Alphavirus replicon vector systems

Information

  • Patent Grant
  • 7045335
  • Patent Number
    7,045,335
  • Date Filed
    Friday, September 6, 2002
    23 years ago
  • Date Issued
    Tuesday, May 16, 2006
    19 years ago
Abstract
The present invention provides compositions useful in and methods for producing populations of infectious, replication-defective alphavirus replicon particles that contain no replication-competent alphavirus particles, as determined by passage on cells in culture. The compositions include helper and replicon nucleic acid molecules that can further reduce the predicted frequency for formation of replication-competent virus and can optimize manufacturing strategies and costs.
Description
FIELD OF THE INVENTION

The present invention relates to improved constructs for and methods of making recombinant alphavirus particles that are useful in immunotherapies for infectious diseases and cancer and in the delivery of genes for therapeutic purposes.


BACKGROUND OF THE INVENTION

Alphaviruses are currently being used as a vector platform to develop vaccines for infectious diseases (e.g. see U.S. Pat. Nos. 5,792,462; 6,156,558; 5,811,407; 5,789,245; 6,015,694; 5,739,026; Pushko et al., Virology 239(2): 389–401 (1997), Frolov et al., J. Virol. 71(1): 248–258 (1997); Smerdou and Liljestrom, J. Virol. 73(2): 1092–1098 (1999). Alphaviruses comprise a genus in the Togaviridae, and members of the genus are found throughout the world, in both vertebrate and invertebrate hosts. Among the most studied alphaviruses for vector platforms are Venezuelan Equine Encephalitis (VEE) Virus, Semiliki Forest Virus (SFV), and Sindbis Virus, the prototype member of the genus. Various constructs have been developed to enhance immunogenicity and effectiveness in vaccine applications. Many of these constructs have also been designed to decrease the likelihood of formation of replication-competent virus through recombination. Johnston et al. (U.S. Pat. Nos. 5,792,462 and 6,156,558, cited above) recognized the potential for recombination from a single helper system (in which the complete set of structural proteins of an alphavirus are on one RNA molecule and the nonstructural proteins and gene of interest are on another molecule), and thus designed “double-helper” systems that utilized two helper RNAs to encode the structural proteins. Dubensky et al. (U.S. Pat. No. 5,789,245) and Polo et al. (U.S. Pat. No. 6,242,259) describe the use of two DNA alphavirus structural protein expression cassettes to package alphavirus replicons or other alphavirus vectors. Liljestrom and colleagues have presented data confirming that a “single helper system” will generate wild-type virus particles through recombination (Bergland, et al. 1993 Biotechnology 11(8): 916–920).


By distributing the viral genes among three nucleic acids, two of which comprise the helper system, as in the above-described art, the theoretical frequency of recombination that would create a replication-competent virus is reduced significantly relative to single helper systems. These existing systems include the use of the alphavirus RNA polymerase recognition signals, so that the helper systems can take advantage of the presence of the alphavirus replication machinery for amplification and efficient expression of helper functions. However, the presence of the terminal recognition signals on the helper RNAs also means that recombinants in which the helper constructs are incorporated into the termini of the replicon RNA by RNA recombination remain replicable. It is also recognized (e.g. Liljestrom et al. U.S. Pat. No. 6,190,666, Column 17, lines 45–48) that the capsid binding region of nsP1 is required for the packaging of alphaviral RNA into virus or viral-like particles, and so removal of this region would result in the reduction of packaging (see also Levis et al. 1986 Cell 44:137 and Weiss et al. 1989 J. Virol. 63:530).


Thus, in existing replicon systems, known packaging signals are typically included in replicon RNAs and excluded from helper constructs. However, helper RNAs are nonetheless packaged or copackaged at a lower frequency (Lu and Silver (J. Virol Methods 2001, 91(1): 59–65), and helper constructs with terminal recognition signals will be amplified and expressed in the presence of a replicon, and potentially yield additional recombination events.


The current preferred dosages for administration of vector replicon particles, as described by Johnston et al., or recombinant alphavirus particles, as described by Dubensky et al., are approximately 106 to 108 particles. In the case of chimpanzee administrations, Dubensky et al. have estimated the need for 4 injections, each containing 107–108 particles, with a Sindbis-HBV vaccine. Such dosages require large scale manufacturing procedures, and the amounts produced at such scale may be greater than the predicted frequency for the generation of replication-competent viruses in these existing systems.


Thus, there remains a need to further improve systems for manufacturing alphavirus replicon particles to further reduce the predicted frequency for formation of replication-competent virus, and to optimize manufacturing strategies and costs.


SUMMARY OF THE INVENTION

The present invention provides improved alphavirus replicon vector systems for producing infectious, replication defective, alphavirus replicon particles in alphavirus-permissive cells. Encompassed in the invention are improved replicon RNAs and improved helper nucleic acids for expressing the alphavirus structural proteins. During the production of recombinant alphavirus particles, the generation of replication-competent virus particles can occur through recombination alone or through a combination of helper packaging and recombination. Thus, constructs are provided that eliminate or minimize the occurrence of one or both of these events. In addition, these constructs are also designed to minimize the manufacturing complexity and cost of particles made with such constructs. The invention also provides methods of making recombinant alphavirus particles using the claimed constructs, and pharmaceutical compositions comprising these recombinant alphavirus particles.


In a first aspect, resolving DNA helpers are provided, namely recombinant DNA molecules for expressing the alphavirus structural proteins which comprise a promoter directing transcription of RNA from a DNA sequence comprising, in order (i) a first nucleic acid sequence encoding at least one alphavirus structural protein, (ii) a second nucleic acid sequence encoding a ribozyme, (iii) a third nucleic acid sequence encoding an IRES, and (iv) a fourth nucleic acid sequence encoding at least one alphavirus structural protein, wherein at least one alphavirus structural protein encoded by the fourth nucleic acid sequence is not encoded by the first nucleic acid sequence.


In another embodiment of the resolving DNA helpers of this invention, recombinant DNA molecules for expressing alphavirus structural proteins are provided, comprising a promoter directing the transcription of RNA from a DNA sequence comprising, in order: (i) a first nucleic acid sequence encoding a 5′ alphavirus replication recognition sequence, (ii) a second nucleic acid sequence encoding either (a) an RNA sequence that promotes transcription of a protein coding RNA sequence or (b) an IRES; (iii) a third nucleic acid sequence encoding at least one alphavirus structural protein, (iv) a fourth nucleic acid sequence encoding a 3′ alphavirus replication recognition sequence, (v) a fifth nucleic acid sequence encoding a ribozyme, (vi) a sixth nucleic acid sequence encoding an IRES, and (vii) a seventh nucleic acid sequence encoding at least one alphavirus structural protein, wherein at least one alphavirus structural protein encoded by the seventh nucleic acid sequence is not encoded by the third nucleic acid sequence.


In yet another embodiment of the resolving DNA helpers, the present invention provides a recombinant DNA molecule for expressing alphavirus structural proteins comprising a promoter directing the transcription of RNA from a DNA sequence comprising, in order: (i) a first nucleic acid sequence encoding an IRES, (ii) a second nucleic acid sequence encoding at least one alphavirus structural protein, (iii)a third nucleic acid sequence encoding a ribozyme, (iv) a fourth nucleic acid sequence encoding an IRES, and (v) a fifth nucleic acid sequence encoding at least one alphavirus structural protein, wherein at least one alphavirus structural protein encoded by the fifth nucleic acid sequence is not encoded by the second nucleic acid sequence.


In a second aspect of the invention, methods for producing infectious, replication-defective alphavirus replicon particles comprising introducing into a population of alphavirus-permissive cells one or more resolving DNA helper(s) of the claimed invention and an alphavirus replicon RNA encoding at least one heterologous RNA such that infectious, replication-defective particles are produced.


In a third aspect, the present invention provides resolving RNA helpers, namely recombinant DNA molecules for expressing alphavirus structural proteins comprising: (i) a DNA dependent RNA polymerase promoter, (ii) an IRES, (iii) a nucleic acid sequence encoding an alphavirus capsid protein, which is modified to remove the active site of the autoprotease, (iv) a non-autocatalytic protease recognition site, and (v) a nucleic acid sequence encoding at least one alphavirus glycoprotein.


In another embodiment of the resolving RNA helpers of this invention, a recombinant DNA molecule for expressing a resolving RNA helper in vivo is provided comprising (i) a DNA dependent RNA polymerase promoter, (ii) a nucleic acid sequence encoding at least one alphavirus structural protein, (iii) a non-autocatalytic protease recognition site, and (iv) a nucleic acid sequence encoding at least one alphavirus structural protein, wherein the nucleic acid sequences in (ii) and (iv) are not identical. In preferred embodiments of this aspect, the promoter is an RNA polymerase II promoter that is operable in a helper cell.


In yet another embodiment of the resolving RNA helpers of this invention, a recombinant DNA molecule for expressing an RNA helper in vitro is provided, comprising a promoter directing the transcription of RNA from a DNA sequence comprising (i) a first nucleic acid sequence encoding an alphavirus 5′ replication recognition sequence, (ii) a transcriptional promoter, (iii) a nucleic acid sequence encoding at least one alphavirus structural protein, (iv) a non-autocatalytic protease recognition site, and (v) a nucleic acid sequence encoding at least one alphavirus structural protein, and (vi) an alphavirus 3′ replication recognition sequence, wherein the nucleic acid sequences of (iii) and (v) are not identical.


In a fourth aspect, methods for producing infectious, replication-defective alphavirus replicon particles comprising introducing into a population of cells (i) one or more resolving RNA helpers of the present invention, (ii) a protease that recognizes the non-autocatalytic protease recognition site, and (iii) an alphavirus replicon RNA encoding at least one heterologous RNA such that infectious, replication-defective alphavirus replicon particles are produced in the cells. In certain embodiments of this aspect, an RNA polymerase that recognizes the DNA dependent RNA polymerase promoter is also made available in the helper cell along with the recombinant DNA molecule, such that the DNA molecule is transcribed in vivo to produce sufficient alphavirus structural proteins for packaging alphavirus replicon particles.


In a fifth aspect of the present invention, a rearranged alphavirus RNA replicon vector is provided comprising in order: (i) a first nucleic acid sequence encoding a 5′ alphavirus replication recognition sequence, (ii) a second nucleic acid encoding alphavirus nonstructural proteins nsp1, nsp2, and nsp3; (iii) either (a) a transcriptional promoter or (b) an IRES, (iv) a nucleic acid encoding at least one heterologous gene of interest, (v) an IRES, (vi) a third nucleic acid encoding an alphavirus nonstructural protein nsp4, and (vii) a fourth nucleic acid encoding a 3′ alphavirus replication recognition sequence. In another embodiment of this aspect, a vector construct comprising a 5′ promoter operably linked to a cDNA of the rearranged alphavirus replicon RNA is provided.


In a sixth aspect, compositions comprising a population of infectious, defective, alphavirus particles, wherein each particle contains an alphavirus replicon RNA comprising a rearranged alphavirus replicon RNA of this invention, and the population has no detectable replication-competent virus, as measured by passage on cell cultures.


In a seventh aspect, a non-replicating DNA helper is provided, namely a recombinant DNA molecule for expressing alphavirus structural proteins comprising a promoter for directing the transcription of RNA from a DNA sequence operably linked to a DNA sequence encoding a complete alphavirus structural polyprotein-coding sequence, with the proviso that the DNA sequence does not encode alphaviral 5′ or 3′ replication recognition sequences or an alphavirus subgenomic promoter.


In an eighth aspect, a chimeric alphavirus RNA helper is provided, namely a recombinant RNA molecule comprising, in order, a 5′ alphavirus replication recognition sequence, a promoter, a nucleic acid encoding at least one alphavirus structural protein, and a 3′ alphaviral replication recognition sequence, wherein the promoter is operably linked to the nucleic acid sequence encoding at least one alphavirus structural protein, wherein the transcription-initiating sequence and the RNA polymerase recognition sequence are recognized by the nonstructural viral proteins of Venezuelan equine encephalitis virus, and wherein the transcription-initiating sequence and the RNA polymerase recognition sequence are derived from a virus other than the alphavirus encoding the structural protein.


In a ninth aspect, an alphavirus structural protein expression system based on a virus other than an alphavirus is provided, comprising two RNA molecules, wherein (a) a first RNA encodes sequence for viral replicase proteins, and (b) a second recombinant RNA encodes sequences for (i) the 5′ replication recognition sequence for a replication complex comprising the viral replicase proteins of (a), (ii) one or more alphavirus structural proteins, and (iii) the 3′ replication recognition sequence for the replication complex comprising the viral replicase proteins of (a), wherein, when the first RNA and the second RNA are introduced into a helper cell, the first RNA replicates the second RNA, then the second RNA is translated to produce one or more alphavirus structural proteins. In preferred embodiments of this aspect, the recombinant RNAs and the viral replicase proteins are derived from a nodavirus.


In a tenth aspect of the invention, methods for producing infectious, replication-defective alphavirus replicon particles comprising introducing into a population of alphavirus-permissive cells one or more helper nucleic acids selected from the group consisting of non-replicating DNA helpers, chimeric alphavirus helpers, and a non-alphavirus based helper system and an alphavirus replicon RNA encoding at least one heterologous RNA, such that the helpers express all of the alphavirus structural proteins, producing said alphavirus replicon particles in the cells, and collecting said alphavirus replicon particles from the cell.


In an eleventh aspect of this invention, helper cells for expressing infectious, replication-defective, alphavirus particles utilizing any combination of the helpers disclosed hereinabove are provided comprising, in an alphavirus-permissive cell, (i) one or more recombinant nucleic acid molecules selected from group consisting of the resolving DNA helpers, the resolving RNA helpers, the non-replicating DNA helpers, the chimeric alphavirus helpers and the non-alphavirus helper system, and (ii) an alphavirus replicon RNA encoding at least one heterologous RNA, wherein the one or more recombinant nucleic acid helpers together encode all alphavirus structural proteins which assemble together into the alphavirus replicon particles.







DETAILED DESCRIPTION OF THE INVENTION

Definitions


As used herein, the term “alphavirus” has its conventional meaning in the art, and includes the various species such as VEE, SFV, Sindbis, Ross River Virus, Western Equine Encephalitis Virus, Eastern Equine Encephalitis Virus, Chikungunya, S.A. AR86, Everglades virus, Mucambo, Barmah Forest Virus, Middelburg Virus, Pixuna Virus, O'nyong-nyong Virus, Getah Virus, Sagiyama Virus, Bebaru Virus, Mayaro Virus, Una Virus, Aura Virus, Whataroa Virus, Banbanki Virus, Kyzylagach Virus, Highlands J Virus, Fort Morgan Virus, Ndumu Virus, and Buggy Creek Virus. The preferred alphaviruses used in the constructs and methods of the claimed invention are VEE, S.AAR86, Sindbis (e.g. TR339, see U.S. Pat. No. 6,008,035), and SFV.


The terms “5′ alphavirus replication recognition sequence” and “3′ alphavirus replication recognition sequence” refer to the sequences found in alphaviruses, or sequences derived therefrom, that are recognized by the nonstructural alphavirus replicase proteins and lead to replication of viral RNA. These are sometimes referred to as the 5′ and 3′ ends, or alphavirus 5′ and 3′ sequences. In the constructs of this invention, the use of these 5′ and 3′ ends will result in replication of the RNA sequence encoded between the two ends. These sequences can be modified by standard molecular biological techniques to further minimize the potential for recombination or to introduce cloning sites, with the proviso that they must still be recognized by the alphavirus replication machinery.


