This application contains a Sequence Listing which is submitted electronically and is hereby incorporated by reference in its entirety. The sequence listing submitted herewith is contained in the XML filed created Mar. 8, 2023 entitled “22-1253-US-CON6_Sequence-Listing.xml” and is 1,716 bytes in size.
The instructions for making the cells in the human body are encoded in deoxyribonucleic acid (DNA). DNA is a long, ladder-shaped molecule, in which each corresponding rung is made up of a pair of interlocking units, called bases, that are designated by the four letters in the DNA alphabet—A, T, G and C. A always pairs with T, and G always pairs with C. The sequence that makes up an individual's DNA is referred to as the individual's genome.
The long molecules of DNA in cells are organized into pieces called chromosomes. Humans have 23 pairs of chromosomes. Chromosomes are further organized into short segments of DNA called genes. The different letters A, T, G, and C, which make up a gene, dictate how cells function and what traits to express by dictating what proteins the cells will make. Proteins do much of the work in the body's cells. Some proteins give cells their shape and structure. Others help cells carry out biological processes like digesting food or carrying oxygen in the blood. Using different combinations of the As, Cs, Ts and Gs, DNA creates the different proteins and regulates when and how they are turned on. Genetic or genotypic data includes information about an individual's DNA sequence, including his or her genome or particular regions of the genome. Regions of a particular individual's genome can also be referred to as DNA or genetic sequences.
Genotypic data includes single nucleotide polymorphisms (SNPs), which are the variations in the DNA sequence that occur at particular locations in an individual's DNA sequence. SNPs can generate biological variation between people by causing differences in the genetic recipes for proteins. Different variants of each SNP are called alleles. Those differences can in turn influence a variety of traits such as appearance, disease susceptibility or response to drugs. While some SNPs lead to differences in health or physical appearance, some SNPs seem to lead to no observable differences between people at all.
Unlike the sex chromosomes and the mitochondrial DNA, which are inherited as blocks, the 22 biparental chromosomes, known as autosomes, are scrambled during reproduction. Through a process known as recombination, each parent pulls his or her paired set of 22 autosomes into chunks, then reassembles a new single set using half the material from each pair. The two single sets of chromosomes from each parent are combined into a new paired set when a sperm fertilizes an egg. Every region of a person's autosomes (non-sex chromosomes) is represented by a pair of DNA sequences, one inherited from the mother and one from the father.
Scientific research today shows that the family trees of all humans living today lead back to an African homeland about 200,000 years ago. The more recent heritage of an individual's chromosomes, however, may have arisen from a population associated with a pre-colonial (before the era of intercontinental travel) home continent, such as Africa, Asia or Europe.
The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
Various embodiments of the invention are disclosed in the following detailed description and the accompanying drawings.
For clarity,
The invention can be implemented in numerous ways, including as a process; an apparatus; a system; a composition of matter; a computer program product embodied on a computer readable storage medium; and/or a processor, such as a processor configured to execute instructions stored on and/or provided by a memory coupled to the processor. In this specification, these implementations, or any other form that the invention may take, may be referred to as techniques. In general, the order of the steps of disclosed processes may be altered within the scope of the invention. Unless stated otherwise, a component such as a processor or a memory described as being configured to perform a task may be implemented as a general component that is temporarily configured to perform the task at a given time or a specific component that is manufactured to perform the task. As used herein, the term ‘processor’ refers to one or more devices, circuits, and/or processing cores configured to process data, such as computer program instructions.
A detailed description of one or more embodiments of the invention is provided below along with accompanying figures that illustrate the principles of the invention. The invention is described in connection with such embodiments, but the invention is not limited to any embodiment. The scope of the invention is limited only by the claims and the invention encompasses numerous alternatives, modifications and equivalents. Numerous specific details are set forth in the following description in order to provide a thorough understanding of the invention. These details are provided for the purpose of example and the invention may be practiced according to the claims without some or all of these specific details. For the purpose of clarity, technical material that is known in the technical fields related to the invention has not been described in detail so that the invention is not unnecessarily obscured.
In display 100, the 22 chromosomes are graphically displayed and each interval of each chromosome is colored according to legend 102. In this example, blue indicates European ancestral origin, orange indicates Asian ancestral origin, green indicates African ancestral origin, and gray indicates that that interval has not been genotyped. For example, a genotyping chip might have no or few markers present at those regions of the genome. Display 100 shows an example of ancestry painting, in which color is used to “paint” ancestral origins. This painting technique allows ancestral data to be conveyed to a user in a way that is easy and intuitive to understand. Although color may be described in the examples herein, in various embodiments, any other type of fill may be used, such as shading, hatching, or other patterns. In some embodiments, other visual cues besides color or fill may be used to display ancestral origins.
Although every person has two copies of each chromosome—one from the mother and one from the father—this display depicts only one set of chromosomes in order to make it easier to read. Thus, each single chromosome drawn in the painting really represents the composition of two paired chromosomes, as will be more fully illustrated below.
As shown in legend 102, Greg Mendel's 22 autosomes have 100% European ancestral origin. In some embodiments, this percentage is determined by adding up the lengths of the segments attributed to each population, as displayed, and then dividing by the total length. The numbers may be rounded to the nearest whole number. In this example, the grayed out regions are not genotyped and therefore not included in the percentage calculations.
Map 104 includes icons placed at various regions across the globe. Clicking on an icon causes the display to depict ancestral data for an example individual from the region where the icon is located. Examples of this are more fully described below.
Although the examples herein may show and describe autosomes (the non-sex chromosomes), in various embodiments, these techniques may be applied to one or more of the X chromosome, Y chromosome, mitochondrial genome, or any other appropriate genetic regions.
In display 300, each chromosome is displayed as half orange and half blue, an indication that one autosome of each pair originated in Europe and the other in Asia. Suppose John Doe had a daughter with a woman of Chinese ancestry. The child would get 22 autosomes from her mother. So one half of each chromosome in her display would be solid orange. The other half would be a roughly 50/50 mix of orange and blue bands—a reflection of her father's half-European, half-Asian ancestry.
If one were to follow the same family over the years, each new generation's ancestry paintings would grow more or less colorful depending on the continental diversity of their parents, grandparents, and so on. If no more people of non-Asian descent joined the pedigree, recombination would repeatedly cut up the blue chunks of DNA, shortening them by half each time, until after about four generations they would become indistinguishable from random noise. People with relatively recent ancestry tracing to two or more continents tend to have the most colorful paintings.
Most African Americans have ancestry from both Europe and Africa. As a result, their ancestry paintings are mostly a mixture of navy and green (as shown), though the relative proportion of the two colors can vary widely.
There may be some small amount of noise present in the painting of a person's recent (the last 500 years or so) ancestry. In this example, there are a few brief stretches of orange (meaning Asian ancestry), as shown. The orange stretches are likely statistical noise rather than indicators of true Asian descent.
Legend 402 indicates that along each of the chromosomes, when the contributions of each region are summed, 64% of this African American's genome traces to European ancestors, 33% to Africans, and 4% Asians (which is likely noise). The gray intervals, such as the one at the left end of chromosome 13, are regions where the genotyping chip has no markers. These regions are not included in calculating the percentages.
Map 404 includes icons placed at various regions across the globe. The selected icon (highlighted in blue) is associated with an African American. Clicking on an icon causes the display to depict ancestral data for an example individual from the region where the icon is located.
In some embodiments, the ancestral data is unphased. In other words, it is not known which parent a particular segment of autosome came from. In any two-color interval, it is not indicated whether the top half or the bottom half was inherited from the mother or father. In some embodiments, when the ancestral data is unphased, the colors are ordered and the top half is colored with the color that is higher in order. For example, the order may be: Asia, Africa, Europe. In this case, orange will always be on top of green, which will always be on top of blue.
In some embodiments, the ancestral data is phased. Phased means that the individual's diploid genotype is resolved into two haplotypes, one for each chromosome. In other words, it is known from which parent a particular segment of autosome was inherited. For example, the top half may show the ancestral origins from the mother and the bottom half may show the ancestral origins from the father, or vice versa.
