An Electrochemical Interface for Molecular Circuit-Based Outputs

Information

  • Patent Application
  • 20230175044
  • Publication Number
    20230175044
  • Date Filed
    October 29, 2020
    5 years ago
  • Date Published
    June 08, 2023
    3 years ago
Abstract
The present description pertains to a detection system and methods of using same comprising an upstream molecular circuitry system that is activated in the presence of a target molecule to produce a reporter molecule and a capture molecule bound to an electrode wherein the reporter molecule specifically binds to the capture molecule bound to the electrode to produce or reduce a detectable electrochemical signal.
Description
INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS A TEXT FILE

A Sequence Listing is provided herewith in a text file, ROBI-018_017978-0205_Seqlist_ST25, created on Nov. 10, 2022 and having a size of 57,434 bytes of file. The contents of the text file are incorporated herein by reference in its entirety.


FIELD

The present invention relates to a molecular circuitry-based detection system for the identification of a target molecule and method of uses thereof.


BACKGROUND

The field of synthetic biology uses genetically-encoded tools to create biological systems with new functions (1,2). Work to date has generated organisms with engineered metabolic pathways for bioproduction (3,4), embedded synthetic logic and memory (5-7) and the capacity to sense and respond (8,9). Despite being poised to revolutionize many aspects of modern life, this cell-based approach requires that all processes be laboriously encoded within a living organism (10), and introduces significant complexity into the application of synthetic biology including limits to the distribution of these tools over concerns of biosafety. Recent efforts have aimed to tackle this long-standing challenge by creating cell-free synthetic biology applications that use the enzymes of transcription and translation (11-13) to provide a biosafe format for applications ranging from point-of-care diagnostics to biomanufacturing to classroom education (14-20). Cell-free systems are particularly advantageous as they can be freeze-dried for distribution without refrigeration and so the central motivation for many of these projects has been to provide portable diagnostics/sensors for global health, agriculture, national security and other applications that would benefit from sensing outside of laboratory settings. Sensors used in these and conventional synthetic biology studies have relied on the expression of optical reporter proteins (e.g. colorimetric, fluorescence), which, while successful, generally provide the capacity for one, at most two or three, reporter signals from a single reaction.


There is therefore a need for a molecular circuit-to-electrode interface that allows for the output from engineered, cell-free molecular circuits to be transformed into a signal that can be detected electrochemically.


SUMMARY

The present description relates to a detection or reporter system, that comprises a molecular circuit, which can be used alone or in a multiplexed fashion. Upstream molecular circuits comprise biological sensors that can detect specific inputs, which triggers a corresponding reporter system to produce an electrochemical output.


In some embodiments described herein, is a detection system comprising:

  • a. an upstream molecular circuitry system that is activated in the presence of a target molecule to produce a reporter molecule;
  • b. a capture molecule bound to an electrode;
  • wherein the reporter molecule specifically binds to the capture molecule bound to the electrode to produce or reduce a detectable electrochemical signal.


In some embodiments described herein, is a detection system comprising:

  • a. an upstream molecular circuitry system that is activated in the presence of a target molecule to produce an activator;
  • b. a reporter system; and
  • c. a capture molecule bound to an electrode;
  • wherein the activator activates the reporter system to produce or specifically release a reporter molecule and wherein the reporter molecule specifically binds to the capture molecule bound to the electrode to produce or reduce a detectable electrochemical signal.


In some embodiments described herein, is a detection system comprising:

  • a. an upstream molecular circuitry system comprising one or more different RNA toehold switch-based sensor(s), wherein each RNA toehold switch is specific to a target molecule that is an RNA sequence within a sample, and comprises an mRNA sequence encoding a distinct activator that is a restriction enzyme;
  • b. one or more reporter system(s), wherein each reporter system comprises a reporter molecule that is a reporterDNA, bound to an inhibitory single-stranded DNA that is an iDNA, wherein said reporterDNA is coupled to a redox active molecule, and wherein said reporterDNA and iDNA comprise a sequence recognized by said restriction enzyme;
  • c. one or more capture molecules, wherein each capture molecule that is a captureDNA, is coupled to an electrode and comprises a sequence complementary to said reporterDNA;
  • wherein the restriction enzyme activates the reporter system by specifically releasing the reporterDNA from the iDNA and wherein the reporterDNA specifically binds to the captureDNA, to produce an electrochemical signal detected by the electrode.


In some embodiments described herein, is a method of detecting a target molecule comprising:

  • a. providing the molecular-based detection system as defined herein;
  • b. contacting said system with a sample; and
  • c. detecting an electrochemical signal, wherein detection of said signal indicates the presence of the target molecule.


In some embodiments described herein, is a method of detecting a target molecule comprising:

  • a. providing the molecular-based detection system as defined herein;
  • b. contacting said system with a sample; and
  • c. detecting an electrochemical signal, wherein detection of said signal indicates the presence of the target molecule.


In some embodiments described herein, is a method for detecting multiple RNA sequences within a sample, said method comprising the steps of:

  • a. incubating the sample with a set of synthetic RNA-based sensors;
  • b. binding of an RNA sequence within said sample to a complementary synthetic RNA toehold switch and activating said synthetic RNA toehold switch;
  • c. translating mRNA regulated by said synthetic RNA toehold switch to a protein;
  • d. binding of said translated protein to a redox reporter molecule and releasing said molecule;
  • e. binding of said redox reporter molecule to an electrode-bound capture molecule; and
  • f. generating an electrochemical signal from said electrode.





BRIEF DESCRIPTION OF THE DRAWINGS

In the appended drawings:



FIG. 1: A molecular circuit-electrode interface for cell-free synthetic gene networks. By combining cell-free transcription and translation systems with engineered molecular circuits on nanostructured microelectrodes, distinct and multiplexed output signals can be tracked in parallel. Here we describe this approach using toehold switch-based RNA sensors, which, in the presence of trigger RNA, express one of ten restriction enzyme-based reporters. Upon sensor activation, expressed restriction enzymes cleave annealed reporterDNA, which is free floating in cell-free reactions, releasing the redox reporter-labelled reporterDNA (blue circle). Nanostructured microelectrodes with conjugated captureDNA then recruit the redox-active reporterDNA to their surface, generating an electrochemical signal. Each toehold switch is engineered to produce a unique restriction enzyme-based reporter that is coupled to a distinct reporterDNA and captureDNA pair for multiplexed signaling.



FIG. 2A: Development of orthogonal, restriction enzyme-based reporters. Candidate restriction enzymes were evaluated through a four-step screening pipeline (i-iv) designed to find enzymes with high rates of expression and processivity in the cell-free expression system (CFS). i) 37 of 66 commercially available enzymes were active in the cell-free (CF) buffer system that replicates the pH, buffer and salt composition found in the complete transcription and translation system, ii) 26 of the 37 above restriction enzymes were successfully expressed de novo in the cell-free system, iii) 14 of these 26 cell-free expressed enzymes showed high levels of cleavage activity, iv) 10 of the 14 enzymes demonstrated high rates of enzyme-mediated cleavage from de novo cell-free expression.



FIG. 2B: A summary of the performance for screened restriction enzymes with colors matching the categories described in FIG. 2A. Representative data of three candidate restriction enzyme-based reporters in molecular beacon cleavage assays. Data presented as percent of maximum fluorescence for each molecular beacon, error bars represent SE (N=3).



FIG. 2C: Heat map of specific enzyme activity. All combinations of restriction enzymes and molecular beacons were tested. Values are average of triplicates at 180 min.



FIG. 3A: Electrochemical detection of restriction enzyme reporters. A schematic of the electrochemical detection chip designed to detect (in triplicate) reporterDNA generated by five restriction enzyme-based reporters in parallel



FIG. 3B: Scanning electron microscopy images of nanostructured microelectrodes. Scale bar is 50 µm.



FIG. 3C: In solution, restriction enzymes cleave a reporter/inhibitor DNA duplex. The reporterDNA strand carrying methylene blue (blue circle) is then recruited to the surface of the electrode through duplex formation with conjugated captureDNA, bringing the electrochemical reporter molecule to the electrode surface.



FIG. 3D: Representative square wave voltammetry data showing the measured current with (black) and without (gray) restriction enzyme expression.



FIG. 3E: On-chip square wave voltammetry measurements in real-time as the restriction enzyme AciI is expressed.