The term “minimal 5′ alphavirus replication recognition sequence” refers to the minimal sequence that allows recognition by the nonstructural proteins of the alphavirus but does not result in significant packaging/recombination of RNA molecules containing the sequence. In a preferred embodiment, the minimal 5′ alphavirus replication recognition sequence results in a fifty to one-hundred fold decrease in the observed frequency of packaging/recombination of the RNA containing that sequence. Packaging/recombination of helpers can be assessed by several methods, e.g. the method described by Lu and Silver (J. Virol Methods 2001, 91(1): 59–65).


The terms “alphavirus RNA replicon”, “alphavirus replicon RNA” and “alphavirus RNA vector replicon” are used interchangeably to refer to an RNA molecule expressing nonstructural protein genes such that it can direct its own replication (amplification) and comprises, at a minimum, the 5′ and 3′ alphavirus replication recognition sequences, coding sequences for alphavirus nonstructural proteins, and a polyadenylation tract. It may additionally contain a promoter or an IRES. It may also be engineered to express alphavirus structural proteins. Johnston et al. and Polo et al. (cited in the background) describe numerous constructs for such alphavirus RNA replicons, and such constructs are incorporated herein by reference. Specific embodiments of the alphavirus RNA replicons utilized in the claimed invention may contain one or more attenuating mutations, an attenuating mutation being a nucleotide deletion, addition, or substitution of one or more nucleotide(s), or a mutation that comprises rearrangement or chimeric construction which results in a loss of virulence in a live virus containing the mutation as compared to the appropriate wild-type alphavirus. Examples of an attenuating nucleotide substitution (resulting in an amino acid change in the replicon) include a mutation at nsP1 amino acid position 538, nsP2 amino acid position 96, or nsP2 amino acid position 372 in the alphavirus S.A.AR86.


The terms “alphavirus structural protein/protein(s)” refers to one or a combination of the structural proteins encoded by alphaviruses. These are produced by the virus as a polyprotein and are represented generally in the literature as C-E3-E2-6k-E1. E3 and 6k serve as membrane translocation/transport signals for the two glycoproteins, E2 and E1. Thus, use of the term E1 herein can refer to E1, E3-E1, 6k-E1, or E3-6k-E1, and use of the term E2 herein can refer to E2, E3-E2, 6k-E2, or E3-6k-E2.


The term “helper(s)” refers to a nucleic acid molecule that is capable of expressing one or more alphavirus structural proteins.


The terms “helper cell” and “packaging cell” are used interchangeably herein and refer to the cell in which alphavirus replicon particles are produced. The helper cell comprises a set of helpers that encode one or more alphavirus structural proteins. As disclosed herein, the helpers may be RNA or DNA. The cell can be any cell that is alphavirus-permissive, i.e. cells that are capable of producing alphavirus particles upon introduction of a viral RNA transcript. Alphavirus-permissive cells include, but are not limited to, Vero, baby hamster kidney (BHK), 293, 293T, chicken embryo fibroblast (CEF), and Chinese hamster ovary (CHO) cells. In certain embodiments of the claimed invention, the helper or packaging cell may additionally include a heterologous RNA-dependent RNA polymerase and/or a sequence-specific protease.


The terms “alphavirus replicon particles”, “virus replicon particles” or “recombinant alphavirus particles”, used interchangeably herein, mean a virion-like structural complex incorporating an alphavirus replicon RNA that expresses one or more heterologous RNA sequences. Typically, the virion-like structural complex includes one or more alphavirus structural proteins embedded in a lipid envelope enclosing a nucleocapsid that in turn encloses the RNA. The lipid envelope is typically derived from the plasma membrane of the cell in which the particles are produced. Preferably, the alphavirus replicon RNA is surrounded by a nucleocapsid structure comprised of the alphavirus capsid protein, and the alphavirus glycoproteins are embedded in the cell-derived lipid envelope. The alphavirus replicon particles are infectious but replication-defective, i.e. the replicon RNA cannot replicate in the host cell in the absence of the helper nucleic acid(s) encoding the alphavirus structural proteins.


As described in detail hereinbelow, the present invention provides improved alphavirus-based replicon systems that reduce the potential for replication-competent virus formation and that are suitable and/or advantageous for commercial-scale manufacture of vaccines or therapeutics comprising them. The present invention provides improved alphavirus RNA replicons and improved helpers for expressing alphavirus structural proteins.


In one embodiment of this invention, a series of “helper constructs”, i.e. recombinant DNA molecules that express the alphavirus structural proteins, is disclosed in which a single helper is constructed that will resolve itself into two separate molecules in vivo. Thus, the advantage of using a single helper in terms of ease of manufacturing and efficiency of production is preserved, while the advantages of a bipartite helper system are captured in the absence of employing a bipartite expression system. In one set of these embodiments, a DNA helper construct is used, while in a second set an RNA helper vector is used. In the case of the DNA helper constructs that do not employ alphaviral recognition signals for replication and transcription, the theoretical frequency of recombination is lower than the bipartite RNA helper systems that employ such signals.


In the preferred embodiments for the constructs of this invention, a promoter for directing transcription of RNA from DNA, i.e. a DNA dependent RNA polymerase, is employed. In the RNA helper embodiments, the promoter is utilized to synthesize RNA in an in vitro transcription reaction, and specific promoters suitable for this use include the SP6, T7, and T3 RNA polymerase promoters. In the DNA helper embodiments, the promoter functions within a cell to direct transcription of RNA. Potential promoters for in vivo transcription of the construct include eukaryotic promoters such as RNA polymerase II promoters, RNA polymerase III promoters, or viral promoters such as MMTV and MoSV LTR, SV40 early region, RSV or CMV. Many other suitable mammalian and viral promoters for the present invention are available in the art. Alternatively, DNA dependent RNA polymerase promoters from bacteria or bacteriophage, e.g. SP6, T7, and T3, may be employed for use in vivo, with the matching RNA polymerase being provided to the cell, either via a separate plasmid, RNA vector, or viral vector. In a specific embodiment, the matching RNA polymerase can be stably transformed into a helper cell line under the control of an inducible promoter. Constructs that function within a cell can function as autonomous plasmids transfected into the cell or they can be stably transformed into the genome. In a stably transformed cell line, the promoter may be an inducible promoter, so that the cell will only produce the RNA polymerase encoded by the stably transformed construct when the cell is exposed to the appropriate stimulus (inducer). The helper constructs are introduced into the stably transformed cell concomitantly with, prior to, or after exposure to the inducer, thereby effecting expression of the alphavirus structural proteins. Alternatively, constructs designed to function within a cell can be introduced into the cell via a viral vector, e.g. adenovirus, poxvirus, adeno-associated virus, SV40, retrovirus, nodavirus, picornavirus, vesicular stomatitis virus, and baculoviruses with mammalian pol II promoters.


Once an RNA transcript (mRNA) encoding the helper or RNA replicon vectors of this invention is present in the helper cell (either via in vitro or in vivo approaches, as described above), it is translated to produce the encoded polypeptides or proteins. The initiation of translation from an mRNA involves a series of tightly regulated events that allow the recruitment of ribosomal subunits to the mRNA. Two distinct mechanisms have evolved in eukaryotic cells to initiate translation. In one of them, the methyl-7-G(5′)pppN structure present at the 5′ end of the mRNA, known as “cap”, is recognized by the initiation factor eIF4F, which is composed of eIF4E, eIF4G and eIF4A. Additionally, pre-initiation complex formation requires, among others, the concerted action of initiation factor eIF2, responsible for binding to the initiator tRNA-Met1, and eIF3, which interacts with the 40S ribosomal subunit (reviewed in Hershey & Merrick. Translational Control of Gene Expression, pp. 33–88. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press. 2000.)


In the alternative mechanism, translation initiation occurs internally on the transcript and is mediated by a cis-acting element, known as an internal ribosome entry site (IRES), that recruits the translational machinery to an internal initiation codon in the mRNA with the help of trans-acting factors (reviewed in Jackson. Translational Control of Gene Expression, pp. 127–184. Cold Spring Harbor Laboratory Press. 2000). During many viral infections, as well as in other cellular stress conditions, changes in the phosphorylation state of eIF2, which lower the levels of the ternary complex eIF2-GTP-tRNA-Met1, results in overall inhibition of protein synthesis. Conversely, specific shut-off of cap-dependent initiation depends upon modification of eIF4F functionality (Thompson & Sarnow, Current Opinion in Microbiology 3, 366–370, 2000).


IRES elements bypass cap-dependent translation inhibition; thus the translation directed by an IRES is termed “cap-independent”. Hence, IRES-driven translation initiation prevails during many viral infections, for example picornaviral infection (Macejak & Sarnow. Nature 353, 90–94, 1991). Under these circumstances, cap-dependent initiation is inhibited or severely compromised due to the presence of small amounts of functional eIF4F. This is caused by cleavage or loss of solubility of eIF4G (Gradi et al., Proceedings of the National Academy of Sciences, USA 95, 11089–11094, 1998); 4E-BP dephosphorylation (Gingras et al., Proceedings of the National Academy of Sciences, USA 93, 5578–5583. 1996) or poly(A)-binding protein (PABP) cleavage (Joachims et al., Journal of Virology 73, 718–727, 1999).


IRES sequences have been found in numerous transcripts from viruses that infect vertebrate and invertebrate cells as well as in transcripts from vertebrate and invertebrate genes. Examples of IRES elements suitable for use in this invention include: viral IRES elements from Picornaviruses e.g. poliovirus (PV), encephalomyocarditis virus (EMCV), foot-and-mouth disease virus (FMDV), from Flaviviruses e.g. hepatitis C virus (HCV), from Pestiviruses e.g. classical swine fever virus (CSFV), from Retroviruses e.g. murine leukemia virus (MLV), from Lentiviruses e.g. simian immunodeficiency virus (SIV), or cellular mRNA IRES elements such as those from translation initiation factors e.g. eIF4G or DAP5, from Transcription factors e.g. c-Myc (Yang and Sarnow, Nucleic Acids Research 25: 2800–2807 1997) or NF-κB-repressing factor (NRF), from growth factors e.g. vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF-2), platelet-derived growth factor B (PDGF B), from homeotic genes e.g. Antennapedia, from survival proteins e.g. X-Linked inhibitor of apoptosis (XIAP) or Apaf-1, or chaperones e.g. the immunoglobulin heavy-chain binding protein BiP (reviewed in Martinez-Salas et al., Journal of General Virology. 82: 973–984, 2001.)


Preferred IRES sequences that can be utilized in these embodiments are derived from: encephalomyocarditis virus (EMCV, accession # NC001479), cricket paralysis virus (accession # AF218039), Drosophila C virus accession # AF014388, Plautia stali intestine virus (accession # AB006531), Rhopalosiphum padi virus (accession # AF022937), Himetobi P virus (accession # AB017037), acute bee paralysis virus (accession # AF150629), Black queen cell virus (accession # AF183905), Triatoma virus (accession # AF178440), Acyrthosiphon pisu virus (accession # AF024514), infectious flacherie virus (accession # AB000906), and Sacbrood virus (accession # AF092924). In addition to the naturally occurring IRES elements listed above, synthetic IRES sequences, designed to mimic the function of naturally occurring IRES sequences, can also be used. In the embodiments in which an IRES is used for translation of the promoter driven constructs, the IRES may be an insect TRES or another non-mammalian IRES that is expressed in the cell line chosen for packaging of the recombinant alphavirus particles, but would not be expressed, or would be only weakly expressed, in the target host. In those embodiments comprising two IRES elements, the two elements may be the same or different.


Rearranged Alphavirus RNA Replicon Vectors


In all systems described to date which employ alphavirus RNA vector replicons to express a heterologous gene of interest, the portion of the alphavirus genome that encodes the alphavirus nonstructural proteins (nsps) is maintained intact, i.e. it appears in the replicon vectors exactly as it appears in the alphavirus. Disclosed herein is a rearranged alphavirus RNA replicon vector in which the sequence encoding nsp4 has been separated from the sequence encoding nsps1–3 and placed under the control of a separate translational control element, such as an IRES. Although it is under separate control and displaced from the other nonstructural coding sequences, the sequence encoding nsp4 is transcribed from the incoming, plus strand of the virus, so that all nonstructural proteins are produced when the replicon is introduced into the helper cell. The cassette directing expression of the heterologous gene of interest is placed between the two nonstructural gene sequences, which together encode all of the alphavirus nonstructural proteins.


In the existing tripartite alphavirus replicon systems (two helper molecules and the vector replicon), recombination between the helper(s) and the replicon is required to generate a replication-competent virus. In these systems, it is generally thought that the viral polymerase complex moves between the helper molecules and the replicon molecule (“strand-switching”), replicating sequences from all three molecules. In these systems, the strand-switching may occur anywhere in the replicon 3′ to the 26S promoter directing expression of the heterogogous RNA, and still replicate all of the nonstructural polyprotein coding region “nsps1–4”. In the rearranged replicons claimed herein, the theoretical frequency of generation of a replication-competent virus is much lower, since any recombination into the heterologous gene region results in the loss of the downstream nsp4 gene in the recombinant.


Thus, described herein is a recombinant nucleic acid comprising, in order: (i) a first nucleic acid sequence encoding a 5′ alphavirus replication recognition sequence, (ii) a second nucleic acid encoding alphavirus nonstructural proteins nsp 1, nsp 2, and nsp3; (iii) an IRES, (iv) a nucleic acid sequence encoding at least one heterologous gene of interest, (v) an IRES, (vi) a third nucleic acid encoding the alphavirus nonstructural protein nsp4, and (vii) a fourth nucleic acid encoding a 3′ alphavirus replication recognition sequence. In another embodiment, element (iii) is a transcriptional promoter, such as the alphavirus subgenomic promoter (also referred to as the 26S promoter or the viral junction region promoter). In certain embodiments, this vector replicon RNA is transcribed in vitro from a DNA plasmid and then introduced into the helper cell by electroporation. In other embodiments, the vector replicon RNA of this invention is transcribed in vivo from a DNA vector plasmid that is transfected into the helper cell (e.g. see U.S. Pat. No. 5,814,482), or it is delivered to the helper cell via a virus or virus-like particle.


The heterologous gene of interest, also referred to herein as a heterologous RNA or heterologous sequence, can be chosen from a wide variety of sequences derived from viruses, prokaryotes or eukaryotes. Examples of categories of heterologous sequences include, but are not limited to, immunogens, cytokines, toxins, therapeutic proteins, enzymes, antisense sequences, and immune response modulators.


In a preferred embodiment, the 3′ alphavirus non-coding sequence used in the replicon construct is approximately 300 nucleotides in length, which contains the 3′ replication recognition sequence. The minimal 3′ replication recognition sequence, conserved among alphaviruses, is a 19 nucleotide sequence (Hill et al., Journal of Virology, 2693–2704, 1997). The 3′ non-coding sequence can be modified through standard molecular biological techniques to minimize the size of the 3′ end while preserving the replication function.


Resolving DNA Helpers


Several specific embodiments of the resolving DNA helper constructs are disclosed hereinbelow. In one embodiment, this invention discloses a recombinant DNA molecule for expressing alphavirus structural proteins comprising a promoter directing the transcription of RNA from a DNA sequence comprising, in order: (i) a first nucleic acid sequence encoding at least one alphavirus structural protein, (ii) a second nucleic acid sequence encoding a ribozyme, (iii) a third nucleic acid sequence encoding an IRES, and (iv) a fourth nucleic acid sequence encoding at least one alphavirus structural protein, wherein at least one alphavirus structural protein encoded by the fourth nucleic acid sequence is not encoded by the first nucleic acid sequence. In a preferred embodiment, the promoter is a pol II promoter, such as the CMV promoter.


