser Asn Val Arg Arg Ala Gln Asn Asp His Phe Leu Leu Gly (SEQ ID NO:13) - Gly His Asp Gly -The sequence obtained from the second PCR amplification (clone 1)ATGTACAACA ACGACTCGAA CGTTCGCAGG GCGCAGAACG ATCATTTCCT (SEQ ID NO:14) - TCTTGGTGGA CATGATGGAT ATCGCATTCT GTGCGCGCCT GTTGTGTGGG - AGAATTCGAC CGAACGNGAA TTGTACTTGC CCGTGCTGAC CCAATGGTAC - AAATTCGGCC C - Met Tyr Asn Asn Asp Ser Asn Val Arg Arg Ala Gln Asn Asp His Phe Leu Leu Gly (SEQ ID NO:15) - Gly His Asp Gly Tyr Arg Ile Leu Cys Ala Pro Val Val Trp Glu Asn Ser Thr Glu - Arg Glu Leu Tyr Leu Pro Val Leu Thr Gln Trp Tyr Lys Phe Gly Pro -The sequence obtained from the third PCR amplification (clone2)TACAGGTGGC AGGAGGTGTT GTACACTGCT ATGTACCAGA (SEQ ID NO:16) - ATGCGGCTTT CGGGAAACCG ATTATCAAGG CAGCTTCCAT - GTACGACAAC GACAGAAACG TTCGCGGCGC ACAGGATGAC - CACTTCCTTC TCGGCGGACA CGATGGATAT CGTATTTTGT - GTGCACCTGT TGTGTGGGAG AATACAACCA GTCGCGATCT - GTACTTGCCT GTGCTGACCA GTGGTACAAA TTCGGCCC - Tyr Arg Trp Gln Glu Val Leu Tyr Thr Ala Met Tyr Gln Asn Ala Ala Phe Gly Lys (SEQ ID NO:17) - Pro Ile Ile Lys Ala Ala Ser Met Tyr Asp Asn Asp Arg Asn Val Arg Gly Ala Gln Asp - Asp His Phe Leu Leu Gly Gly His Asp Gly Tyr Arg Ile Leu Cys Ala Pro Val Val - Trp Glu Asn Thr Thr Ser Arg Asp Leu Tyr Leu Pro Val Leu Thr Lys Trp Tyr Lys - Phe Gly 1. Cytological Investigations of Gracilariopsis lemaneiformis 1.1.1 Detection of fungal infection in Gracilariopsis lemaneiformis

Sections of Gracilariopsis lemaneiformis collected in China were either hand cut or cut from paraffin embedded material. Sectioned material was carefully investigated by light microscopy. Fungal hyphae were clearly detected in Gracilariopsis lemaneiformis.

The thalli of the Gracilariopsis lemaneiformis are composed of cells appearing in a highly ordered and almost symmetric manner. The tubular thallus of G. lemaneiformis is composed of large, colourless central cells surrounded by elongated, slender, ellyptical cells and small, round, red pigmented peripherial cells. All algal cell types are characterized by thick cell walls. Most of the fungal hyphae are found at the interphase between the central layer of large cells and the peripherial layer. These cells can clearly be distinguished from the algae cells as they are long and cylindrical. The growth of the hypha e is observed as irregularities between the highly ordered algae cells. The most frequent orientation of the hypha is along the main axis of the algal thallus. Side branches toward tie central and periphery are detected in some cases. The hypha can not be confused with the endo/epiphytic 2nd generation of the algae.

Calcofluor White is known to stain chitin and cellulose containing tissue. The reaction with chitin requires four covalently linked terminal n-acetyl glucosamine residues. It is generally accepted that cellulose is almost restricted to higher plants although it might occur in trace amounts in some algae. It is further known that chitin is absent in Gracilaria.

Calcofluor White was found to stain domains corresponding to fungi hyfa cell walls in sectioned Gracilariopsis lemaneiformis material.

The hypha appear clear white against a faint blue background of Gracilaria tissue when observed under u.v. light--see FIGS. 1a and 1b. Chitin is the major cell wall component in most fungi but absent in Gracilaria. Based upon these observations we conclude that the investigated algae is infected by a fungi. 40% of the lower parts of the investigated Gracilariopsis lemaneiformis sections were found to be infected with fungal hyphae. In the algae tips 25% of the investigated Gracilariopsis lemaneiformis sections were found to be infected.

Staining of sectioned Gracilariopsis lemaneiformis with Periodic acid Schiff (PAS) and Aniline blue black revealed a significantly higher content of carbohydrates within the fungal cells as compared with the algae cells--see FIG. 2. Safranin O and Malachit Green showed the same colour reaction of fungi cells as found in higher plants infected with fungi.

An Acridin Orange reaction with sectioned Gracilariopsis lemaneiformis showed clearly the irregularly growth of the fungus.

1.1.2 Electron Microscopy

Slides with 15 .mu.m thick sections, where the fungus was detected with Calcofluor White were fixed in 2% OsO.sub.4, washed in water and dehydrated in dimethoxypropane and absolute alcohol. A drop of a 1:1 mixture of acetone and Spurr resin was placed over each section on the glass slide, and after one hour replaced by a drop of pure resin. A gelatin embedding capsule filled with resin was placed face down over the section and left over night at 4.degree. C. After the polymerization at 55.degree. C. for 8 hrs, the thick sections adhering to the resin blocks could can be separated from the slide by immersion in liquid nitrogen.

Blocks were trimmed and 100 nm thick sections were cut using a diamond knife on a microtome. The sections were stained in aqueous uranyl acetate and in lead citrate. The sections were examined in an electron microscope at 80 kV.

The investigation confirmed the light microscopical observations and provided further evidence that the lyase producing, chinese strain of G. lamneiformis is infected by a fungal parasite or symbiont.

Fungal hyphae are build of tubular cells 50 to 100 .mu.m long and only few microns in diameter. The cells are serially arranged with septate walls between the adjacent cells. Ocasional branches are also seen. The hyphae grow between the thick cell walls of algal thallus without penetrating the wall or damaging the cell. Such a symbiotic association, called mycophycobiosis, is known to occur between some filamentous marine fungi and large marine algae (Donk and Bruning, 1992--Ecology of aquatic fungi in and on algae. In Reisser, W.(ed.): Algae and Symbioses: Plants, Animals, Fungi, Viruses, Interactions Explored. Biopress Ltd.,Bristol.)

Examining the microphotograph in FIG. 9, several differences between algal and fungal cells can be noticed. In contrast to several .mu.m thick walls of the alga, the fungal walls are only 100-200 nm thick. Plant typical organells as chloroplasts with thyllacoid membranes as well as floridean starch grains can be seen in algal cells, but not in the fungus.

Intercellular connections of red algae are characterized by specific structures termed pit plugs, or pit connections The structures are prominent, electron dense cores and they are important features in algal taxonomy (Pueschel, C. M.: An expanded survey of the ultrastructure of Red algal pit plugs. J. Phycol. 25, 625, (1989)). In our material, such connections were frequently observed in the algal thallus, but never between the cells of the fungus.

1.2 In situ Hybridization Experiments

In situ hybridization technique is based upon the principle of hybridization of an antisense ribonucotide sequence to the mRNA. The technique is used to visualize areas in microscopic sections where said mRNA is present. In this particular case the technique is used to localize the enzyme .alpha.-1,4-glucan lyase in sections of Gracilariopsis lemaneiformis.

1.2.1 Preparation of .sup.35 S Labelled Probes for In situ Hybridization

A 238 bp PCR fragment from a third PCR amplification--called clone 2 (see above)--was cloned into the pGEM-3Zf(+) Vector (Promega). The transcription of the antisense RNA was driven by the SP6 promotor, and the sense RNA by the T7 promotor. The Ribonuclease protection assay kit (Ambion) was used with the following modifications. The transcripts were run on a 6% sequencing gel to remove the unincorporated nucleotide and eluted with the elution buffer supplied with the T7RNA polymerase in vitro Transcription Kit (Ambion). The antisense transcript contained 23 non-coding nucleotides while the sense contained 39. For hybridization 10.sup.7 cpm/ml of the .sup.35 S labelled probe was used.

In situ hybridisation was performed essentially as described by Langedale et.al.(1988). The hybridization temperature was found to be optimal at 45.degree. C. After washing at 45.degree. C. the sections were covered with KodaK K-5 photographic emulsion and left for 3 days at 5.degree. C. in dark (Ref: Langedale, J. A., Rothermel, B. A. and Nelson, T. (1988). Genes and development 2: 106-115. Cold Spring Harbour Laboratory).

The in situ hybridization experiments with riboprobes against the mRNA of .alpha.-1,4-glucan lyase, show strong hybridizations over and around the hypha of the fungus detected in Gracilariopsis lemaneiformis--see FIGS. 3a-d and 4. This is considered a strong indication that the .alpha.-1,4-glucan lyase is produced. A weak random background reactions were detected in the algae tissue of both Gracilariopsis lemaneiformis. This reaction was observed both with the sense and the antisense probes. Intense staining over the fungi hypha was only obtained with antisense probes.

These results were obtained with standard hybridisation conditions at 45.degree. C. in hybridization and washing steps. At 50.degree. C. no staining over the fungi was observed, whereas the background staining remained the same. Raising the temperature to 55.degree. C. reduced the background staining with both sense and antisense probes significantly and equally.

Based upon the cytological investigations using complementary staining procedures it is concluded that Gracilariopsis lemaneiformis is fungus infected. The infections are most pronounced in the lower parts of the algal tissue.

In sectioned Gracilariopsis lemaneiformis material in situ hybridization results clearly indicate that hybridization is restricted to areas where fungal infections are found--see FIGS. 3a-d. The results indicate that .alpha.-1,4-glucan lyase mRNA appears to be restricted to fungus infected areas in Gracilariopsis lemaneiformis.