FIG. 3F: Fold turn-on of measured peak current in the presence of restriction enzymes for each of the ten respective reporterDNA-captureDNA systems. Data was normalized to the measured current in the absence of DNA encoding each restriction enzyme, represented as dotted line.



FIG. 3G: Electrochemical reporterDNA-captureDNA systems were tested to evaluate cross-reactivity between respective restriction enzyme reporters. Values on heat map are average of triplicates at 30 min.



FIG. 3H: Using methylated DNA, fold turn-on from the co-expression of five restriction enzyme reporters in a single solution and measured on a single chip. Data was normalized to the measured current in the absence of DNA encoding each restriction enzyme, represented as dotted line. Data represents the mean ± SE of three replicates. All electrochemical measurements were performed with square wave voltammetry and peak current is used for calculation of fold turn-on.



FIG. 4A: Application of the gene-circuit electrochemical interface for small molecule- and RNA-actuated electrochemical signaling. Anhydrotetracycline (ATc)-mediated derepression of TetR-regulated TetO expression of the restriction enzyme-based reporter AciI (left). ATc-dependent induction (440 µM) of electrochemical signaling on-chip (right).



FIG. 4B: Toehold switches specific to synthetic RNA sequences were designed to control the expression of six different restriction enzyme-based reporters. RNA-dependent activation of toehold switches induces electrochemical signaling. Dotted line indicates switch alone negative controls. All electrochemical measurements were performed with square wave voltammetry and peak current is used for calculation of fold turn-on.



FIG. 5A: Detection of Mobilized Colistin Resistance (MCR) genes. Toehold switch-based RNA sensors were designed and screened for the detection of four MCR genes. Five separate experiments were performed on-chip in the presence of all components except the corresponding MCR-specific trigger RNA(s). The first four experiments (samples A-D) test the detection of single MCR-related RNAs (1 nM) based on the electrochemical response (Sample A: MCR-3 RNA trigger, Sample B: MCR-1 RNA trigger, Sample C: MCR-4 trigger and Sample D: MCR-2 trigger). Sample E tests the co-detection of MCR-3 and MCR-4 RNA triggers (1 nM each) in parallel. Data was normalized to the measured current in the absence of trigger RNA (5 µM). S refers to toehold switch, T refers to the corresponding trigger RNA. Graphs represent peak current for methylene blue. Data represents the mean ± SE of three replicates.



FIG. 5B: On-chip electrochemical signaling from activation of MCR-4_ClaI in the presence of MCR-4 RNA from complex whole cell RNA samples isolated from E. coli. Tested with a combination of inputs, the real-time signal is only detected in the presence of MCR-4 RNA and isothermal amplification. Cellular RNA was isolated from Dh5α E. coli cells in the presence or absence of a plasmid expressing MCR-4. All electrochemical measurements were performed with square wave voltammetry and peak current is used for calculation of fold turn-on. Switch, MCR-4_ClaI; Amp, NASBA with primers (+) or without primers (-). Data represents the mean ± SE of three replicates.



FIG. 6A. A direct molecular circuit-electrode interface as novel method for sensor outputs. The system comprises five main components Molecular circuit-based sensors which can include riboswitches, inducible transcription or guide RNA-based mechanisms. Upon activation of the sensors, these molecular circuits generate a nuclease-based reporter. FIG. 6B The target analyte of interest (e.g. RNA, DNA, small molecule) that is sensed by the molecular circuit-based sensor. FIG. 6C ReporterDNAs, which are the substrates of the nucleases generated by the sensors FIG. 6D The cell-free biochemical system that provides the necessary transcription and translation activity. FIG. 6E The electrode array chip which is used to host the captureDNA and measure the electrochemical response to binding of released reporterDNAs. Schematics represent various types of gene-circuits capable of sensing analytes such as nucleic acids and small molecules. First, gene-circuits can be designed to regulate translation of nucleases such as restriction enzymes using riboswitches (e.g. toehold switch) upon sensing specific target RNA analytes. Secondly, gene-circuits can also be designed to regulate expression of nucleases at the transcription level. The example represented here uses a transcriptional repressor that can depart and allow for proper transcription of specific nucleases in presence of a specific ligand (e.g. Tet repressor). Thirdly, CRISPR machinery can be used in combination with inducible guide RNAs that can be activated by either small molecule ligands3 or specific RNA sequences4 and guide Cas mediated cleavage in sequence specific manner.





SEQUENCE LISTING

This application contains a Sequence Listing in computer readable form created Oct. 10, 2019 having a size of about 51 kb. The computer readable form is incorporated herein by reference.





TABLE 1






Sequence Listing of Successfully Expressed Restriction Enzymes in a Cell-Free System codon optimized for E. coli expression and modified to remove self-cutting sequences)


SEQ ID NO:
GenBankID
Description




1
HQ327694
AciI


2
AF247972
AgeI


3
ADJ68010
AluI


4
HQ327698
ApaI


5
NZ_LCYI01000022
BamHI


6
HM569709
BanII


7
CP007640.1
BglII


8
AF522187
BpmI


9
HQ446231
BsaAI


10
EU386360
BsaHI


11
HQ636106
BstEII


12
JF323047
ClaI


13
DQ491002
CviQI


14
Y00449
DdeI


15
WP_081407150
EcoRI


16
P04390
EcoRV


17
NEBM150
HhaI


18
X54197
HincII


19
M22862
HinfI


20
JF432060
MscI


21
AF068761
NcoI


22
AY462277
NheI


23
DQ242471
NotI


24
AAA25673
PstI


25
Q53608
SalI


26
JF432057
SfoI


27
U44748
XmnI









TABLE 2








DNA sequences used for the electrochemical detection system


Enzyme
DNA Strand Type
5′ Modification
Sequence
3′ Modification




AciI
Capture
Thiol
CTAGCAGTACACCG (SEQ ID NO: 40)




Inhibitor

CTAGCAGAACACCGCGGTTCACGTCCG (SEQ ID NO: 41)




Reporter

CGGACGTGAACCGCGGTGTACTGCTAG (SEQ ID NO: 42)
Amine


BanII
Capture

GGCTCCTCGAGTATGC (SEQ ID NO: 43)
Thiol



Inhibitor

ACTGAGAACGTGGGGCTCCTCGAGTATGC (SEQ ID NO: 44)




Reporter
Amine
GCATACTCGAGGAGCCCCACGTTCTCAGT (SEQ ID NO: 45)



BglII
Capture
Thiol
GCTTGAGAACTAGATC (SEQ ID NO: 46)




Inhibitor

GCTTGAGAACTAGATCTAAGCACGTCCAGT (SEQ ID NO: 47)




Reporter

ACTGGACGTGCTTAGATCTAGTTCTCAAGC (SEQ ID NO: 48)
Amine


BsaAI
Capture
Thiol
CGTAGGGATCATAC (SEQ ID NO: 49)




Inhibitor

CGTAGGGATAATACGTGAGCTCACGTGCA (SEQ ID NO: 50)




Reporter

TGCACGTGAGCTCACGTATGATCCCTACG (SEQ ID NO: 51)
Amine


BstEII
Capture
Thiol
CACATCGTCATGGTGAC (SEQ ID NO : 52)




Inhibitor

CACATCGACATGGTGACCCGATGACCTCGC (SEQ ID NO: 53)




Reporter

GCGAGGTCATCGGGTCACCATGACGATGTG (SEQ ID NO: 54)
Amine


ClaI
Capture
Thiol
GCAACTGAACAATCG (SEQ ID NO: 55)




Inhibitor

GCAACTGTACAATCGATGACTCAGCACCG (SEQ ID NO: 56)




Reporter

CGGTGCTGAGTCATCGATTGTTCAGTTGC (SEQ ID NO: 57)
Amine


EcoRV
Capture
Thiol
TGCCTGGATTTGAT (SEQ ID NO: 58)




Inhibitor

TGCCTGGATTAGATATCCGTCGAGGAGAC (SEQ ID NO: 59)




Reporter

GTCTCCTCGACGGATATCAAATCCAGGCA (SEQ ID NO: 60)
Amine


HincII
Capture
Thiol
GTCGAGGTACTGTT (SEQ ID NO: 61)




Inhibitor

GTCGAGGTAATGTTGACGATCCTGAGCGA (SEQ ID NO: 62)