In a further specific embodiment thereof, the first nucleic acid sequence is selected from the group of nucleic acid sequences encoding: capsid, E1 glycoprotein, E2 glycoprotein, E1 and E2 glycoprotein, capsid and E1 glycoprotein, or capsid and E2 glycoprotein. In these specific embodiments, the structural gene nucleic acid sequence(s) encoded by the fourth nucleic acid sequence is selected from this same group. In a preferred embodiment, the combination of sequences encoded by the first and fourth nucleic acid sequences encompass all the structural proteins required to assemble a recombinant alphavirus particle. In a further specific embodiment, one or more of the alphavirus structural proteins may encode one or more attenuating mutations, for example as defined in U.S. Pat. Nos. 5,792,462 and 6,156,558. Specific attenuating mutations for the VEE E1 glycoprotein include an attenuating mutation at any one of E1 amino acid positions 81, 272 or 253. Alphavirus replicon particles made from the VEE-3042 mutant contain an isoleucine substitution at E1-81, and virus replicon particles made from the VEE-3040 mutant contain an attenuating mutation at E1-253. Specific attenuating mutations for the VEE E2 glycoprotein include an attenuating mutation at any one of E2 amino acid positions 76, 120, or 209. Alphavirus replicon particles made from the VEE-3014 mutant contain attenuating mutations at both E1-272 and at E2-209 (see U.S. Pat. No. 5,792,492). A specific attenuating mutation for the VEE E3 glycoprotein includes an attenuating mutation consisting of a deletion of E3 amino acids 56–59. Virus replicon particles made from the VEE-3526 mutant contain this deletion in E3 (aa56–59) as well as a second attenuating mutation at E1-253. Specific attenuating mutations for the S.A.AR86 E2 glycoprotein include an attenuating mutation at any one of E2 amino acid positions 304, 314, 372, or 376.


In another embodiment, this invention discloses a recombinant DNA molecule for expressing alphavirus structural proteins comprising a promoter directing the transcription of RNA from a DNA sequence comprising, in order: (i) a first nucleic acid sequence encoding a 5′ alphavirus replication recognition sequence, (ii) a second nucleic acid sequence encoding either (a) an RNA sequence that promotes transcription of a protein coding RNA sequence or (b) an IRES; (iii) a third nucleic acid sequence encoding at least one alphavirus structural protein, (iv) a fourth nucleic acid sequence encoding a 3′ alphavirus replication recognition sequence, (v) a fifth nucleic acid sequence encoding a ribozyme, (vi) a sixth nucleic acid sequence encoding an IRES, and (vii) a seventh nucleic acid sequence encoding at least one alphavirus structural protein, wherein at least one alphavirus structural protein encoded by the seventh nucleic acid sequence is not encoded by the third nucleic acid sequence. In a preferred embodiment, the promoter is a pol II promoter, such as the CMV promoter. In another embodiment, the promoter is the T7 promoter, and the T7 polymerase is provided in the packaging cell in any one of the methods described hereinabove. In a specific embodiment thereof, the third nucleic acid sequence is selected from the group of nucleic acid sequences encoding: capsid, E1 glycoprotein, E2 glycoprotein, E1 and E2 glycoprotein, capsid and E1 glycoprotein, or capsid and E2 glycoprotein. In these specific embodiments, the structural gene nucleic acid sequence(s) encoded by the seventh nucleic acid sequence is selected from this same group. In a preferred embodiment thereof, the combination of sequences encoded by the third and seventh nucleic acid sequences encompass all the structural proteins required to assemble a recombinant alphavirus particle. In a further specific embodiment, the sequences encoded by the third nucleic acid comprise one or more of the alphavirus glycoprotein genes, and the sequence encoded by the seventh nucleic acid comprises the alphavirus capsid gene. In a further specific embodiment, one or more of the alphavirus structural proteins may encode one or more attenuating mutations, as defined in U.S. Pat. Nos. 5,792,462 and 6,156,558, and specific examples of which are listed hereinabove.


In another embodiment, this invention discloses a recombinant DNA molecule for expressing alphavirus structural proteins comprising a promoter directing the transcription of RNA from a DNA sequence comprising, in order: (i) a first nucleic acid sequence encoding an IRES, (ii) a second nucleic acid sequence encoding at least one alphavirus structural protein, (iii) a third nucleic acid sequence encoding a ribozyme, (iv) a fourth nucleic acid sequence encoding an IRES, and (v) a fifth nucleic acid sequence encoding at least one alphavirus structural protein, wherein at least one alphavirus structural protein encoded by the fifth nucleic acid sequence is not encoded by the second nucleic acid sequence. In a preferred embodiment, the promoter is a pol II promoter, such as the CMV promoter. In another embodiment, the promoter is the T7 promoter, and the T7 polymerase is provided in the packaging cell in any one of the methods described hereinabove. In a specific embodiment thereof, the second nucleic acid sequence is selected from the group of nucleic acid sequences encoding: capsid, E1 glycoprotein, E2 glycoprotein, E1 and E2 glycoprotein, capsid and E1 glycoprotein, or capsid and E2 glycoprotein. In these specific embodiments, the structural gene nucleic acid sequence(s) encoded by the fifth nucleic acid sequence is selected from this same group. In a preferred embodiment thereof, the combination of sequences encoded by the second and fifth nucleic acid sequences encompass all the structural proteins required to assemble a recombinant alphavirus particle. In a further specific embodiment, one or more of the alphavirus structural proteins may encode one or more attenuating mutations, as defined in U.S. Pat. Nos. 5,792,462 and 6,156,558, and specific examples of which are listed hereinabove.


As described above, the resolving ability of the DNA helper constructs derives from the insertion of a ribozyme. Ribozymes are catalytic RNA molecules possessing the ability to specifically catalyze its own (cis-) or other (trans-) single-stranded RNA excision (cleavage) following transcription of the RNA in vivo from the DNA vector. Ribozymes target a specific RNA sequence, and different ribozymes target different RNA sequences. Through the insertion of nucleotide sequences encoding these ribozymes into the DNA vector, it is possible to engineer molecules that will recognize specific nucleotide sequences within an RNA transcript and cleave it (Cech, T. Amer. Med. Assn., 260:3030, 1988). When a single DNA helper construct as described herein is introduced into a packaging cell, the ribozyme cleaves the single RNA transcript synthesized in vivo from the introduced DNA construct at the ribozyme target sequence, resulting in the generation of two separate RNA molecules within the cell, each encoding one or more than one alphaviral structural proteins.


A wide variety of ribozymes may be utilized within the context of the present invention, including for example, Group I intron ribozymes (Cech et al., U.S. Pat. No. 4,987,071); Group II Introns (Michel, et al., EMBO J. 2:33–38 1983), hairpin ribozymes (Hampel et al., Nucl. Acids Res. 18:299–304, 1990, U.S. Pat. No. 5,254,678 and European Patent Publication No. 0 360 257), hammerhead ribozymes (Rossi, J. J. et al., Pharmac. Ther. 50:245–254, 1991; Forster and Symons, Cell 48:211–220, 1987; Haseloff and Gerlach, Nature 328:596–600, 1988; Walbot and Bruening, Nature 334:196, 1988; Haseloff and Gerlach, Nature 334:585, 1988), hepatitis delta virus ribozymes (Perrotta and Been, Biochem. 31:16, 1992); Neurospora Vakrud satellite (VS) ribozymes (Anderson and Collins, Mol. Cell 5: 4690478, 2000, RNase P ribozymes (Takada et al., Cell 35:849, 1983); as well as other types of ribozymes (see e.g., WO 95/29241, and WO 95/31551). Further examples of ribozymes include those described in U.S. Pat. Nos. 5,116,742, 5,225,337 and 5,246,921.


The Group I intron ribozyme was the first known ribozyme which was described by Cech and colleagues in Tetrahymena in 1982 (Kruger et al. Cell 31: 147–157, 1992). This ribozyme was found to be involved in the processing of ribosomal RNA (rRNA) through a unique self-splicing manner. The self-splicing of rRNA occurs by a two step mechanism. First, a guanine nucleotide is added to the 5′ end of the intron as the intron-exon junction is being cleaved. Then the freed 5′ intron with guanine attacks at the 3′ intron-exon junction to release the intron and generate spliced exons (Zaug et al. Nature 324:429–433 1986). Ribonuclease P contains a catalytic RNA and a small subunit protein. It was discovered in bacteria and is able to generate a mature 5′ end of tRNA by endonucleocatalytic cleavage of precursor transcripts (Guerrier-Takada et al. Cell 35: 849–857 1983). The mechanism of cleavage by a hammerhead ribozyme has been characterized in the art [see, e.g., Reddy et al., U.S. Pat. No. 5,246,921; Taira et al., U.S. Pat. No. 5,500,357; Goldberg et al., U.S. Pat. No. 5,225,347].


While an understanding of the precise mechanism of the ribozyme is not necessary to practice the claimed invention, it is generally thought that the ribozyme is attached to the substrate RNA molecule by forming two paired regions via Watson-Crick pairing between the RNA substrate sequence and the two binding regions of the ribozyme. The first deprotonation reaction takes place in the 2′ sugar at the 3′ side of the substrate cleavage site. This deprotonation causes nucleophilic attack of the adjacent phosphodiester bond and subsequently protonation of the 5′ oxyanion cleaving group thereby generating, 2′,3′-cyclic phosphate and a 5′ hydroxyl terminus.


Like the hammerhead ribozyme, the hairpin ribozyme was also found in plant viroids, and it acts by a similar mode of action to the hammerhead ribozyme (Feldstein et al. Gene 82:53–61 1989). The design and use of hairpin ribozymes for cleaving an RNA substrate has been described in the art (Hampel et al., U.S. Pat. No. 5,527,895).


Generally, the targeted sequence of a ribozyme can vary from approximately 3 to 20 nucleotides long. The length of this sequence is sufficient to allow a hybridization with target RNA and disassociation of the ribozyme from the cleaved RNA.


Haseloff et al (U.S. Pat. No. 6,071,730) describe trans-splicing ribozymes that also provide precise cleavage sites. Trans-splicing ribozymes may be used in alternative embodiments to those described above, in which the element of the recombinant nucleic acid that comprises a ribozyme is substituted therefor with a ribozyme target sequence. The ribozyme itself is then provided in trans as a separate DNA or RNA molecule.


Thompson et al. (U.S. Pat. No. 6,183,959) describe at least seven basic varieties of enzymatic RNA molecules which are derived from naturally occurring self-cleaving RNAs. In the embodiments of the invention which employ a ribozyme, an alternative embodiment employs the use of a pol III promoter, since ribozymes often have extensive secondary structure that may be more efficiently transcribed by such a promoter.


As described hereinabove, in one set of embodiments of this invention, one or more of the nucleic acid sequences encoding the alphavirus structural proteins is/are placed between the 5′ and 3′ alphavirus replication recognition sequences, resulting in amplification of this nucleic acid by the alphavirus replicase proteins. In preferred embodiments, a minimal 5′ alphavirus replication recognition sequence is utilized. In a specific embodiment, all of the alphavirus structural proteins are expressed from a single promoter. The single transcript is then resolved through a precise cleavage at the ribozyme site into two replicable (i.e. amplifiable) RNAs (replicable due to the presence of the 5′ and 3′ alphavirus replication recognition sequences), each encoding only a subset of the alphavirus structural proteins. These RNAs are then translated from IRES sequences located 5′ to the structural protein coding sequences.


In a specific, preferred embodiment of the invention, the Hepatitis Delta virus (HDV) ribozyme is utilized (Wu et al. Science 243:652–655, 1989). The RNA of the hepatitis delta virus has autocatalytic RNA processing activity similar to that of hammerhead and hairpin ribozymes, and the ribozyme cleavage points of both delta strands and the domains containing them are clearly defined. The HDV ribozyme is approximately 80–90 nucleotides in length and only functional in cis. Advantages in using this ribozyme are (i) there are no specific sequence requirements at the 5′ cleavage site and (ii) the cleavage product is generated with defined 3′ ends. As described in U.S. Pat. No. 5,225,337 (incorporated herein by reference), a preferred embodiment for an HDV ribozyme is a sequence consisting of at least 18 consecutive nucleotides from the conserved region of HDV, in which the conserved region of the HDV RNA is found within either the region of HDV having ribozyme activity between residues 611 and 771 on the genomic strand or the region between residues 845 and 980 on the complementary anti-genomic strand. The selected sequence having ribozyme activity cleaves the target RNA molecule to form a 2′,3′ cyclic phosphate and 5′ hydroxyl.


In certain embodiments of this invention, additional sequence alterations are made downstream from the ribozyme region. The ribozyme cleavage event results in a clean 3′ end, such that the nucleotide sequence remains unchanged. With some ribozymes, the 5′ end of the downstream molecule resulting from the cleavage event may contain residual ribozyme sequence, and the potential secondary structure of this residual sequence may have detrimental effects on downstream translational activity, e.g. driven by an IRES, or upon any other functional role of the 5′ sequence of the downstream fragment. Thus, to minimize the potential for such interference, in some embodiments of this invention it may be useful to include a region of non-translated irrelevant nucleotide sequence downstream from the ribozyme sequence. In an alternative embodiment to generate a clean 5′ end, a second antigenomic ribozyme, e.g. HDV, can be added downstream from the sense ribozyme. This second ribozyme would be functional only on the negative sense strand, and thus it would generate its clean “3′ end” on the 5′ end of the downstream sequence.


Resolving RNA Helpers


In another embodiment of resolving helpers of this invention, the helper construct is a DNA helper in which the promoter is a DNA-dependent RNA polymerase promoter, such as the T7 polymerase promoter, and this promoter directs more than one alphavirus structural protein; preferably capsid and at least one glycoprotein. The helper further encodes a protease recognition sequence which is inserted in-frame between coding sequences for the alphavirus structural proteins. Thus, disclosed is a recombinant DNA molecule for expressing alphavirus structural proteins comprising: (i) a DNA dependent RNA polymerase promoter, (ii) an IRES (iii) a nucleic acid sequence encoding at least one alphavirus structural protein, (iv) a non-autocatalytic protease recognition site, and (v) a nucleic acid sequence encoding at least one alphavirus structural protein, wherein the nucleic acid sequences in (iii) and (v) are not identical.


In a separate embodiment, a DNA helper for expressing a resolving RNA helper in vivo is provided comprising (i) a DNA dependent RNA polymerase promoter, (ii) a nucleic acid sequence encoding at least one alphavirus structural protein, (iii) a non-autocatalytic protease recognition site, and (iv) a nucleic acid sequence encoding at least one alphavirus structural protein, wherein the nucleic acid sequences in (ii) and (iv) are not identical. In a preferred embodiment, the promoter is an RNA polymerase II promoter, such as the CMV promoter.


In another embodiment, the RNA helper is produced in vitro from a recombinant DNA molecule comprising a promoter directing the transcription of RNA from a DNA sequence comprising (i) a first nucleic acid sequence encoding an alphavirus 5′ replication recognition sequence, (ii) a transcriptional promoter, (iii) a nucleic acid sequence encoding at least one alphavirus structural protein, (iv) a non-autocatalytic protease recognition site, and (v) a nucleic acid sequence encoding at least one alphavirus structural protein, and (vi) an alphavirus 3′ replication recognition sequence, wherein the nucleic acid sequences of (iii) and (v) are not identical. In preferred embodiments, the promoter is the T7 promoter and the transcription promoter of element (ii) is an alphavirus subgenomic promoter.


