Ancestry painting

Information

  • Patent Grant
  • 12033046
  • Patent Number
    12,033,046
  • Date Filed
    Thursday, September 21, 2023
    a year ago
  • Date Issued
    Tuesday, July 9, 2024
    11 months ago
Abstract
Displaying an indication of ancestral data is disclosed. An indication that a genetic interval corresponds to a reference interval that has a likelihood of having one or more ancestral origins is received. One or more graphic display parameters are determined based at least in part on the indication. An indication of the one or more ancestral origins is visually displayed using the one or more graphic display parameters.
Description
SEQUENCE LISTING

This application contains a Sequence Listing which is submitted electronically and is hereby incorporated by reference in its entirety. The sequence listing submitted herewith is contained in the XML filed created Mar. 8, 2023 entitled “22-1253-US-CON6_Sequence-Listing.xml” and is 1,716 bytes in size.


BACKGROUND OF THE INVENTION

The instructions for making the cells in the human body are encoded in deoxyribonucleic acid (DNA). DNA is a long, ladder-shaped molecule, in which each corresponding rung is made up of a pair of interlocking units, called bases, that are designated by the four letters in the DNA alphabet—A, T, G and C. A always pairs with T, and G always pairs with C. The sequence that makes up an individual's DNA is referred to as the individual's genome.


The long molecules of DNA in cells are organized into pieces called chromosomes. Humans have 23 pairs of chromosomes. Chromosomes are further organized into short segments of DNA called genes. The different letters A, T, G, and C, which make up a gene, dictate how cells function and what traits to express by dictating what proteins the cells will make. Proteins do much of the work in the body's cells. Some proteins give cells their shape and structure. Others help cells carry out biological processes like digesting food or carrying oxygen in the blood. Using different combinations of the As, Cs, Ts and Gs, DNA creates the different proteins and regulates when and how they are turned on. Genetic or genotypic data includes information about an individual's DNA sequence, including his or her genome or particular regions of the genome. Regions of a particular individual's genome can also be referred to as DNA or genetic sequences.


Genotypic data includes single nucleotide polymorphisms (SNPs), which are the variations in the DNA sequence that occur at particular locations in an individual's DNA sequence. SNPs can generate biological variation between people by causing differences in the genetic recipes for proteins. Different variants of each SNP are called alleles. Those differences can in turn influence a variety of traits such as appearance, disease susceptibility or response to drugs. While some SNPs lead to differences in health or physical appearance, some SNPs seem to lead to no observable differences between people at all.


Unlike the sex chromosomes and the mitochondrial DNA, which are inherited as blocks, the 22 biparental chromosomes, known as autosomes, are scrambled during reproduction. Through a process known as recombination, each parent pulls his or her paired set of 22 autosomes into chunks, then reassembles a new single set using half the material from each pair. The two single sets of chromosomes from each parent are combined into a new paired set when a sperm fertilizes an egg. Every region of a person's autosomes (non-sex chromosomes) is represented by a pair of DNA sequences, one inherited from the mother and one from the father.


Scientific research today shows that the family trees of all humans living today lead back to an African homeland about 200,000 years ago. The more recent heritage of an individual's chromosomes, however, may have arisen from a population associated with a pre-colonial (before the era of intercontinental travel) home continent, such as Africa, Asia or Europe.





BRIEF DESCRIPTION OF THE DRAWINGS

The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.


Various embodiments of the invention are disclosed in the following detailed description and the accompanying drawings.



FIG. 1 is a diagram illustrating an embodiment of a display of ancestral data for an individual of European descent.



FIG. 2 is a diagram illustrating an embodiment of a display of ancestral data for an individual of European descent, including a pull-down menu.



FIG. 3 is a diagram illustrating an embodiment of a display of ancestral data for an individual of Asian and European descent.



FIG. 4 is a diagram illustrating an embodiment of a display of ancestral data for an individual of African American descent.



FIG. 5 is a diagram illustrating an embodiment of a display of ancestral data associated with a chromosome.



FIG. 6 is a flow chart illustrating an embodiment of a process for displaying ancestral data.



FIG. 7 is a flow chart illustrating an embodiment of a process for receiving an indication that a genetic interval matches a reference interval that has a likelihood of having one or more ancestral origins.



FIG. 8 is a flow chart illustrating an embodiment of a process for determining a likelihood that a genetic interval is associated with an ancestral origin.