Reporter

TCGCTCAGGATCGTCAACAGTACCTCGAC (SEQ ID NO: 63)
Amine


NcoI
Capture
Thiol
CGAACACGTGACCATG (SEQ ID NO: 64)




Inhibitor

CGAACACGTGACCATGGTGCAGCATATGG (SEQ ID NO: 65)




Reporter

CCATATGCTGCACCATGGTCACGTGTTCG (SEQ ID NO: 66)
Amine


PstI
Capture
Thiol
AGGCATGTCACCTGCA (SEQ ID NO: 67)




Inhibitor

AGGCATGTCACCTGCAGGAGCTTCAGAAC (SEQ ID NO: 68)




Reporter

GTTCTGAAGCTCCTGCAGGTGACATGCCT (SEQ ID NO: 69)
Amine









TABLE 3







Synthetic Toehold Switch and Trigger Sequences for Unique Restriction Enzymes


SEQ ID NO:
Toehold Switch Name
SEQ ID NO:
Paired Reporter Enzyme




28
Switch 1
29
AciI


30
Switch 2
31
BanII


32
Switch 3
33
BstEII


34
Switch 4
35
ClaI/AciI


36
Switch 5
37
EcoRV


38
Switch 6
39
HincII






General Definitions

Headings, and other identifiers, e.g., (a), (b), (i), (ii), etc., are presented merely for ease of reading the specification and claims. The use of headings or other identifiers in the specification or claims does not necessarily require the steps or elements be performed in alphabetical or numerical order or the order in which they are presented.


The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one” but it is also consistent with the meaning of “one or more”, “at least one”, and “one or more than one”.


The term “about” is used to indicate that a value includes the standard deviation of error for the device or method being employed in order to determine the value. In general, the terminology “about” is meant to designate a possible variation of up to 10%. Therefore, a variation of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 % of a value is included in the term “about”. Unless indicated otherwise, use of the term “about” before a range applies to both ends of the range.


As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.


As used herein, the term “upstream molecular circuitry system” (also referred to as a gene circuit) refers to an engineered composition that comprises at least one nucleic acid material or construct and can perform a function including, but not limited to sensing, and a regulatory function. An input activates the upstream molecular circuitry system to produce an output. The nucleic acid material or construct (DNA, RNA) can be naturally occurring or synthetic. The upstream system can be a gene expression system wherein the system regulates transcription, translation or cleavage (e.g. synthetic RNA or DNA toehold switch-based sensor, an aptamer-based RNA or DNA switch-based sensor, an inducible transcription system, a riboregulated toehold-gated guide RNA (gRNA) switch-based sensor, or a system for generating a gRNA).


As used herein, the term “target molecule” refers to a small molecule or at least one nucleic acid material such as DNA or RNA.


As used herein, the term “activator” refers to an output produced by the upstream molecular circuitry system and includes, for example, a protein such as a nuclease, a CRISPR associated (Cas) protein, DNAs and RNAs that can cleave nucleic acids or any other molecule with specific nuclease activity. The protein can also be a restriction enzyme which is EcoRV, AciI, ClaI, BanII, BsaAI, BglII, BstEII, HincII, NcoI, or PstI or a Cas protein. The activator can also be a DNAzyme (e.g. deoxyribozyme or catalytic DNA) or RNAzyme (e.g. ribozyme or catalytic RNA). When used in the multiplex context, each activator (for example, restriction enzymes) are selected to provide orthogonal signalling. In certain embodiments, the activator comprises an enzyme (e.g. any oxidase, reductase, or oxidoreductase).


As used herein, the term “reporter system” refers to an engineered composition that is activated by the activator to produce or release a reporter molecule. For example, the reporter system can be a substrate for a nuclease generated by upstream molecular circuitry system.


As used herein, the term “reporter molecule” refers to a molecule (e.g. may be within the reporter system) that can be activated or produced by the activator or the upstream molecular circuitry system. For example, the reporter molecule could be a single-stranded DNA (reporterDNA) or a protein, such as an antibody or an antigen. In certain embodiments, the reporter molecule could be inactive in its bound state and could be released to its active state by an activator. For example, the reporterDNA could be hybridized to a complementary single-stranded DNA (iDNA) in its inactive state. In other embodiments, the reporter molecule can be coupled to a redox active molecule and can bind a capture molecule in its active state. The reporter molecule coupled to a redox active molecule can be referred to as a redox active reporter or redox active reporter molecule. In certain embodiments, the redox active reporter comprises an enzyme cofactor and is enzymatically produced. In other embodiments, the reporter molecule comprises an enzyme (e.g. any oxidase, reductase, or oxidoreductase).


As used herein, the terms “redox active molecule” or “electrochemically active molecule” refer to a molecule or chemical that experiences reduced or oxidized states, which is characterized by the transfer of electrons. For example, methylene blue.


As used herein, the terms “redox enzyme” refers to an enzyme that can catalyze electron transfer by reduction or oxidation of substrates within a redox reaction. For example, oxidases (e.g. glucose oxidase), reductases, or oxidoreductases.


As used herein, the terms “enzyme cofactor” (i.e. coenzyme), refers to small molecules that carry chemical groups between enzymes. In some embodiments, the enzyme cofactor carries and transfers electrons and functions as an oxidizing or reducing agent in redox reactions. For example, nicotinamide adenine dinucleotide (NADH) or flavin adenine dinucleotide (FADH).


As used herein, the term “capture molecule” refers to a molecule that is capable of binding a reporter molecule, and an electrode. For example, a capture molecule could be a single-stranded DNA (captureDNA) that is complementary to the reporter molecule, or an antigen or an antibody. In other embodiments, the capture molecule comprises an enzyme cofactor and is enzymatically produced to be redox active. In other embodiments, the capture molecule may comprise a redox active molecule. In other embodiments, the capture molecule may comprise a double stranded DNA that is able to recruit a catalytically inactive Cas protein. In this embodiment, either the Cas protein or gRNA can be modified with a redox active molecule or fused to a redox enzyme to create an electrochemical signal.


As used herein, “protein” or “polypeptide”, or any protein/polypeptide enzymes described herein, refers to any peptide-linked chain of amino acids, which may comprise any type of modification (e.g., chemical or post-translational modifications such as acetylation, phosphorylation, glycosylation, sulfatation, sumoylation, prenylation, ubiquitination, etc.). For further clarity, protein/polypeptide/enzyme modifications are envisaged so long as the modification does not destroy the desired enzymatic activity.


As used herein, the term “in vitro” refers to activities that take place outside an organism. In some embodiments, “in vitro” refers to activities that occur in the absence of cells.


As used herein, the term “cell-free” a used in “cell-free, detection system” refers to a set of biological components capable of providing for or supporting a biological reaction (e.g., transcription reaction, translation reaction, or both) in vitro in the absence of cells. Cell-free systems can be prepared using proteins, nucleic acid material and other subcellular components either isolated or purified from eukaryotic or prokaryotic cells, including recombinant cells, or prepared as whole extracts or fractions of cells.


As used herein, the term “electrode” refers to any electrode or electrochemical system that is sufficient for detecting the change in electrochemical potential when the reporter molecule specifically binds the capture molecule bound to the electrode. The electrode can be a nanostructured electrode, a non-nano structured electrode, a micro-patterned electrode, or an array thereof.


As used herein, the term “electrochemical signal” refers to the electric potential generated by a chemical messenger. For example, the electric potential generated by the chemical messenger or redox active molecule (e.g. methylene blue) could be measured by an electrode when in close proximity.


As used herein, the term “sample” means any sample comprising or being tested for the presence of one or more target molecule. Samples can include but are not limited to, small molecules, prokaryotic or eukaryotic cell-derived components such as nucleic acid material, proteins, or cellular extracts, extracellular fluid or fluid harvested from the body of a mammal, culture media, blood, plasma, and/or serum thereof.


As used herein, the term “small molecule” refers to a natural or synthetic molecule having a molecular mass of less than about 5 kD. For example, anhydrotetracycline (ATc).


As used herein, the term “transcriptional repressor” refers to a molecule that inhibits transcriptional activity. For example, a transcriptional repressor can be TetR, which binds and inhibits transcription of TetO. ATc may bind TetR and derepress transcription of TetO.


As used herein, the term “transcriptional activator” refers to a molecule that promotes or activates transcriptional activity.


As used herein, the term “computer” refers to an electronic device for storing and processing data, and capable of performing logic functions based on instructions given to it in an adjustable program.