In preferred embodiments of these helpers, the construct produces the polyprotein Capsid-protease site-E2-E1. In other embodiments, the polyprotein is E2-E1-protease site-Capsid or Capsid-E1-protease site-E2. Signal sequences, such as E3 or 6k, are included as appropriate, with E1 and/or E2 sequences. In those constructs which encode an alphavirus capsid protein, the capsid protein should be modified to remove the active site for the autoproteolytic activity of capsid (see U.S. Pat. No. 5,792,462; Col 11, lines 9–19; Strauss et al. 1990 Seminars in Virology 1:347).


The protease recognition sequence is preferably a relatively rare sequence that does not occur frequently in the coding sequences of the helper cell. Examples of such proteases are widely known in the art such as factor Xa, enteropeptidase and thrombin, but some of these proteases have exhibited lowered specificity for their target recognition/cleavage sites and have cleaved proteins at non-canonical sites. For this reason, the use of a rare protease with a specific cleavage recognition site which would be unlikely to be present in the host cell or alphaviral protein repertoire would be a preferred embodiment in this invention. An example of such a rare protease site is that of the tobacco etch virus NIa protease (TEV protease). TEV protease cleaves the amino acid sequence ENLYFQG between Q and G with high specificity. In addition, recent advances in the art have demonstrated the activity of TEV protease can be increased significantly by a number of methods. One method includes increasing the solubility of the protease by producing it in the form of a fusion protein. The second ablates the inherent auto-catalytic function of the protease which severely reduces the functional levels of protease within the cell. Using standard mutagenesis techniques the autocatalytic domain has been altered and leads to maintenance of high levels of the protease in its active form (Kapust et al., Protein Engineering, 14:993–1000, 2001). In the rare event that the consensus cleavage recognition site is present within the alphaviral vector or the host cell, alternate proteases may be used in this invention. These alternates would most likely be derived from non-mammalian origins to lessen the chance that the protease would recognize mammalian sequences. Such proteases would preferably include proteases derived from members of the Potyvirus family of plant viruses such as Turnip mosaic potyvirus (TuMV) which recognizes an amino acid sequence XVRHQ where X is any aliphatic amino acid. The invention can also utilize other proteases such as Wheat streak mosaic virus, plum pox virus, potato virus Y, tobacco vein mottling virus, Ornithogalum mosaic virus, yam mosaic virus, shallot potyvirus, bean yellow mosaic virus, papaya ringspot virus, pea seed-borne mosaic virus, Johnson grass mosaic virus, rye grass mosaic virus, sweet potato mild mottle virus, or any other members of the family of C4 unassigned peptidases. The only required feature of the protease in this invention is its restricted ability to recognize only the target sequence in the vector construct and to lack non-specific protease activity that could cleave host or other alphaviral sequences.


In the foregoing embodiments comprising a protease recognition site, the promoter directs the expression of all encoded alphavirus structural proteins. The DNA helpers are introduced into the helper cell along with a source of T7 polymerase (e.g. a stably transformed expression cassette, a separate expression plasmid, or the polymerase protein), a single RNA transcript is produced from the promoter which contains the IRES to direct cap-independent translation of a polyprotein, which is then cleaved by the protease provided in the helper cell. The RNA helper, transcribed from a DNA helper vector in vitro, is introduced to the helper cell, preferably by electroporation, where it is amplified and translated into the polyprotein. As above, the protease is provided to the helper cell in any one of several formats, and the polyprotein is cleaved in the presence of the protease.


In a specific embodiment, the protease may be present as a stably transformed cassette in the genome of the helper cell. In this embodiment, the gene encoding the protease is preferably under the control of an inducible promoter, such a heat shock or metallothionen-responsive promoter. In another embodiment, the protease gene and/or the T7 polymerase gene can be present in the helper cell as an alphavirus subgenomic expression cassette, comprising an alphavirus 5′end, an alphavirus subgenomic promoter directing expression of the protease, and an alphavirus 3′ end. This cassette is inducible in the helper cell, being expressed only upon introduction of the alphavirus RNA replicon to the cell. Alternatively, the protease may be added to the helper cell concomitantly with the RNA helper and the RNA replicon, either as a separately translatable RNA or as protein.


Non-replicating DNA Helper


In another set of embodiments of this invention, a DNA helper that does not incorporate the alphavirus replication recognition sequences that allow amplification of the RNA encoded between the sequences is disclosed. Lacking such sequences, which can contribute to the frequency of functional recombinant molecules that may be generated in the helper cell, a single DNA helper encoding all the alphavirus structural proteins necessary to produce recombinant alphavirus particles can minimize the effect that packaging/recombination may have in a helper cell. The decrease in packaging/recombination detected, as compared to the bipartite RNA system, is at least one order of magnitude lower; in preferred embodiments, it is two, three, or four orders of magnitude lower. Thus, another embodiment of the claimed invention comprises a recombinant DNA for expressing alphavirus structural proteins comprising a promoter operably linked to a nucleotide sequence encoding all the alphavirus structural proteins. In a preferred embodiment, the promoter is an RNA polymerase II promoter, such as the CMV promoter.


Preferred methods for introducing this DNA helper to alphavirus-permissive cells are also disclosed, including the use of cationic lipids, such as FuGene® and Lipofectamine®, electroporation, or viral vectors. The combination of cell type and transfection method can be optimized by testing of such combinations according to the methods disclosed herein. In specific embodiments, 293T and Vero cells can be used. In a preferred embodiment, the DNA helper is introduced prior to the introduction of the replicon RNA, e.g. thirty minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 24, or 48 hours prior to electroporation of the replicon RNA into the cells. Any amount of time that results in no significant decrease in the transfection efficiency of the replicon RNA and allows sufficient packaging of VRPs by the cells is suitable.


In an alternative embodiment, the DNA helpers of this invention may be co-electroporated into the helper cells with an alphavirus replicon RNA. The parameters of electroporation are adjusted from those used for solely RNA or DNA electroporation to optimize the yield of VRPs from the helper cells.


Chimeric Alphavirus RNA Helpers


In another set of embodiments, an RNA helper which utilizes replication recognition signals (5′ and 3′) from alphaviruses other than the alphavirus from which the structural proteins are derived is disclosed. In these embodiments, the promoter directs the expression of at least one structural protein and the alphavirus 5′ and 3′ ends that direct replication of the helper allow amplification, but the frequency of packaging/recombination by these helpers is reduced, due to the inefficient or complete lack of recognition of packaging signals of the one alphavirus by the alphavirus structural proteins of the other alphavirus. In a preferred embodiment, the RNA helper of this invention encodes one or more VEE structural proteins and utilizes the replication recognition signals from an alphavirus selected from the group consisting of Sindbis (particularly TR339), S.A.AR86, Semliki Forest Virus, or Ross River Virus.


Non-alphavirus RNA Helpers


In another set of embodiments of this invention, helper constructs that express one or more alphavirus structural proteins are disclosed which utilize viral RNA replication machinery derived from a virus other than an alphavirus. Disclosed is an alphavirus structural protein expression system, comprising two RNA molecules, wherein (a) a first RNA encodes sequences for viral replicase proteins, and (b) a second recombinant RNA encodes sequences for (i) the 5′ replication recognition sequence for a replication complex comprising the viral replicase proteins of (a), (ii) one or more alphavirus structural proteins, and (iii) the 3′ replication recognition sequence for the replication complex comprising the viral replicase proteins of (a). Following introduction of the two RNA molecules into the helper cell, the first RNA replicates the second RNA encoding one or more alphavirus structural proteins, and then the helper cell's translational machinery translates the structural protein sequence(s) encoded on the second recombinant RNA.


In a preferred embodiment, the first and second RNA molecules are derived from a nodavirus. The Nodaviridae are a family of small, non-enveloped, isometric viruses with bipartite positive-sense RNA genomes (Ball & Johnson, 1998 In The Insect Viruses, pp. 225–267. Edited by L. K. Miller & L. A. Ball. New York:Plenum). The nodavirus genomes are among the smallest of all known animal viruses, containing less than 5 kb of genetic material. Genomic nodavirus RNA is infectious to insect, plant (Selling, B. H., et al., Proc. Natl. Acad. Sci. USA 87:434–438, 1990) and mammalian (Ball, L. A., et al., J. Virol. 66:2326–2334, 1992) cells. Nodaviruses use unique regulatory cis-elements, including nodaviral-specific RNA replication (Zhong, W., et al., Proc. Natl. Acad. Sci. USA 89:11146–11150, 1992; Ball, L. A. and Li, Y., J. Virol. 67:3544–3551, 1993; Li, Y. and Ball, L. A., J. Virol. 67:3854–3860, 1993; Ball, L. A., J. Virol. 69:720–727, 1995) and packaging signals (Zhong, W., et al., supra, 1992). Both genome segments are capped at their 5′ ends but lack poly(A) tails (Newman & Brown, 1976. Journal of General Virology 30, 137–140). The smaller segment, referred to as RNA2, encodes a precursor to the nodavirus coat, or capsid, protein. The larger segment, referred to as RNA1, encodes the viral portion of the RNA-dependent RNA polymerase (RdRp), which replicates both RNA1 and 2 (Ball & Johnson, 1998, ibid.). The RNA1 of nodaviruses are notable for their ability to synthesize high cytoplasmic levels of capped and functional mRNAs, i.e. RNA1 and RNA2. The sequences of several nodavirus RNA1 molecules have been reported recently, and the RNA2 sequences have been previously disclosed (see Johnson et al. 2001 J. Gen. Virol. 82:1855–1866 and references cited therein, including GenBank accession numbers).


Applicants have determined that nodavirus replication and alphavirus replication can occur at the same time within the same cell. Thus, in one set of embodiments of this invention, a nodavirus-based alphavirus structural protein expression system is disclosed, in which RNA1 of a selected nodavirus is supplied to a cell in which recombinant alphavirus particles are to be packaged, along with an engineered RNA2 from the same or a different nodavirus. The RNA2 is engineered to remove part of the coding sequence for the nodavirus capsid gene and substitute therefor the coding sequence for at least one alphavirus structural protein. In a specific embodiment of the methods of this invention, these two nodavirus RNAs (i.e. RNA1 and engineered RNA2) are co-electroporated with an alphavirus RNA replicon into a cell in which all three RNAs are expressed. In a preferred embodiment, a nodavirus RNA1, a recombinant nodavirus RNA2 expressing an alphavirus capsid gene, an alphavirus RNA replicon, and a second helper RNA expressing alphavirus glycoproteins are co-electroporated into a cell in which all four RNAs can be expressed, resulting in the packaging of the replicon into recombinant alphavirus particles. Suitable nodaviruses for use in the claimed invention include Nodamura virus (NoV), Flock House virus (FHV), Black Beetle virus (BBV), Boolarra virus (BoV), Gypsy moth virus (GMV), and Manawatu virus (MwV). Preferred nodaviruses are FHV and NoV. In another embodiment, the RNA1 and recombinant RNA2 are introduced into the helper cell by a virus or a virus-like particle, such as adenovirus, vaccinia, poxvirus, SV-40, adeno-associated virus, retrovirus, nodavirus, picornavirus, vesicular stomatitis virus, and baculoviruses with mammalian pol II promoters.


Methods for Making Alphavirus Replicon Particles


Methods for making alphavirus replicon particles expressing one or more heterologous sequences which utilize the helpers and/or the alphavirus RNA replicons of this invention are also disclosed. Using the methods of this invention, preparations of alphavirus replicon particles are produced which contain no detectable replication-competent alphavirus particles, as determined by passage on alphavirus-permissive cells in culture.


To make the particles, a helper or combination of helpers is selected such that it provides all alphavirus structural proteins necessary to assemble an infectious particle. In preferred embodiments, the helper or combination of helpers encode capsid, E1 and E2. In an embodiment comprising more than one helper, one of the helpers may be selected from the helpers known in the art, e.g. the standard split RNA helpers referenced herein. A helper or combination of helpers comprising at least one embodiment of this invention can be used to package any alphavirus replicon RNA. In preferred embodiments, the alphavirus replicon RNA is a rearranged alphavirus RNA replicon as claimed herein or the standard alphavirus replicon RNA referenced herein. In specific, preferred embodiments, the alphavirus replicon particles are VEE-based particles, i.e. the helpers encode VEE alphavirus structural proteins and the replicon RNA is derived from VEE.


Alphavirus replicon particles are prepared according the methods disclosed herein in combination with techniques known to those skilled in the art. The methods include first introducing the selected helper(s) and an alphavirus replicon RNA encoding one or more heterologous RNAs into a population of alphavirus-permissive cells, and then incubating the cells under conditions that allow for the production of alphavirus replicon particles. The step of introducing the helper(s) and alphavirus replicon RNA to the population of helper cells can be performed by any suitable means, as disclosed herein or known to those generally skilled in the art. As described herein, the population of cells may be a stably transformed cell line that provides a promoter, a trans-acting ribozyme, a protease, or any combination thereof. Alternatively, said promoters, trans-acting ribozymes or proteases may be added to the population of cells in the form of separately relicable or non-replicable nucleic acids or proteins, as applicable.


Compositions or preparations of alphavirus replicon particles are collected from the population of helper cells using conventional techniques know to those skilled in the art, e.g. U.S. Pat. Nos. 5,492,462; 6,156,558; and these compositions are characterized by the fact that they will contain no detectable, replication-competent alphavirus particles, as measured by passage on alphavirus-permissive cells in culture.


As will be understood by one skilled in the art, there are several embodiments and elements for each aspect of the claimed invention, and all combinations of different elements are hereby anticipated, so the specific combinations exemplified herein are not to be construed as limitations in the scope of the invention as claimed. If specific elements are removed or added to the group of elements available in a combination, then the group of elements is to be construed as having incorporated such a change.


All references cited herein, including publications, patent applications, and patents, are hereby incorporated by reference to the same extent if each was individually and specifically indicated to be incorporated by reference, and was reproduced in its entirety herein.