At 602, an indication that a genetic interval corresponds (e.g., matches) a reference interval that has a likelihood of having one or more ancestral origins is received. Depending on the embodiment, a genetic interval may include a chromosome segment (haploid) or a pair of chromosome segments (diploid). Thus, a genetic interval may be associated with one or two ancestral origins. A segment may include a sequence or set of SNPs along a chromosome. Examples of intervals include intervals 502-506. A reference interval is a genetic interval that has a likelihood of having one or more ancestral origins. For example, the likelihood may be determined based on a database of reference individuals who have known ancestral origins.
At 604, one or more graphic display parameters are determined based at least in part on the indication. Examples of the graphic display parameters include different colors (or visual patterns) that correspond to ancestral origins. For example, if the indication is that the genetic interval matches a reference interval that has a 90% likelihood of having African and Asian origin, then in some embodiments, it is determined that green and orange are graphical display parameters. In other embodiments, it might be determined that blue is a graphical display parameter, for example, based on the fact that neighboring intervals have a high likelihood of having European origin. In various embodiments, a variety of techniques may be used to obtain a graphic display parameter, as more fully described below.
At 606, one or more graphic display parameters are used to visually display an indication of the one or more ancestral origins. For example, if the graphical display parameters are blue and green, than an interval is painted blue and green, such as interval 502 in display 500.
At 702, an individual's phased or unphased genetic data is received. For example, a genotyping chip, such as the Illumina HumanHap550v3 genotyping chip, may be used to assay an individual's genotype. As an example, genetic data for each of the non-gray segments shown in display 100 is obtained for an individual. The genetic data may be phased or unphased. If it is phased, then information regarding whether each location in a segment is inherited from the mother or the father of the individual is known. In some embodiments, phasing is performed using BEAGLE software, developed by Brian and Sharon Browning at the University of Auckland. Phasing can also be performed for an individual if the genetic data of one or both parents is known. Phasing refers to resolving an individual's diploid genotype into two haplotypes, one for each chromosome. In some embodiments, phased data includes data for one chromosome segment and an indication of a parent from which the data was inherited, and unphased data includes data for two corresponding chromosome segments in a pair of chromosome segments without an indication of a parent from which the data was inherited because this has not been determined. In the case of phased data, it is not necessarily known from which parent (mother or father) a phased chromosome segment comes from, in the absence of genetic data from the mother and/or father. What is known is that one phased segment came from one parent, and the homologous segment came from the other parent.
At 704, each chromosome is partitioned into intervals. In some embodiments, the intervals correspond to intervals in a table of genotype frequencies, as more fully described below. The interval may include diploid data or haploid data, depending on whether the data is phased or unphased. For example, in the case of phased data, each chromosome is partitioned into segments, e.g., of consecutive SNPs. In the case of unphased data, each chromosome pair is partitioned into segment pairs, e.g., of consecutive SNPs.
At 706, for each interval, likelihood that the interval is associated with an ancestral origin is determined. In the cased of phased data, a likelihood that the segment is associated with an ancestral origin is determined. In the case of unphased data, likelihood that the segment pair is associated with an ancestral origin is determined. In some embodiments, the likelihood is determined by looking up the interval in a table of genotype frequencies, as more fully described below.
At 804, for each interval of an individual's chromosome, an estimate of the frequency with which that interval is observed in the several reference populations is looked up in a table constructed for this purpose. The estimation method takes the reference population sample size into account, so that intervals not observed in the reference populations receive frequency estimates with small positive values instead of zero. In some embodiments, a pseudocounted frequency value of 0 is replaced with a small nonzero number because a frequency of 0 would be problematic in some implementations (e.g., implementations that include a division by 0). In some embodiments, at 808, the frequency is set equal to 0.
In some embodiments, 804 and 806 are repeated for all intervals until likelihood is determined for all intervals of the individual's genotyped data.
In some embodiments, the data may be obtained from a database associated with a website that allows individuals to view and/or share with other users their genetic data. An example of such a website is www.23andme.com. Each user may provide data regarding their ancestral origin.
At 904, for each reference population, each chromosome of each reference individual is partitioned into intervals. In some embodiments, the intervals are nonoverlapping, adjacent words of consecutive SNPs, or points along the genome where individuals may differ. In some embodiments, the intervals overlap. In some embodiments, words of a fixed number of SNPs, such as ten SNPs are used. In some embodiments, words spanning a minimum genetic distance, e.g., 0.010 cM, as defined by the fine scale recombination map found at HapMap, are used with a threshold on the minimum number of SNPs per word.
If the data is unphased and reference populations of individuals of mixed ancestry are not available, then in some embodiments, at 906, a plurality of intervals corresponding to a synthetic reference population of synthetic individuals are generated from a population of real individuals, as more fully described below.
At 908, a rate of occurrence of each interval in each reference population is computed, which is also more fully described below.
Table 1000 is an example of a genotype frequency table for a particular interval j on a particular chromosome i, for the case of phased data. For the case of phased data, each interval is a segment. The possible values of the segment j on chromosome i in this example are: X, Y, and Z. For example, X may be ACAAGTACCTTGAAAAAATTT (SEQ ID NO: 1). In some embodiments, the genotype frequencies (i.e., 0.12, 0.42, 0.46, 0.02, 0.92, 0.06, 0.85, 0.04, and 0.11) are obtained according to 908 or as follows: For each reference population, for each value X, Y, and Z, the number of individuals in that reference population having that value at segment j, chromosome i, is determined. The number of individuals is divided by the total number of individuals in that reference population to obtain the genotype frequency. For example, if there are 100 African individuals in the reference population and 12 of those individuals have genotype X at interval j on chromosome i, then the genotype frequency would be 12/100=0.12, as shown in table 1000. As shown, each column in table 1000 sums to 1.
Table 1004 is an example of a genotype frequency table for a particular interval j on a particular chromosome i, for the case of unphased data.
The data in table 1002 is discussed first. For the case of unphased data, each interval is a segment pair. In this example, the possible values of each segment are X, Y, and Z (as in table 1000). Therefore, the possible values of the segment pair j on chromosome i in this example are all possible combinations of X, Y, and Z: X/X, X/Y, Y/X, Y/Y, Y/Z, Z/X, Z/Y, and Z/Z. For example, X/X may be the pair ACAAGTACCTTGAAAAAATTT/ACAAGTACCTTGAAAAAATTT. This is an example of generating a plurality of intervals corresponding to a synthetic reference population, or 906.
The possible reference populations are African/African, East Asian/East Asian, European/European, African/East Asian, African/European, and East Asian/European. The frequency of each segment pair value is determined by taking the product of the frequencies of the individual segments within a reference population. For example, the frequency of X in an African population (0.12) times the frequency of Y in an East Asian population (0.92) equals the frequency of X/Y in an African/East Asian synthetic population (0.1104). Because the data is unphased and there is no distinction between X/Y and Y/X, for each possible reference population, the frequency of X/Y and the frequency of Y/X can be summed under X/Y. For example, 0.1104 is summed with 0.0084 to produce 0.1188 for the above example. The same is true for X/Z and Z/X, and for Y/Z and Z/Y. This produces table 1004. This is an example of computing the rate of occurrence of each interval in each reference population, or 908.
For clarity,
In some embodiments, the reference populations include individuals of mixed ancestry, and there is no need to generate synthetic reference populations. In this case, the genotype frequencies in table 1004 may be obtained as follows: For each reference population, for each possible value X/X, X/Y, X/Z, Y/Y, Y/Z, and Z/Z, the number of individuals in that reference population having that value at segment pair j, chromosome i, is determined. The number of individuals is divided by the total number of individuals in that reference population to obtain the genotype frequency. For example, if there are 1000 Asian/European individuals in the reference population and 17 of those individuals have genotype X/X at interval j on chromosome i, then the genotype frequency would be 17/1000=0.017, as shown in table 1004.
In some embodiments, some combination of synthetic and real reference populations is used to obtain the genotype frequencies in table 1004.
Tables 1000 and 1004 are examples of genotype frequency tables for a particular interval j on a particular chromosome i. In some embodiments, to display an indication of ancestral data for all 22 autosomes, there is a table for each interval on each chromosome. In some embodiments, as previously described, data is not available for all intervals since some genotyping chips do not have or have few markers in some segments. In various embodiments, data may be organized in a variety of ways. For example, the number of tables used may vary and/or other data structures besides tables may be used. In some embodiments, the data is implemented as a hash table for ease of lookup. Any appropriate type of lookup table may be used in various embodiments.