As used herein, the term “portable” refers to a device, such as a computer, that can be held in one or two hands, without the need for any special carriers. In some embodiments, a portable can be used outside of a laboratory setting. In some embodiments, a portable device can be battery powered.


As used herein, the term “multiplex” refers to a system that allows for the simultaneous detection of a plurality of distinct target molecules in a single assay (e.g., at least 2, at least 6, at least 10, at least 20, at least 30 target molecules).


Other objects, advantages and features of the present description will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.


DETAILED DESCRIPTION

In one aspect, the present description relates to a direct interface between engineered molecular circuits and electronics. Interfacing in vitro synthetic biology with electronics will enable engineered gene networks to rapidly share data with computational tools, a feature that will drive more sophisticated and interactive diagnostics and embedded sensor applications. Importantly, this electrochemical interface also enables the large-scale multiplexing outputs from molecular circuit-based sensors. Reporter output from these networks has largely been optical, which has limited the potential to measure distinct, parallel signals.


In one aspect, the present description provides an electrochemical interface permitting multiplexed detection for cell-free synthetic gene networks.


In one aspect, the present description provides a scalable system of reporter enzymes that release a modified DNA strand, resulting in recruitment of a redox reporter molecule to the surface of a nanostructured microelectrode and an increase in measured current.


In one aspect, the molecular circuitry system described therein can be used to detect target molecules such as small molecules, DNA, RNA, and proteins, including the detection of multiple antibiotic resistance genes in parallel. This technology has potential for expanding the integration between synthetic biology applications (sensing) and hardware, software, and machine learning.


In one aspect, the molecular circuitry system comprises one or more different switch-based sensors, specific for different target molecules. In some aspects, the switch-based sensor is a toehold RNA switch-based sensor. In some aspects, the target molecule is RNA within a sample and can bind a toehold RNA switch comprising an mRNA sequence encoding a protein. Upon RNA binding, the toehold RNA switch linearizes and the mRNA is translated into said protein. In some aspects, the protein is an activator or is the reporter molecule. In some aspects, the protein is a nuclease. In some aspects, the nuclease is a restriction enzyme. In some aspects, the restriction enzyme is from the list of EcoRV, AciI, ClaI, BanII, BsaAI, BglII, BstEII, HincII, NcoI, or PstI. In some aspects, the nuclease is a Cas protein. In some aspects, the restriction enzyme is specific for a reporter molecule, which is a single stranded DNA strand referred to as reporterDNA. In some aspects, the reporterDNA is inactive when hybridized to a complementary inhibitory single-stranded DNA strand referred to as iDNA. In some aspects, the reporter molecule or reporterDNA comprises a redox active molecule, referred to as a redox active reporter. In some aspects, the restriction enzyme or nuclease specifically cleaves the reporterDNA/iDNA complex, thereby releasing the reporterDNA. In some aspects, a series of electrodes are coupled to a corresponding capture molecule. In some aspects, the capture molecule is a single-stranded DNA strand specific for a reporterDNA. In some aspects, the captureDNA binds the released or active reporterDNA. In some aspects, an electrode detects an electrochemical signal generated by the electric potential of the redox active molecule that is bound to the reporterDNA. In other aspects, the activator or the reporter molecule comprises enzyme that could any oxidase, reductase, or oxidoreductase. In some aspects, the reporter molecule or reporterDNA comprises an enzyme cofactor. In some aspects, the enzyme produces a redox active reporter. In some aspects, the oxidase, reductase, or oxidoreductase enzymes are fused to Cas protein and recruited to the capture molecule on the surface. In other aspects, the RNA toehold switch encodes an RNAzyme.


In one aspect, the target molecule is DNA within a sample and can bind a toehold DNA switch comprising a DNA sequence encoding an mRNA, gRNA, or RNAzyme. In some aspects, the mRNA is translated into a protein, which can be the reporter molecule or an activator that activates a reporter molecule. In other aspects, the transcribed gRNA is bound by a Cas protein, which can activate a reporter molecule. In other aspects, the DNA sequence encodes a DNAzyme, that can activate a reporter molecule.


In one aspect, the target molecule is RNA within a sample and can bind a riboregulated toehold-gated guide RNA (gRNA) switch-based sensor. In some aspects, the gRNA is exposed and can be bound by a Cas protein. In some aspects, the gRNA is specific for a reporterDNA. In some aspects, the Cas-gRNA complex binds and cleaves the reporterDNA/iDNA complex, thereby releasing and activating the reporterDNA.


In one aspect, aptamer switch-based sensors detect certain target molecules within a sample. In some aspects, the aptamer switches detect specific molecules like proteins or small molecules. In some aspects, the aptamer is DNA-based. In other aspects, the aptamer is RNA-based. In some aspects, the aptamer is fused to a DNA or RNA sequence. In some aspects, upon aptamer binding of a specific molecule, DNA can be transcribed into an RNA sequence, which could be an mRNA, gRNA, or RNAzyme. In some aspects, the mRNA is be translated into a protein, which is the reporter molecule or is an activator that can activate a reporter molecule. In other aspects, the transcribed gRNA is bound by a Cas protein, which can activate a reporter molecule. In other aspects, the DNA sequence encodes a DNAzyme, that can activate a reporter molecule.


In one aspect, the target molecule is small molecule within a sample and can activate an inducible transcription system by binding a transcriptional activator or transcriptional repressor. In some aspects, the inducible transcription system encodes an mRNA, gRNA, or RNAzyme. In some aspects, the mRNA is translated into a protein, which is the reporter molecule or is an activator that can activate a reporter molecule. In other aspects, the transcribed gRNA is bound by a Cas protein, which can activate a reporter molecule. In other aspects, transcribed gRNA is not bound to Cas protein in its inactive state (e.g. riboregulated guide RNAs); however, upon activation by target sequence (e.g. pathogen RNA) the gRNA becomes available to bind to the Cas protein and generate an electrochemical signal.


In one aspect, by amalgamating programmable molecular circuit-based sensors with electrochemical detection, the molecular circuitry system as described herein is adaptive, broadly capable and has the potential to allow 5-10 multiplexed sensors to operate with parallel but distinct signals.


In some aspects, the electrode-bound capture molecule is coupled to an enzyme cofactor. In some aspects, the activator/reporter molecule comprises an enzyme that could be any oxidase, reductase, or oxidoreductase and can produce a redox active capture molecule. In other aspects, the redox active reporter molecule continuously produces an electrochemical signal detected by the electrode. In some aspects, the activator/reporter molecule that is an enzyme can inhibit the detection of the electrochemical signal by the electrode.


In one aspect, the electrode-bound capture molecule could be an aptamer DNA or RNA and is coupled to a redox active molecule. In some aspects, the electrochemical signal is continuously detected by the electrode. In some aspects, the reporter molecule/activator can bind the aptamer and inhibit detection of the electrochemical signal.


Using DNA-functionalized nanostructured microelectrodes as electrochemical detectors (26,32), the activation of molecular circuits is linked to specifically paired electrodes through the expression of orthogonal reporters (see FIG. 1). Sequence-specific and scalable, this approach uses the production of restriction enzyme-based reporters to catalyze the release of methylene blue-labelled ssDNA (reporterDNA), which in turn interacts with complementary ssDNA (captureDNA) conjugated to the electrode surface. Upon hybridization of reporterDNA with captureDNA, methylene blue, a redox reporter molecule, is brought in close proximity to the electrode surface, allowing for a large increase in the measured current at that electrode (22,27). It is this conversion of molecular circuit-based sensor activation into sequence-specific DNA interactions that enables distinct and multiplexed signals to operate without crosstalk. Here, we demonstrate the power of this new electrochemical interface by detecting the activation of rationally designed toehold-switch-based RNA sensors, a small-molecule actuated synthetic gene network and demonstrate the multiplexed detection of colistin antibiotic resistance genes.


In one aspect, upon activation of the upstream system by a target molecule, nanostructured microelectrodes recruit the reporter molecule to their surface (e.g. redox-active reporterDNA through complementary binding to captureDNA), generating an electrochemical signal. Each sensor system is engineered to produce a unique activator or reporter molecule (e.g. nuclease with sequence-specific cleavage activity that is coupled to a distinct reporter system and capture molecule (e.g. reporter DNA molecule specific - capture DNA pair) for multiplexed signaling.