TABLE 1







PCR primers for Resolving DNA helper cloning











Primer

Amplification



name
Sequence
product














GP
5′CTAGCTAGCTATGTCACTAGTGACCACCATG3′
(SEQ ID NO:1)
VEE glycoprotein



forward





GP
5′GGGCCCTCAATTATGTTTCTGGTTGGT 3′
(SEQ ID NO:2)
VEE glycoprotein


reverse





GP-2
5′
(SEQ ID NO:3)
VEE glycoprotein


forward
GCAGAGCTGGTTTAGTGAACCGTATAGGCGGCGGATGAGA



GAAGCGCAGACCA 3′





GP-2
5′GCTAGCGCTCTTCCCTTTTTTTTTTTT 3′
(SEQ ID NO:4)
VEE glycoprotein


reverse





Capsid
5′GCTCTAGAATGTCCCGTTGCAGCCAATG 3′
(SEQ ID NO:5)
VEE capsid


forward





Capsid
5′GCGTCGACGTCTTGGCCATAGCGGCCGCGGTTAGAGACAC
(SEQ ID NO:6)
VEE capsid


reverse
ATGGTGGTCACT 3′





hdR
5′CGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCT
(SEQ ID NO:7)
Hepatitis delta


Forward
GGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAG
ribozyme



GGAGAGCTCGC 3′





hdR
5′TCGAGCGAGCTCTCCCTTAGCCATCCGAGTGGACGACGTC
(SEQ ID NO:8)
Hepatitis delta


Reverse
CTCCTTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGAT
ribozyme



GCCATGCCGACCCGGGCC 3′





CMV
5′TAGTTATTAATAGTAATCAATTACGG 3′
(SEQ ID NO:9)
CMV IE promoter


forward





CMV
5′TGGTCTGGGCTTCTCTCATGCGCCGCCTATACGGTTCACTA
(SEQ ID NO:10)
CMV IE promoter


reverse
AACCAGCTCTGC 3′





d26S
5′GGCGCGCCGTCCTCCGATCGTTGTCAGAAG 3′
(SEQ ID NO:11)
CMV IE + VEE 5′


forward

NCR





d26S
5′GGCGCGCCTCCGTCAACCGCGTATACATCCTGGTAA 3′
(SEQ ID NO:12)
CMV IE + VEE 5′


reverse

NCR





E3
5′GGCGCGCCATGTCACTAGTGACCACCATGTG 3′
(SEQ ID NO:13)
E3-E2-6K genes


forward





6K
5′CTCGTAGGCGCCGGCGCCTGCGG 3′
(SEQ ID NO:14)
E3-E2-6K genes


reverse





EMCV
5′GGCGCGGCAATTCCGCCCCTCTCCCTCCC 3′
(SEQ ID NO:15)
EMCV IRES


forward





EMCV
5′GGCGCGCCTTATCATCGTGTTTTTTCAAAG 3′
(SEQ ID NO:16)
EMCV IRES


reverse





EMCV-2
5′GCTAGCAATTCCGCCCCTCTCCCTCCC 3′
(SEQ ID NO:17)
EMCV IRES


forward





EMCV-2
5′GCTAGCTTATCATCGTGTTTTTCAAAG 3′
(SEQ ID NO:18)
EMCV IRES


reverse

















TABLE 2







PCR primers for Nodavirus RNA helper cloning











Primer

Amplification



name
Primer sequence
product














Capsid F
5′ CGACGCGTATGTTCCCGTTCCAGCCAATG 3′
(SEQ ID NO:19)
VEE capsid MluI



(MluI)





Capsid R
5′GCACGCGTTTACAGACACATGGTGGTCACT
(SEQ ID NO:20)
VEE capsid MluI,


(MluI)
3′

VEE capsid 1, VEE





capsid 2





Capsid
5′CCTGCCATGGTATAAATGTTCCCGTTCCAACCA
(SEQ ID NO:21)
VEE capsid 1


F1
ATG3′


(NcoI)





Capsid
5′CCTGCCATGGCCCCGTTCCAACCAATG 3′
(SEQ ID NO:22)
VEE capsid 2


F2


(NcoI)









EXAMPLES

The following examples are provided to illustrate the present invention, and should not be construed as limiting thereof. In these examples, nm means nanometer, mL means milliliter, pfu/mL means plaque forming units/milliliter, nt means nucleotide(s), PBS means phosphate-buffered saline, VEE means Venezuelan Equine Encephalitis virus, EMC means Encephalomyocarditis virus, BHK means baby hamster kidney cells, GFP means green fluorescent protein, Gp means glycoprotein, CAT means chloramphenicol acetyl transferase, IFA means immunofluorescence assay, and IRES means internal ribosome entry site. The expression “E2 amino acid (e.g., lys, thr, etc.) number” indicates the designated amino acid at the designated residue of the E2 gene, and is also used to refer to amino acids at specific residues in the E1 protein and in the E3 protein.


In the Examples that follow, the starting materials for constructing the various helper plasmids can be selected from any of the following: full-length cDNA clones of VEE, i.e. pV3000, the virulent Trinidad donkey strain of VEE; or any of these clones with attenuating mutations: pV3014 (E2 lys 209, E1 thr 272), p3042 (E1 ile 81), pV3519 (E2 lys 76, E2 lys 209, E1 thr 272) and pV3526 (deletion of E3 56–59, E1 ser 253), which are in the genetic background of Trinidad donkey strain VEE. As described in U.S. Pat. No. 5,792,462, these plasmids are digested with restriction enzymes and religated to remove the nonstructural protein coding region. Alternatively, one may start with existing helper plasmids, such as those described in Pushko et al. 1997, Ibid., or as described herein.


Example 1
VEE Replicon Particles

Replicon particles for use as a vaccine or for gene therapy can be produced using the VEE-based vector system (see for example U.S. Pat. No. 5,792,462). In these Examples, one or more attenuating mutations (e.g. Johnston and Smith, Virology 162(2): 437–443 (1988); Davis et al., Virology 171(1): 189–204 (1989); Davis et al., 1990) may have been inserted into VEE sequence to generate attenuated VEE replicon particles (Davis et al., Virology 183(1): 20–31 (1991); Davis et al., Virology 212(1): 102–110 (1995); Grieder et al., Virology 206(2): 994–1006 (1995).


The examples herein describe the construction of an RNA replicon, i.e. an RNA that self-amplifies and expresses, and one or more helper nucleic acids encoding the structural proteins to allow packaging. The replicon RNA carries one or more foreign genes, e.g. a gene encoding an immunogen or a reporter gene. The replicon RNA and the helper nucleic acids (which express the alphavirus structural proteins, as described hereinbelow) are then introduced into a single cell, i.e. the helper or packaging cell, in which the replicon RNA is packaged into virus-like particles (herein referred to as “virus replicon particles” or “VRPs”) that are infectious for only one cycle. During the single, infectious cycle, the characteristics of the alphavirus-based vector result in very high levels of expression of the replicon RNA in cells to which the VRP is targeted, e.g. cells of the lymph node.


The resulting vaccine vectors are a virulent and provide complete protection against lethal virus challenge in animals, including but not limited to rodents, horses, nonhuman primates, and humans.


Example 2
Standard VEE Replicons and RNA Helpers

As described in U.S. Pat. No. 5,792,462, Pushko et al., 1997 (Virology 239:389–401), and WO 02/03917 (Olmsted, et al.), a standard alphavirus replicon based on VEE contains the VEE nonstructural genes and a single copy of the 26S subgenomic RNA promoter followed by a multiple cloning site. In a vaccine construct, one or more genes encoding an immunogen are inserted into this cloning site. For purposes of demonstrating the capability of the novel structural protein expression cassettes of this invention, VEE replicons are constructed by inserting the GFP or CAT gene into this cloning site. Expression of these reporter genes from particles made with various combinations of the structural protein expression cassettes described herein demonstrate the utility and novelty of these cassettes.


The standard VEE split RNA helper systems, as described in U.S. Pat. No. 5,792,462, Pushko et al., 1997 (Virology 239:389–401), and PCT publication WO 02/03917 (Olmsted, et al.), are described herein as “Cap or Gp RNA”, “wild-type Gp RNA helper”, “glycoprotein helper”, “Gp helper RNA”, “GP-helper”, “capsid helper”, or “C-helper”. These RNA helpers are made from DNA plasmids as described in the cited references, and these DNA plasmids can be a convenient source for obtaining the structural protein coding fragments, e.g. by PCR amplification. Alternatively, these coding fragments can be obtained from full-length clones of VEE or attenuated variants thereof (see U.S. Pat. Nos. 5,185,440; 5,505,947). These standard VEE helpers are used in combination with the helper inventions disclosed herein and/or in comparative studies with the new systems, as disclosed herein.


Example 3
Rearranged Alphavirus RNA Replicon Vector

The nsP4 region was deleted from a standard VEE GFP-expressing replicon vector (see Example 2) by digestion with AvrII and ApaI restriction enzymes, followed by treatment of the digested DNA with T4 DNA polymerase to generate blunt ends, and re-ligation of the DNA to generate pGFPΔnsP4-1. When RNA transcribed in vitro from the pGFPΔnsP4-1 DNA plasmid is electroporated into cells, GFP is not expressed. However, GFP protein can readily be detected in cells co-electroporated with GFPΔnsP4-1 RNA and an unmodified replicon vector RNA. This demonstrates that the pGFPΔnsP4-1 vector can be complemented by nsP4 protein provided in trans by another replicon RNA. This result indicates that the nsp4 gene can function when expressed separately from the other non-structural proteins.


The nsP4 gene (including a portion of nsP3 to maintain an nsP2 protease cleavage site) was then cloned downstream of an EMCV IRES. The nsP4 region was PCR amplified from the standard VEE replicon vector with primers nsP34-forward (SEQ ID NO: 33) and nsP4-stop (SEQ ID NO: 34) (also, see Table 3). The amplified nsP4 gene fragment was cloned into a transfer vector containing an EMCV IRES, using BamHI and XbaI as the 5′ and 3′ restriction enzyme sites. A second set of primers was then used to amplify the EMCV-nsP4 construct from the transfer vector: EMCV forward-AscI (SEQ ID NO: 35) and EMCV reverse-AscI (SEQ ID NO: 36), also, see Table 3). The EMCV-nsP4 PCR product was digested with AscI restriction enzyme and ligated into AscI linearized pGFPΔnsP4-1 vector DNA, to generate pGFPΔnsP4-1.1. The cloned nsP4 gene region (including a portion of nsP3 that contains the nsP2 protease site) was sequenced to ensure that no mutations to the nsP4 gene were introduced during cloning.


RNA transcribed in vitro from pGFPΔnsP4-1.1 DNA was electroporated into Vero, BHK, 293T and CEF cells, and GFP protein expression was detected in all cell types.










TABLE 3







PCR primers for Rearranged Replicon Vector.











Primer





name
Sequence 5′–3′
Region amplified














nsP34
CGGGATCCATGCGGTTTGATGCGGGTGCATA
(SEQ ID NO:33)
VEE nsP4 gene



forward
CATC





nsP4 stop
GCTCTAGATTAGCCGTAGAGAGTTATAGGGG
(SEQ ID NO:34)
VEE nsP4 gene





EMCV
TGGCGCGCCGCTCGGAATTCCCCCTCTCCC
(SEQ ID NO:35)
EMCV-nsP4


forward-AscI





EMCV
AGGCGCGCCTTCTATGTAAGCAGCTTGCC
(SEQ ID NO:36)
EMCV-nsP4


reverse-AscI









Example 4
Construction of Helpers with Minimal 5′ Alphavirus Replication Recognition Sequence

A. Constructs for Determining the Minimal 5′ Untranslated Region (UTR)


When VEE replicon particles (VRP) are inoculated onto fresh cultures of Vero cells, at high multiplicities of infection (MOI), capsid protein can be detected by anti-capsid immunofluoresence assay (IFA; see Table 5 below). Detection of capsid protein in VRP infected cells indicates that the capsid gene is present in the VRP. Similar findings to these have been reported by others (Lu and Silver, 2001, ibid.). This may occur in at least three ways: 1) as the result of a recombination event between the capsid helper RNA and a replicon RNA, 2) as the result of copackaging of the capsid helper RNA into a VEE replicon RNA containing particle, or 3) as a result of packaging the capsid helper RNA alone into particles (no VEE replicon RNA present). VEE helpers previously described in the art (Johnston et al., ibid., Pushko et al., ibid.) contain 519 nucleotides of the 5′ region of VEE RNA. Specifically, this 5′ region encodes a 45 nt untranslated region (UTR) as well as 474 nt of the nsP1 open reading frame (ORF). These helper RNAs were originally designed to remove the VEE nucleotide region thought to be involved in packaging of viral RNAs into particles. This design was based on work carried out using Sindbis virus, in which a region of nsP1, located approximately 1000 nt into the genome, was thought to encode the packaging signal (Bredenbeek, P J et al., 1993 J Virol 67: 6439–6446; Levis et al 1986 Cell 44:137–145; Weiss et al. 1989 J Virol 63:5310–8). To further optimize the helper constructs, increasing deletions were made into the 5′ UTR to determine the minimal sequences required for the helpers to provide (i) acceptable VRP yields and (ii) the lowest theoretical frequency for capsid gene copackaging/recombination in VRP preparations.


1. Construction of 5′ Truncated VEE Capsid Helpers


A capsid helper plasmid containing the sequence for the VEE capsid gene was constructed as previously described. This construct contains a sequence of 519 nucleotides, the “5′ UTR”, located upstream (i.e. 5′) from the ATG initiation codon for the capsid coding sequence, and is herein referred to as “hcap10”.


(a) PCR-based Construction


Nine consecutive deletions of approximately 50 nt each were made in the 519 nt UTR present in the VEE capsid helper (see Example 2). The following deletions were made from the 3′ end of the 5′ UTR:
















Hcap Construct name:
5′ UTR nt included:



















10
1-520



1
1-484



2
1-435



3
1-397



4
1-336



5
1-294



6
1-231



7
1-185



8
1-125



9
1-46 











This initial set of capsid helper (“Hcap”) constructs was produced using a PCR method that did not require cloning of individual constructs. The procedure was carried out in two separate steps. First, nine reverse primers (Hcap 1–9 reverse) were designed ˜50 nt apart, complementary to the 5′ UTR up to position 470 of the VEE replicon, and engineered to contain an ApaI restriction site:
















Primer name
SEQ ID NO:









48-132.pr2
39



48-132.pr4
40



48-132.pr6
41



48-132.pr8
42



48-132.pr10
43



48-132.pr12
44



48-132.pr14
45



48-132.pr16
46



48-132.pr18
47










The sequences of each of these primers is presented in Table 4. An Hcap forward primer, 13–101.pr1 (SEQ ID NO: 37) (also, see Table 4) was designed so that when it was used in combination with any one of the reverse primers, it would amplify a fragment containing the T7 promoter and the respective 5′UTR deletion. Second, primers were designed to amplify the capsid gene out of the existing capsid helper plasmid such that the fragment would have the following composition: 5′ ApaI restriction site, 26S promoter, capsid gene, 3′ UTR-3′. These primers are 48–132.pr1 (SEQ ID NO: 48) and 3–8pr4 (SEQ ID NO: 49) (also, see Table 4). The amplified PCR products were digested with ApaI enzyme and ligated together at the common ApaI site. These ligated DNAs were used as template to PCR amplify each of the Hcap constructs using primers 13–101.pr1 (SEQ ID NO: 37) and 13–101.pr4 (SEQ ID NO: 38), which flank the 5′ and 3′ regions of each helper, respectively. The amplified Hcap helper DNAs were used to transcribe RNA in vitro for use in VRP packaging experiments.










TABLE 4







Primers for Hcap construct cloning.











Primer





name
Primer sequence 5′–3′
Region amplified














13-101.prl
CCGGGAAAACAGCATTCCAGGTATTAGA
(SEQ ID NO:37)
Heap forward






13-101.pr4
TTTTTTTTTTTTTTTTTTTTTTTTTTTT
(SEQ ID NO:38)
VEE 3′ reverse



TTTTTTTTTGAAATATTAAAAAACAAAATCCGAT



TCGG





48-132.pr2
GACGGGCCCCTTGCCCTTCGTAGCGACAC
(SEQ ID NO:39)
Heap-1 reverse





48-132.pr4
GACGGGCCCAGTTTCCAGGTCAGGGTCGC
(SEQ ID NO:40)
Hcap-2 reverse





48-132.pr6
GACGGGCCCCCTTCATTTTCTTGTCCAATTCCT
(SEQ ID NO:41)
Hcap-3 reverse





48-132.pr8
GACGGGCCCTGCATACTTATACAATCTGTCCG
(SEQ ID NO:42)
Hcap-4 reverse



GA





48-
GACGGGCCCCGGACAGATACAATGATACTTGT
(SEQ ID NO:43)
Hcap-5 reverse


132.pr10
GCT





48-
GACGGGCCCGCCAGATGCGAAAACGCTCTG
(SEQ ID NO:44)
Hcap-6 reverse


132.pr12





48-
GACGGGCCCGCCAGATGCGAAAACGCTCTG
(SEQ ID NO:45)
Hcap-7 reverse


132.pr14





48-
GACGGGCCCTACCTCAAACTGCGGGAAGC
(SEQ ID NO:46)
Hcap-8 reverse


132.pr16





48-
GACGGGCCCTTTTGGGTAGGTAATFFGGTCTGG
(SEQ ID NO:47)
Hcap-9 reverse


132.pr18





48-132.pr1
GACGGGCCCCTATAACTCTCTAC
(SEQ ID NO:48)
Capsid forward





3-8pr4
GCAACGCGGGGAGGCAGACA
(SEQ ID NO:49)
Capsid reverse










(b) Plasmid Construction of Selected Truncated Helpers


To construct plasmid versions of selected Hcap clones, each 5′ UTR was PCR amplified as described above, digested with EcoRI and ApaI restriction enzymes, and then ligated into a standard VEE replicon vector (see Example 2), which was also digested with EcoRI and ApaI restriction enzymes. The resulting “empty” helper vectors (Δ-helpers) each contained one of the nine deleted 5′ UTR regions. The capsid gene was then PCR amplified from a standard capsid helper plasmid with primers 48–132.pr1 and 3–8pr4, as described above, digested with ApaI and NotI restriction enzymes and ligated into each of the Δ-helpers also linearized with ApaI and NotI enzymes.