In addition, a variety of techniques may be used to obtain genotype frequencies. In various embodiments, any appropriate technique to obtain genotype frequencies may be used.
Diagram 1202 illustrates consecutive segments of a chromosome, their assignments after 1104 and the ratio of the largest frequency to the second largest frequency for each. In this example, the threshold is 5. Therefore, if the ratio is below 5, an assignment was not made. A window of length W segments is used. In this example, W=4. In various embodiments W may be any appropriate length, such as 10-50. In some embodiments, the window length varies depending on the individual and/or chromosome. For example, if the assigned segments of a chromosome of an individual are all EUR, then the window length may be longer than if they are a mix of EUR and ASN. In diagram 1202, the window includes the first four segments with assignments EUR, EUR, EUR, and ASN. The majority is EUR, and so the first segment remains EUR, as shown in diagram 1204. In diagram 1204, the window has moved by one segment. The window now includes EUR, EUR, and ASN. The fifth segment does not count towards the vote because its ratio, 3, is below the threshold of 5. The majority is EUR, and so the second segment is still assigned EUR, as shown in diagram 1206. Similarly, at 1208, the third segment is assigned ASN. At 1210, the fourth segment is assigned ASN. At 1210, the window includes ASN and EUR, which is a tie. In some embodiments, the tie is broken by the segment with the higher ratio, in this case EUR with a ratio of 51, as shown at 1212. Ties may be broken in various ways in various embodiments.
In some embodiments, the window slides by more than one segment at a time. The distance by which a window slides each time is referred to as a slide length. A frame of segments is assigned the same ancestral origin at a time, where the frame has a length equal to the slide length. This may be the case because, depending on the display resolution, it may not be possible to display the ancestral origins at as fine a granularity as the segments. Therefore, it may be desirable to choose a slide length that is appropriate for the display resolution.
Other examples of post processing that may be performed at 1106 include sweeping for sharp discontinuities. For example, for each frame, if the neighboring frames have the same ancestral pair assignment, and it disagrees sharply with the ancestral-pair assignment of the frame, that frame is reverted to the ancestral-pair assignment of its neighbors. A sharp disagreement may be defined as one in which the intersection of the ancestral pairs is empty. This is seen in an example: frame 1 is African-European and frame 2 is Asian-Asian. Since frame 1 and frame 2 have no ancestry in common, i.e., their intersection is empty, the transition from frame 1 to frame 2 is sharp. If frame 1 were African-European and frame 2 were Asian-European, the intersection is “European”, so the transition is not sharp.
The blue discs on the world map indicate that this user has substantial ancestry deriving from Eastern Europe and East Asia. The intensity of the color encodes the proportion of the user's genome derived from that location on the Earth's surface. Alternatively, a contour plot or another density plot could be used. This painting would be expected for an individual having an Eastern European father and a Chinese mother.
In this example, there are substantial contributions to the user's ancestry from West Africa, Northern Europe, and North America. Since the locations shown in the feature correspond to the locations of the world's people (just) prior to the era of intercontinental travel, this North American ancestry refers to Native American ancestry.
In some embodiments, the personal landscape view allows users to zoom in on their results. For users with wholly European ancestry or wholly East Asian ancestry, this allows them to see their results more readily.
In various embodiments, a user interface associated with any of the displays described herein provides controls to allow the user to interact with the data.
In some embodiments, users may also switch to a discrete representation of their results by toggling a “Mosaic” option. Rather than the smoothed landscapes depicted above, the user's ancestry is represented in terms of the world's national or regional boundaries. Countries colored more darkly contribute greater proportions of the user's ancestry.
In some embodiments, this view also allows the user to specify an arbitrary subset of the genome for visualization. Thus, if a user noticed an interesting stretch on Chromosome 6 in a karyotype view, they could look at the spatial distribution of ancestry from just Chromosome 6 in their personal landscape view.
In some embodiments, markers can be added at the most likely geographic origins of the user's parents, grandparents, or more distant ancestors. Information can be included on each ancestor's Y and mitochondrial haplogroups, if this data is available. In this example, the user's father with Y haplogroup R1b1c, and mitochondrial haplogroup E4 is shown; the mother has mitochondrial haplogroup U4.
In some embodiments, the data may be obtained from a database associated with a website that allows individuals to view and/or share with other users their genetic data. An example of such a website is www.23andme.com. Within a database of genetic data, likely relatives can be determined by haplotype matching. In some cases, users can provide their ancestral origin; in other cases, ancestral origin can be computed using the techniques described above. These putative relatives can be displayed on the same personal landscape map. If the putative relatives appear in regions that concur with the user's own ancestry, this lends extra credence to these relationships.
In this example, a migration of the user's ancestors is charted, by using known human migration patterns and the ultimate location of the user's haplotypes (before the era of intercontinental travel). For instance, in this example, the early migration out of Africa is shown, and from the techniques described above, it can be determined that the user's ancestors must have traveled to Asia and Europe, but not as far as the Americas.
The three divisions in the table correspond to the three levels of hierarchy in the data set: continental, regional, and local. This is a tabular view representation that might correspond to the half-European/half-Asian individual discussed above. Each of the columns in the table divide the user's ancestry into proportions (that add up to 100%). The gray-colored regions correspond to unassigned regions of the user's genome, due to noninformative markers or due to lack of data. The columns provide increased spatial resolution of assignment as they proceed to the right, and the unassignable proportion also tends to increase. Thus the assignable portion of this user's genome can be seen to be about 50/50 European/East Asian in the leftmost column. All of the European ancestry that is assignable at the regional level comes from Eastern European populations, and at the local level can be seen to be derived from Ukrainian and Russian ancestors. All of the East Asian ancestry that is assignable at the regional level comes from Eastern Chinese populations, and at the local level can be seen to be derived from Han ancestors.
Although the foregoing embodiments have been described in some detail for purposes of clarity of understanding, the invention is not limited to the details provided. There are many alternative ways of implementing the invention. The disclosed embodiments are illustrative and not restrictive.
This application is a continuation of and claims priority to U.S. patent application Ser. No. 18/180,691, filed Mar. 8, 2023, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 18/180,691 is a continuation of and claims priority to U.S. patent application Ser. No. 18/058,029, filed Nov. 22, 2022, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 18/058,029 is a continuation of and claims priority to U.S. patent application Ser. No. 17/682,761, filed Feb. 28, 2022, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 17/682,761 is a continuation of and claims priority to U.S. patent application Ser. No. 16/226,116, filed Dec. 19, 2018, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 16/226,116 is a continuation of and claims priority to U.S. patent application Ser. No. 15/267,053, filed Sep. 15, 2016, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 15/267,053 is a continuation of and claims priority to U.S. patent application Ser. No. 12/381,992, filed Mar. 18, 2009, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 12/381,992 claims priority to U.S. provisional patent application No. 61/070,310, filed Mar. 19, 2008, which is hereby incorporated by reference in its entirety.