Based upon these observations we conclude that .alpha.-1,4-glucan lyase activity is detected in fungally infected Gracilariopsis lemaneiformis.

2. Enzyme Purification and Characterization

Purification of .alpha.-1,4-glucan lyase from fungal infected Gracilariopsis lemaneiformis material was performed as follows.

2.1 Materials and Methods

The algae were harvested by filtration and washed with 0.9% NaCl. The cells were broken by homogenization followed by sonication on ice for 6.times.3 min in 50 mM citrate-NaOH pH 6.2 (Buffer A). Cell debris were removed by centrifugation at 25,000.times.g for 40 min. The supernatant obtained at this procedure was regarded as cell-free extract and was used for activity staining and Western blotting after separation on 8-25% gradient gels.

2.2 Separation by .beta.-cyclodextrin Sepharose gel

The cell-free extract was applied directly to a .beta.-cyclodextrin Sepharose gel 4B column (2.6.times.18 cm) pre equilibrated with Buffer A. The column was washed with 3 volumes of Buffer A and 2 volumes of Buffer A containing 1 M NaCl. .alpha.1,4-glucan lyase was eluted with 2% dextrins in Buffer A. Active fractions were pooled and the buffer changed to 20 mM Bis-tris propane-HCl (pH 7.0, Buffer B).

Active fractions were applied onto a Mono Q HR 5/5 column pre-equilibrated with Buffer B. The fungal lyase was eluted with Buffer B in a linear gradient of 0.3 M NaCl.

The lyase preparation obtained after, .beta.-cyclodextrin Sepharose chromatography was alternatively concentrated to 150 .mu.l and applied on a Superose 12 column operated under FPLC conditions.

2.3 Assay for .alpha.-1,4-glucan lyase activity and conditions for determination of substrate specificity, pH and temperature optimum

The reaction mixture for the assay of the .alpha.-1,4-glucan lyase activity contained 10 mg ml.sup.-1 amylopectin and 25 mM Mes-NaOH (pH 6.0). The reaction was carried out at 30.degree. C. for 30 min and stopped by the addition of 3,5-dinitrosalicylic acid reagent. Optical density at 550 nm was measured after standing at room temperature for 10 min.

3. Amino Acid Sequencing of the .alpha.-1,4-Glucan Lyase from Fungus Infected Gracilariopsis Lemaneiformis 3.1 Amino Acid Sequencing of the Lyases

The lyases were digested with either endoproteinase Arg-C from Clostridium histolyticum or endoproteinase Lys-C from Lysobacter enzymogenes, both sequencing grade purchased from Boehringer Mannheim, Germany. For digestion with endoproteinase Arg-C, freeze dried lyase (0.1 mg) was dissolved in 50 .mu.l 10 M urea, 50 mM methylamine, 0.1 M Tris-HCl, pH 7.6. After overlay with N.sub.2 and addition of 10 .mu.l of 50 mM DTT and 5 mM EDTA the protein was denatured and reduced for 10 min at 50.degree. C. under N.sub.2. Subsequently, 1 .mu.g of endoproteinase Arg-C in 10 .mu.l of 50 mM Tris-HCl, pH 8.0 was added, N.sub.2 was overlayed and the digestion was carried out for 6 h at 37.degree. C. For subsequent cysteine derivatization, 12.5 .mu.l 100 mM iodoacetamide was added and the solution was incubated for 15 min at RT in the dark under N.sub.2.

For digestion with endoproteinase Lys-C, freeze dried lyase (0.1 mg) was dissolved in 50 .mu.of 8 M urea, 0.4 M NH.sub.4 HCO.sub.3, pH 8.4. After overlay with N.sub.2 and addition of 5 .mu.l of 45 mM DTT, the protein was denatured and reduced for 15 min at 50.degree. C. under N.sub.2. After cooling to RT, 5 .mu.l of 100 mM iodoacetamide was added for the cysteines to be derivatized for 15 min at RT in the dark under N.sub.2.

Subsequently, 90 .mu.l of water and 5 .mu.g of endoproteinase Lys-C in 50 .mu.l of 50 mM tricine and 10 mM EDTA, pH 8.0, was added and the digestion was carried out for 24 h at 37.degree. C. under N.sub.2.

The resulting peptides were separated by reversed phase HPLC on a VYDAC C18 column (0.46.times.15 cm; 10 .mu.m; The Separations Group; California) using solvent A: 0.1% TFA in water and solvent B: 0. 1% TFA in acetonitrile. Selected peptides were rechromatographed on a Develosil C18 column (0.46.times.10 cm; 3 .mu.m; Dr. Ole Schou, Novo Nordisk, Denmark) using the same solvent system prior to sequencing on an

Applied Biosystems 476A sequencer using pulsed-liquid fast cycles.

The amino acid sequence information from the enzyme derived from fungus infected Gracilariopsis lemaneiformis is shown below, in particular SEQ. ID. No. 1. and SEQ. ID. No. 2.

SEQ. I.D. No. 1 has: Number of residues: 1088. Amino acid composition (including the signal sequence) 61 Ala 15 Cys 19 His 34 Met 78 Thr - 51 Arg 42 Gln 43 Ile 53 Phe 24 Trp - 88 Asn 53 Glu 63 Leu 51 Pro 58 Tyr - 79 Asp 100 Gly 37 Lys 62 Ser 77 Val - SEQ. I.D. No. 2 has: Number of residues: 1091. Amino acid composition (including the signal sequence) 58 Ala 16 Cys 14 His 34 Met 68 Thr - 57 Arg 4O Gln 44 Ile 56 Phe 23 Trp - 84 Asn 47 Glu 69 Leu 51 Pro 61 Tyr - 81 Asp 102 Gly 50 Lys 60 Ser 76 Val 3.2 N-terminal Analysis

Studies showed that the N-terminal sequence of native glucan lyase 1 was blocked. Deblocking was achieved by treating glucan lyase 1 blotted onto a PVDF membrane with anhydrous TFA for 30 min at 40.degree. C. essentially as described by LeGendre et al. (1993) [Purification of proteins and peptides by SDS-PAGE; In: Matsudaira, P. (ed.) A practical guide to protein and peptide purification for microsequencing, 2nd edition; Academic Press Inc., San Diego; pp. 74-101.]. The sequence obtained was TALSDKQTA (SEQ ID NO:25), which matches the sequence (sequence position from 51 to 59 of SEQ. I.D. No.1) derived from the clone for glucan lyase 1 and indicates N-acetylthreonine as N-terminal residue of glucan lyase 1. Sequence position 1 to 50 of SEQ. I.D. No. 1 represents a signal sequence.

4. DNA Sequencing of Genes Coding for the .alpha.-1,4-Glucan Lyase from Fungus Infected Gracilariopsis lemaneiformis 4.1 Methods for Molecular Biology

DNA was isolated as described by Saunders (1993) with the following modification: The polysaccharides were removed from the DNA by ELUTIP-d (Schleicher & Schuell) purification instead of gel purification. (Ref: Saunders, G. W. (1993). Gel purification of red algal genomic DNA: An inexpensive and rapid method for the isolation of PCR-friendly DNA. Journal of phycology 29(2): 251-254 and Schleicher & Schuell: ELUTIP-d. Rapid Method for Purification and Concentration of DNA.)

4.2 PCR

The preparation of the relevant DNA molecule was done by use of the Gene Amp DNA Amplification Kit (Perkin Elmer Cetus, USA) and in accordance with the manufactures instructions except that the Taq polymerase was added later (see PCR cycles) and the temperature cycling was changed to the following:

______________________________________PCR cycles: no of cycles C time (min.)______________________________________1 98 5 60 5addition of Taq polymerase and oil 35 94 1 47 2 72 3 1 72 20______________________________________ 4.3 Cloning of PCR Fragments

PCR fragments were cloned into pT7Blue (from Novagen) following the instructions of the supplier.

4.4 DNA Sequencing

Double stranded DNA was sequenced essentially according to the dideoxy method of Sanger et al. (1979) using the Auto Read Sequencing Kit (Pharmacia) and the Pharmacia LKB A.L.F.DNA sequencer. (Ref: Sanger, F., Nicklen, S. and Coulson, A. R.(1979). DNA sequencing with chain-determinating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467.).

The sequences are shown as SEQ. I.D. No.s 3 and 4, wherein

SEQ. I.D. No. 3 has:

Total number of bases is: 3267.

DNA sequence composition: 850 A; 761 C; 871 G; 785 T

SEQ. I.D. No. 4 has:

Total number of bases is: 3276.

DNA sequence composition: 889 A; 702 C; 856 G; 829 T

4.5 Screening of the Library

Screening of the Lambda Zap library obtained from Stratagene, was performed in accordance with the manufacturer's instructions except that the prehybridization and hybridization was performed in 2.times.SSC, 0.1% SDS, 10.times.Denhardt's and 100 .mu.g/ml denatured salmon sperm DNA. To the hybridization solution a 32P-labeled denatured probe was added. Hybridization was performed over night at 55.degree. C. The filters were washed twice in 2.times.SSC, 0.1% SDS and twice in 1.times.SSC, 0.1% SDS.

4.6 Probe

The cloned PCR fragments were isolated from the pT7 blue vector by digestion with appropriate restriction enzymes. The fragments were separated from the vector by agarose gel electrophoresis and the fragments were purified from the agarose by Agarase (Boehringer Mannheim). As the fragments were only 90-240 bp long the isolated fragments were exposed to a ligation reaction before labelling with 32P-dCTP using either Prime-It random primer kit (Stratagene) or Ready to Go DNA labelling kit (Pharmacia).

4.7 Results 4.7.1 Generation of PCR DNA fragments coding for .alpha.-1,4-glucan lyase.

The amino acid sequences of three overlapping tryptic peptides from .alpha.-1,4-glucan lyase were used to generate mixed oligonucleotides, which could be used as PCR primers (see the sequences given above).