In one aspect, the detected electrochemical signals, or change thereof, by the electrodes are transmitted to a processing device, such as a computer. In some aspects, the signals are analyzed by computer-implemented methods such as software. In some aspects, the signals are converted into rich data sets, that may also be used for machine learning applications.


Taken together, the present description provides a series of proof-of-concept experiments for a direct and scalable interface between engineered molecular circuits and electronics. Interfacing cell-free synthetic biology with electronics will enable engineered gene networks to curate mixed molecular information and rapidly share data with computational tools, a capability that promises to drive more sophisticated and interactive applications. Potential uses include high-content multiplexing systems for decentralized sensing in health, agriculture, national security and industry, among others. Using low-cost electronics, ultimately, we envision this interface to enable dozens of diagnostics to operate for the cost of a single test in our current colorimetric format (<$1/test) (15). Moreover, by simply modifying the upstream molecular sensor elements in the system, the same reporter enzyme-electrode pairs can be left unchanged, along with common microelectrode hardware, to, in principle, serve any sensor application. Toehold switches can be rationally designed (35) and therefore the platform can be tailored to detect virtually any nucleic acid sequence. The stable and biosafe nature of the cell-free format also means that the technology can be used without the limitations of cellular systems, potentially enabling new applications and operating environments outside of the laboratory.


This approach also holds exciting technical implications for the field of synthetic biology. First, this work highlights the potential for chemistry to enable and mediate signaling for synthetic gene networks, creating a much-needed mechanism for increasing the bandwidth of sensor outputs. This contrasts with conventional reporters, which are optical and have a limited capacity for multiplexing (9,15). While sensing arrays can be contemplated for optical detection (e.g. microarrays), the complexity of these devices and the optics needed for detection are major disadvantages. Second, tackling another key challenge in the field, here we demonstrate that rather than having to encode decision making and memory features genetically into molecular circuits, we can off-load these features to attached electronics. The system continues to take advantage of biology’s incredible capacity to sense, but has the potential to dramatically reduce the time needed to develop synthetic biology applications. With this approach, the underlying connectivity of sensory outputs can be re-programmed at will, easily creating any number of logic calculations (e.g. AND gates, etc.) by simply modifying the code at the level of the software rather than at the level of the DNA. Looking forward, we see this bio-electrochemical approach as providing the field a new enabling venue and one that provides new opportunities for even greater interdisciplinarity and rational design of chemical and biological systems.


EXAMPLES
Example 1: Materials and Methods
1.1 Chip Fabrication

Microelectrode patterns including reference, counter, and working electrodes were generated using standard contact photolithography techniques from glass substrates layered with chrome, gold, and with or without positive photoresist (AZ1600) obtained from Telic Company or EMF. The working electrodes were nanostructured using electrodeposition in solution of 50 mM AuCl3 in 0.5 M HCl. Standard three-electrode system with an Ag/AgCl reference electrode and a platinum counter electrode was set up at constant potential of 0 mV for 100 s using Bioanalytical Systems Epsilon potentiostat (West Lafayette, IN, USA). Finally, 100 µm high PDMS channels were fabricated and bonded to chips using standard soft lithography techniques.


1.2 CaptureDNA Deposition

CaptureDNA strands were obtained from Integrated DNA Technologies containing a 6-carbon linker with a terminal thiol. Final concentrations of 10.5 µM of captureDNA along with 5 µM mercaptohexanol (MCH) were deposited on nanostructured working electrodes, and incubated in a humid environment at room temperature for approximately 14 hr. In order to deposit multiple DNA capture strands on a single chip, Dowsil™ 3145 RTV silicone adhesive sealant (Dowsil, Midland, Michigan, USA) was used to create separate chambers for DNA deposition, and the glue was removed after overnight incubation with the DNA solutions. Chips were then washed 3x with 1x PBS. A solution of 1 mM MCH was added to cover the working electrodes of each chip to backfill any gold surface and prevent nonspecific interaction. After incubation for 3 hr at room temperature, chips were washed 3x with 1x Phosphate-Buffered Saline, pH 7.4 (PBS), then rinsed with ddH2O and dried under a stream of N2.


1.3 Reporter DNA Preparation

ReporterDNA was ordered from Integrated DNA Technologies with a terminal amine, which was used for labeling with a methylene blue NHS Ester (Glen Research, Sterling, VA, USA) according to manufacturer’s protocol. Labeled DNA was then purified using reverse phase HPLC, dried via lyophilization, and re-dissolved in 1x PBS. Then reporter and inhibitor DNA strands were annealed at ratio of 1:4 (for initial proof-of-concept experiments) or 1:10 (for multiplexed experiments) in 1x PBS incubated at 95° C. for 4 min. The solutions were then cooled slowly to room temperature.


1.5 Cell-Free Expression of Restriction Enzymes

All experiments were performed using the recombinant cell-free protein expression system (CFS), PURExpress™ (E6800S, NEB, Ipswich, MA, USA) following manufacturers procedures with an additional 0.5% by volume RNAse inhibitor (M0314S, NEB). All DNA constructs and gene-circuits were designed to be compatible with this cell-free system. Restriction enzyme expression reactions were assembled using 10 nM linear DNA encoding for the restriction enzyme in CFS. To measure restriction enzyme expression and activity electrochemically, the reporterDNA-iDNA complex was added to a final concentration of 100-280 nM reporterDNA. If measurements were to be made in real-time, the solution was then added directly to the electrochemical chips for measurement during incubation at 37° C. Unless otherwise stated, the reactions were incubated at 37° C. for 1 hr before addition to chips. The reactions were then incubated on the chips for 15-30 min at 37° C. before electrochemical measurements were obtained.


For the restriction enzyme co-expression experiments, we took advantage of the methyl sensitivity of AciI, BsaAI, and HincII. The coding DNA sequences for AciI, ClaI, and EcoRV were methylated to protect against cross cleavage by, BsaAI/HincII, BsaAI, and AciI respectively by combining 10 units of CpG methyltransferase (#M0226M, NEB) with 4 µg of linear DNA at 37° C. overnight in 100 µl 1x NEBuffer™ 2 (NEB). The methylated product was purified using QIAquick™ Spin Columns (#28104, Qiagen, Germantown, Maryland, USA). 30 nM of either methylated (AciI, ClaI, EcoRV) or non-methylated (BsaAI, HincII) coding sequences were used for co-expression and results monitored electrochemically as described above (FIG. 3H). RNA MCR switches with concentrations of 200 nM MCR1-EcoRV, 25 nM MCR2-AciI, 250 nM MCR3-BanII, and 100 nM MCR4-ClaI were used for multiplexed electrochemical experiments. Here, final concentrations of 1 nM RNA trigger sequences and 100 nM reporterDNA were also added to the CFS (FIG. 5A).


1.6 Electrochemical Measurements

All measurements were performed using either a Bioanalytical Systems Epsilon potentiostat or a PalmSens PSTrace™ potentiostat, both with a three-electrode system. An on-board gold reference electrode was used in addition to a platinum wire auxiliary electrode. The multiplex chip was designed to house both an on-board gold reference and counter electrodes. Square wave voltammetry (SW) signals were obtained with a potential pulse step of 1 mV at a frequency of 60 Hz and an amplitude of 25 mV, with measurements taken from 100 to 450 mV.


1.7 Toehold Switch-based Design and Multiplexed Sensing of MCR Antibiotic Resistances

A series of toehold switches recognizing synthetic target sequences were used to build toehold-based gene-circuits14 (Table 3). Briefly, each toehold switch was constructed separately with multiple restriction enzymes by overlap extension PCR using the primers. For each construct, both the toehold switch sequence and reporter enzyme were amplified with PCR primers to add ~20 nucleotides that overlap between the two sequences. The overlapping region allows for attachment of the switch to reporter in the second round of PCR using forward and reverse primers. The activity of these toehold switch-based sensors was tested and screened for performance using MB fluorescence assays as described above. Top performing switches were then tested using electrochemical assays. Here reactions for restriction enzyme expression were assembled as described previously in CFS, containing 10 nM linear DNA coding for the respective restriction enzyme under switch-molecular circuit control and 1 µM trigger RNA. Reactions were incubated at 37° C. for 1 hr before adding to electrochemical detection chips, where they were then incubated for 20-60 min before measuring current (FIG. 4B). Trigger RNA was produced in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB).