Number | Name | Date | Kind |
---|---|---|---|
5692501 | Minturn | Dec 1997 | A |
6570567 | Eaton | May 2003 | B1 |
6703228 | Landers | Mar 2004 | B1 |
7142205 | Chithambaram | Nov 2006 | B2 |
7567894 | Durand | Jul 2009 | B2 |
7729863 | Ostrander | Jun 2010 | B2 |
7797302 | Kenedy | Sep 2010 | B2 |
7818281 | Kennedy | Oct 2010 | B2 |
7818310 | Kenedy | Oct 2010 | B2 |
7844609 | Kenedy | Nov 2010 | B2 |
7848914 | Durand | Dec 2010 | B2 |
7917438 | Kenedy | Mar 2011 | B2 |
7933912 | Kenedy | Apr 2011 | B2 |
7941329 | Kenedy | May 2011 | B2 |
7941434 | Kenedy | May 2011 | B2 |
7951078 | Scheuner | May 2011 | B2 |
7957907 | Sorenson | Jun 2011 | B2 |
7983893 | Durand | Jul 2011 | B2 |
8024348 | Kenedy | Sep 2011 | B2 |
8051033 | Kenedy | Nov 2011 | B2 |
8055643 | Kenedy | Nov 2011 | B2 |
8065324 | Kenedy | Nov 2011 | B2 |
8099424 | Kenedy | Jan 2012 | B2 |
8108406 | Kenedy | Jan 2012 | B2 |
8156158 | Rolls | Apr 2012 | B2 |
8185461 | Kenedy | May 2012 | B2 |
8187811 | Eriksson | May 2012 | B2 |
8195446 | Durand | Jun 2012 | B2 |
8200509 | Kenedy | Jun 2012 | B2 |
8207316 | Bentwich | Jun 2012 | B1 |
8209319 | Kenedy | Jun 2012 | B2 |
8214192 | Durand | Jul 2012 | B2 |
8214195 | Durand | Jul 2012 | B2 |
8224835 | Kenedy | Jul 2012 | B2 |
8255403 | Kenedy | Aug 2012 | B2 |
8285486 | Martin | Oct 2012 | B2 |
8326648 | Kenedy | Dec 2012 | B2 |
8386519 | Kenedy | Feb 2013 | B2 |
8428886 | Wong | Apr 2013 | B2 |
8443339 | Letourneau | May 2013 | B2 |
8452619 | Kenedy | May 2013 | B2 |
8458097 | Kenedy | Jun 2013 | B2 |
8458121 | Kenedy | Jun 2013 | B2 |
8463554 | Hon | Jun 2013 | B2 |
8467976 | Lo | Jun 2013 | B2 |
8473273 | Durand | Jun 2013 | B2 |
8510057 | Avey | Aug 2013 | B1 |
8543339 | Wojcicki | Sep 2013 | B2 |
8589437 | Khomenko | Nov 2013 | B1 |
8606761 | Kenedy | Dec 2013 | B2 |
8645118 | Durand | Feb 2014 | B2 |
8645343 | Wong | Feb 2014 | B2 |
8655899 | Kenedy | Feb 2014 | B2 |
8655908 | Kenedy | Feb 2014 | B2 |
8655915 | Kenedy | Feb 2014 | B2 |
8666271 | Saiki | Mar 2014 | B2 |
8666721 | Durand | Mar 2014 | B2 |
8685737 | Serber | Apr 2014 | B2 |
8719045 | Yoon | May 2014 | B2 |
8731819 | Dzubay | May 2014 | B2 |
8738297 | Sorenson | May 2014 | B2 |
8786603 | Rasmussen | Jul 2014 | B2 |
8788283 | Kenedy | Jul 2014 | B2 |
8788286 | Kenedy | Jul 2014 | B2 |
8798915 | Dzubay | Aug 2014 | B2 |
8855935 | Myres | Oct 2014 | B2 |
8990198 | Rolls | Mar 2015 | B2 |
8990250 | Chowdry | Mar 2015 | B1 |
9026423 | Durand | May 2015 | B2 |
9031870 | Kenedy | May 2015 | B2 |
9116882 | Macpherson | Aug 2015 | B1 |
9170992 | Kenedy | Oct 2015 | B2 |
9213944 | Do | Dec 2015 | B1 |
9213947 | Do | Dec 2015 | B1 |
9218451 | Wong | Dec 2015 | B2 |
9262567 | Durand | Feb 2016 | B2 |
9323632 | Durand | Apr 2016 | B2 |
9336177 | Hawthorne | May 2016 | B2 |
9367663 | Deciu | Jun 2016 | B2 |
9367800 | Do | Jun 2016 | B1 |
9390225 | Barber | Jul 2016 | B2 |
9405818 | Chowdry | Aug 2016 | B2 |
9582647 | Kenedy | Feb 2017 | B2 |
9836576 | Do | Dec 2017 | B1 |
9864835 | Avey | Jan 2018 | B2 |
9886576 | Urakabe | Feb 2018 | B2 |
9977708 | Do | May 2018 | B1 |
10025877 | Macpherson | Jul 2018 | B2 |
10127346 | Dewey | Nov 2018 | B2 |
10162880 | Chowdry | Dec 2018 | B1 |
10275569 | Avey | Apr 2019 | B2 |
10296847 | Do | May 2019 | B1 |
10379812 | Kenedy | Aug 2019 | B2 |
10432640 | Hawthorne | Oct 2019 | B1 |
10437858 | Naughton | Oct 2019 | B2 |
10516670 | Hawthorne | Dec 2019 | B2 |
10572831 | Do | Feb 2020 | B1 |
10643740 | Avey | May 2020 | B2 |
10658071 | Do | May 2020 | B2 |
10691725 | Naughton | Jun 2020 | B2 |
10699803 | Do | Jun 2020 | B1 |
10755805 | Do | Aug 2020 | B1 |
10777302 | Chowdry | Sep 2020 | B2 |
10790041 | Macpherson | Sep 2020 | B2 |
10803134 | Kenedy | Oct 2020 | B2 |
10841312 | Hawthorne | Nov 2020 | B2 |
10854318 | Macpherson | Dec 2020 | B2 |
10891317 | Chowdry | Jan 2021 | B1 |
10896233 | Kenedy | Jan 2021 | B2 |
10936626 | Naughton | Mar 2021 | B1 |
10957455 | Kenedy | Mar 2021 | B2 |
10991467 | Kenedy | Apr 2021 | B2 |
10999285 | Hawthorne | May 2021 | B2 |
11003694 | Kenedy | May 2021 | B2 |
11031101 | Hon | Jun 2021 | B2 |
11049589 | Hon | Jun 2021 | B2 |
11170047 | Macpherson | Nov 2021 | B2 |
11170873 | Avey | Nov 2021 | B2 |
11171962 | Hawthorne | Nov 2021 | B2 |
11322227 | Hon | May 2022 | B2 |
20020095585 | Scott | Jul 2002 | A1 |
20020133495 | Hugh, Jr. | Sep 2002 | A1 |
20030113727 | Girn | Jun 2003 | A1 |
20030113729 | Daquino | Jun 2003 | A1 |
20030130798 | Hood | Jul 2003 | A1 |
20030135096 | Dodds | Jul 2003 | A1 |
20030172065 | Sorenson | Sep 2003 | A1 |
20030179223 | Ying | Sep 2003 | A1 |
20030186244 | Margus | Oct 2003 | A1 |
20040002818 | Kulp | Jan 2004 | A1 |
20040088191 | Holden | May 2004 | A1 |
20040146870 | Liao | Jul 2004 | A1 |
20040175700 | Geesaman | Sep 2004 | A1 |
20040229213 | Legrain | Nov 2004 | A1 |
20040229231 | Frudakis | Nov 2004 | A1 |
20040241730 | Yakhini | Dec 2004 | A1 |
20050039110 | De La Vega | Feb 2005 | A1 |
20050191731 | Judson | Sep 2005 | A1 |
20050250151 | Mei | Nov 2005 | A1 |
20060003354 | Krantz | Jan 2006 | A1 |
20060046256 | Halldorsson | Mar 2006 | A1 |
20060100872 | Yokoi | May 2006 | A1 |
20060142949 | Helt | Jun 2006 | A1 |
20060161460 | Smitherman | Jul 2006 | A1 |
20060166224 | Norviel | Jul 2006 | A1 |
20060257888 | Zabeau | Nov 2006 | A1 |
20060287876 | Jedlicka | Dec 2006 | A1 |
20070037182 | Gaskin | Feb 2007 | A1 |
20070150978 | Byrum | Jun 2007 | A1 |
20070178500 | Martin | Aug 2007 | A1 |
20070250809 | Kennedy | Oct 2007 | A1 |
20070277267 | Byrum | Nov 2007 | A1 |
20080004848 | Avey | Jan 2008 | A1 |
20080081331 | Myres | Apr 2008 | A1 |
20080131887 | Stephan | Jun 2008 | A1 |
20080154566 | Myres | Jun 2008 | A1 |
20080189047 | Wong | Aug 2008 | A1 |
20080227063 | Kenedy | Sep 2008 | A1 |
20080228043 | Kenedy | Sep 2008 | A1 |
20080228410 | Kenedy | Sep 2008 | A1 |
20080228451 | Kenedy | Sep 2008 | A1 |
20080228677 | Kenedy | Sep 2008 | A1 |
20080228698 | Kenedy | Sep 2008 | A1 |
20080228699 | Kenedy | Sep 2008 | A1 |
20080228700 | Kenedy | Sep 2008 | A1 |
20080228701 | Kenedy | Sep 2008 | A1 |
20080228702 | Kenedy | Sep 2008 | A1 |
20080228704 | Kenedy | Sep 2008 | A1 |
20080228705 | Kenedy | Sep 2008 | A1 |
20080228706 | Kenedy | Sep 2008 | A1 |
20080228708 | Kenedy | Sep 2008 | A1 |