In the first PCR amplification primers A/B (see above) were used as upstream primers and primer C (see above) was used as downstream primer. The size of the expected PCR product was 71 base pairs.

In the second PCR amplification primers A/B were used as upstream primers and E was used as downstream primer. The size of the expected PCR product was 161 base pairs.

In the third PCR amplification primers F1 (see above) and F2 (see above) were used as upstream primers and E was used as downstream primer. The size of the expected PCR product was 238 base pairs. The PCR products were analysed on a 2% LMT agarose gel and fragments of the expected sizes were cut out from the gel and treated with Agarase (Boehringer Manheim) and cloned into the pT7blue Vector (Novagen) and sequenced.

The cloned fragments from the first and second PCR amplification coded for amino acids corresponding to the sequenced peptides (see above). The clone from the third amplification (see above) was only about 87% homologous to the sequenced peptides.

4.7.2 Screening of the Genomic Library with the Cloned PCR Fragments

Screening of the library with the above-mentioned clones gave two clones. One clone contained the nucleotide sequence of SEQ I.D. No. 4 (gene 2). The other clone contained some of the sequence of SEQ I.D. No.3 (from base pair 1065 downwards) (gene 1).

The 5' end of SEQ. I.D. No. 3 (i.e. from base pair 1064 upwards) was obtained by the RACE (rapid amplification of cDNA ends) procedure (Michael, A. F., Michael, K. D. & Martin, G. R.(1988). Proc. Natl. Acad. Sci. USA 85: 8998-99002.) using the 5' race system from Gibco BRL. Total RNA was isolated according to Collinge et al.(Collinge, D. B., Milligan D. E:, Dow, J. M., Scofield, G. & Daniels, M. J.(1987). Plant Mol Biol 8: 405-414). The 5' race was done according to the protocol of the manufacturer, using 1 .mu.g of total RNA. The PCR product from the second amplification was cloned into pT7blue vector from Novagen according to the protocol of the manufacturer. Three independent PCR clones were sequenced to compensate for PCR errors.

An additional PCR was performed to supplement the clone just described with XbaI and NdeI restriction sites immediately in front of the ATG start codon using the following oligonucleotide as an upstream primer: GCTCTAGAGCATGTTTTCAACCCTTGCG (SEQ ID No:18) and a primer containing the complement sequence of bp 1573-1593 in sequence GL1 (i.e. SEQ. I.D. No. 3) was used as a downstream primer.

The complete sequence for gene 1 (i.e. SEQ. I.D. No. 3) was generated by cloning the 3' end of the gene as a BamHI-HindIII fragment from the genomic clone into the pBluescript II KS+ vector from Stratagene and additionally cloning the PCR generated 5' end of the gene as a XbaI-BamHI fragment in front of the 3' end.

Gene 2 was cloned as a HindIII blunt ended fragment into the EcoRV site of pBluescript II SK+ vector from Stratagene. A part of the 3' untranslated sequence was removed by a SacI digestion, followed by religation. HindIII and HpaI restriction sites were introduced immediately in front of the start ATG by digestion with HindIII and NarI and religation in the presence of the following annealed oligonucleotides

(SEQ ID NO:19)AGCTTGTTAACATGTATCCAACCCTCACCTTCGTGG - (SEQ ID NO:20) ACAATTGTACATAGGTTGGGAGTGGAAGCACCGC

No introns were found in the clones sequenced.

The clone 1 type (SEQ.ID.No.3) can be aligned with all ten peptide sequences (see FIG. 8) showing 100% identity. Alignment of the two protein sequences encoded by the genes isolated from the fungal infected algae Gracilariopsis lemaneiformis shows about 78% identity, indicating that both genes are coding for a .alpha.-1.4-glucan lyase.

5. Expression of the GL Gene in Micro-Organisms (E.G. Analyses of Pichia Lyase Transformants and Aspergillus Lyase Transformants)

The DNA sequence encoding the GL was introduced into microorganisms to produce an enzyme with high specific activity and in large quantities.

In this regard, gene 1 (i.e. SEQ. I.D. No. 3) was cloned as a NotI-HindIII blunt ended (using the DNA blunting kit from Amersham International) fragment into the Pichia expression vector pHIL-D2 (containing the AOX1 promoter) digested with EcoRI and blunt ended (using the DNA blunting kit from Amersham International) for expression in Pichia pastoris (according to the protocol stated in the Pichia Expression Kit supplied by Invitrogen).

In another embodiment, the gene 1 (i.e. SEQ. I.D. No. 3) was cloned as a NotI-HindIII blunt ended fragment (using the DNA blunting kit from Amersham International) into the Aspergillus expression vector pBARMTE1 (containing the methyl tryptophan resistance promoter from Neuropera crassa) digested with SmaI for expression in Aspergillus niger (Pall et al (1993) Fungal Genet Newslett. vol 40 pages 59-62). The protoplasts were prepared according to Daboussi et al (Curr Genet (1989) vol 15 pp 453-456) using lysing enzymes Sigma L-2773 and the lyticase Sigma L-8012. The transformation of the protoplasts was followed according to the protocol stated by Buxton et al (Gene (1985) vol 37 pp 207-214) except that for plating the transformed protoplasts the protocol laid out in Punt et al (Methods in Enzymology (1992) vol 216 pp 447-457) was followed but with the use of 0.6% osmotic stabilised top agarose.

The results showed that lyase activity was observed in the transformed Pichia pastoris and Aspergillus niger.

5.1 General Methods

Preparation of cell-free extracts.

The cells were harvested by centrifugation at 9000 rpm for 5 min and washed with 0.9% NaCl and resuspended in the breaking buffer (5 mM K-phosphate, pH 7.5 containing 1 mM of EDTA, and 5% glycerol). Cells were broken using glass beads and vortex treatment. The breaking buffer contained 1 mM PMSF (protease inhibitor). The lyase extract (supernatant) was obtained after centrifugation at 9000 rpm for 5 min followed by centrifugation at 20,000.times.g for 5 min.

Assay of lyase activity by alkaline 3,5-dinitrosalicylic acid reagent (DNS) One volume of lyase extract was mixed with an equal volume of 4% amylopectin solution. The reaction mixture was then incubated at a controlled temperature and samples were removed at specified intervals and analyzed for AF.

The lyase activity was also analyzed using a radioactive method.

The reaction mixture contained 10 .mu.l .sup.14 C-starch solution (1 .mu.Ci; Sigma Chemicals Co.) and 10 .mu.l of the lyase extract. The reaction mixture was left at 25.degree. C. overnight and was then analyzed in the usual TLC system. The radioactive AF produced was detected using an Instant Imager (Pachard Instrument Co., Inc., Meriden, Conn.).

Electrophoresis and Western blotting

SDS-PAGE was performed using 8-25% gradient gels and the PhastSystem (Pharmacia). Western blottings was also run on a Semidry transfer unit of the PhastSystem.

Primary antibodies raised against the lyase purified from the red seaweed collected at Qingdao (China) were used in a dilution of 1:100. Pig antirabbit IgG conjugated to alkaine phosphatase (Dako A/S, Glostrup, Denmark) were used as secondary antibodies and used in a dilution of 1:1000.

Part I, Analysis of the Pichia Transformants Containing the above Mentioned Construct Results

1. Lyase activity was determined 5 days after induction (according to the manual) and proved the activity to be intracellular for all samples in the B series.

______________________________________Samples 11 12 13 15 26 27 28 29 30 of B series: Specific 139 81 122 192 151 253 199 198 150 activity:______________________________________ *Specific activity is defined as nmol AF released per min per mg protein in a reaction mixture containing 2% (w/v) of glycogen, 1% (w/v) glycerol in 10 mM potassium phosphate buffer (pH 7.5). The reaction temperature wa 45.degree. C.; the reaction time was 60 min.

A time course of sample B27 is as follows. The data are also presented in FIG. 1.

______________________________________Time (min) 0 10 20 30 40 50 60 Spec. act. 0 18 54 90 147 179 253______________________________________

Assay conditions were as above except that the time was varied.

2. Western-blotting analysis.

The CFE of all samples showed bands with a molecular weight corresponding to the native lyase.

______________________________________MC-Lyase expressed intracellularly in Pichia pastoris Names of culture Specific activity*______________________________________A18 10 A20 32 A21 8 A22 8 A24 6______________________________________ Part II, The Aspergilus Transformants Results

I. Lyase activity was determined after 5 days incubation(minimal medium containing 0.2% casein enzymatic hydrolysate analysis by the alkaline 3,5-dinitrosalicylic acid reagent

1). Lyase activity analysis of the culture medium

Among 35 cultures grown with 0.2% amylopectin included in the culture medium, AF was only detectable in two cultures. The culture medium of 5.4+ and 5.9+ contained 0.13 g AF/liter and 0.44 g/liter, respectively. The result indicated that active lyase had been secreted from the cells. Lyase activity was also measurable in the cell-free extract.

2). Lyase activity analysis in cell-free extracts

______________________________________Name of the culture Specific activity*______________________________________5.4+ 51 5.9+ 148 5.13 99 5.15 25 5.19 37______________________________________ *The specific activity was defined as nmol of AF produced per min per mg protein at 25.degree. C. + indicates that 0.2% amylopectin was added.

The results show that Gene 1 of GL was expressed intracellular in A. niger.

Experiments with transformed E.coli (using cloning vectors pQE30 from the Qia express vector kit from Qiagen) showed expression of enzyme that was recognised by anti-body to the enzyme purified from fungally infected Gracilariopsis lemaneiformis.

Instead of Aspergillus niger as host, other industrial important microorganisms for which good expression systems are known could be used such as: Aspergillus oryzae, Aspergillus sp., Trichoderma sp., Saccharomyces cerevisiae, Kluyveromyces sp., Hansenula sp., Pichia sp., Bacillus subtilis, B. amyloliquefaciens, Bacillus sp., Streptomyces sp. or E. coli.