For proof of concept experiments (FIG. 4B) cell-free reactions were set up as described above supplied with 10 nM DNA toehold switches. For multiplexed MCR detection, switches were supplied as RNA, with concentrations of 200 nM MCR-1_EcoRV, 25 nM MCR-2_AciI, 250 nM MCR-3_BanII, and 100 nM MCR-4_ClaI. Respective switches were triggered by 1 nM RNA trigger sequences in presence of 100 nM reporterDNA (FIG. 5B).


Example 2: Screening for High-Performing Restriction Enzyme-Based Reporters

The creation of this electrochemical approach to gene circuit-based sensor signaling required that we first identify a set of restriction enzymes capable of rapid and robust performance. We screened 66 commercially available restriction enzymes for cleavage activity under buffer conditions required for the cell-free transcription and translation system (FIG. 2A, B) (11). The ability of restriction enzymes to cleave target DNA was evaluated using gel electrophoresis. The commercially available PURExpress cell-free system (NEB) was selected for experiments because of its recombinant nature, meaning that it is free from background nuclease activity. Of the 37 restriction enzymes that were capable of cleavage, DNA sequences encoding for 26 restriction enzymes were designed and proteins were successfully expressed upon transcription by T7 RNA polymerase (RNAP) in the cell-free system (Table 1) After a three-hour expression period, restriction enzyme activity was tested using gel-electrophoresis-based analysis.


Given that restriction enzyme expression and processivity are critical for reporter performance, we developed a fluorescence-based molecular beacon assay to monitor DNA cleavage in real-time as the restriction enzymes were expressed in vitro. The hairpin-based molecular beacons contain a DNA recognition site for each of the respective restriction enzymes and are designed with a 5′ FAM-6 fluorophore and a 3′ BHQ-1 quencher (FIG. 2C) (33). Upon restriction-enzyme-mediated cleavage, the FAM-6 fluorophore is released, allowing for tracking of enzyme activity over time. De novo expression of candidate restriction enzymes resulted in significant cleavage activity by six restriction enzymes as early as fifteen minutes (AciI, BanII, BsaAI, BstEII, ClaI, EcoRV) and by others at later time points (HincII, BglII, NcoI, PstI). The orthogonality of these ten restriction enzymes was then tested by expressing each enzyme in the presence of all ten respective molecular beacons individually. Results indicated good orthogonality, with little crosstalk between restriction enzymes (FIG. 2D).


Example 3: Electrochemical Detection of Restriction Enzyme-Activated Redox Reporters

With a set of restriction enzymes established, we next developed the companion electrode and redox reporter systems. Each chip contains an array of fifteen micropatterned electrodes arranged in five sets of three, which were prepared using standard photolithography techniques (FIG. 3A, B). Briefly, gold electrodes were patterned on a glass wafer, followed by a layer of photoresist, to create six 400 µm x 20 µm openings over each electrode and to prevent nonspecific interactions. Electrodeposition in a gold chloride solution was then employed to create nanostructured microelectrode topologies, which were found to provide optimal speed of detection and sensitivity (34). Nanostructured electrodes were tested over time and found to perform stably, with little decrease in current, when stored under ambient atmosphere, humidity and temperature. After electrode preparation, captureDNA complementary to the reporterDNA for each restriction enzyme was conjugated to each of the five triplicate electrode sets via a terminal thiol group; 6-mercaptohexanol (MCH) was added as a co-adsorbent to minimize electrostatic repulsion on the electrode surface (Table 2).


Release of the complementary reporterDNA is catalyzed by restriction enzyme-dependent cleavage of free-floating DNA duplexes in cell-free reactions (FIG. 3C). These stable DNA duplexes are comprised of a full-length reporterDNA strand and a complementary inhibitor DNA strand (iDNA), which prevents interaction with electrodes in the absence of cleavage. Conversely, upon duplex cleavage, the truncated reporterDNA is designed to hybridize with captureDNA and bring the terminal methylene blue label to the electrode surface, enabling electron transfer to create a restriction enzyme-dependent electrochemical signal (FIG. 3D). The preference of the truncated reporterDNA for the captureDNA is driven by mismatched base pairing with the iDNA, which leads to greater relative stability (higher melting temperature, ΔG) when hybridized to on-chip captureDNA. As in the molecular beacon assay, restriction enzyme specificity results from recognition of sequence-specific DNA cleavage sites, and electrochemical detection requires conjugation of the complementary captureDNA on the electrode surface.


Using T7-RNAP expression, we showed that the restriction enzyme-mediated electrochemical signal can be detected in as little as 20 minutes after transcription initiation using square wave voltammetry (FIG. 3E). We next determined that this model of restriction enzyme-mediated signaling is scalable with the demonstration of ten restriction enzyme-electrode pairs (FIG. 3F). Here expression constructs for each restriction enzyme were combined in cell-free reactions with their respective reporterDNA duplexes (reporter DNA-iDNA) and electrodes containing one of the ten captureDNA strands. After a 1 hour off-chip reaction incubation at 37° C., all ten pairs led to significant electrochemical signal fold change at 30 minutes once applied to the electrodes. The orthogonality of all ten restriction enzymes was then tested by repeating the expression of each enzyme in the presence of all ten reporterDNA duplexes individually. The resulting electrochemical signaling demonstrated strong orthogonality and little crosstalk (FIG. 3G). A subset of these restriction enzymes could also be co-expressed in a single reaction mixture to generate clear electrochemical signals on chip. In this experimental set-up, all five restriction enzyme expression constructs and their corresponding reporterDNA duplexes were combined in a single cell-free reaction volume (FIG. 3H, left). When expressing multiple restriction enzymes in a single pot, it is important to ensure that enzymes are not cross-reactive towards the DNA encoding the respective restriction enzymes. To address this, restriction enzyme expression here was performed using methylated DNA to prevent restriction enzyme-mediated cleavage, (FIG. 3H) and, alternatively, by modifying their DNA sequences to remove restriction enzyme cleavage sites. These strategies effectively limited cross-reactivity and broaden the pool of restriction enzymes that could be used as reporters. With reporter validation complete, we now refer to these restriction enzymes simply as reporter enzymes.


Example 4: Electrochemical Detection of Molecular Circuit-Driven Expression: TetO and Toehold Switches

With the fundamental components for the electrochemical interface complete, we next developed applications to demonstrate electronic sensing of molecular circuit activation. We began with TetO-regulated expression of a reporter enzyme (FIG. 4A). TetO is a 19 bp operon sequence that can be placed between a promoter and an upstream (5′) of a gene of interest to provide tetracycline-responsive expression. In this system, transcription is regulated through Tet repressor (TetR) binding to the T7-TetO promoter region, which inhibits transcription, and the small molecule tetracycline analog anhydrotetrcycline (ATc), which relieves this inhibition (FIG. 4A, left). By placing the reporter enzyme AciI under TetO regulation, we were able to demonstrate the corresponding activation and inhibition of electrochemical signaling in the presence and absence of Atc, respectively (FIG. 4A, right). These signals corresponded closely with positive and negative controls.


The multiplexed linkage of molecular circuits to electronics has the potential to enable automated and high-capacity biosensing. We have previously demonstrated that toehold switches can be designed to recognize specific RNA sequences and that these RNA sensors can be used to identify the presence of pathogens (14,15). To explore the potential of multiplexing such sensing capacity, we used six toehold switches designed to recognize six synthetic model sequences (Table 3) (35). Cell-free reactions containing a toehold switch, with or without its respective RNA trigger sequence, were monitored electrochemically at 37° C. on microelectrode arrays containing the complementary captureDNA and free floating reporterDNA duplex. This resulted in the sequence-specific RNA activation of toehold switches and electrochemical outputs that ranged from 7- to 30-fold (FIG. 4B) compared to background. The fold change values represent maximum signal between 60 and 90 minutes, with significant signals observable in as little as 15-20 minutes. Importantly, as previously demonstrated (14, 35), the performance of riboregulators is switch-dependent, and here we show that this signal can also be modulated by the choice of reporter enzyme, providing a further layer of engineering control.


Example 5: Application to Detection of Colistin Antibiotic Resistance Genes

The overuse of antibiotics has given rise to the growing threat of drug resistance. With the vast majority of antibiotic use related to agricultural settings, farms represent a significant risk for the emergence of resistance (36,37). Here we developed toehold switch-based sensors specific to the coding regions of resistance genes for the key last-line antibiotic colistin (MCR-1, MCR-2, MCR-3 and MCR-4). These genes have recently been identified in livestock globally and represent a dangerous threat to the efficacy of an antibiotic of last resort.