FIG. 9 is a flow chart illustrating an embodiment of a process for creating a table of genotype frequencies.



FIG. 10A illustrates examples of genotype frequency tables.


For clarity, FIG. 10B illustrates how the values are obtained when going from table 1000 to table 1002.



FIG. 11 is a flow chart illustrating an embodiment of a process for determining one or more graphic display parameters.



FIG. 12 is a diagram illustrating an embodiment of a sliding window used to smooth out ancestral origin assignments.



FIG. 13 is a diagram illustrating an embodiment of a karyotype view of a display of ancestral data for an individual.



FIG. 14 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual of Eastern European and East Asian ancestry.



FIG. 15 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual of African-American ancestry.



FIG. 16 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual, in which markers are indicated.



FIG. 17 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual, in which multiple individuals are indicated.



FIG. 18 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual, in which migration information is indicated.



FIG. 19 is a diagram illustrating an embodiment of a tabular view of a display of ancestral data for an individual.





DETAILED DESCRIPTION

The invention can be implemented in numerous ways, including as a process; an apparatus; a system; a composition of matter; a computer program product embodied on a computer readable storage medium; and/or a processor, such as a processor configured to execute instructions stored on and/or provided by a memory coupled to the processor. In this specification, these implementations, or any other form that the invention may take, may be referred to as techniques. In general, the order of the steps of disclosed processes may be altered within the scope of the invention. Unless stated otherwise, a component such as a processor or a memory described as being configured to perform a task may be implemented as a general component that is temporarily configured to perform the task at a given time or a specific component that is manufactured to perform the task. As used herein, the term ‘processor’ refers to one or more devices, circuits, and/or processing cores configured to process data, such as computer program instructions.


A detailed description of one or more embodiments of the invention is provided below along with accompanying figures that illustrate the principles of the invention. The invention is described in connection with such embodiments, but the invention is not limited to any embodiment. The scope of the invention is limited only by the claims and the invention encompasses numerous alternatives, modifications and equivalents. Numerous specific details are set forth in the following description in order to provide a thorough understanding of the invention. These details are provided for the purpose of example and the invention may be practiced according to the claims without some or all of these specific details. For the purpose of clarity, technical material that is known in the technical fields related to the invention has not been described in detail so that the invention is not unnecessarily obscured.



FIG. 1 is a diagram illustrating an embodiment of a display of ancestral data for an individual of European descent. Display 100 indicates ancestral origins for Greg Mendel, an example individual whose parents and grandparents are of European descent. Three of his grandparents are German and one is Norwegian.


In display 100, the 22 chromosomes are graphically displayed and each interval of each chromosome is colored according to legend 102. In this example, blue indicates European ancestral origin, orange indicates Asian ancestral origin, green indicates African ancestral origin, and gray indicates that that interval has not been genotyped. For example, a genotyping chip might have no or few markers present at those regions of the genome. Display 100 shows an example of ancestry painting, in which color is used to “paint” ancestral origins. This painting technique allows ancestral data to be conveyed to a user in a way that is easy and intuitive to understand. Although color may be described in the examples herein, in various embodiments, any other type of fill may be used, such as shading, hatching, or other patterns. In some embodiments, other visual cues besides color or fill may be used to display ancestral origins.


Although every person has two copies of each chromosome—one from the mother and one from the father—this display depicts only one set of chromosomes in order to make it easier to read. Thus, each single chromosome drawn in the painting really represents the composition of two paired chromosomes, as will be more fully illustrated below.


As shown in legend 102, Greg Mendel's 22 autosomes have 100% European ancestral origin. In some embodiments, this percentage is determined by adding up the lengths of the segments attributed to each population, as displayed, and then dividing by the total length. The numbers may be rounded to the nearest whole number. In this example, the grayed out regions are not genotyped and therefore not included in the percentage calculations.


Map 104 includes icons placed at various regions across the globe. Clicking on an icon causes the display to depict ancestral data for an example individual from the region where the icon is located. Examples of this are more fully described below.


Although the examples herein may show and describe autosomes (the non-sex chromosomes), in various embodiments, these techniques may be applied to one or more of the X chromosome, Y chromosome, mitochondrial genome, or any other appropriate genetic regions.