Other preferred embodiments of the present invention include any one of the following: A transformed host organism having the capability of producing AF as a consequence of the introduction of a DNA sequence as herein described; such a transformed host organism which is a microorganism--preferably wherein the host organism is selected from the group consisting of bacteria, moulds, fungi and yeast; preferably the host organism is selected from the group consisting of Saccharomyces, Kluyveromyces, Aspergillus, Trichoderma Hansenula, Pichia, Bacillus Streptomyces, Eschericia such as Aspergillus oryzae, Saccharomyces cerevisiae, bacillus sublilis, Bacillus amyloliquefascien, Eschericia coli.; A method for preparing the sugar 1,5-D-anhydrofructose comprising contacting an alpha 1,4-glucan (e.g. starch) with the enzyme .alpha.-1,4-glucan lyase expressed by a transformed host organism comprising a nucleotide sequence encoding the same, preferably wherein the nucleotide sequence is a DNA sequence, preferably wherein the DNA sequence is one of the sequences hereinbefore described; A vector incorporating a nucleotide sequence as hereinbefore described, preferably wherein the vector is a replication vector, preferably wherein the vector is an expression vector containing the nucleotide sequence downstream from a promoter sequence, the vector preferably containing a marker (such as a resistance marker); Cellular organisms, or cell line, transformed with such a vector; A method of producing the product .alpha.-1,4-glucan lyase or any nucleotide sequence or part thereof coding for same, which comprises culturing such an organism (or cells from a cell line) transfected with such a vector and recovering the product.

Other modifications of the present invention will be apparent to those skilled in the art without departing from the scope of the invention.