20080228722 | Kenedy | Sep 2008 | A1 |
20080228753 | Kenedy | Sep 2008 | A1 |
20080228756 | Kenedy | Sep 2008 | A1 |
20080228757 | Kenedy | Sep 2008 | A1 |
20080228765 | Kenedy | Sep 2008 | A1 |
20080228766 | Kenedy | Sep 2008 | A1 |
20080228767 | Kenedy | Sep 2008 | A1 |
20080228768 | Kenedy | Sep 2008 | A1 |
20080228797 | Kenedy | Sep 2008 | A1 |
20080243843 | Kenedy | Oct 2008 | A1 |
20080255768 | Martin | Oct 2008 | A1 |
20080270366 | Frank | Oct 2008 | A1 |
20090043752 | Kenedy | Feb 2009 | A1 |
20090099789 | Stephan | Apr 2009 | A1 |
20090112871 | Hawthorne | Apr 2009 | A1 |
20090118131 | Avey | May 2009 | A1 |
20090119083 | Avey | May 2009 | A1 |
20090182579 | Liu | Jul 2009 | A1 |
20090198519 | Mcnamar | Aug 2009 | A1 |
20090299645 | Colby | Dec 2009 | A1 |
20100042438 | Moore | Feb 2010 | A1 |
20100063830 | Kenedy | Mar 2010 | A1 |
20100063835 | Kenedy | Mar 2010 | A1 |
20100063865 | Kenedy | Mar 2010 | A1 |
20100070292 | Kenedy | Mar 2010 | A1 |
20100070455 | Halperin | Mar 2010 | A1 |
20100076950 | Kenedy | Mar 2010 | A1 |
20100076988 | Kenedy | Mar 2010 | A1 |
20100145981 | Wojcicki | Jun 2010 | A1 |
20100169262 | Kenedy | Jul 2010 | A1 |
20100169313 | Kenedy | Jul 2010 | A1 |
20100169338 | Kenedy | Jul 2010 | A1 |
20100191513 | Listgarten | Jul 2010 | A1 |
20100281401 | Tebbs | Nov 2010 | A1 |
20110078168 | Kenedy | Mar 2011 | A1 |
20110130337 | Eriksson | Jun 2011 | A1 |
20110184656 | Kenedy | Jul 2011 | A1 |
20110257889 | Klammer | Oct 2011 | A1 |
20120270190 | Kenedy | Oct 2012 | A1 |
20120270794 | Eriksson | Oct 2012 | A1 |
20120301864 | Bagchi | Nov 2012 | A1 |
20130080068 | Dewey | Mar 2013 | A1 |
20130080365 | Dewey | Mar 2013 | A1 |
20130085728 | Tang | Apr 2013 | A1 |
20130149707 | Sorenson | Jun 2013 | A1 |
20130345988 | Avey | Dec 2013 | A1 |
20140006433 | Hon | Jan 2014 | A1 |
20140045705 | Bustamante | Feb 2014 | A1 |
20140067280 | Vockley | Mar 2014 | A1 |
20140067355 | Noto | Mar 2014 | A1 |
20150227610 | Chowdry | Aug 2015 | A1 |
20150248473 | Kenedy | Sep 2015 | A1 |
20150347566 | Kenedy | Dec 2015 | A1 |
20160026755 | Byrnes | Jan 2016 | A1 |
20160103950 | Myres | Apr 2016 | A1 |
20160171155 | Do | Jun 2016 | A1 |
20160277408 | Hawthorne | Sep 2016 | A1 |
20160350479 | Han | Dec 2016 | A1 |
20200273542 | Song | Aug 2020 | A1 |
20200321073 | Zhi | Oct 2020 | A1 |
Number | Date | Country |
---|---|---|
2004097712 | Nov 2004 | WO |
WO-2004097712 | Nov 2004 | WO |
2006089238 | Aug 2006 | WO |
2009002942 | Dec 2008 | WO |
2009042975 | Apr 2009 | WO |
2012099890 | Jul 2012 | WO |
2017009788 | Jan 2017 | WO |
Entry |
---|
Ratsch, et al., “Learning Interpretable SVMs for Biological Sequence Classification” BMC Bioinformatics, Mar. 20, 2006, 7(Suppll):S9, pp. 1-14. |
Roach JC, et al., Analysis of genetic inheritance in a family quartet by whole-genome sequencing. Science. Apr. 30, 2010;328(5978):636-9. doi: 10.1126/science.1186802. Epub Mar. 10, 2010. PMID: 20220176; PMCID: PMC3037280. |
Sankararaman, et al., “Estimating Local Ancestry in Admixed Populations,” The American Journal of Human Genetics, vol. 82, Feb. 2008, pp. 290-303. |
Sankararaman, et al., “On the inference of ancestries in admixed populations,” Genome Research, Mar. 2008, vol. 18, pp. 668-675. |
Scheet, et al., “A Fast and Flexible Statistical Model for Large-Scale Population Genotype Data: Applications to Inferring Missing Genotypes and Haplotypic Phase,” The American Journal of Human Genetics, vol. 78, Apr. 2006, pp. 629-644. |
Sengupta, et al., “Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists,” The American Journal of Human Genetics, vol. 78, Feb. 2006, pp. 202-221. |
Shriver, et al., “Ethnic-Affiliation Estimation by Use of Population-Specific DNA Markers,” American Journal of Human Genetics, vol. 60, 1997, pp. 957-964. |
Shriver, et al., “Genetic ancestry and the Search for Personalized Genetic Histories,” Nature Reviews Genetics, vol. 5, Aug. 2004, pp. 611-618. |
Shriver, M.D et al., “The Genomic Distribution of Population Substructure in Four Populations Using 8,525 Autosomal SNPs”, Human Genomics, 2004, vol. 1, No. 4, pp. 274-286. |
Stephens, et al., “A Comparison of Bayesian Methods for Haplotype Reconstruction from Population Genotype Data,” Am. J. Hum. Genet., vol. 73, 2003, pp. 1162-1169. |
Stephens, et al., “A New Statistical Method for Haplotype Reconstruction from Population Data,” Am. J. Hum. Genet., vol. 68, 2001, pp. 978-989. |
Stephens, et al., “Accounting for Decay of Linkage Disequilibrium in Haplotype Inference and Missing-Data Imputation,” Am. J. Hum. Genet., vol. 76, 2005, pp. 449-462. |
Sundquist, et al., “Effect of genetic divergence in identifying ancestral origin using HAPAA” Genome Research, vol. 18, No. 4, Apr. 2008, pp. 676-682. |
Tang, et al., “Reconstructing Genetic Ancestry Blocks in Admixed Individuals,” The American Journal of Human Genetics, vol. 79, No. 1, Jul. 2006, pp. 1-12. |
Tang, Hua, et al., “Estimation of Individual Admixture: Analytical and Study Design Considerations”, Genetic Epidemiology 28: 289-301 (2005). |
The International HapMap Consortium, “A haplotype map of the human genome” vol. 437, Oct. 27, 2005, pp. 1300-1320. doi:10.1038/nature04226. |
The International HapMap Consortium, “A second generation human haplotype map of over 3.1 million SNPs,” Nature, vol. 449, Oct. 18, 2007, pp. 851-860. < doi: 10.1038/nature06258>. |
Thiele, H., et al., HaploPainter: a tool for drawing Pedigrees with complex haplotypes, vol. 21 No. 8, 2005, pp. 1730-1732. |
U.S. Appl. No. 12/381,992, filed Mar. 18, 2009. |
U.S. Appl. No. 15/181,083, filed Jun. 13, 2016. |
U.S. Appl. No. 15/181,088, filed Jun. 13, 2016. |
U.S. Appl. No. 15/950,023, filed Apr. 10, 2018. |
U.S. Appl. No. 16/044,364, filed Jul. 24, 2018. |
U.S. Appl. No. 16/219,597, filed Dec. 13, 2018. |
U.S. Appl. No. 16/226,116, filed Dec. 19, 2018. |
U.S. Appl. No. 16/282,221, filed Feb. 21, 2019. |
U.S. Appl. No. 16/844,758, filed Apr. 9, 2020. |
U.S. Appl. No. 16/915,868, filed Jun. 29, 2020. |
U.S. Appl. No. 16/946,829, filed Jul. 8, 2020. |
U.S. Appl. No. 17/161,140, filed Jan. 28, 2021. |
U.S. Appl. No. 17/387,940, filed Jul. 28, 2021. |
U.S. Appl. No. 17/443,946, filed Jul. 28, 2021. |
U.S. Appl. No. 17/444,989, filed Aug. 12, 2021. |
U.S. Appl. No. 17/662,040, filed May 4, 2022. |