FIG. 2 is a diagram illustrating an embodiment of a display of ancestral data for an individual of European descent, including a pull-down menu. Display 200 shows display 100 after a user has selected pull-down menu 202. Pull-down menu 202 includes a list of individuals from which to select. In some embodiments, the list includes individuals who have allowed sharing of their genetic data with the user. Some individuals in the list are not identified by name, such as “African American Man” or “Uyghur Woman.” These are unidentified individuals that are provided as examples for illustrative purposes. The anonymous Italian, Cambodian, and Senegalese sample individuals have similarly uniform paintings to Greg Mendel's.



FIG. 3 is a diagram illustrating an embodiment of a display of ancestral data for an individual of Asian and European descent. Display 300 indicates ancestral origins for John Doe, an individual who has a mother of Chinese ancestry and a father of Northern European ancestry.


In display 300, each chromosome is displayed as half orange and half blue, an indication that one autosome of each pair originated in Europe and the other in Asia. Suppose John Doe had a daughter with a woman of Chinese ancestry. The child would get 22 autosomes from her mother. So one half of each chromosome in her display would be solid orange. The other half would be a roughly 50/50 mix of orange and blue bands—a reflection of her father's half-European, half-Asian ancestry.


If one were to follow the same family over the years, each new generation's ancestry paintings would grow more or less colorful depending on the continental diversity of their parents, grandparents, and so on. If no more people of non-Asian descent joined the pedigree, recombination would repeatedly cut up the blue chunks of DNA, shortening them by half each time, until after about four generations they would become indistinguishable from random noise. People with relatively recent ancestry tracing to two or more continents tend to have the most colorful paintings.



FIG. 4 is a diagram illustrating an embodiment of a display of ancestral data for an individual of African American descent. Display 400 indicates ancestral origins for an African American man. For example, display 400 may be displayed in response to a user selecting “African American Man” from menu 202. Also, display 400 may be displayed in response to a user selecting an icon corresponding to an African American (one of the icons in North America) in map 104.


Most African Americans have ancestry from both Europe and Africa. As a result, their ancestry paintings are mostly a mixture of navy and green (as shown), though the relative proportion of the two colors can vary widely.


There may be some small amount of noise present in the painting of a person's recent (the last 500 years or so) ancestry. In this example, there are a few brief stretches of orange (meaning Asian ancestry), as shown. The orange stretches are likely statistical noise rather than indicators of true Asian descent.


Legend 402 indicates that along each of the chromosomes, when the contributions of each region are summed, 64% of this African American's genome traces to European ancestors, 33% to Africans, and 4% Asians (which is likely noise). The gray intervals, such as the one at the left end of chromosome 13, are regions where the genotyping chip has no markers. These regions are not included in calculating the percentages.


Map 404 includes icons placed at various regions across the globe. The selected icon (highlighted in blue) is associated with an African American. Clicking on an icon causes the display to depict ancestral data for an example individual from the region where the icon is located.



FIG. 5 is a diagram illustrating an embodiment of a display of ancestral data associated with a chromosome. Display 500 is an example display of ancestral data associated with chromosome 11. Display 500 includes five intervals across its length—intervals 502-506. Each interval is divided into an upper half and a bottom half. Each half represents a segment in a chromosome pair, where one segment is inherited from the mother and the other segment in the pair is inherited from the father of the individual. Each half is colored according to an ancestral origin associated with one parent. For example, in this case, two of them (intervals 503 and 505) are blue in both the top and bottom halves, meaning that this man inherited DNA tracing to European ancestors from both his mother and father. The other three intervals (intervals 502, 504, and 506) are each half blue and half green. That means in those locations, one copy of this man's DNA traces back to a European ancestor who lived in the last few hundred years, the other to an African ancestor. Thus, as depicted in this display, one interval along the graphical chromosome represents a pair of chromosome segments in a real chromosome.


In some embodiments, the ancestral data is unphased. In other words, it is not known which parent a particular segment of autosome came from. In any two-color interval, it is not indicated whether the top half or the bottom half was inherited from the mother or father. In some embodiments, when the ancestral data is unphased, the colors are ordered and the top half is colored with the color that is higher in order. For example, the order may be: Asia, Africa, Europe. In this case, orange will always be on top of green, which will always be on top of blue.


In some embodiments, the ancestral data is phased. Phased means that the individual's diploid genotype is resolved into two haplotypes, one for each chromosome. In other words, it is known from which parent a particular segment of autosome was inherited. For example, the top half may show the ancestral origins from the mother and the bottom half may show the ancestral origins from the father, or vice versa.