__________________________________________________________________________# SEQUENCE LISTING - - - - (1) GENERAL INFORMATION: - - (iii) NUMBER OF SEQUENCES: 25 - - - - (2) INFORMATION FOR SEQ ID NO:1: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1088 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: - - Met Phe Ser Thr Leu Ala Phe Val Ala Pro Se - #r Ala Leu Gly AlaSer 1 5 - # 10 - # 15 - - Thr Phe Val Gly Ala Glu Val Arg Ser Asn Va - #l Arg Ile His Ser Ala 20 - # 25 - # 30 - - Phe Pro Ala Val His Thr Ala Thr Arg Lys Th - #r Asn Arg Leu Asn Val 35 - # 40 - # 45 - - Ser Met Thr Ala Leu Ser Asp Lys Gln Thr Al - #a Thr Ala Gly Ser Thr 50 - # 55 - # 60 - - Asp Asn Pro Asp Gly Ile Asp Tyr Lys Thr Ty - #r Asp Tyr Val Gly Val 65 - #70 - #75 - #80 - - Trp Gly Phe Ser Pro Leu Ser Asn Thr Asn Tr - #p Phe Ala Ala Gly Ser 85 - # 90 - # 95 - - Ser Thr Pro Gly Gly Ile Thr Asp Trp Thr Al - #a Thr Met Asn Val Asn 100 - # 105 - # 110 - - Phe Asp Arg Ile Asp Asn Pro Ser Ile Thr Va - #l Gln His Pro Val Gln 115 - # 120 - # 125 - - Val Gln Val Thr Ser Tyr Asn Asn Asn Ser Ty - #r Arg Val Arg Phe Asn 130 - # 135 - # 140 - - Pro Asp Gly Pro Ile Arg Asp Val Thr Arg Gl - #y Pro Ile Leu Lys Gln 145 1 - #50 1 - #55 1 -#60 - - Gln Leu Asp Trp Ile Arg Thr Gln Glu Leu Se - #r Glu Gly Cys AspPro 165 - # 170 - # 175 - - Gly Met Thr Phe Thr Ser Glu Gly Phe Leu Th - #r Phe Glu Thr Lys Asp 180 - # 185 - # 190 - - Leu Ser Val Ile Ile Tyr Gly Asn Phe Lys Th - #r Arg Val Thr Arg Lys 195 - # 200 - # 205 - - Ser Asp Gly Lys Val Ile Met Glu Asn Asp Gl - #u Val Gly Thr Ala Ser 210 - # 215 - # 220 - - Ser Gly Asn Lys Cys Arg Gly Leu Met Phe Va - #l Asp Arg Leu Tyr Gly 225 2 - #30 2 - #35 2 -#40 - - Asn Ala Ile Ala Ser Val Asn Lys Asn Phe Ar - #g Asn Asp Ala ValLys 245 - # 250 - # 255 - - Gln Glu Gly Phe Tyr Gly Ala Gly Glu Val As - #n Cys Lys Tyr Gln Asp 260 - # 265 - # 270 - - Thr Tyr Ile Leu Glu Arg Thr Gly Ile Ala Me - #t Thr Asn Tyr Asn Tyr 275 - # 280 - # 285 - - Asp Asn Leu Asn Tyr Asn Gln Trp Asp Leu Ar - #g Pro Pro His His Asp 290 - # 295 - # 300 - - Gly Ala Leu Asn Pro Asp Tyr Tyr Ile Pro Me - #t Tyr Tyr Ala Ala Pro 305 3 - #10 3 - #15 3 -#20 - - Trp Leu Ile Val Asn Gly Cys Ala Gly Thr Se - #r Glu Gln Tyr SerTyr 325 - # 330 - # 335 - - Gly Trp Phe Met Asp Asn Val Ser Gln Ser Ty - #r Met Asn Thr Gly Asp 340 - # 345 - # 350 - - Thr Thr Trp Asn Ser Gly Gln Glu Asp Leu Al - #a Tyr Met Gly Ala Gln 355 - # 360 - # 365 - - Tyr Gly Pro Phe Asp Gln His Phe Val Tyr Gl - #y Ala Gly Gly Gly Met 370 - # 375 - # 380 - - Glu Cys Val Val Thr Ala Phe Ser Leu Leu Gl - #n Gly Lys Glu Phe Glu 385 3 - #90 3 - #95 4 -#00 - - Asn Gln Val Leu Asn Lys Arg Ser Val Met Pr - #o Pro Lys Tyr ValPhe 405 - # 410 - # 415 - - Gly Phe Phe Gln Gly Val Phe Gly Thr Ser Se - #r Leu Leu Arg Ala His 420 - # 425 - # 430 - - Met Pro Ala Gly Glu Asn Asn Ile Ser Val Gl - #u Glu Ile Val Glu Gly 435 - # 440 - # 445 - - Tyr Gln Asn Asn Asn Phe Pro Phe Glu Gly Le - #u Ala Val Asp Val Asp 450 - # 455 - # 460 - - Met Gln Asp Asn Leu Arg Val Phe Thr Thr Ly - #s Gly Glu Phe Trp Thr 465 4 - #70 4 - #75 4 -#80 - - Ala Asn Arg Val Gly Thr Gly Gly Asp Pro As - #n Asn Arg Ser ValPhe 485 - # 490 - # 495 - - Glu Trp Ala His Asp Lys Gly Leu Val Cys Gl - #n Thr Asn Ile Thr Cys 500 - # 505 - # 510 - - Phe Leu Arg Asn Asp Asn Glu Gly Gln Asp Ty - #r Glu Val Asn Gln Thr 515 - # 520 - # 525 - - Leu Arg Glu Arg Gln Leu Tyr Thr Lys Asn As - #p Ser Leu Thr Gly Thr 530 - # 535 - # 540 - - Asp Phe Gly Met Thr Asp Asp Gly Pro Ser As - #p Ala Tyr Ile Gly His 545 5 - #50 5 - #55 5 -#60 - - Leu Asp Tyr Gly Gly Gly Val Glu Cys Asp Al - #a Leu Phe Pro AspTrp 565 - # 570 - # 575 - - Gly Arg Pro Asp Val Ala Glu Trp Trp Gly As - #n Asn Tyr Lys Lys Leu 580 - # 585 - # 590 - - Phe Ser Ile Gly Leu Asp Phe Val Trp Gln As - #p Met Thr Val Pro Ala 595 - # 600 - # 605 - - Met Met Pro His Lys Ile Gly Asp Asp Ile As - #n Val Lys Pro Asp Gly 610 - # 615 - # 620 - - Asn Trp Pro Asn Ala Asp Asp Pro Ser Asn Gl - #y Gln Tyr Asn Trp Lys 625 6 - #30 6 - #35 6 -#40 - - Thr Tyr His Pro Gln Val Leu Val Thr Asp Me - #t Arg Tyr Glu AsnHis 645 - # 650 - # 655 - - Gly Arg Glu Pro Met Val Thr Gln Arg Asn Il - #e His Ala Tyr Thr Leu 660 - # 665 - # 670 - - Cys Glu Ser Thr Arg Lys Glu Gly Ile Val Gl - #u Asn Ala Asp Thr Leu 675 - # 680 - # 685 - - Thr Lys Phe Arg Arg Ser Tyr Ile Ile Ser Ar - #g Gly Gly Tyr Ile Gly 690 - # 695 - # 700 - - Asn Gln His Phe Gly Gly Met Trp Val Gly As - #p Asn Ser Thr Thr Ser 705 7 - #10 7 - #15 7 -#20 - - Asn Tyr Ile Gly Met Met Ile Ala Asn Asn Il - #e Asn Met Asn MetSer 725 - # 730 - # 735 - - Cys Leu Pro Leu Val Gly Ser Asp Ile Gly Gl - #y Phe Thr Ser Tyr Asp 740 - # 745 - # 750 - - Asn Glu Asn Gln Arg Thr Pro Cys Thr Gly As - #p Leu Met Val Arg Tyr 755 - # 760 - # 765 - - Val Gln Ala Gly Cys Leu Leu Pro Trp Phe Ar - #g Asn His Tyr Asp Arg 770 - # 775 - # 780 - - Trp Ile Glu Ser Lys Asp His Gly Lys Asp Ty - #r Gln Glu Leu Tyr Met 785 7 - #90 7 - #95 8 -#00 - - Tyr Pro Asn Glu Met Asp Thr Leu Arg Lys Ph - #e Val Glu Phe ArgTyr 805 - # 810 - # 815 - - Arg Trp Gly Glu Val Leu Tyr Thr Ala Met Ty - #r Gln Asn Ala Ala Phe 820 - # 825 - # 830 - - Gly Lys Pro Ile Ile Lys Ala Ala Ser Met Ty - #r Asn Asn Asp Ser Asn 835 - # 840 - # 845 - - Val Arg Arg Ala Gln Asn Asp His Phe Leu Le - #u Gly Gly His Asp Gly 850 - # 855 - # 860 - - Tyr Arg Ile Leu Cys Ala Pro Val Val Trp Gl - #u Asn Ser Thr Glu Arg 865 8 - #70 8 - #75 8 -#80 - - Glu Leu Tyr Leu Pro Val Leu Thr Gln Trp Ty - #r Lys Phe Gly ProAsp 885 - # 890 - # 895 - - Phe Asp Thr Lys Pro Leu Glu Gly Ala Met As - #n Gly Gly Asp Arg Ile 900 - # 905 - # 910 - - Tyr Asn Tyr Pro Val Pro Gln Ser Glu Ser Pr - #o Ile Phe Val Arg Glu 915 - # 920 - # 925 - - Gly Ala Ile Leu Pro Thr Arg Tyr Thr Leu As - #n Gly Glu Asn Lys Ser 930 - # 935 - # 940 - - Leu Asn Thr Tyr Thr Asp Glu Asp Pro Leu Va - #l Phe Glu Val Phe Pro 945 9 - #50 9 - #55 9 -#60 - - Leu Gly Asn Asn Arg Ala Asp Gly Met Cys Ty - #r Leu Asp Asp GlyGly 965 - # 970 - # 975 - - Val Thr Thr Asn Ala Glu Asp Asn Gly Lys Ph - #e Ser Val Val Lys Val 980 - # 985 - # 990 - - Ala Ala Glu Gln Asp Gly Gly Thr Glu Thr Il - #e Thr Phe Thr Asn Asp 995 - # 1000 - # 1005 - - Cys Tyr Glu Tyr Val Phe Gly Gly Pro Phe Ty - #r Val Arg Val Arg Gly 1010 - # 1015 - # 1020 - - Ala Gln Ser Pro Ser Asn Ile His Val Ser Se - #r Gly Ala Gly Ser Gln 025 1030 - # 1035 - # 1040 - - Asp Met Lys Val Ser Ser Ala Thr Ser Arg Al - #a Ala Leu Phe Asn Asp 1045 - # 1050 - # 1055 - - Gly Glu Asn Gly Asp Phe Trp Val Asp Gln Gl - #u Thr Asp Ser Leu Trp 1060 - # 1065 - # 1070 - - Leu Lys Leu Pro Asn Val Val Leu Pro Asp Al - #a Val Ile Thr Ile Thr 1075 - # 1080 - # 1085 - - - - (2) INFORMATION FOR SEQ ID NO:2: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1091 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: - - Met Tyr Pro Thr Leu Thr Phe Val Ala Pro Se - #r Ala Leu Gly Ala Arg 1 5 - # 10 - # 15 - - Thr Phe Thr Cys Val Gly Ile Phe Arg Ser Hi - #s Ile Leu Ile His Ser 20 - # 25 - # 30 - - Val Val Pro Ala Val Arg Leu Ala Val Arg Ly - #s Ser Asn Arg Leu Asn 35 - # 40 - # 45 - - Val Ser Met Ser Ala Leu Phe Asp Lys Pro Th - #r Ala Val Thr Gly Gly 50 - # 55 - # 60 - - Lys Asp Asn Pro Asp Asn Ile Asn Tyr Thr Th - #r Tyr Asp Tyr Val Pro 65 - #70 - #75 - #80 - - Val Trp Arg Phe Asp Pro Leu Ser Asn Thr As - #n Trp Phe Ala Ala Gly 85 - # 90 - # 95 - - Ser Ser Thr Pro Gly Asp Ile Asp Asp Trp Th - #r Ala Thr Met Asn Val 100 - # 105 - # 110 - - Asn Phe Asp Arg Ile Asp Asn Pro Ser Phe Th - #r Leu Glu Leu Pro Val 115 - # 120 - # 125 - - Gln Val Gln Val Thr Ser Tyr Lys Asn Asn Cy - #s Phe Arg Val Arg Phe 130 - # 135 - # 140 - - Asn Pro Asp Gly Pro Ile Arg Asp Val Asp Ar - #g Gly Pro Ile Leu Gln 145 1 - #50 1 - #55 1 -#60 - - Gln Gln Leu Asn Trp Ile Arg Lys Gln Glu Gl - #n Ser Lys Gly PheAsp 165 - # 170 - # 175 - - Pro Lys Met Gly Phe Thr Lys Glu Gly Phe Le - #u Lys Phe Glu Thr Lys 180 - # 185 - # 190 - - Asp Leu Asn Val Ile Ile Tyr Gly Asn Phe Ly - #s Thr Arg Val Thr Arg 195 - # 200 - # 205 - - Lys Arg Asp Gly Lys Gly Ile Met Glu Asn As - #n Glu Val Pro Ala Gly 210 - # 215 - # 220 - - Ser Leu Gly Asn Lys Cys Arg Gly Leu Met Ph - #e Val Asp Arg Leu Tyr 225 2 - #30 2 - #35 2 -#40 - - Gly Thr Ala Ile Ala Ser Val Asn Glu Asn Ty - #r Arg Asn Asp ProAsp 245 - # 250 - # 255 - - Arg Lys Glu Gly Phe Tyr Gly Ala Gly Glu Va - #l Asn Cys Glu Phe Trp 260 - # 265 - # 270 - - Asp Ser Glu Gln Asn Arg Asn Lys Tyr Ile Le - #u Glu Arg Thr Gly Ile 275 - # 280 - # 285 - - Ala Met Thr Asn Tyr Asn Tyr Asp Asn Tyr As - #n Tyr Asn Gln Ser Asp 290 - # 295 - # 300 - - Leu Ile Ala Pro Gly Tyr Pro Ser Asp Pro As - #n Phe Tyr Ile Pro Met 305 3 - #10 3 - #15 3 -#20 - - Tyr Phe Ala Ala Pro Trp Val Val Val Lys Gl - #y Cys Ser Gly AsnSer 325 - # 330 - # 335 - - Asp Glu Gln Tyr Ser Tyr Gly Trp Phe Met As - #p Asn Val Ser Gln Thr 340 - # 345 - # 350 - - Tyr Met Asn Thr Gly Gly Thr Ser Trp Asn Cy - #s Gly Glu Glu Asn Leu 355 - # 360 - # 365 - - Ala Tyr Met Gly Ala Gln Cys Gly Pro Phe As - #p Gln His Phe Val Tyr 370 - # 375 - # 380 - - Gly Asp Gly Asp Gly Leu Glu Asp Val Val Gl - #n Ala Phe Ser Leu Leu 385 3 - #90 3 - #95 4 -#00 - - Gln Gly Lys Glu Phe Glu Asn Gln Val Leu As - #n Lys Arg Ala ValMet 405 - # 410 - # 415 - - Pro Pro Lys Tyr Val Phe Gly Tyr Phe Gln Gl - #y Val Phe Gly Ile Ala 420 - # 425 - # 430 - - Ser Leu Leu Arg Glu Gln Arg Pro Glu Gly Gl - #y Asn Asn Ile Ser Val 435 - # 440 - # 445 - - Gln Glu Ile Val Glu Gly Tyr Gly Ser Asn As - #n Phe Pro Leu Glu Gly 450 - # 455 - # 460 - - Leu Ala Val Asp Val Asp Met Gln Gln Asp Le - #u Arg Val Phe Thr Thr 465 4 - #70 4 - #75 4 -#80 - - Lys Ile Glu Phe Trp Thr Ala Asn Lys Val Gl - #y Thr Gly Gly AspSer 485 - # 490 - # 495 - - Asn Asn Lys Ser Val Phe Glu Trp Ala His As - #p Lys Gly Leu Val Cys 500 - # 505 - # 510 - - Gln Thr Asn Val Thr Cys Phe Leu Arg Asn As - #p Asn Gly Gly Ala Asp 515 - # 520 - # 525 - - Tyr Glu Val Asn Gln Thr Leu Arg Glu Lys Gl - #y Leu Tyr Thr Lys Asn 530 - # 535 - # 540 - - Asp Ser Leu Thr Asn Thr Asn Phe Gly Thr Th - #r Asn Asp Gly Pro Ser 545 5 - #50 5 - #55 5 -#60 - - Asp Ala Tyr Ile Gly His Leu Asp Tyr Gly Gl - #y Gly Gly Asn CysAsp 565 - # 570 - # 575 - - Ala Leu Phe Pro Asp Trp Gly Arg Pro Gly Va - #l Ala Glu Trp Trp Gly 580 - # 585 - # 590 - - Asp Asn Tyr Ser Lys Leu Phe Lys Ile Gly Le - #u Asp Phe Val Trp Gln 595 - # 600 - # 605 - - Asp Met Thr Val Pro Ala Met Met Pro His Ly - #s Val Gly Asp Ala Val 610 - # 615 - # 620 - - Asp Thr Arg Ser Pro Tyr Gly Trp Pro Asn Gl - #u Asn Asp Pro Ser Asn 625 6 - #30 6 - #35 6 -#40 - - Gly Arg Tyr Asn Trp Lys Ser Tyr His Pro Gl - #n Val Leu Val ThrAsp 645 - # 650 - # 655 - - Met Arg Tyr Glu Asn His Gly Arg Glu Pro Me - #t Phe Thr Gln Arg Asn 660 - # 665 - # 670 - - Met His Ala Tyr Thr Leu Cys Glu Ser Thr Ar - #g Lys Glu Gly Ile Val 675 - # 680 - # 685 - - Ala Asn Ala Asp Thr Leu Thr Lys Phe Arg Ar - #g Ser Tyr Ile Ile Ser 690 - # 695 - # 700 - - Arg Gly Gly Tyr Ile Gly Asn Gln His Phe Gl - #y Gly Met Trp Val Gly 705 7 - #10 7 - #15 7 -#20 - - Asp Asn Ser Ser Ser Gln Arg Tyr Leu Gln Me - #t Met Ile Ala AsnIle 725 - # 730 - # 735 - - Val Asn Met Asn Met Ser Cys Leu Pro Leu Va - #l Gly Ser Asp Ile Gly 740 - # 745 - # 750 - - Gly Phe Thr Ser Tyr Asp Gly Arg Asn Val Cy - #s Pro Gly Asp Leu Met 755 - # 760 - # 765 - - Val Arg Phe Val Gln Ala Gly Cys Leu Leu Pr - #o Trp Phe Arg Asn His 770 - # 775 - # 780 - - Tyr Gly Arg Leu Val Glu Gly Lys Gln Glu Gl - #y Lys Tyr Tyr Gln Glu 785 7 - #90 7 - #95 8 -#00 - - Leu Tyr Met Tyr Lys Asp Glu Met Ala Thr Le - #u Arg Lys Phe IleGlu 805 - # 810 - # 815 - - Phe Arg Tyr Arg Trp Gln Glu Val Leu Tyr Th - #r Ala Met Tyr Gln Asn 820 - # 825 - # 830 - - Ala Ala Phe Gly Lys Pro Ile Ile Lys Ala Al - #a Ser Met Tyr Asp Asn 835 - # 840 - # 845 - - Asp Arg Asn Val Arg Gly Ala Gln Asp Asp Hi - #s Phe Leu Leu Gly Gly 850 - # 855 - # 860 - - His Asp Gly Tyr Arg Ile Leu Cys Ala Pro Va - #l Val Trp Glu Asn Thr 865 8 - #70 8 - #75 8 -#80 - - Thr Ser Arg Asp Leu Tyr Leu Pro Val Leu Th - #r Lys Trp Tyr LysPhe 885 - # 890 - # 895 - - Gly Pro Asp Tyr Asp Thr Lys Arg Leu Asp Se - #r Ala Leu Asp Gly Gly 900 - # 905 - # 910 - - Gln Met Ile Lys Asn Tyr Ser Val Pro Gln Se - #r Asp Ser Pro Ile Phe 915 - # 920 - # 925 - - Val Arg Glu Gly Ala Ile Leu Pro Thr Arg Ty - #r Thr Leu Asp Gly Ser 930 - # 935 - # 940 - - Asn Lys Ser Met Asn Thr Tyr Thr Asp Lys As - #p Pro Leu Val Phe Glu 945 9 - #50 9 - #55 9 -#60 - - Val Phe Pro Leu Gly Asn Asn Arg Ala Asp Gl - #y Met Cys Tyr LeuAsp 965 - # 970 - # 975 - - Asp Gly Gly Ile Thr Thr Asp Ala Glu Asp Hi - #s Gly Lys Phe Ser Val 980 - # 985 - # 990 - - Ile Asn Val Glu Ala Leu Arg Lys Gly Val Th - #r Thr Thr Ile Lys Phe 995 - # 1000 - # 1005 - - Ala Tyr Asp Thr Tyr Gln Tyr Val Phe Asp Gl - #y Pro Phe Tyr Val Arg 1010 - # 1015 - # 1020 - - Ile Arg Asn Leu Thr Thr Ala Ser Lys Ile As - #n Val Ser Ser Gly Ala 025 1030 - # 1035 - # 1040 - - Gly Glu Glu Asp Met Thr Pro Thr Ser Ala As - #n Ser Arg Ala Ala Leu 1045 - # 1050 - # 1055 - - Phe Ser Asp Gly Gly Val Gly Glu Tyr Trp Al - #a Asp Asn Asp Thr Ser 1060 - # 1065 - # 1070 - - Ser Leu Trp Met Lys Leu Pro Asn Leu Val Le - #u Gln Asp Ala Val Ile 1075 - # 1080 - # 1085 - - Thr Ile Thr 1090 - - - - (2) INFORMATION FOR SEQ ID NO:3: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3267 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: - - ATGTTTTCAA CCCTTGCGTT TGTCGCACCT AGTGCGCTGG GAGCCAGTAC CT -#TCGTAGGG 60 - - GCGGAGGTCA GGTCAAATGT TCGTATCCAT TCCGCTTTTC CAGCTGTGCA CA -#CAGCTACT 120 - - CGCAAAACCA ATCGCCTCAA TGTATCCATG ACCGCATTGT CCGACAAACA AA -#CGGCTACT 180 - - GCGGGTAGTA CAGACAATCC GGACGGTATC GACTACAAGA CCTACGATTA CG -#TCGGAGTA 240 - - TGGGGTTTCA GCCCCCTCTC CAACACGAAC TGGTTTGCTG CCGGCTCTTC TA -#CCCCGGGT 300 - - GGCATCACTG ATTGGACGGC TACAATGAAT GTCAACTTCG ACCGTATCGA CA -#ATCCGTCC 360 - - ATCACTGTCC AGCATCCCGT TCAGGTTCAG GTCACGTCAT ACAACAACAA CA -#GCTACAGG 420 - - GTTCGCTTCA ACCCTGATGG CCCTATTCGT GATGTGACTC GTGGGCCTAT CC -#TCAAGCAG 480 - - CAACTAGATT GGATTCGAAC GCAGGAGCTG TCAGAGGGAT GTGATCCCGG AA -#TGACTTTC 540 - - ACATCAGAAG GTTTCTTGAC TTTTGAGACC AAGGATCTAA GCGTCATCAT CT -#ACGGAAAT 600 - - TTCAAGACCA GAGTTACGAG AAAGTCTGAC GGCAAGGTCA TCATGGAAAA TG -#ATGAAGTT 660 - - GGAACTGCAT CGTCCGGGAA CAAGTGCCGG GGATTGATGT TCGTTGATAG AT -#TATACGGT 720 - - AACGCTATCG CTTCCGTCAA CAAGAACTTC CGCAACGACG CGGTCAAGCA GG -#AGGGATTC 780 - - TATGGTGCAG GTGAAGTCAA CTGTAAGTAC CAGGACACCT ACATCTTAGA AC -#GCACTGGA 840 - - ATCGCCATGA CAAATTACAA