Using a purpose-built algorithm for toehold switch design (15), each MCR gene was computationally screened for regions of low structural complexity that could be targeted by toehold switches. We then synthesized toehold switch designs complementary to the 24 top ranked binding sites within each MCR gene and ligated a unique reporter enzyme gene to each set of switches (MCR-1_EcoRV, MCR-2_AciI, MCR-3_BanII, MCR-4_ClaI). Reporter enzyme selection was based on the speed of DNA cleavage in time course assays (FIG. 2C). The performance of the resulting 96 sensors was then screened against their respective RNA sequences for optimal ON/OFF ratios using molecular beacons. Top performing sensors were then validated on microelectrode arrays. With the activity of each MCR sensor linked to a unique reporter enzyme, we first demonstrated that the corresponding electrode array for all four MCR genes can detect each gene independently (FIG. 5A, samples A-D). Each of the MCR RNAs (1 nM, samples A-D) were added to four cell-free reactions each containing one set of the toehold sensors (MCR-1_EcoRV, MCR-2_AciI, MCR-3_BanII, MCR-4_ClaI) and corresponding reporterDNAs, and incubated for 30 minutes off-chip at 37° C. After separate incubation, the four reactions were pooled together on-chip (e.g. samples A, B, C and D) for incubation at 37° C. The electrochemical response for each of the four MCR genes individually provided a clear signal enhancement of ~20-fold (50 min). We then demonstrated that this capacity could be multiplexed, enabling the specific and simultaneous detection of RNA sequences from MCR-3 and MCR-4 (FIG. 5A).


As with other cell-free sensors (15,20), we next used isothermal amplification (1 hour) to specifically amplify target sequences before adding the sample to cell-free reactions containing toehold sensors. The limit of detection (LOD) without an amplification step was determined through on-chip sensing of MCR-1 at RNA concentrations between 10 nM and 150 nM using 200 nM MCR-1_EcoRV switch following the experimental design described above. These measurements yielded a calculated LOD of 64.5 nM. With the addition of a Nucleic Acid Sequence Based Amplification (NASBA) step upstream of the electrochemical workflow, we were able to extend the detection of the antibiotic resistance gene MCR-4 to the low femtomolar range (1 fM), an improvement of many orders of magnitude (-107). In these experiments, MCR-4 RNA at 1 fM was added to a NASBA reaction (1 hr) and this amplified RNA was then added to cell-free reactions at 14% of total cell-free reaction volume. Here the combined workflow led to a robust increase in electrochemical signal on-chip after 120 minutes of incubation at 37° C. This level of performance compares well with the turnaround time and sensitivity of other recently published cell-free synthetic biology-based detection schemes (2-3 hours) (15,38).


Finally, with a long-term goal of applying this approach to the interrogation of real-world samples, we wanted to determine the capacity of our on-chip detection for more complex samples. Here the MCR-4 gene was expressed in E. coli and then total RNA was collected from the resulting culture. In total, cellular RNA was added to the NASBA reaction (1 hr) at concentration of 30 ng/µl for isothermal amplification using MCR-4 specific primers. The amplified MCR-4 mix was added without purification to the cell-free reactions containing (MCR-4_ClaI switch), followed by 30 minutes of off-chip, and 15 minutes of on-chip incubation at 37° C. prior to taking the first electrochemical measurement (FIG. 5B). Electrochemical activation of the system was specific to MCR-4 RNA in the presence of high background off-target RNA sequences and provided a strong, distinct signal against negative controls.


REFERENCES



  • 1. Cameron, D. E., Bashor, C. J. & Collins, J. J. A brief history of synthetic biology. Nat. Rev. Microbiol. 12, 381-90 (2014).

  • 2. Cheng, A. A. & Lu, T. K. Synthetic biology: an emerging engineering discipline. Annu. Rev. Biomed. Eng. 14, 155-78 (2012).

  • 3. Fossati, E. et al. Reconstitution of a 10-gene pathway for synthesis of the plant alkaloid dihydrosanguinarine in Saccharomyces cerevisiae. Nat. Commun. 5, 3283 (2014).

  • 4. Smanski, M. J. et al. Synthetic biology to access and expand nature’s chemical diversity. Nat. Rev. Microbiol. 14, 135-49 (2016).

  • 5. Green, A. A. et al. Complex cellular logic computation using ribocomputing devices. Nature 548, 117-121 (2017).

  • 6. Yehl, K. & Lu, T. Scaling Computation and Memory in Living Cells. Curr. Opin. Biomed. Eng. 4, 143-151 (2017).

  • 7. Kitada, T., DiAndreth, B., Teague, B. & Weiss, R. Programming gene and engineered-cell therapies with synthetic biology. Science 359, eaad1067 (2018).

  • 8. Mao, N., Cubillos-Ruiz, A., Cameron, D. E. & Collins, J. J. Probiotic strains detect and suppress cholera in mice. Sci. Transl. Med. 10, eaao2586 (2018).

  • 9. Kotula, J. W. et al. Programmable bacteria detect and record an environmental signal in the mammalian gut. Proc. Natl. Acad. Sci. U. S. A. 111, 4838-43 (2014).

  • 10. Keasling, J. D. Synthetic biology and the development of tools for metabolic engineering. Metab. Eng. 14, 189-95 (2012).

  • 11. Shimizu, Y. et al. Cell-free translation reconstituted with purified components. Nat. Biotechnol. 19, 751-755 (2001).

  • 12. Jewett, M. C., Calhoun, K. A., Voloshin, A., Wuu, J. J. & Swartz, J. R. An integrated cell-free metabolic platform for protein production and synthetic biology. Mol. Syst. Biol. 4, 220 (2008).

  • 13. Shin, J., Jardine, P. & Noireaux, V. Genome replication, synthesis, and assembly of the bacteriophage T7 in a single cell-free reaction. ACS Synth. Biol. 1, 408-413 (2012).

  • 14. Pardee, K. et al. Paper-based synthetic gene networks. Cell 159, 940-954 (2014).

  • 15. Pardee, K. et al. Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell 165, 1255-1266 (2016).

  • 16. Pardee, K. et al. Portable, On-Demand Biomolecular Manufacturing. Cell 167, 248-259.e12 (2016).

  • 17. Huang, A. et al. BioBitsTM Explorer: A modular synthetic biology education kit. Sci. Adv. 4, eaat5105 (2018).

  • 18. Stark, J. C. et al. BioBitsTM Bright: A fluorescent synthetic biology education kit. Sci. Adv. 4, eaat5107 (2018).

  • 19. Wen, K. Y. et al. A Cell-Free Biosensor for Detecting Quorum Sensing Molecules in P. aeruginosa -Infected Respiratory Samples. ACS Synth. Biol. 6, 2293-2301 (2017).

  • 20. Takahashi, M. K. et al. A low-cost paper-based synthetic biology platform for analyzing gut microbiota and host biomarkers. Nat. Commun. 9, 3347 (2018).

  • 21. Alligrant, T. M., Nettleton, E. G. & Crooks, R. M. Lab on a Chip Electrochemical detection of individual DNA. Lab Chip 349-354 (2013). Doi:10.1039/c21c40993c

  • 22. Fan, C., Plaxco, K. W. & Heeger, A. J. Electrochemical interrogation of conformational changes as a reagentless method for the sequence-specific detection of DNA. Proc. Natl. Acad. Sci. 100, 9134—9137 (2003).

  • 23. Khan, H. U. et al. In situ, label-free DNA detection using organic transistor sensors. Adv. Mater. 22, 4452-4456 (2010).

  • 24. Patolsky, F., Lichtenstein, A. & Willner, I. Detection of single-base DNA mutations by enzyme-amplified electronic transduction. Nat. Biotechnol. 19, 253-257 (2001).

  • 25. Slinker, J. D., Muren, N. B., Gorodetsky, A. A. & Barton, J. K. Multiplexed DNA-modified electrodes. J. Am. Chem. Soc. 132, 2769-74 (2010).

  • 26. Das, J. et al. An ultrasensitive universal detector based on neutralizer displacement. Nat. Chem. 4, 642-8 (2012).