U.S. Appl. No. 17/682,761, filed Feb. 28, 2022. |
U.S. Appl. No. 17/707,790, filed Mar. 29, 2022. |
Uddin, et al., “Variability of Haplotype Phase and Its Effect on Genetic Analysis,” Electrical and Computer Engineering, 2008, CCECE 2008, Canadian Conference on, IEEE, 2008, pp. 000596-000600. |
Underhill, et al., “Use of Y Chromosome and Mitochondrial DNA Population Structure in Tracing Human Migrations,” Annu. Rev. Genet., vol. 41, 2007, pp. 539-564. |
Van Rossum, G., “Python reference manual” Computer Science/Department of Algorithmics and Architecture, CS-R9525, Apr. 10, 1995, version 1.2, pp. 1-59. |
Ward, J.J. et al., “Secondary Structure Prediction with Support Vector Machines”, Bioinformatics, 2003, vol. 19, No. 13, pp. 1650-1655. |
Yang, et al., “Examination of Ancestry and Ethnic Affiliation Using Highly Informative Diallelic DNA Markers: Application to Diverse and Admixed Populations and Implications for Clinical Epidemiology and Forensic Medicine,” Human Genetics, vol. 118, 2005, pp. 382-392. |
Yoon, Byung-Jun, “Hidden Markov Models and their Applications in Biological Sequence Analysis,” Current Genomics, vol. 10, 2009, pp. 402-415. |
Yousef, Malik, et al., “Recursive Cluster Elimination (RCE) for Classification and Feature Selection From Gene Expression Data,” BMC Bioinformatics, vol. 8, May 2007, pp. 1-12. |
Yu, Haiyuan et al., “Total Ancestry Measure: quantifying the similarity in tree-like classification, with genomic applications” Bioinformatics, vol. 23, No. 16, May 31, 2007, pp. 2163-2173. |
Zhou, Nina, et al., “Effective Selection of Informative SNPs and Classification on the HapMap Genotype Data,” BMC Bioinformatics, vol. 8, No. 1, 2007, pp. 1-9. |
Office Action, U.S. Appl. No. 14/924,562, mailed Jun. 5, 2019. |
Office Action, U.S. Appl. No. 14/924,562, mailed Jan. 8, 2020. |
Office Action, U.S. Appl. No. 14/938,111, mailed Sep. 25, 2018. |
Office Action, U.S. Appl. No. 14/938,111, mailed Jun. 24, 2019. |
Office Action, U.S. Appl. No. 15/181,083, mailed Jan. 23, 2018. |
Office Action, U.S. Appl. No. 15/181,088, mailed Jun. 25, 2019. |
Office Action, U.S. Appl. No. 15/267,053, mailed Sep. 26, 2018. |
Office Action, U.S. Appl. No. 15/950,023, mailed Dec. 30, 2020. |
Office Action, U.S. Appl. No. 15/950,023, mailed Jun. 29, 2021. |
Office Action, U.S. Appl. No. 15/950,023, mailed Jan. 25, 2022. |
Office Action, U.S. Appl. No. 15/950,023, mailed Aug. 12, 2022. |
Office Action, U.S. Appl. No. 16/044,364, mailed Feb. 11, 2019. |
Office Action, U.S. Appl. No. 16/226,116, mailed Nov. 1, 2021. |
Office Action, U.S. Appl. No. 16/240,641, mailed Nov. 19, 2021. |
Office Action, U.S. Appl. No. 16/282,221, mailed Feb. 4, 2022. |
Office Action, U.S. Appl. No. 16/446,465, mailed Oct. 11, 2019. |
Office Action, U.S. Appl. No. 16/844,758, mailed Oct. 5, 2020. |
Office Action, U.S. Appl. No. 16/844,758, mailed Feb. 2, 2021. |
Office Action, U.S. Appl. No. 16/844,758, mailed Oct. 1, 2021. |
Office Action, U.S. Appl. No. 16/844,758, mailed Apr. 11, 2022. |
Office Action, U.S. Appl. No. 16/844,758, mailed Sep. 1, 2022. |
Office Action, U.S. Appl. No. 16/915,868, mailed Oct. 20, 2020. |
Office Action, U.S. Appl. No. 16/915,868, mailed Feb. 10, 2021. |
Office Action, U.S. Appl. No. 16/946,829, mailed Nov. 16, 2022. |
Office Action, U.S. Appl. No. 16/947,107, mailed Mar. 13, 2023. |
Office Action, U.S. Appl. No. 16/947,107, mailed Aug. 17, 2023. |
Office Action, U.S. Appl. No. 17/161,140, mailed Jun. 3, 2021. |
Office Action, U.S. Appl. No. 17/161,140, mailed Oct. 1, 2021. |
Office Action, U.S. Appl. No. 17/161,140, mailed Apr. 15, 2022. |
Office Action, U.S. Appl. No. 17/249,520, mailed Jun. 1, 2021. |
Office Action, U.S. Appl. No. 17/249,520, mailed Dec. 29, 2021. |
Office Action, U.S. Appl. No. 17/249,520, mailed Nov. 23, 2022. |
Office Action, U.S. Appl. No. 17/249,520, mailed Feb. 7, 2023. |
Office Action, U.S. Appl. No. 17/387,940, mailed Jan. 24, 2022. |
Office Action, U.S. Appl. No. 17/662,040, mailed Jul. 10, 2023. |
Office Action, U.S. Appl. No. 17/682,761, mailed Jun. 7, 2022. |
Office Action, U.S. Appl. No. 17/707,790, mailed Dec. 15, 2022. |
Office Action, U.S. Appl. No. 18/157,595, mailed May 1, 2023. |
Office Action, U.S. Appl. No. 18/157,595, mailed Aug. 24, 2023. |
Pasaniuc et al., “Highly Scalable Genotype Phasing By Entropy Minimization,” Engineering in Medicine and Biology Society, 2006, EMBS'06, 28th Annual International Conference of the IEEE, 2006, 5 pages. |
Pasaniuc, et al., “Inference of locus-specific ancestry in closely related populations,” Bioinformatics, 25(12) Jun. 2009, pp. i213-i221. |
Patterson, et al., “Population Structure and Eigenanalysis,” PLoS Genetics, vol. 2, No. 12, e190, Dec. 2006, pp. 2074-2093. |
Phillips, et al., “Inferring Ancestral Origin Using a Single Multiplex Assay of Ancestry-Informative Marker SNPs,” Forensic Science International, Genetics, vol. 1, 2007, pp. 273-280. |
Pool, et al., “Inference of Historical Changes in Migration Rate From the Lengths of Migrant Tracts,” Genetics, 181(2), Feb. 2009, pp. 711-719. |
Price, et al. “Sensitive Detection of Chromosomal Segments of Distinct Ancestry in Admixed Populations,” PLoS Genetics, vol. 5, No. 6, Jun. 19, 2009 (e1000519) pp. 1-18. |
Pritchard, et al., “Association Mapping in Structured Populations,” Am. J. Hum. Genet., vol. 67, 2000, pp. 170-181. |
Pritchard, et al., “Inference of population structure using multilocus genotype data” Genetics 155, (2000) pp. 945-959. |
Purcell, et al., “PLINK: a toolset for whole-genome association and population-based linkage analysis”, Am. J. Hum. Genet., vol. 81, Sep. 2007, pp. 559-575. |
Rabiner, L., “A Tutorial on Hidden Markov Models and Selected Applications in Speech Recognition,” Proceedings of the IEEE, vol. 77, No. 2, Feb. 1989, pp. 257-286. |
Ma, et al., “PatternHunter: faster and more sensitive homology search” Bioinformatics, vol. 18, No. 3 (2002) pp. 440-445. |
Mahieu, L., [webpage] “My (free) Ancestry.com DNA results—a comparison to FamilyTreeDNA,” Genejourneys (Internet Blog), published online Mar. 6, 2012, pp. 1-3. [retrieved May 23, 2018]. |
McCarthy, et al., “A reference panel of 64,976 haplotypes for genotype imputation” Nature genetics, 48(10), Oct. 2016, pp. 1279-1283. |