FIG. 6 is a flow chart illustrating an embodiment of a process for displaying ancestral data. For example, this process may be used to display any one of displays 100-500.


At 602, an indication that a genetic interval corresponds (e.g., matches) a reference interval that has a likelihood of having one or more ancestral origins is received. Depending on the embodiment, a genetic interval may include a chromosome segment (haploid) or a pair of chromosome segments (diploid). Thus, a genetic interval may be associated with one or two ancestral origins. A segment may include a sequence or set of SNPs along a chromosome. Examples of intervals include intervals 502-506. A reference interval is a genetic interval that has a likelihood of having one or more ancestral origins. For example, the likelihood may be determined based on a database of reference individuals who have known ancestral origins.


At 604, one or more graphic display parameters are determined based at least in part on the indication. Examples of the graphic display parameters include different colors (or visual patterns) that correspond to ancestral origins. For example, if the indication is that the genetic interval matches a reference interval that has a 90% likelihood of having African and Asian origin, then in some embodiments, it is determined that green and orange are graphical display parameters. In other embodiments, it might be determined that blue is a graphical display parameter, for example, based on the fact that neighboring intervals have a high likelihood of having European origin. In various embodiments, a variety of techniques may be used to obtain a graphic display parameter, as more fully described below.


At 606, one or more graphic display parameters are used to visually display an indication of the one or more ancestral origins. For example, if the graphical display parameters are blue and green, than an interval is painted blue and green, such as interval 502 in display 500.



FIG. 7 is a flow chart illustrating an embodiment of a process for receiving an indication that a genetic interval matches a reference interval that has a likelihood of having one or more ancestral origins. For example, this process may be used to perform 602.


At 702, an individual's phased or unphased genetic data is received. For example, a genotyping chip, such as the Illumina HumanHap550v3 genotyping chip, may be used to assay an individual's genotype. As an example, genetic data for each of the non-gray segments shown in display 100 is obtained for an individual. The genetic data may be phased or unphased. If it is phased, then information regarding whether each location in a segment is inherited from the mother or the father of the individual is known. In some embodiments, phasing is performed using BEAGLE software, developed by Brian and Sharon Browning at the University of Auckland. Phasing can also be performed for an individual if the genetic data of one or both parents is known. Phasing refers to resolving an individual's diploid genotype into two haplotypes, one for each chromosome. In some embodiments, phased data includes data for one chromosome segment and an indication of a parent from which the data was inherited, and unphased data includes data for two corresponding chromosome segments in a pair of chromosome segments without an indication of a parent from which the data was inherited because this has not been determined. In the case of phased data, it is not necessarily known from which parent (mother or father) a phased chromosome segment comes from, in the absence of genetic data from the mother and/or father. What is known is that one phased segment came from one parent, and the homologous segment came from the other parent.


At 704, each chromosome is partitioned into intervals. In some embodiments, the intervals correspond to intervals in a table of genotype frequencies, as more fully described below. The interval may include diploid data or haploid data, depending on whether the data is phased or unphased. For example, in the case of phased data, each chromosome is partitioned into segments, e.g., of consecutive SNPs. In the case of unphased data, each chromosome pair is partitioned into segment pairs, e.g., of consecutive SNPs.


At 706, for each interval, likelihood that the interval is associated with an ancestral origin is determined. In the cased of phased data, a likelihood that the segment is associated with an ancestral origin is determined. In the case of unphased data, likelihood that the segment pair is associated with an ancestral origin is determined. In some embodiments, the likelihood is determined by looking up the interval in a table of genotype frequencies, as more fully described below.



FIG. 8 is a flow chart illustrating an embodiment of a process for determining likelihood that a genetic interval is associated with an ancestral origin. For example, this process may be used to perform 706. At 802, a database of genotype frequencies is obtained. In some embodiments, the database includes a table that maps a list of known genetic intervals to the corresponding frequencies of the genetic intervals within reference populations. In some embodiments, the table includes all possible genotypes of each interval within each reference population and the fraction of that population having that genotype. The fraction of a population having a genotype may also be referred to as the frequency or rate (of occurrence) of a genotype within a population. In the case of phased data, the reference populations include single ancestral origins to correspond to a segment of a single chromosome. In the case of unphased data, the reference populations include all combinations of two ancestral origins to correspond to a pair of segments from two chromosomes, as more fully described below.