CTACGATAAC TTGAACTATA ACCAGTGGGA CC -#TTAGACCT 900 - - CCGCATCATG ATGGTGCCCT CAACCCAGAC TATTATATTC CAATGTACTA CG -#CAGCACCT 960 - - TGGTTGATCG TTAATGGATG CGCCGGTACT TCGGAGCAGT ACTCGTATGG AT -#GGTTCATG 1020 - - GACAATGTCT CTCAATCTTA CATGAATACT GGAGATACTA CCTGGAATTC TG -#GACAAGAG 1080 - - GACCTGGCAT ACATGGGCGC GCAGTATGGA CCATTTGACC AACATTTTGT TT -#ACGGTGCT 1140 - - GGGGGTGGGA TGGAATGTGT GGTCACAGCG TTCTCTCTTC TACAAGGCAA GG -#AGTTCGAG 1200 - - AACCAAGTTC TCAACAAACG TTCAGTAATG CCTCCGAAAT ACGTCTTTGG TT -#TCTTCCAG 1260 - - GGTGTTTTCG GGACTTCTTC CTTGTTGAGA GCGCATATGC CAGCAGGTGA GA -#ACAACATC 1320 - - TCAGTCGAAG AAATTGTAGA AGGTTATCAA AACAACAATT TCCCTTTCGA GG -#GGCTCGCT 1380 - - GTGGACGTGG ATATGCAAGA CAACTTGCGG GTGTTCACCA CGAAGGGCGA AT -#TTTGGACC 1440 - - GCAAACAGGG TGGGTACTGG CGGGGATCCA AACAACCGAT CGGTTTTTGA AT -#GGGCACAT 1500 - - GACAAAGGCC TTGTTTGTCA GACAAATATA ACTTGCTTCC TGAGGAATGA TA -#ACGAGGGG 1560 - - CAAGACTACG AGGTCAATCA GACGTTAAGG GAGAGGCAGT TGTACACGAA GA -#ACGACTCC 1620 - - CTGACGGGTA CGGATTTTGG AATGACCGAC GACGGCCCCA GCGATGCGTA CA -#TCGGTCAT 1680 - - CTGGACTATG GGGGTGGAGT AGAATGTGAT GCACTTTTCC CAGACTGGGG AC -#GGCCTGAC 1740 - - GTGGCCGAAT GGTGGGGAAA TAACTATAAG AAACTGTTCA GCATTGGTCT CG -#ACTTCGTC 1800 - - TGGCAAGACA TGACTGTTCC AGCAATGATG CCGCACAAAA TTGGCGATGA CA -#TCAATGTG 1860 - - AAACCGGATG GGAATTGGCC GAATGCGGAC GATCCGTCCA ATGGACAATA CA -#ACTGGAAG 1920 - - ACGTACCATC CCCAAGTGCT TGTAACTGAT ATGCGTTATG AGAATCATGG TC -#GGGAACCG 1980 - - ATGGTCACTC AACGCAACAT TCATGCGTAT ACACTGTGCG AGTCTACTAG GA -#AGGAAGGG 2040 - - ATCGTGGAAA ACGCAGACAC TCTAACGAAG TTCCGCCGTA GCTACATTAT CA -#GTCGTGGT 2100 - - GGTTACATTG GTAACCAGCA TTTCGGGGGT ATGTGGGTGG GAGACAACTC TA -#CTACATCA 2160 - - AACTACATCC AAATGATGAT TGCCAACAAT ATTAACATGA ATATGTCTTG CT -#TGCCTCTC 2220 - - GTCGGCTCCG ACATTGGAGG ATTCACCTCA TACGACAATG AGAATCAGCG AA -#CGCCGTGT 2280 - - ACCGGGGACT TGATGGTGAG GTATGTGCAG GCGGGCTGCC TGTTGCCGTG GT -#TCAGGAAC 2340 - - CACTATGATA GGTGGATCGA GTCCAAGGAC CACGGAAAGG ACTACCAGGA GC -#TGTACATG 2400 - - TATCCGAATG AAATGGATAC GTTGAGGAAG TTCGTTGAAT TCCGTTATCG CT -#GGCAGGAA 2460 - - GTGTTGTACA CGGCCATGTA CCAGAATGCG GCTTTCGGAA AGCCGATTAT CA -#AGGCTGCT 2520 - - TCGATGTACA ATAACGACTC AAACGTTCGC AGGGCGCAGA ACGATCATTT CC -#TTCTTGGT 2580 - - GGACATGATG GATATCGCAT TCTGTGCGCG CCTGTTGTGT GGGAGAATTC GA -#CCGAACGC 2640 - - GAATTGTACT TGCCCGTGCT GACCCAATGG TACAAATTCG GTCCCGACTT TG -#ACACCAAG 2700 - - CCTCTGGAAG GAGCGATGAA CGGAGGGGAC CGAATTTACA ACTACCCTGT AC -#CGCAAAGT 2760 - - GAATCACCAA TCTTCGTGAG AGAAGGTGCG ATTCTCCCTA CCCGCTACAC GT -#TGAACGGT 2820 - - GAAAACAAAT CATTGAACAC GTACACGGAC GAAGATCCGT TGGTGTTTGA AG -#TATTCCCC 2880 - - CTCGGAAACA ACCGTGCCGA CGGTATGTGT TATCTTGATG ATGGCGGTGT GA -#CCACCAAT 2940 - - GCTGAAGACA ATGGCAAGTT CTCTGTCGTC AAGGTGGCAG CGGAGCAGGA TG -#GTGGTACG 3000 - - GAGACGATAA CGTTTACGAA TGATTGCTAT GAGTACGTTT TCGGTGGACC GT -#TCTACGTT 3060 - - CGAGTGCGCG GCGCTCAGTC GCCGTCGAAC ATCCACGTGT CTTCTGGAGC GG -#GTTCTCAG 3120 - - GACATGAAGG TGAGCTCTGC CACTTCCAGG GCTGCGCTGT TCAATGACGG GG -#AGAACGGT 3180 - - GATTTCTGGG TTGACCAGGA GACAGATTCT CTGTGGCTGA AGTTGCCCAA CG -#TTGTTCTC 3240 - - CCGGACGCTG TGATCACAAT TACCTAA - # - # 3267 - - - - (2) INFORMATION FOR SEQ ID NO:4: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3276 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: - - ATGTATCCAA CCCTCACCTT CGTGGCGCCT AGTGCGCTAG GGGCCAGAAC TT -#TCACGTGT 60 - - GTGGGCATTT TTAGGTCACA CATTCTTATT CATTCGGTTG TTCCAGCGGT GC -#GTCTAGCT 120 - - GTGCGCAAAA GCAACCGCCT CAATGTATCC ATGTCCGCTT TGTTCGACAA AC -#CGACTGCT 180 - - GTTACTGGAG GGAAGGACAA CCCGGACAAT ATCAATTACA CCACTTATGA CT -#ACGTCCCT 240 - - GTGTGGCGCT TCGACCCCCT CAGCAATACG AACTGGTTTG CTGCCGGATC TT -#CCACTCCC 300 - - GGCGATATTG ACGACTGGAC GGCGACAATG AATGTGAACT TCGACCGTAT CG -#ACAATCCA 360 - - TCCTTCACTC TCGAGAAACC GGTTCAGGTT CAGGTCACGT CATACAAGAA CA -#ATTGTTTC 420 - - AGGGTTCGCT TCAACCCTGA TGGTCCTATT CGCGATGTGG ATCGTGGGCC TA -#TCCTCCAG 480 - - CAGCAACTAA ATTGGATCCG GAAGCAGGAG CAGTCGAAGG GGTTTGATCC TA -#AGATGGGC 540 - - TTCACAAAAG AAGGTTTCTT GAAATTTGAG ACCAAGGATC TGAACGTTAT CA -#TATATGGC 600 - - AATTTTAAGA CTAGAGTTAC GAGGAAGAGG GATGGAAAAG GGATCATGGA GA -#ATAATGAA 660 - - GTGCCGGCAG GATCGTTAGG GAACAAGTGC CGGGGATTGA TGTTTGTCGA CA -#GGTTGTAC 720 - - GGCACTGCCA TCGCTTCCGT TAATGAAAAT TACCGCAACG ATCCCGACAG GA -#AAGAGGGG 780 - - TTCTATGGTG CAGGAGAAGT AAACTGCGAG TTTTGGGACT CCGAACAAAA CA -#GGAACAAG 840 - - TACATCTTAG AACGAACTGG AATCGCCATG ACAAATTACA ATTATGACAA CT -#ATAACTAC 900 - - AACCAGTCAG ATCTTATTGC TCCAGGATAT CCTTCCGACC CGAACTTCTA CA -#TTCCCATG 960 - - TATTTTGCAG CACCTTGGGT AGTTGTTAAG GGATGCAGTG GCAACAGCGA TG -#AACAGTAC 1020 - - TCGTACGGAT GGTTTATGGA TAATGTCTCC CAAACTTACA TGAATACTGG TG -#GTACTTCC 1080 - - TGGAACTGTG GAGAGGAGAA CTTGGCATAC ATGGGAGCAC AGTGCGGTCC AT -#TTGACCAA 1140 - - CATTTTGTGT ATGGTGATGG AGATGGTCTT GAGGATGTTG TCCAAGCGTT CT -#CTCTTCTG 1200 - - CAAGGCAAAG AGTTTGAGAA CCAAGTTCTG AACAAACGTG CCGTAATGCC TC -#CGAAATAT 1260 - - GTGTTTGGTT ACTTTCAGGG AGTCTTTGGG ATTGCTTCCT TGTTGAGAGA GC -#AAAGACCA 1320 - - GAGGGTGGTA ATAACATCTC TGTTCAAGAG ATTGTCGAAG GTTACCAAAG CA -#ATAACTTC 1380 - - CCTTTAGAGG GGTTAGCCGT AGATGTGGAT ATGCAACAAG ATTTGCGCGT GT -#TCACCACG 1440 - - AAGATTGAAT TTTGGACGGC AAATAAGGTA GGCACCGGGG GAGACTCGAA TA -#ACAAGTCG 1500 - - GTGTTTGAAT GGGCACATGA CAAAGGCCTT GTATGTCAGA CGAATGTTAC TT -#GCTTCTTG 1560 - - AGAAACGACA ACGGCGGGGC AGATTACGAA GTCAATCAGA CATTGAGGGA GA -#AGGGTTTG 1620 - - TACACGAAGA ATGACTCACT GACGAACACT AACTTCGGAA CTACCAACGA CG -#GGCCGAGC 1680 - - GATGCGTACA TTGGACATCT GGACTATGGT GGCGGAGGGA ATTGTGATGC AC -#TTTTCCCA 1740 - - GACTGGGGTC GACCGGGTGT GGCTGAATGG TGGGGTGATA ACTACAGCAA GC -#TCTTCAAA 1800 - - ATTGGTCTGG ATTTCGTCTG GCAAGACATG ACAGTTCCAG CTATGATGCC AC -#ACAAAGTT 1860 - - GGCGACGCAG TCGATACGAG ATCACCTTAC GGCTGGCCGA ATGAGAATGA TC -#CTTCGAAC 1920 - - GGACGATACA ATTGGAAATC TTACCATCCA CAAGTTCTCG TAACTGATAT GC -#GATATGAG 1980 - - AATCATGGAA GGGAACCGAT GTTCACTCAA CGCAATATGC ATGCGTACAC AC -#TCTGTGAA 2040 - - TCTACGAGGA AGGAAGGGAT TGTTGCAAAT GCAGACACTC TAACGAAGTT CC -#GCCGCAGT 2100 - - TATATTATCA GTCGTGGAGG TTACATTGGC AACCAGCATT TTGGAGGAAT GT -#GGGTTGGA 2160 - - GACAACTCTT CCTCCCAAAG ATACCTCCAA ATGATGATCG CGAACATCGT CA -#ACATGAAC 2220 - - ATGTCTTGCC TTCCACTAGT TGGGTCCGAC ATTGGAGGTT TTACTTCGTA TG -#ATGGACGA 2280 - - AACGTGTGTC CCGGGGATCT AATGGTAAGA TTCGTGCAGG CGGGTTGCTT AC -#TACCGTGG 2340 - - TTCAGAAACC ACTATGGTAG GTTGGTCGAG GGCAAGCAAG AGGGAAAATA CT -#ATCAAGAA 2400 - - CTGTACATGT ACAAGGACGA GATGGCTACA TTGAGAAAAT TCATTGAATT CC -#GTTACCGC 2460 - - TGGCAGGAGG TGTTGTACAC TGCTATGTAC CAGAATGCGG CTTTCGGGAA AC -#CGATTATC 2520 - - AAGGCAGCTT CCATGTACGA CAACGACAGA AACGTTCGCG GCGCACAGGA TG -#ACCACTTC 2580 - - CTTCTCGGCG GACACGATGG ATATCGTATT TTGTGTGCAC CTGTTGTGTG GG -#AGAATACA 2640 - - ACCAGTCGCG ATCTGTACTT GCCTGTGCTG ACCAAATGGT ACAAATTCGG CC -#CTGACTAT 2700 - - GACACCAAGC GCCTGGATTC TGCGTTGGAT GGAGGGCAGA TGATTAAGAA CT -#ATTCTGTG 2760 - - CCACAAAGCG ACTCTCCGAT ATTTGTGAGG GAAGGAGCTA TTCTCCCTAC CC -#GCTACACG 2820 - - TTGGACGGTT CGAACAAGTC AATGAACACG TACACAGACA AAGACCCGTT GG -#TGTTTGAG 2880 - - GTATTCCCTC TTGGAAACAA CCGTGCCGAC GGTATGTGTT ATCTTGATGA TG -#GCGGTATT 2940 - - ACTACAGATG CTGAGGACCA TGGCAAATTC TCTGTTATCA ATGTCGAAGC CT -#TACGGAAA 3000 - - GGTGTTACGA