  • 27. Zuo, X., Xiao, Y. & Plaxco, K. W. High Specificity, Electrochemical Sandwich Assays Based on Single Aptamer Sequences and Suitable for the Direct Detection of Small-Molecule Targets in Blood and Other Complex Matrices. J. Am. Chem. Soc. 131, 6944-6945 (2009).

  • 28. Kuang, Z., Kim, S. N., Crookes-goodson, W. J., Farmer, B. L. & Naik, R. R. Biomimetic Chemosensor : Designing Peptide Recognition Elements for Surface Functionalization of Carbon Nanotube Field Effect Transistors. ACS Nano 4, 452-458 (2010).

  • 29. Liu, H., Xiang, Y., Lu, Y. & Crooks, R. M. Aptamer-Based Origami Paper Analytical Device for Electrochemical Detection of Adenosine. Angew. Chemie Int. Ed. 51, 6925-6928 (2012).

  • 30. Das, J. & Kelley, S. O. Protein Detection Using Arrayed Microsensor Chips: Tuning Sensor Footprint to Achieve Ultrasensitive Readout of CA-125 in Serum and Whole Blood. Anal. Chem. 83, 1167-1172 (2011).

  • 31. Tang, D., Yuan, R. & Chai, Y. Ultrasensitive Electrochemical Immunosensor for Clinical Immunoassay Using Thionine-Doped Magnetic Gold Nanospheres as Labels and Horseradish Peroxidase as Enhancer. Anal. Chem. 80, 1582-1588 (2008).

  • 32. Sage, A. T., Besant, J. D., Lam, B., Sargent, E. H. & Kelley, S. O. Ultrasensitive electrochemical biomolecular detection using nanostructured microelectrodes. Acc. Chem. Res. 47, 2417-25 (2014).

  • 33. Li, J. J., Geyer, R. & Tan, W. Using molecular beacons as a sensitive fluorescence assay for enzymatic cleavage of single-stranded DNA. Nucleic Acids Res. 28, E52 (2000).

  • 34. Soleymani, L., Fang, Z., Sargent, E. H. & Kelley, S. O. Programming the detection limits of biosensors through controlled nanostructuring. Nat. Nanotechnol. 4, 844-848 (2009).

  • 35. Green, A. A., Silver, P. A., Collins, J. J. & Yin, P. Toehold switches: de-novo-designed regulators of gene expression. Cell 159, 925-939 (2014).

  • 36. Zhang, J. et al. Molecular detection of colistin resistance genes (mcr-1, mcr-2 and mcr-3) in nasal/oropharyngeal and anal/cloacal swabs from pigs and poultry. Sci. Rep. 8, 3705 (2018).

  • 37. Garcia, V. et al. Co-occurrence of mcr-1, mcr-4 and mcr-5 genes in multidrug-resistant ST10 Enterotoxigenic and Shiga toxin-producing Escherichia coli in Spain (2006-2017). Int. J. Antimicrob. Agents 52, 104-108 (2018).

  • 38. Gootenberg, J. S. et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 356, 438-442 (2017).

  • 39. 3Karig DK, Iyer S, Simpson ML, Doktycz MJ. Expression optimization and synthetic gene networks in cell-free systems. Nucleic Acids Res. 40, 3763-3774 (2012).

  • 40. J. N. Zadeh, C. D. Steenberg, J. S. Bois, B. R. Wolfe, M. B. Pierce, A. R. Khan, R. M. Dirks & N. A. Pierce, “NUPACK: Analysis and design of nucleic acid systems,” Journal of computational chemistry 32, 170-173 (2011).

  • 41. Davis JH, Rubin AJ, Sauer RT. Design, construction and characterization of a set of insulated bacterial promoters. Nucleic Acids Res. 2011;39(3):1131-41. 10.1093/nar/gkq810


Claims
  • 1-17. (canceled)
  • 18. A detection system comprising: a. an upstream molecular circuitry system that is activated in the presence of a target molecule to produce an activator;b. a reporter system; andc. a capture molecule bound to an electrode; wherein the activator activates the reporter system to specifically release a reporter molecule and wherein the reporter molecule specifically binds to the capture molecule bound to the electrode to produce a detectable electrochemical signal.
  • 19. The system of claim 18, wherein said detection system is a cell-free system.
  • 20. The system of claim 18. wherein said system is a multiplexed system comprising a plurality of distinct detection systems.
  • 21. The system of claim 18, wherein the upstream system comprises a synthetic toehold switch-based sensor, an aptamer-based switch-based sensor, an inducible transcription system, a riboregulated toehold-gated guide RNA (gRNA) switch-based sensor, or a system for generating a gRNA.
  • 22. The system of claim 21, wherein said synthetic toehold switch-based sensor further comprises a sequence that is specific for the target molecule which is a trigger RNA or trigger DNA sequence.
  • 23. (canceled)
  • 24. The system of claim 18, the upstream system comprises an inducible transcription system, and wherein the transcription is controlled by a transcriptional repressor; orthe upstream system comprises an inducible transcription system, and wherein the transcription is controlled by a transcriptional activator.
  • 25. The system of claim 24, wherein said transcriptional repressor or transcriptional activator is specific for a small molecule.
  • 26-29. (canceled)
  • 30. The system of claim 18, wherein said activator is or comprises a nuclease, restriction enzyme, DNAzyme, or RNAzyme.
  • 31. (canceled)
  • 32. The system of claim 30, wherein said a restriction enzyme is comprises EcoRV, AciI, ClaI, BanII, BsaAI, BglII, BstEII, HincII, NcoI, or PstI.
  • 33. The system of claim 30, wherein said a nuclease is comprises a Cas protein.
  • 34-37. (canceled)
  • 38. The system of claim 18, wherein the reporter molecule comprises a single-stranded DNA sequence, and wherein the reporter system comprises reporter molecule hybridized to a complementary inhibitory single-stranded DNA sequence (iDNA).
  • 39. The system of claim 18, wherein the reporter molecule comprises a redox active molecule.
  • 40-41. (canceled)
  • 42. The system of to claim 39, wherein the a redox active molecule is comprises methylene blue.
  • 43. The system of claim 18, wherein said capture molecule comprises a single-stranded DNA sequence.
  • 44. The system of claim 43, wherein said capture molecule is coupled to the electrode via a terminal thiol group.
  • 45-48. (canceled)
  • 49. The system of claim 18, wherein said reporter molecule binds to a capture molecule and increases the detection of a generated electrochemical signal by an electrode.
  • 50. The system of claim 18, wherein the electrochemical signal is detected by a computer.
  • 51. (canceled)
  • 52. A detection system comprising: a. an upstream molecular circuitry system comprising one or more different RNA toehold switch-based sensor(s), wherein each RNA toehold switch is specific to a target molecule that is an RNA sequence within a sample, and comprises an mRNA sequence encoding a distinct activator that is a restriction enzyme;b. one or more reporter system(s), wherein each reporter system comprises a reporter molecule that is a reporterDNA bound to an inhibitory single-stranded DNA that is an iDNA, wherein said reporterDNA is coupled to a redox active molecule, and wherein said reporterDNA and iDNA comprise a sequence recognized by said restriction enzyme;c. one or more capture molecules, wherein each capture molecule that is a captureDNA, is coupled to an electrode and comprises a sequence complementary to said reporterDNA; wherein the restriction enzyme activates the reporter system by specifically releasing the reporterDNA from the iDNA and wherein the reporterDNA specifically binds to the captureDNA, to produce an electrochemical signal detected by the electrode.
  • 53. A method of detecting a target molecule comprising: a. providing the molecular-based detection system of claim 18;b. contacting said system with a sample; andc. detecting an electrochemical signal, wherein detection of said signal indicates the presence of the target molecule.
  • 54. A method of detecting a plurality of target molecules comprising: a. providing the molecular-based detection system of claim 20;b. contacting said system with a sample; andc. detecting an electrochemical signal, wherein detection of said signal indicates the presence of a target molecule in the sample.
  • 55-56. (canceled)
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is the national phase under 35 U.S.C. §371 of International Application Serial No. PCT/CA2020/051464, which has an International filing date of Oct. 29, 2020, which claims priority to U.S. Provisional Application Serial No. 62/929,452, filed on Nov. 1, 2019, which application is incorporated herein by reference in its entirety.

PCT Information
Filing Document Filing Date Country Kind
PCT/CA2020/051464 10/29/2020 WO
Provisional Applications (1)
Number Date Country
62929452 Nov 2019 US