Moore, C., [webpage] “LivingSocial's AncestrybyDNA Offer is Not the AncestryDNA Test!” Your Genetic Genealogist (Internet Blog), published online Sep. 18, 2012, pp. 1-2. [retrieved May 23, 2018]. |
Moore, C., [webpage] “New Information on Ancestry.com's AncestryDNA Product,” Your Genetic Genealogist (Internet Blog), published online Mar. 30, 2012, pp. 1-3. [retrieved May 23, 2018]. |
Ng, et al., “On discriminative vs. generative classifiers: A comparison of logistic regression and naive Bayes” Advances in neural information processing systems, 14:841, 2002. |
Notice of Allowance, U.S. Appl. No. 13/800,683, mailed Jan. 20, 2016. |
Notice of Allowance, U.S. Appl. No. 13/800,683, mailed May 3, 2016. |
Notice of Allowance, U.S. Appl. No. 13/801,056, mailed May 18, 2015. |
Notice of Allowance, U.S. Appl. No. 13/801,056, mailed Aug. 12, 2015. |
Notice of Allowance, U.S. Appl. No. 13/801,386, mailed Jul. 24, 2017. |
Notice of Allowance, U.S. Appl. No. 13/801,552, mailed Feb. 4, 2015. |
Notice of Allowance, U.S. Appl. No. 13/801,552, mailed Jun. 26, 2015. |
Notice of Allowance, U.S. Appl. No. 13/801,552, mailed Aug. 12, 2015. |
Notice of Allowance, U.S. Appl. No. 13/801,653, mailed Dec. 28, 2017. |
Notice of Allowance, U.S. Appl. No. 14/938,111, mailed Apr. 29, 2019. |
Notice of Allowance, U.S. Appl. No. 14/938,111, mailed Jan. 9, 2020. |
Notice of Allowance, U.S. Appl. No. 15/181,083, mailed Aug. 14, 2018. |
Notice of Allowance, U.S. Appl. No. 15/181,083, mailed Nov. 15, 2018. |
Notice of Allowance, U.S. Appl. No. 15/181,088, mailed Feb. 26, 2020. |
Notice of Allowance, U.S. Appl. No. 16/044,364, mailed Nov. 12, 2019. |
Notice of Allowance, U.S. Appl. No. 16/446,465, mailed Apr. 2, 2020. |
Notice of Allowance, U.S. Appl. No. 17/161,140, mailed Aug. 23, 2022. |
Notice of Allowance, U.S. Appl. No. 17/444,989, mailed Feb. 25, 2013. |
Notice of Allowance, U.S. Appl. No. 17/682,761, mailed Aug. 10, 2022. |
Notice of Allowance, U.S. Appl. No. 18/058,029, mailed Feb. 7, 2023. |
Notice of Allowance, U.S. Appl. No. 18/180,691, mailed Feb. 25, 2013. |
Office Action, U.S. Appl. No. 12/381,992, mailed Aug. 2, 2011. |
Office Action, U.S. Appl. No. 12/381,992, mailed Dec. 20, 2011. |
Office Action, U.S. Appl. No. 12/381,992, mailed Aug. 6, 2013. |
Office Action, U.S. Appl. No. 12/381,992, mailed Feb. 27, 2013. |
Office Action, U.S. Appl. No. 12/381,992, mailed Aug. 7, 2014. |
Office Action, U.S. Appl. No. 12/381,992, mailed Dec. 22, 2014. |
Office Action, U.S. Appl. No. 12/381,992, mailed May 22, 2015. |
Office Action, U.S. Appl. No. 12/381,992, mailed Nov. 3, 2015. |
Office Action, U.S. Appl. No. 12/381,992, mailed Mar. 16, 2016. |
Office Action, U.S. Appl. No. 13/800,683, mailed Aug. 12, 2015. |
Office Action, U.S. Appl. No. 13/801,056, mailed Jan. 29, 2015. |
Office Action, U.S. Appl. No. 13/801,386, mailed Jul. 8, 2015. |
Office Action, U.S. Appl. No. 13/801,386, mailed Jan. 11, 2016. |
Office Action, U.S. Appl. No. 13/801,386, mailed Oct. 27, 2016. |
Office Action, U.S. Appl. No. 13/801,552, mailed Mar. 16, 2015. |
Office Action, U.S. Appl. No. 13/801,653, mailed Sep. 30, 2015. |
Office Action, U.S. Appl. No. 13/801,653, mailed May 31, 2016. |
Office Action, U.S. Appl. No. 13/801,653, mailed Apr. 19, 2017. |
Office Action, U.S. Appl. No. 14/924,552, mailed Feb. 9, 2018. |
Office Action, U.S. Appl. No. 14/924,552, mailed Sep. 4, 2018. |
Office Action, U.S. Appl. No. 14/924,562, mailed Jan. 30, 2018. |
Office Action, U.S. Appl. No. 14/924,562, mailed Sep. 13, 2018. |
23andMeBlog [webpage] “New Feature: Ancestry Painting,” by 23andMe, Ancestry, published online Mar. 25, 2008, pp. 1. [retrieved May 23, 2018] . |
Advisory Action, U.S. Appl. No. 15/950,023, mailed Nov. 23, 2022. |
Akbani, R et al., “Applying Support Vector Machines to Imbalanced Datasets”, In Machine Learning: ECML 2004; Boulicaut, J.- F., Esposito, F., Giannotti, F., Pedreschi, D., Eds.; Lecture Notes in Computer Science; Springer Berlin Heidelberg: Berlin, Heidelberg, 2004; vol. 3201, pp. 39-50. |
Alexander, et al., “Fast model-based estimation of ancestry in unrelated individuals”, Genome Research 19, (2009) pp. 1655-1664. |
Ball, C et al., “ancestryDNA—AncestryDNA Matching White Paper—Discovering genetic matches across a massive, expanding genetic database” AncestryDNA, Jul. 15, 2020, pp. 1-34. |
Ball, C et al., “ancestryDNA—DNA Circles White Paper—2014” AncestryDNA 2014, pp. 1-43. |
Ball, C et al., [Webpage] “ancestryDNA—Genetic Communities White Paper: Predicting fine-scale ancestral origins from the genetic sharing patterns among millions of individuals” Ancestry.com, Genetic Communities, pp. 1-28. [retrieved on Jan. 22, 2021]. |
Bettinger, B., [webpage] “AncestryDNA Launches New Ethnicity Estimate,” The Genetic Genealogist (Internet Blog), published online Sep. 12, 2013, pp. 1-4. [retrieved May 23, 2018],. |
Bettinger, B., [webpage] “AncestryDNA Officially Launches,” The Genetic Genealogist (Internet Blog), published online May 3, 2012, pp. 1-2. [retrieved May 23, 2018]. |
Bettinger, B., [webpage] “The Monday Morning DNA Testing Company Review — AncestryByDNA, The Genetic Genealogist (Internet Blog), published Feb. 26, 2007, p. 1. [retrieved May 23, 2018]. |
Bohringer, S., et al., “A Software Package for Drawing Ideograms Automatically,” Online J Bioinformatics, vol. 1, 2002, pp. 51-61. |
Boser, et al., “A training algorithm for optimal margin classifiers” In Proceedings of the fifth annual workshop on computational learning theory, ACM, 1992, pp. 144-152. |
Brion, M., et al., “Introduction of a Single Nucleodite Polymorphism—Based ”Major Y—Chromosome Haplogroup Typing Kit Suitable for Predicting the Geographical Origin of Male Lineages, Electrophoresis, vol. 26, 2005, pp. 4411-4420. |
Browning, Brian L., and Sharon R Browning, “Efficient multilocus association testing for whole genome association 42 studies using localized haplotype clustering”, Genetic Epidemiology: The Official Publication of the International Genetic Epidemiology Society 31, No. 5 (2007): 365-375. |
Browning, Sharon R, and Brian L. Browning,“Rapid and accurate haplotype phasing and missing-data inference for whole-genome association studies by use of localized haplotype clustering,” The American Journal of Human Genetics, No. 5 (2007): 1084-1097. |