B. Analysis of Truncated Helper Constructs


Each of the truncated helper constructs was tested separately for its ability to package replicon RNA expressing an immunogen (e.g. the Gag protein from HIV) into VRPs. 30 ug of each of the 3 RNAs (i.e. the truncated capsid helper, standard VEE Gp helper, and an HIV-Gag-expressing replicon RNA) were electroporated into CHO or VERO cells.


1. IFA Analysis of Electroporated CHO Cells









TABLE 5







IFA Analysis of Electroporated CHO Cells












Sample
GAG
capsid
Gp
















Hcap1
>90%
20%
>90%



Hcap2
>90%
15%
>90%



Hcap3
>90%
15%
>90%



Hcap4
>90%
10%
>90%



Hcap5
>90%
5%
>90%



Hcap6
>90%
5%
>90%



Hcap7
>90%
5%
>90%



Hcap8
>90%
<1%
>90%



Hcap9
>90%
<1%
>90%



Hcap10
>90%
>90%
>90%











2. Packaging/recombination Analysis in CHO Cells


Packaging/recombination studies were carried out on VRP generated in CHO cells (Table 6). The titer of the resultant GAG VRP and capsid expressing particles was determined by infection of fresh cells and performing IFA for GAG or capsid protein.


High titered VRP (>1×10^8/ml) were generated in CHO cells using Hcap-1 through Hcap-6. Most CHO cell VRP preparations generated with these Hcap RNAs had 20 to >100 fold reduction in capsid copackaging/recombination titer, as compared with Hcap10 (the standard, “full length 5′UTR” capsid helper).














TABLE 6








GAG VRP
capsid
fold reduction



Sample
Titer/ml
titer/ml
capsid titer vs hcap 10





















Hcap1
2.5 × 108
1.4 × 103
23.6



Hcap2
1.0 × 108
1.4 × 103
23.6



Hcap3
1.8 × 108
7.1 × 102
46.5



Hcap4
1.4 × 108
2.6 × 102
126.9



Hcap5
1.1 × 108
1.4 × 103
23.6



Hcap6
1.7 × 108
6.7 × 103
4.9



Hcap7
8.8 × 107
1.4 × 103
23.6



Hcap8
2.8 × 106
nd
nd



Hcap9
7.4 × 106
3.5 × 102
94.3



Hcap10
3.4 × 108
3.3 × 104
0.0







nd: not determined







3. Packaging/recombination Analysis in Vero Cells Using Selected Helpers


Plasmid clones were prepared for the truncated 5′ UTRs of Hcap1 through Hcap4, and the clones were sequenced to confirm their identity. Using the Hcap4 truncated helper to provide the capsid protein, VRP were produced following co-electroporation into Vero cells with an HIV-Gag VEE replicon RNA and a standard Gp RNA helper (see Example 2).


IFA analysis of Vero cells infected with these VRP at an MOI of ˜50–100 (to ensure 100% infection of cells) was carried out 16 hr post infection using an anti-capsid antibody. The number of cells that were IFA-positive for capsid was determined per field at a 10× magnification, and this number was used to calculate a copackaging-recombination titer for capsid on a per milliliter basis. Table 7 provides the results using this truncated helper, as compared with the standard capsid helper (“Hcap 10”).









TABLE 7







VRP and Capsid titers in Vero cells using Hcap4 Helper













GAG VRP
capsid
fold reduction



Sample
Titer/ml
titer/ml
capsid titer vs hcap10
















Hcap4
9.6 × 108
1.3 × 104
36.2



Hcap10
1.2 × 109
4.7 × 105
0.0










Example 4
T7 Polymerase-driven Helpers
A. T7 Polymerase-driven VEE Glycoprotein Helper

The glycoprotein (Gp) genes from the Gp helper are amplified by PCR and cloned downstream from an EMC IRES. The EMC/Gp fragment is then cloned into pCRBlunt (Invitrogen, Carlsbad, Calif.) under the control of a T7 RNA polymerase promoter. Transfection of this pCRBlunt-EMC/Gp DNA (Fugene 6, Bochringer Mannheim, Indianapolis, Ind.) into BHK-21 cells expressing T7 RNA polymerase protein resulted in VEE Gp protein expression in cells transfected with the DNA, as determined by IFA.


B. Resolving T7-polymerase Driven VEE DNA Helper


Construction of VEE DNA Resolving Helper


The VEE capsid protein is amplified from standard C helper plasmid (see Example 2) using the VEECapF/XbaI primer (SEQ ID NO: 23) and the VEECapR/BamHI primer (SEQ ID NO: 24) (also, see Table 8). The resulting PCR product is cloned into pCR4-TOPO (InVitrogen Corp., Carlsbad, Calif.), resulting in pC4-Vcapsid, and orientation is verified by restriction enzyme analysis with SpeI. The VEE glycoprotein genes are PCR amplified from the standard Gp helper plasmid using the VEEGpTEP/BamHI primer (containing the 21 nt sequence encoding the tobacco etch virus protease recognition sequence (TEP); SEQ ID NO: 25) and the VEEGpR/EcoRV primer (SEQ ID NO: 26) (also, see Table 8) followed by restriction enzyme digest with BamHI. The pCR4-VCapsid clone is digested with BamHI and PmeI and ligated with the Bam HI-digested VEEGp PCR product to generate a structural protein coding cassette with the protease recognition sequence in between the capsid and Gp sequences. The EMCV IRES is PCR amplified from pIRES using EMCV-2 forward (SEQ ID NO: 17) and reverse (SEQ ID NO: 18) primers, digested with NheI and cloned into the XbaI restriction enzyme site of pCR4-VSp, and orientation is verified by PCR analysis with EMCV-2 forward and VEECapR/BamHI.










TABLE 8







Primers for T7 promoter driven DNA Resolving Helper









Primer
Primer Sequence













VEECapF/XbaI
5′-GTCTAGAATGTTCCCGTTCCAACCAATG-3′
(SEQ ID NO:23)






VEECapR/Bam
5′-CGGGATCCCCATTGCTCGCAGTTCTCCGG-3′
(SEQ ID NO:24)





VEEGpTEP/Ba
5′-CGGGATCCGAAAACCTGTATTTTCAGGGCATGTCACT
(SEQ ID NO:25)


mHI
AGTGACGACCATGTGTCTGCTCGCC-3′





VEEGpR/EcoR
5′-CGATATCTCAATTATGTTTCTGGTTG-3′
(SEQ ID NO:26)


V









Example 5
Pol II Promoter-driven Non-replicating Helpers

A. Construction of Helpers


Alphavirus structural protein genes are PCR amplified using gene specific primers that possess unique restriction enzyme sites and cloned downstream of a DNA Polymerase II promoter for gene expression in transfected cells. In the case of VEE constructs, capsid and/or Gp genes were PCR amplified from the C-helper or Gp-helper and cloned into pCDNA-3.1 (In Vitrogen, Carlsbad, Calif.) under the control of a CMV promoter. None of the clones retained any VEE 5′UTR, 3′UTR or 26S RNA sequences. The following constructs were generated:













Name:
Expression Product:







pCDNA-VCap
VEE capsid protein


pCDNA-VcapCleave
VEE capsid protein and 8 amino acids of the E3



protein


pCDNA-VGp(X/X/N)
VEE Gps


pCDNA-VSp
VEE capsid protein and Gps (all VEE structural



proteins)









To construct pCDNA-VSp, the VEE glycoprotein gene was PCR amplified from the standard Gp helper plasmid (see Example 2) using the VEEGpF/XbaI primer (SEQ ID NO: 27) and the VEEGpR/NheI primer (SEQ ID NO: 28) (also, see Table 9). The resulting PCR product was digested with XbaI and NheI restriction enzymes and cloned into the XbaI site of pCDNA3.1 (−) to generate pCDNA-VGp(X/N). Orientation with respect to the CMV immediate early promoter was verified by restriction enzyme analysis with XbaI and SpeI. The full-length VEE capsid gene was PCR amplified from the standard C helper plasmid (see Example 2) using the VEECapF/XbaI primer (SEQ ID NO: 29) and the 3–42pr4 primers (SEQ ID NO: 30) (also, see Table 9). This PCR product was digested with XbaI and ligated into pCDNA-VGp(X/N) at the XbaI restriction enzyme site to generate pCDNA-VSp. Orientation was verified by restriction enzyme analysis with SpeI.










TABLE 9







Primers for constructing pCDNA-VSp









Primer
Sequence












VEEGpF/XbaI
5′-GTCTAGAATGTCCCTAGTGACCACCATG-3′




(SEQ ID NO:27)





VEEGpR/NheI
5′-GCGCTAGCGTCAATTATGTTTCTGGTTG-3′



(SEQ ID NO:28)





VEECapF/XbaI
5′-GTCTAGAATGTTCCCGTTCCAACCAATG-3′



(SEQ ID NO:29)





3-42pr4
5′-CAATCGCCGCGAGTTCTATG-3′



(SEQ ID NO:30)










B. Transfection with pCDNA-VSp


293T cells in T-175 flasks were transfected with 20 μg pCDNA-VSp DNA using Fugene® 6 (Roche, Indianapolis, Ind.) or Lipofectamine® 2000 (LF2K; Gibco-BRL, Gaithersburg, Md.) and cells were incubated for 6 or 24 h at 37° C. with 5% CO2. Cells were trypsinized, washed twice in PBS and resuspended at 1.2×107 cells/ml in 800 μl PBS. Cells were then mixed with 30 μg of an alphavirus replicon RNA encoding GFP and transferred to a 0.4 cm gap electroporation cuvette. The cells and RNA were pulsed three times at 450 V and 25 μF. After 10 minutes at room temperature, the cells were seeded into T75 flasks with 25 mls DMEM+10% FBS. Samples of each electroporation were aliquoted to 96 well plates for immunofluorescence analysis and all cells were incubated at 37° C. with 5% CO2.


At approximately 16 h post-electroporation, cells in 96 well plates were fixed with 2% formaldehyde; 0.2% gluteraldehyde and analyzed for GFP protein expression. Samples were alternatively fixed with MeOH and analyzed by IFA for VEE capsid and Gp protein expression. Results are summarized in Table 10, as a percentage of the electroporated cells expressing protein.









TABLE 10







Percentage of cells expressing protein 16 h after electroporation.
















VEE
VEE



Helper
Time*
GFP
Capsid
Gp

















Cap/Gp
 6 h
50%
50%
50%



RNA



Cap/Gp
24 h
80%
>50%
>50%



RNA



VSp
 6 h
80%
<1%
1%



(Fugene)



VSp
24 h
>80%
<1%
30%



(Fugene)



VSp
 6 h
80%
10%
50%



(LF2K)



VSp
24 h
>80%
1%
80%



(LF2K)







*Time elapsed following transformation with helpers that cells were harvested for electroporation with GFP-replicon RNA






Western analysis demonstrates the presence and proper processing of the capsid protein in cells transformed with pCDNA-VSp.


C. GFP-expressing VRP Production Using DNA Helpers


Each of the constructs described in (A.) were tested separately or in combination for their ability to package replicon particles expressing a reporter (e.g. GFP protein).


1. 293T cells


293T cells transformed with DNA constructs were electroporated with 30 ug GFP-expressing RNA. 30 ug of Capsid or Gp helper RNAs were included in electroporation of cells receiving only Gp or Capsid DNAs respectively. At approximately 24 h after replicon RNA electroporation as described in (B.), the culture medium was harvested and cell debris was removed by centrifugation in a swinging bucket rotor for 5 min. at 2000 rpm. The supernatant was transferred to new 50 ml conical tubes and stored at 4° C. Ten-fold serial dilutions of clarified culture medium, containing alphavirus GFP-VRPs, were prepared, and 30 μl of each dilution were inoculated onto Vero cells in 96-well plates. Cells were incubated overnight at 37° C. with 5% CO2 followed by fixation in 2% formaldehyde/0.2% glutaraldehyde. Titrations were determined by counting the number of cells that were GFP positive in 5 fields at the lowest possible dilution. Results are summarized in Table 11 below:









TABLE 11







GFP VRP Production using DNA Helpers














Titer/ml
IFA for
IFA for
IFA for



Sample
VRP
GFP*
Capsid*
Gp*

















Control**
1.5 × 106
>80%
20%
20%



VCap
6.4 × 104
50%
20%
10%



CapCleave
1.0 × 105
50%
20%
10%



VGp(X/X/N)
4.3 × 104
50%
20%
20%



VSp
1.9 × 105
50%
1%
30%



CapCleave +
4.3 × 104
50%
20%
20%



VGp(X/X/N)







*Percent of electroporated cells positive for GFP, Capsid or Gp protein expression.



**(Controls = GFP replicon particles generated using VEE Capsid and Gp helper RNAs)







2. Optimization of DNA Transfection in 293T Cells Followed by Electroporation Using pCDNA-VSp


At approximately 24 h after replicon RNA electroporation as described in (B.), the culture medium was harvested and cell debris was removed by centrifugation in a swinging bucket rotor for 5 min. at 2000 rpm. The supernatant was transferred to new 50 ml conical tubes and stored at 4° C. Ten-fold serial dilutions of clarified culture medium, containing alphavirus GFP-VRPs, were prepared, and 30 μl of each dilution were inoculated onto Vero cells in 96-well plates. Cells were incubated overnight at 37° C. with 5% CO2 followed by fixation in 2% formaldehyde/0.2% glutaraldehyde. Titrations were determined by counting the number of cells that were GFP positive in 5 fields at the lowest possible dilution. Results are summarized in Table 12.









TABLE 12







VRP titers generated using pCDNA-VSp helper











Helper
Time*
Titer (VRP/ml)







Cap/Gp RNA
 6 h
1.49 × 107



Cap/Gp RNA
24 h
5.69 × 107



VSp (Fugene)
 6 h
2.13 × 105



VSp (Fugene)
24 h
2.13 × 106



VSp (LF2K)
 6 h
9.26 × 105



VSp (LF2K)
24 h
2.85 × 106







*Time after transformation with helpers that cells were harvested for subsequent electroporation with GFP replicon RNA







D. HIV-Gag Expressing VRP Production Using pCDNA-VSp Helper


293T cells in T175 flasks were transfected with pCDNA-VSp DNA, as above, collected 6 h later, and then electroporated with 30 μg HIV-Gag replicon RNA (see Olmsted, et al., WO 02/03917). Electroporated cells were seeded into T75 flasks and samples were aliquotted into 96-well plates. At 16 h post-electroporation, samples of the helper cells in 96-well plates were fixed in methanol and analyzed by IFA for HIV-Gag, VEE Capsid or VEE Gp protein expression.