CGACGATCAA GTTTGCGTAT GACACTTATC AATACGTATT TG -#ATGGTCCA 3060 - - TTCTACGTTC GAATCCGTAA TCTTACGACT GCATCAAAAA TTAACGTGTC TT -#CTGGAGCG 3120 - - GGTGAAGAGG ACATGACACC GACCTCTGCG AACTCGAGGG CAGCTTTGTT CA -#GTGATGGA 3180 - - GGTGTTGGAG AATACTGGGC TGACAATGAT ACGTCTTCTC TGTGGATGAA GT -#TGCCAAAC 3240 - - CTGGTTCTGC AAGACGCTGT GATTACCATT ACGTAG - #- # 3276 - - - - (2) INFORMATION FOR SEQ ID NO:5: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 90 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: - - Tyr Arg Trp Gln Glu Val Leu Tyr Thr Ala Me - #t Tyr Gln Asn AlaAla 1 5 - # 10 - # 15 - - Phe Gly Lys Pro Ile Ile Lys Ala Ala Ser Me - #t Tyr Asn Asn Asp Ser 20 - # 25 - # 30 - - Asn Val Arg Arg Ala Gln Asn Asp His Phe Le - #u Leu Gly Gly His Asp 35 - # 40 - # 45 - - Gly Tyr Arg Ile Leu Cys Ala Pro Val Val Tr - #p Glu Asn Ser Thr Glu 50 - # 55 - # 60 - - Arg Glu Leu Tyr Leu Pro Val Leu Thr Gln Tr - #p Tyr Lys Phe Gly Pro 65 - #70 - #75 - #80 - - Asp Phe Asp Thr Lys Pro Leu Glu Gly Ala 85 - # 90 - - - - (2) INFORMATION FOR SEQ ID NO:6: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (ix) FEATURE: (A) NAME/KEY: Other (B) LOCATION: 18...18 (D) OTHER INFORMATION: - #N is G or A or T or C - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: - - ATGTAYAAYA AYGAYTCNAA YGT - # - # 23 - - - - (2) INFORMATION FOR SEQ ID NO:7: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (ix) FEATURE: - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: - - ATGTAYAAYA AYGAYAGYAA YGT - # - # 23 - - - - (2) INFORMATION FOR SEQ ID NO:8: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (ix) FEATURE: (A) NAME/KEY: Other (B) LOCATION: 3...3 (D) OTHER INFORMATION: - #N is G or A or T or C (A) NAME/KEY: Other (B) LOCATION: 12...12 (D) OTHER INFORMATION: - #N is G or A or T or C (A) NAME/KEY: Other (B) LOCATION: 15...15 (D) OTHER INFORMATION: - #N is G or A or T or C - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: - - TANCCRTCRT GNCCNCC - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO:9: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (ix) FEATURE: (A) NAME/KEY: Other (B) LOCATION: 3...3 (D) OTHER INFORMATION: - #N is G or A or T or C - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: - - GGNCCRAAYT TRTACCAYTG - # - # - # 20 - - - - (2) INFORMATION FOR SEQ ID NO:10: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (ix) FEATURE: (A) NAME/KEY: Other (B) LOCATION: 6...6 (D) OTHER INFORMATION: - #N is G or A or T or C - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: - - TAYCGNTGGC ARGARGT - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO:11: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (ix) FEATURE: - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: - - TAYAGRTGGC ARGARGT - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO:12: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 71 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: - - ATGTACAACA ACGACTCGAA CGTTCGCAGG GCGCAGAACG ATCATTTCCT TC -#TTGGCGGC 60 - - CACGACGGTT A - # - # - # 71 - - - - (2) INFORMATION FOR SEQ ID NO:13: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: - - Met Tyr Asn Asn Asp Ser Asn Val Arg Arg Al - #a Gln Asn Asp His Phe 1 5 - # 10 - # 15 - - Leu Leu Gly Gly His Asp Gly 20 - - - - (2) INFORMATION FOR SEQ ID NO:14: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 160 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: - - ATGTACAACA ACGACTCGAA CGTTCGCAGG GCGCAGAACG ATCATTTCCT TC -#TTGGTGGA 60 - - CATGATGGAT ATCGCATTCT GTGCGCGCCT GTTGTGTGGG AGAATTCGAC CG -#AACGGAAT 120 - - TGTACTTGCC CGTGCTGACC CAATGGTACA AATTCGGCCC - # - # 160 - - - - (2) INFORMATION FOR SEQ ID NO:15: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 54 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: - - Met Tyr Asn Asn Asp Ser Asn Val Arg Arg Al - #a Gln Asn Asp His Phe 1 5 - # 10 - # 15 - - Leu Leu Gly Gly His Asp Gly Tyr Arg Ile Le - #u Cys Ala Pro Val Val 20 - # 25 - # 30 - - Trp Glu Asn Ser Thr Glu Arg Glu Leu Tyr Le - #u Pro Val Leu Thr Gln 35 - # 40 - # 45 - - Trp Tyr Lys Phe Gly Pro 50 - - - - (2) INFORMATION FOR SEQ ID NO:16: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 238 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: - - TACAGGTGGC AGGAGGTGTT GTACACTGCT ATGTACCAGA ATGCGGCTTT CG -#GGAAACCG 60 - - ATTATCAAGG CAGCTTCCAT GTACGACAAC GACAGAAACG TTCGCGGCGC AC -#AGGATGAC 120 - - CACTTCCTTC TCGGCGGACA CGATGGATAT CGTATTTTGT GTGCACCTGT TG -#TGTGGGAG 180 - - AATACAACCA GTCGCGATCT GTACTTGCCT GTGCTGACCA GTGGTACAAA TT -#CGGCCC 238 - - - - (2) INFORMATION FOR SEQ ID NO:17: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 79 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: - - Tyr Arg Trp Gln Glu Val Leu Tyr Thr Ala Me - #t Tyr Gln Asn AlaAla 1 5 - # 10 - # 15 - - Phe Gly Lys Pro Ile Ile Lys Ala Ala Ser Me - #t Tyr Asp Asn Asp Arg 20 - # 25 - # 30 - - Asn Val Arg Gly Ala Gln Asp Asp His Phe Le - #u Leu Gly Gly His Asp 35 - # 40 - # 45 - - Gly Tyr Arg Ile Leu Cys Ala Pro Val Val Tr - #p Glu Asn Thr Thr Ser 50 - # 55 - # 60 - - Arg Asp Leu Tyr Leu Pro Val Leu Thr Lys Tr - #p Tyr Lys Phe Gly 65 - #70 - #75 - - - - (2) INFORMATION FOR SEQ ID NO:18: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: - - GCTCTAGAGC ATGTTTTCAA CCCTTGCG - # - # 28 - - - - (2) INFORMATION FOR SEQ ID NO:19: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: - - AGCTTGTTAA CATGTATCCA ACCCTCACCT TCGTGG - # -# 36 - - - - (2) INFORMATION FOR SEQ ID NO:20: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: - - ACAATTGTAC ATAGGTTGGG AGTGGAAGCA CCGC - # -# 34 - - - - (2) INFORMATION FOR SEQ ID NO:21: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: - - Met Tyr Asn Asn Asp Ser Asn Val 1 5 - - - - (2) INFORMATION FOR SEQ ID NO:22: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: - - Gly Gly His Asp Gly Tyr 1 5 - - - - (2) INFORMATION FOR SEQ ID NO:23: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: - - Gln Trp Tyr Lys Phe Gly 1 5 - - - - (2) INFORMATION FOR SEQ ID NO:24: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: - - Tyr Arg Trp Gln Glu Val 1 5 - - - - (2) INFORMATION FOR SEQ ID NO:25: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino - #acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: - - Thr Ala Leu Ser Asp Lys Gln Thr Ala 1 5__________________________________________________________________________

Claims

1. A method of preparing an a-1,4-glucan lyase having an amino acid sequence of SEQ ID NO:2, said method comprising the step of isolating a-1,4-glucan lyase from a fungally infected algae, said algae being Gracilariopsis lemaneiformis as identified by deposit CCAP 1373/1.

2. A method according to claim 1 wherein the .alpha.-1,4-glucan lyase is isolated and/or further purified using a gel that is not degraded by the .alpha.-1,4-glucan lyase.

3. A method according to claim 2, wherein the gel comprises dextrin or a cyclodextrin.

4. A .alpha.-1,4-glucan lyase enzyme prepared by the method of claim 1.

5. An isolated enzyme comprising an amino acid sequence of SEQ ID NO:2.

6. A method according to claim 3, wherein the gel comprises a cyclodextrin.

7. A method according to claim 6, wherein the gel comprises beta-cyclo-dextrin.