Burroughs et al., “Analysis of Distributed Intrusion Detection Systems Using Bayesian Methods,” Performance, Computing and Communications Conference, 2002, 21st IEEE International. IEEE, 2002, pp. 329-334. |
Cann, et al., “A human genome diversity cell line panel” Science, 296(5566), Apr. 12, 2002, vol. 296 No. 5566, pp. 261-262. |
Cavalli-Sforza et al., The History and Geography of Human Genes, 1994, pp. 77-81, 90-93, 169-171. |
Cavalli-Sforza, L., “The Human Genome Diversity Project: past, present and future,” Nature Reviews, Genetics, vol. 6, Apr. 2005, pp. 333-340. |
Chiang, et al., “Conflation of Short Identity-by-Descent Segments Bias Their Inferred Length Distribution”, G3 Genes| Genomes|Genetics, vol. 6, No. 5, May 1, 2016, pp. 1287-1296. |
Crawford, et al., “Evidence for substantial fine-scale variation in recombination rates across the human genome,” Nature Genetics, vol. 36, No. 7, Jul. 2004, pp. 700-706. |
Dean, M., et al., “Polymorphic Admixture Typing in Human Ethnic Populations,” American Journal of Human Genetics, vol. 55:4, 1994, pp. 788-808. |
Delaneau, et al., “A Linear complexity phasing method for thousands of genomes,” Nature Methods, vol. 9, No. 2, Feb. 2012, pp. 179-184. |
Dempster, et al., “Maximum likelihood from incomplete data via the EM algorithm” Journal of the Royal Statistical Society, Series B, 39(1), 1977, pp. 1-38. |
DODECAD Project, [webpage] “Clusters Galore results, K=73 for Dodecad Project members (up to DOD581)” Dodecad Ancestry Project (Internet Blog), published Mar. 31, 2011, pp. 1-11. [retrieved May 23, 2018]. |
Druet, Tom, et al., “A Hidden Markov Model Combining Linkage and Linkage Disequilibrium Information for Haplotype Reconstruction and Quantitative Trait Locus Fine Mapping,” Genetics vol. 184, No. 3, Jun. 2010, pp. 789-798. |
Extended European Search Report, European Patent Application No. 20843426.6, mailed Jul. 7, 2023. |
Falush, et al., “Inference of population structure using multilocus genotype data:linked loci and correlated allele frequencies” Genetics 164, (2003) pp. 1567-1587. |
Feng et al., “Mining Multiple Temporal Patterns of Complex Dynamic Data Systems,” Computational Intelligence and Data Mining, IEEE, 2009, 7 pages. |
Fujimura, J. H., et al., Different Differences: The Use of 'genetic Ancestry' versus Race in Biomedical Human Genetic Research, Soc. Stud Sci. Feb. 2011 ; 41(1): 5-30. |
Gu et al., “Phenotypic Selection for Dormancy Introduced a Set of Adaptive Haplotypes from Weedy Into Cultivated Rice,” Genetics Society of America, vol. 171, Oct. 2005, pp. 695-704. |
Gusev, et al., “Whole population, genome-wide mapping of hidden relatedness,” Genome Research, vol. 19, 2009, pp. 318-326. |
Halder, Indrani, et al., “A Panel of Ancestry Informative Markers for Estimating Individual Biogeographical Ancestry and Admixture From Four Continents: Utility and Applications,” Human Mutation, vol. 29, No. 5, 2008, pp. 648-658. |
He, et al., “Multiple Linear Regression for Index SNP Selection on Unphased Genotypes,” Engineering in Medicine and Biology Society, EMBS Annual International Conference of the IEEE, Aug. 30-Sep. 3, 2006, pp. 5759-5762. |
Howie, et al., “A Flexible and Accurate Genotype Imputation Method for the Next Generation of Genome-Wide Association Studies,” PLOS Genetics, vol. 5, No. 6, Jun. 2009, pp. 1-15. |
International HapMap Consortium “A second generation human haplotype map of over 3.1 million SNPs” Nature 449 (764) Oct. 18, 2007, pp. 851-861. |
International Search Report, PCT App. No. PCT/US2020/042628, mailed Dec. 29, 2020. |
International Search Report, PCT App. No. PCT/US2021/045880, mailed Nov. 15, 2021. |
Jaakkola, et al., “Exploiting generative models in discriminative classifiers” Advances in neural information processing systems, (1999) pp. 487-493. |
Kerchner, [webpage] “DNAPrint Test Results—East Asian vs Native American Minority Admixture Detection,” PA Deutsch Ethnic Group DNA Project, created Jun. 26, 2004, updated May 27, 2005, pp. 1-9. [retrieved May 23, 2018]. |
Khatri et al., Ontological Analysis of Gene Expression Data, 2005, Bioinformatics, vol. 21, No. 18 2005, pp. 3587-3595. |
Kraak, M-J, “Visualising Spatial Distributions,” Geographical Information Systems: Principles, Techniques, Applications and Management, New York, John Wiley and Sons, 1999, pp. 157-173. |
Lafferty, et al., “Conditional random fields: Probabilistic models for segmenting and labeling sequence data” Proceedings of the 18th International Conference on Machine Learning (ICML-2001), Jun. 28, 2001, pp. 1-10. |
Li, et al. “Worldwide Human Relationships Inferred from Genome-Wide Patterns of Variation,” Science, vol. 319, Feb. 22, 2008, pp. 1100-1104. |
Li, et al., “Mapping short DNA sequencing reads and calling variants using mapping quality scores,” Genome Research, Aug. 19, 2008, pp. 1851-1858. |
Li, et al., “Modeling linkage disequilibrium and identifying recombination hotspots using single-nucleotide polymorphism data” Genetics 165, (2003) pp. 2213-2233. |
Liang et al., “A Deterministic Sequential Monte Carlo Method for Haplotype Inference,” IEEE Journal of Selected Topics in Signal Processing, vol. 2, No. 3, Jun. 2008, pp. 322-331. |
Lin et al. “Polyphase Speech Recognition,” Acoustics, Speech and Signal Processing, IEEE International Conference on 2008, IEEE, 2008, 4 pages. |
Extended European Search Report, European Patent Application No. 21856763.4, mailed Nov. 16, 2023. |
Office Action, U.S. Appl. No. 18/157,595, mailed Jan. 2, 2024. |
Office Action, U.S. Appl. No. 18/503,841, mailed Jan. 9, 2024. |
Stasko et al., Focus+Context Display and Navigation Techniques for Enhancing Radial, Space-Filling Hierarchy Visualizations, Proc. of the IEEE Symposium on Information Visualization, Feb. 2000. |
Number | Date | Country | |
---|---|---|---|
20240062115 A1 | Feb 2024 | US |
Number | Date | Country | |
---|---|---|---|
61070310 | Mar 2008 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 18180691 | Mar 2023 | US |
Child | 18472019 | US | |
Parent | 18058029 | Nov 2022 | US |
Child | 18180691 | US | |
Parent | 17682761 | Feb 2022 | US |
Child | 18058029 | US | |
Parent | 16226116 | Dec 2018 | US |
Child | 17682761 | US | |
Parent | 15267053 | Sep 2016 | US |
Child | 16226116 | US | |
Parent | 12381992 | Mar 2009 | US |
Child | 15267053 | US |