Culture medium containing the VRPs released from electroporated cells was collected, and titrations to determine recombinant alphavirus particle yield were measured. Titers for HIV-Gag expressing VRP, as well as Capsid and Gp copackaging/single recombinants, were determined by IFA (Table 13).









TABLE 13







GAG VRP titers and copackaging with VSp DNA helpers.











HIV-Gag




Helper
(VRP/ml)
Capsid (FFU/ml)
Gp (FFU/ml)





Cap/Gp RNA
7.75 × 106
1.03 × 103
1.42 × 103


pCDNA-VSp
1.64 × 106
none detected
none detected









The results in Table 13 demonstrate that the HIV-Gag VRP titers from the pCDNA-VSp helper were less then 10-fold lower than titers obtained with the bipartite RNA helper system (“Cap/Gp RNA”) while the packaging/recombination frequencies were decreased by at least three orders of magnitude.


Example 6
Construction of Resolving DNA Helpers

A. Resolving DNA Helper A


To construct this embodiment of the invention, alphavirus capsid and glycoprotein structural protein genes are cloned into two separate positions in the single helper DNA molecule. At least one structural gene, located in the first position, is cloned directly downstream from a DNA dependant RNA polymerase II (po II) promoter. One or more structural genes, not encoded in the first position, are located in the second position, being positioned downstream of the first position, such that the transcript resulting from the pol II promoter-directed expression contains an IRES element directly 5′ to the structural protein gene(s) in the downstream position.


One method of construction employs first PCR amplifying the selected alphavirus capsid or glycoprotein structural proteins using structural-gene specific primers that also code for unique restriction enzyme sites. The sequence encoding the structural protein gene(s) located in the first position is cloned directly into the DNA dependent RNA polymerase II (pol II) promoter-based expression vector of choice. The sequence encoding the structural protein gene(s) located in the second position is initially cloned into a transfer vector that contains an IRES sequence such that the transcript eventually resulting from the promoter-directed expression will contain an IRES element directly 5′ to the structural protein gene(s) coding sequence in the second position.


To insert the ribozyme sequence, overlapping complementary primers that encode a ribozyme are annealed to produce a ribozyme linker sequence with unique 5′ and 3′ restriction sites at each end. Then, the IRES-structural protein gene fragment is digested out of the transfer vector, and the pol II expression vector is digested at the unique 3′ restriction site of the sequence encoding the gene(s) in the first position and at another unique restriction site further downstream that is compatible with the 3′ site of the IRES-structural protein gene DNA fragment. The construct is completed by ligating the IRES-structural protein gene fragment and the po II expression vector together at the compatible 5′ and 3′ sites at the ends of the ribozyme linker sequence.


Construction of a VEE Helper A


The VEE glycoprotein (GP) gene is amplified with GP forward (SEQ ID NO: 1) and GP reverse primers (SEQ ID NO: 2) (also, see Table 1) and the VEE capsid (C) gene is amplified with C forward (SEQ ID NO: 5) and C reverse primers (SEQ ID NO: 6) (also, see Table 1) using GP-helper and C-helper plasmids as templates for PCR, respectively (e.g. Pushko et al, 1997). The VEE GP PCR product is digested with NheI and ApaI restriction enzymes and ligated into a suitable vector linearized with the same restriction enzymes and containing a polII promoter, such as the commercially available pCDNA3.1 (Invitrogen, Carlsbad, Calif.; note that this vector, as well as other commercially available vectors, is engineered with a selectable marker for use of the purchased plasmid in mammalian cell culture, but since the claimed inventions do not require such a marker, it is removed prior to insertion of the VEE structural protein coding sequence(s)). In employing pCDNA3.1, the VEE GP gene is then located downstream of the CMV immediate early (IE) promoter, generating pCDNA3.1 /sp1.


The VEE capsid PCR fragment is digested with XbaI and SalI restriction enzymes and ligated into a suitable vector linearized with the same restriction enzymes and containing as IRES, such as the commercially available XbaI/SalI linearized pIRES DNA (Clontech, Palo Alto, Calif.). This manipulation generates pIRES/sp2. Overlapping complementary primers hdR-Forward (SEQ ID NO: 7) and hdR-Reverse (SEQ ID NO: 8) (also, see Table 1), coding for the hepatitis delta ribozyme (hdR), are annealed together to generate an hdR linker sequence with ApaI and XhoI restriction sites at the 5′ and 3′ ends, respectively. The vector portion of the construct is produced by digesting pCDNA3 1/sp1 with ApaI and NotI restriction enzymes. A 1502 base pair XhoI/NotI IRES/sp2 fragment digested from pIRES/sp2 DNA and the ApaII/XhoI hdR linker fragment are then ligated with ApaI/NotI linearized pCDNA3.1/sp1 to generate VEE Helper A.


B. Resolving DNA Helpers B and C


To construct other embodiments of the invention, an alphavirus structural protein helper vector (e.g. comprising an alphaviral 5′ replication recognition sequence, either an alphavirus transcriptional promoter (herein Helper B; e.g. an 26S alphavirus subgenomic promoter) or an internal ribosome entry site (IRES) (herein Helper C; e.g. the EMCV IRES), a nucleic acid sequence encoding the upstream alphavirus structural protein gene(s), and an alphavirus 3′ replication recognition sequence) is cloned directly into a polII promoter-based expression vector of choice (see Example 5). Concomitantly, the nucleic acid sequence encoding the alphavirus structural protein gene(s) in the downstream fragment is cloned into a transfer vector containing an IRES sequence, as described herein. To assemble Helper B, the IRES-structural protein coding sequence fragment is then digested out of the transfer vector and the released fragment is ligated into the promoter expression vector, so that the polII promoter directs the expression of the structural proteins in both the upstream and downstream positions.


Helper C is prepared in two steps from Helper B. The first step is to remove the 26S promoter from Helper B, while introducing a unique restriction site in its place. The second step is to clone an IRES sequence into the unique engineered restriction site.


Construction of a VEE Helper B.


The CMV IE promoter is PCR amplified from pIRES2-DsRed2 (Clontech) using the CMV forward primer (SEQ ID NO: 9) and the CMV reverse primer (SEQ ID NO: 10) (also, see Table 1). The VEE 5′ non-coding region, 26S promoter, GP gene and VEE 3′ noncoding region is amplified from a GP-helper plasmid (see Example 4A) using the GP-2 forward primer (SEQ ID NO: 3) and the GP-2 reverse primer (SEQ ID NO: 4) (also, see Table 1). The CMV IE PCR product and the GP-helper PCR product have a 53 nt region of homology at their 3′ and 5′ends, respectively. This region of homology allows an overlapping PCR reaction to produce a gene construct containing the CMV IE promoter that initiates transcription at the VEE 5′ end of the GP-helper sequence. The CMV IE/GP-helper fragment is then digested with NheI restriction enzyme. The pol II promoter-based vector pCDNA3.1 is linearized with BglII restriction enzyme and then treated with T4 DNA polymerase to produce a blunt end. The vector is further digested with NheI to release the existing CMV IE and T7 RNA polymerase promoters from the vector. The NheI digested CMV IE/GP-helper PCR product is then ligated into the BglII(T4 treated)/NheI digested pCDNA3.1 vector, generating pCDNA3.1/sp1.2. The 1502 base pair XhoI/NotI IRES/sp2 fragment digested from pIRES/sp2 DNA and the ApaI/XhoI hdR linker fragment are then ligated with ApaI/NotI linearized pCDNA3.1/sp1.2 to generate VEE Helper B.


Construction of VEE Helper C.


Removal of the 26S promoter in Helper B is accomplished by PCR, using two sets of primers. The first set of primers (d26S forward (SEQ ID NO: 11) and d26S reverse (SEQ ID NO: 12); also, see Table 1) amplify a fragment containing the CMV IE and the VEE 5′ non-coding region (NCR). The d26S reverse primer anneals upstream from the 26S promoter so that it is not included in the PCR product. The CMV IE/VEE 5′ NCR PCR product encodes a 5′ PvuI site, found in the backbone of Helper B DNA, and an engineered unique AscI restriction site at the 3′ end of the VEE 5′ NCR. The second set of primers (E3 forward (SEQ ID NO: 13) and 6K reverse (SEQ ID NO: 14); also, see Table 1) amplify a product containing the VEE E3-6K region of the GP-helper that also does not contain the 26S promoter. The E3-6K product contains an engineered 5′ AscI site and a 3′ unique SgrAI restriction site found in the 6K gene. After PCR amplification, the CMV IE/VEE 5′ NCR PCR product is digested with PvuI and AscI restriction enzymes, and the E3-6K product is digested with AscI and SgrAI restriction enzymes. Helper B DNA (see above) is digested with PvuI and SgrAI restriction enzymes to release the CMV IE-VEE 5′ NCR-26S-E3-6K region. A new Helper is then reconstituted by ligating the PvuI/AscI CMV IE/VEE 5′ NCR digested fragment and the AscI/SgrAI E3-6K digested fragment with the PvuI/SgrAI digested Helper B vector, generating Helper B.2. Helper B.2 is identical to Helper B except that the 26S promoter has been removed and a unique AscI restriction site has replaced it.


The EMCV IRES is amplified from the pIRES vector using the EMCV forward primer (SEQ ID NO: 15) and the EMCV reverse primer (SEQ ID NO: 16) which both contain engineered 5′ AscI restriction sites (also, see Table 1). After amplification, the EMCV IRES PCR product is digested with AscI restriction enzyme and ligated into AscI linearized Helper B.2 DNA, generating Helper C.


C. Resolving DNA Helper D


Another embodiment of this invention can be constructed by modifying Helper A to contain an IRES element that directs cap-independent translation of the alphavirus structural proteins in the upstream as well as the downstream location, a construct referred to herein as Helper D.


Construction of a VEE Helper D.


The EMCV IRES is amplified from the pIRES vector using the EMCV-2 forward primer (SEQ ID NO: 17) and the EMCV-2 reverse primer (SEQ ID NO: 18), each containing engineered 5′ NheI restriction sites (also, seeTable 1). After amplification, the EMCV IRES PCR product is digested with NheI restriction enzyme and ligated into NheI linearized VEE Helper A, generating VEE Helper D.


Example 7
Chimeric Alphavirus RNA Helpers

A. Construction of VEE-SIN Helper


The VEE capsid gene was cloned into the XbaI restriction site of the pSINrep5 replicon vector (InVitrogen, Carlsbad, Calif.). Sindbis-based helpers that contain the VEE capsid gene were constructed by deleting portions of the Sindbis nsP region from the pSINrep5/VEEcapsid construct. The pΔSIN/VEEcapsid DNA was prepared by digesting pSINrep5/VEEcapsid DNA with SmaI and BamHI restriction enzymes, deleting 6567 base pairs (bp) of the nsP genes. A second helper construct (pΔSIN/VEEcap-2), lacking an additional 667 bp of the nsP region, was prepared by PCR amplifying a region of pΔSIN/VEEcapsid, using the primers ΔSIN26S/RsrII forward (SEQ ID NO: 31) and ΔSIN-ApaI/reverse (SEQ ID NO: 32) (also, see Table 14) and ligating it into RsrII and ApaI linearized pΔSIN/VEEcapsid DNA.










TABLE 14







PCR primers used to generate ASIN/VEEcap-2













Region



primer
Sequence 5′–3′
amplified














ΔSIN26S/RsrII
TTTCGGACCGTCTCTACGGTGGTCCTAAAT
(SEQ ID NO:31)
nsP and VEE



forward
AGTC

capsid





ΔSIN-Apal/
CTGGTCGGATCATGGGCCC
(SEQ ID NO:32)
nsP and VEE


reverse


capsid










B. HIV-Gag Expressing VRP Production Using a Chimeric Alphavirus Helper


The ΔSIN/VEEcapsid or ΔSIN/VEEcap-2 helpers were used to generate VRP in Vero cells with a VEE Gp RNA helper (as described herein) and a VEE RNA replicon expressing the HIV Gag gene. The culture medium containing HIV-Gag VRP, generated using either the ΔSIN/VEEcapsid or ΔSIN/VEEcap-2 helper, was collected, and the yield of VRPs was determined using an HIV-Gag IFA. Using the ΔSIN/VEEcapsid helper, a VRP titer of 2.6×106/ml was obtained; using the ΔSIN/VEEcap-2 helper, a VRP titer of 1.9×106/ml was obtained.


Example 8
Construction of Nodavirus-based Helper RNAs

Generally, the constructs are produced as follows. The alphavirus capsid gene is PCR amplified with gene specific primers that introduce restriction enzyme sites. The PCR amplified product is cloned directly into a Nodavirus RNA2 (generated from either flock house virus (FHV) or nodamura (NoV)), which are digested with compatible restriction enzymes.


Construction of Nodavirus VEE Capsid Helpers


The VEE capsid gene is PCR amplified with the capsid F (MluI) primer (SEQ ID NO: 19) and the capsid R (MluI) primer (SEQ ID NO: 20) that introduce a MluI site, (also, see Table 1), using pCDNA VSp (see Example 5) as the template. The VEE capsid PCR product is digested with MluI and ligated into the MluI digested FHV RNA2 vector and the BssHII digested NoV RNA2. BssHII digestion produces compatible cohesive ends with MluI. The resultant clones are sequenced to determine orientation and to verify sequence accuracy.


Alternatively, the VEE capsid gene can be directionally cloned into the NcoI and MluI sites of FHV RNA2 and the NcoI and BssHII sites of NoV RNA2. This NcoI site is 5′ to the MluI or BssHII sites in the FHV and NoV RNA2, respectively, separated by one nucleotide. The VEE capsid gene is PCR amplified with one of two forward primers containing an NcoI site, capsid F1 (NcoI) (SEQ ID NO: 21) and capsid F2 (NcoI) (SEQ ID NO: 22), and a reverse primer that contains a MluI site, capsid R (MluI) (SEQ ID NO: 20), using pCDNA VSp (see Example 5) as the template. The resultant VEE capsid 1 and VEE capsid 2 PCR products are digested with NcoI and MluI and ligated into the NcoI/MluI digested FHV RNA2 vector and the NcoI/BssHII digested NoV RNA2 vector.


In addition, the VEE glycoprotein gene and the entire VEE structural protein gene cassette can be cloned into the FHV RNA2 and the NoV RNA2 expression vectors as described above using appropriate primers.


The nodavirus capsid helper described herein is co-electroporated into VERO cells at 28 C with nodavirus RNA1, a VEE GP helper (e.g. see Pushko, et. al. 1997, ibid.) and a VEE RNA replicon expressing the HIV gag protein (see Olmsted et al., WO 02/03917). When the FHV RNA 1 and 2 are used, recombinant alphavirus particle yields were 4.3×106 per ml. When the NoV RNA 1 and 2 are used, particle yields were approximately 2×105 per ml.


Example 9
Production of Replicon Particles Using DNA or RNA Helpers

The replicon RNA and helper nucleic acids can be introduced to the helper cell by one or more of several different techniques generally known to the art, e.g. electroporation, transfection (e.g. using calcium phosphate precipitation or nucleic acids deposited on microbeads or nanoparticles), lipid-mediated DNA uptake, micro- or nano-projectiles, stable transformation, by incorporation into a viral vector, such as adenovirus, SV40, poxvirus (e.g. modified vaccinia Ankara), nodavirus or adenoassociated virus, or by coating onto a virus vector, such as adenovirus. When using a combination of DNA helper nucleic acids and an RNA replicon, these molecules may be introduced at different times using different techniques. The difference in timing may provide a period of time for recovery by the cells, and it may also allow optimization of the differing kinetics of expression from a DNA vector as compared with an RNA vector. The timing can be 30 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 24 hours between the introduction of each nucleic acid molecule to the cells. The introduction of DNA helper(s) by a different means and prior to the electroporation of replicon RNA (and helper RNA, as appropriate) does not have significant detrimental effects on the efficiency of the RNA electroporation.


Transfection of DNA Helpers


Lipid-Mediated


293T, VERO or DF1 cells are first transfected with the DNA helper by lipofection using Fugene® 6 (Boehringer Mannheim, Indianapolis, Ind.). Cells are incubated in the presence of Fugene and DNA in medium containing 10% FBS for 1 to 24 hours. After incubation, they are washed with PBS and collected by trypsinization.


Electroporation


Transfection of DNA into Vero cells using commercially available cationic lipids such as FuGene and Lipofectamine is typically inefficient (˜1% efficiency). While these methods may be sufficient for certain applications, electroporation of DNA helpers into Vero cells is a preferred alternative approach. Various parameters of the electroporation process can be optimized to enhance the efficiency of DNA entry into Vero cells.


For example, it is preferable to use purified DNA constructs. For example, plasmid DNA containing a gene under the control of a CMV promoter is first isolated using a high purity maxiprep system (e.g. Qiagen®; Promega Corporation, Madison, Wis.). Such initially purifed DNA is preferably further purified by phenol extraction in the presence of ethidium bromide and high salt (reference: Stemmer, W P, Biotechniques. 1991 June; 10(6):726). This further purified DNA is resuspended in nuclease free water prior to electroporation.


Another optimization step involves the culturing conditions for Vero cells can be optimized for electroporation of DNA. Vero cells are initially cultured in EMEM medium and grown to late log phase, then harvested by trypsinization, washed twice with Invitrus® (Cell Culture Technologies GmBh, Zurich, Switzerland), and resuspended in 800 μl Invitrus medium.


These Invitrus-bathed cells are combined with an optimized amount of purified DNA (typically, concentrations range from 10 μg to 200 μg) and then transferred to a 0.4 cm2 gap cuvette. Electroporations is performed using a Biorad Gene Pulser® (BioRad Laboratories, Inc., Hercules, Calif.), with four pulses at 50 μF, over a range of voltages (500–700V). After electroporation, the Vero cells were seeded into 6 well plates and incubated for 24 hours at 37° C. with 5% CO2.


In determining the optimized parameters, expression of protein is first analyzed at 16 and 23 hours post-electroporation. The percentage of transfected cells, varying the above parameters, ranged from 1%–40%; an example of an optimized set of parameters is: 150 μg purified plasmid DNA and pulsing four times at 650V, 50 μF. In addition, there is typically an additional 5–10% increase in expression between 17 and 23 hours post-electroporation.


Electroporation efficiency can also be enhanced by synchronizing the Vero cells in a specific phase of the cell cycle. In one example, cells are synchronized in the G2/M phase with aphidicolin (1 mg/ml) prior to electroporation (see Golzio, M, Biochem Biophys Acta. 2002 June 13:1563(1–2):23–8). These synchronized cells are handled as described above and combined with 50 μg of plasmid DNA prior to electroporation. In this example, aphidicolin-treated cells show a two-fold increase in the percentage of cells transfected, as compared to untreated (unsynchronized) cells.


Electroporation of Alphavirus Replicon RNA


After introduction of the DNA helpers of this invention, 1.2×107 cells are then electroporated in the presence of a replicon RNA and appropriate helper RNAs (if required) under the following conditions: 450V (293T) or 850V (VERO and DF1) and 25 uF in 0.4 cm gap electroporation cuvettes (pulse 3×'s with 4 sec. between pulses). Electroporated cells are then allowed to recover for 10 min. before seeding into 25 mls medium containing 10% FBS.


When using RNA replicon and RNA helper combinations, all RNAs may be co-electroporated into the helper cell at the same time. Methods for RNA electroporation are as described above. In an alternative embodiment, when introducing the DNA helpers to the helper cell via electroporation, the replicon RNA may be co-electroporated with the DNA helpers.

Claims
  • 1. A recombinant DNA molecule for transiently expressing alphavirus structural proteins comprising a constitutive promoter for directing the transcription of RNA from a DNA sequence operably linked to a DNA sequence comprising a complete alphavirus structural polyprotein-coding sequence, with the proviso that the DNA sequence does not encode alphaviral 5′ or 3′ replication recognition sequences or an alphavirus subgenomic promoter.
  • 2. The recombinant DNA molecule of claim 1, wherein the alphavirus structural proteins are selected from the group consisting of VEE, Sindbis, S.A.AR 86, Semliki Forest virus and Ross River virus structural proteins.
  • 3. The recombinant DNA molecule of claim 1, wherein the alphavirus structural polyprotein-coding sequence comprises one or more attenuating mutations.
  • 4. A helper cell for producing an infectious, replication-defective, alphavirus replicon particle comprising, in an alphavirus permissive cell, (i) the recombinant DNA molecule of claim 1; and(ii) an alphavirus replicon RNA encoding at least one heterologous RNA.
  • 5. The helper cell of claim 4, wherein the cell is selected from the group consisting of 293, BHK, Vero, CHO, CEF and DF-1 (ATCC Accession No. CRL-12203) cells.
  • 6. The helper cell of claim 4, wherein the alphavirus structural proteins are selected from the group consisting of VEE, Sindbis, S.A.AR 86, Semliki Forest virus and Ross River virus structural proteins.
  • 7. The helper cell of claim 4, wherein the alphavirus structural polyprotein-coding sequence comprises one or more attenuating mutations.
  • 8. A method of producing infectious, replication-defective alphavirus replicon particles, comprising introducing into a population of cells (i) the recombinant DNA molecule of claim 1; and (ii) an alphavirus replicon RNA encoding at least one heterologous RNA, under conditions whereby the alphavirus structural polyprotein-coding sequence is transiently expressed from the DNA molecule to produce alphavirus structural proteins and infectious, replication-defective alphavirus replicon particles are produced.
  • 9. The method of claim 8, wherein the recombinant DNA molecule is electroporated into the population of cells.
  • 10. A method of producing infectious, replication-defective alphavirus replicon particles, comprising introducing into a population of cells, (i) a first recombinant DNA molecule for transiently expressing alphavirus structural proteins comprising a constitutive promoter for directing the transcription of RNA from a DNA sequence operably linked to a DNA sequence encoding at least one alphavirus structural protein-coding sequence, with the proviso that the DNA sequence does not encode alphaviral 5′ or 3′ replication recognition sequences or an alphavirus subgenomic promoter,(ii) a second recombinant DNA molecule for transiently expressing alphavirus structural proteins comprising a constitutive promoter for directing the transcription of RNA from a DNA sequence operably linked to a DNA sequence encoding at least one alphavirus structural protein-coding sequence not present in the at least one alphavirus structural protein-coding sequence of the first recombinant DNA molecule, with the proviso that the DNA sequence does not encode alphaviral 5′ or 3′ replication recognition sequences or an alphavirus subgenomic promoter, wherein the first and second recombinant DNA molecules together encode all alphavirus structural proteins; and(iii) an alphavirus replicon RNA encoding at least one heterologous RNA, under conditions wherein the first and second recombinant DNA molecules are expressed from autonomous plasmids, whereby the alphavirus structural protein coding sequences are transiently expressed from the first and second recombinant DNA molecules to produce alphavirus structural proteins and infectious, replication-defective alphavirus replicon particles are produced and wherein the first and second recombinant DNA molecules are introduced into the population of cells by electroporation.
  • 11. The method of claim 10, wherein the population of cells is selected from the group consisting of 293, BHK, Vero, CHO, CEF and DF-1 (ATCC Accession No. CRL-12203) cells.
  • 12. The method of claim 10, wherein the alphavirus structural protein of the first recombinant DNA molecule is selected from the group consisting of a VEE, Sindbis, S.A.AR 86, Semliki Forest virus and Ross River virus structural protein.
  • 13. The method of claim 10, wherein the alphavirus structural protein of the second recombinant DNA molecule is selected from the group consisting of a VEE, Sindbis, S.A.AR86, Semliki Forest virus and Ross River virus structural protein.
  • 14. The method of claim 10, wherein the alphavirus structural protein-coding sequence of at least the first recombinant DNA molecule or the second recombinant DNA molecule or of both the first and second recombination DNA molecules comprises one or more attenuating mutations.
  • 15. The method of claim 8, wherein the population of cells is selected from the group consisting of 293, BHK, Vero, CHO, CEF and DF-1 (ATCC Accession No. CRL-12203) cells.
  • 16. The method of claim 8, wherein the alphavirus structural proteins are selected from the group consisting of VEE, Sindbis, S.A.AR 86, Semliki Forest virus and Ross River virus structural proteins.
  • 17. The method of claim 8, wherein the alphavirus structural polyprotein-coding sequence comprises one or more attenuating mutations.
  • 18. A vector comprising the recombinant DNA molecule of claim 1.
  • 19. A cell comprising the recombinant DNA molecule of claim 1.
  • 20. A cell comprising the vector of claim 18.
  • 21. A method of producing a population of infectious, replication-defective alphavirus replicon particles having a decreased frequency of recombination/copackaging as compared to a population of infectious, replication-defective alphavirus replicon particles produced using a bipartite RNA transfection helper system, comprising introducing into a population of cells (i) the recombinant DNA molecule of claim 1; and (ii) an alphavirus replicon RNA encoding at least one heterologous RNA, under conditions whereby the alphavirus structural polyprotein-coding sequence is transiently expressed from the DNA molecule to produce alphavirus structural proteins and a population of infectious, replication-defective alphavirus replicon particles is produced.
  • 22. The method of claim 21, wherein the population of cells is selected from the group consisting of 293, BHK, Vero, CHO, CEF and DF-1 (ATCC Accession No. CRL-12203) cells.
  • 23. The method of claim 21, wherein the alphavirus structural proteins are selected from the group consisting of VEE, Sindbis, S.A.AR 86, Semliki Forest virus and Ross River virus structural proteins.
  • 24. The method of claim 21, wherein the alphavirus structural polyprotein-coding sequence comprises one or more attenuating mutations.
  • 25. The method of claim 21, wherein the recombinant DNA molecule is electroporated into the population of cells.
CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims benefit of priority from U.S. Provisional Application No. 60/317,722, filed Sep. 6, 2001, which is herein incorporated by reference in its entirety.

US Referenced Citations (76)
Number Name Date Kind
4650764 Temin Mar 1987 A
4708871 Geysen Nov 1987 A
5091309 Schlesinger Feb 1992 A
5185440 Davis Feb 1993 A
5217879 Huang Jun 1993 A
5505947 Johnston Apr 1996 A
5521082 Lewis et al. May 1996 A
5639650 Johnston Jun 1997 A
5643576 Johnston Jul 1997 A
5703057 Johnston et al. Dec 1997 A
5726022 Burmer Mar 1998 A
5739026 Garoff Apr 1998 A
5766602 Xiong Jun 1998 A
5789245 Dubensky et al. Aug 1998 A
5792462 Johnston et al. Aug 1998 A
5811407 Johnston Sep 1998 A
5814482 Dubensky Sep 1998 A
5827658 Liang Oct 1998 A
5831016 Wang et al. Nov 1998 A
5843723 Dubensky Dec 1998 A
5853719 Nair et al. Dec 1998 A
5958738 Lindermann et al. Sep 1999 A
5989553 Johnston et al. Nov 1999 A
6008035 Johnston Dec 1999 A
6015686 Dubensky Jan 2000 A
6015694 Dubensky Jan 2000 A
6146874 Zolotukhin Nov 2000 A
6156558 Johnston Dec 2000 A
6190666 Garoff Feb 2001 B1
6194191 Zhang et al. Feb 2001 B1
6197502 Renner et al. Mar 2001 B1
6224879 Sjoberg May 2001 B1
6242259 Polo et al. Jun 2001 B1
6261570 Parker Jul 2001 B1
6267967 Johnston et al. Jul 2001 B1
6306388 Nair et al. Oct 2001 B1
6329201 Polo Dec 2001 B1
6342372 Dubensky Jan 2002 B1
6495143 Lee et al. Mar 2002 B1
6376236 Dubensky Apr 2002 B1
6391632 Dubensky May 2002 B1
6426196 Dubensky et al. Jul 2002 B1
6485958 Blanch et al. Nov 2002 B1
6521235 Johnston et al. Feb 2003 B1
6531135 Johnston et al. Mar 2003 B1
6541010 Johnston et al. Apr 2003 B1
6583121 Johnston et al. Jun 2003 B1
6767699 Polo et al. Jul 2004 B1
6770283 Garoff et al. Aug 2004 B1
6783939 Olmsted et al. Aug 2004 B1
6844188 MacDonald et al. Jan 2005 B1
20010016199 Johnston et al. Aug 2001 A1
20020018766 Roberts et al. Feb 2002 A1
20020034521 Lee et al. Mar 2002 A1
20020102273 Grieve et al. Aug 2002 A1
20020141975 Olmsted et al. Oct 2002 A1
20020164582 Hart et al. Nov 2002 A1
20030021766 Vadjy et al. Jan 2003 A1
20030091591 Xiong et al. May 2003 A1
20030096397 Schlesinger et al. May 2003 A1
20030119182 Smith et al. Jun 2003 A1
20030120060 Gonczol et al. Jun 2003 A1
20030152590 Hevey et al. Aug 2003 A1
20030232036 Johnston et al. Dec 2003 A1
20040008458 Kase et al. Jan 2004 A1
20040009183 Lee et al. Jan 2004 A1
20040009945 Lee et al. Jan 2004 A1
20040029279 Kovacs et al. Feb 2004 A1
20040030117 Johnston et al. Feb 2004 A1
20040121466 Johnston et al. Jun 2004 A1
20040146859 Hart et al. Jul 2004 A1
20040166573 Smith et al. Aug 2004 A1
20040208848 Smith et al. Oct 2004 A1
20050031592 Doolan et al. Feb 2005 A1
20050054107 Chulay et al. Mar 2005 A1
20050118251 Nagata et al. Jun 2005 A1
Foreign Referenced Citations (23)
Number Date Country
WO 0210578 Jun 1992 WO
WO 9210578 Jun 1992 WO
WO 9507994 Mar 1995 WO
WO 9527044 Oct 1995 WO
WO 9531565 Nov 1995 WO
WO 9617072 Jun 1996 WO
WO 9637220 Nov 1996 WO
WO 9637616 Nov 1996 WO
WO 9907834 Feb 1999 WO
WO 9908706 Feb 1999 WO
WO 0039302 Jul 2000 WO
WO 0039318 Jul 2000 WO
WO 0061772 Oct 2000 WO
WO 0116343 Mar 2001 WO
WO 02003917 Jan 2002 WO
WO 0204493 Jan 2002 WO
WO 0220721 Mar 2002 WO
WO 03023026 Mar 2003 WO
WO 03083065 Oct 2003 WO
WO 04055166 Jul 2004 WO
WO 04055167 Jul 2004 WO
WO 04085660 Oct 2004 WO
WO 05007689 Jan 2005 WO
Related Publications (1)
Number Date Country
20030119182 A1 Jun 2003 US
Provisional Applications (1)
Number Date Country
60317722 Sep 2001 US