At 804, for each interval of an individual's chromosome, an estimate of the frequency with which that interval is observed in the several reference populations is looked up in a table constructed for this purpose. The estimation method takes the reference population sample size into account, so that intervals not observed in the reference populations receive frequency estimates with small positive values instead of zero. In some embodiments, a pseudocounted frequency value of 0 is replaced with a small nonzero number because a frequency of 0 would be problematic in some implementations (e.g., implementations that include a division by 0). In some embodiments, at 808, the frequency is set equal to 0.


In some embodiments, 804 and 806 are repeated for all intervals until likelihood is determined for all intervals of the individual's genotyped data.



FIG. 9 is a flow chart illustrating an embodiment of a process for creating a table of genotype frequencies. For example, such a table may be obtained at 802. At 902, genetic data for a plurality of reference populations is received from one or more sources. For example, data may be obtained from sources such as the Centre d'Etude du Polymorphisme Humain (CEPH) Human Genodiversity Project or the International HapMap Project (www.hapmap.org).


In some embodiments, the data may be obtained from a database associated with a website that allows individuals to view and/or share with other users their genetic data. An example of such a website is www.23andme.com. Each user may provide data regarding their ancestral origin.


At 904, for each reference population, each chromosome of each reference individual is partitioned into intervals. In some embodiments, the intervals are nonoverlapping, adjacent words of consecutive SNPs, or points along the genome where individuals may differ. In some embodiments, the intervals overlap. In some embodiments, words of a fixed number of SNPs, such as ten SNPs are used. In some embodiments, words spanning a minimum genetic distance, e.g., 0.010 cM, as defined by the fine scale recombination map found at HapMap, are used with a threshold on the minimum number of SNPs per word.


If the data is unphased and reference populations of individuals of mixed ancestry are not available, then in some embodiments, at 906, a plurality of intervals corresponding to a synthetic reference population of synthetic individuals are generated from a population of real individuals, as more fully described below.


At 908, a rate of occurrence of each interval in each reference population is computed, which is also more fully described below.



FIG. 10A illustrates examples of genotype frequency tables. For example, these tables may be obtained at 802 and/or created by process 900. In this example, there are three reference populations: African (AFR), East Asian (ASN), and European (EUR).


Table 1000 is an example of a genotype frequency table for a particular interval j on a particular chromosome i, for the case of phased data. For the case of phased data, each interval is a segment. The possible values of the segment j on chromosome i in this example are: X, Y, and Z. For example, X may be ACAAGTACCTTGAAAAAATTT (SEQ ID NO: 1). In some embodiments, the genotype frequencies (i.e., 0.12, 0.42, 0.46, 0.02, 0.92, 0.06, 0.85, 0.04, and 0.11) are obtained according to 908 or as follows: For each reference population, for each value X, Y, and Z, the number of individuals in that reference population having that value at segment j, chromosome i, is determined. The number of individuals is divided by the total number of individuals in that reference population to obtain the genotype frequency. For example, if there are 100 African individuals in the reference population and 12 of those individuals have genotype X at interval j on chromosome i, then the genotype frequency would be 12/100=0.12, as shown in table 1000. As shown, each column in table 1000 sums to 1.


Table 1004 is an example of a genotype frequency table for a particular interval j on a particular chromosome i, for the case of unphased data.


The data in table 1002 is discussed first. For the case of unphased data, each interval is a segment pair. In this example, the possible values of each segment are X, Y, and Z (as in table 1000). Therefore, the possible values of the segment pair j on chromosome i in this example are all possible combinations of X, Y, and Z: X/X, X/Y, Y/X, Y/Y, Y/Z, Z/X, Z/Y, and Z/Z. For example, X/X may be the pair ACAAGTACCTTGAAAAAATTT/ACAAGTACCTTGAAAAAATTT. This is an example of generating a plurality of intervals corresponding to a synthetic reference population, or 906.


The possible reference populations are African/African, East Asian/East Asian, European/European, African/East Asian, African/European, and East Asian/European. The frequency of each segment pair value is determined by taking the product of the frequencies of the individual segments within a reference population. For example, the frequency of X in an African population (0.12) times the frequency of Y in an East Asian population (0.92) equals the frequency of X/Y in an African/East Asian synthetic population (0.1104). Because the data is unphased and there is no distinction between X/Y and Y/X, for each possible reference population, the frequency of X/Y and the frequency of Y/X can be summed under X/Y. For example, 0.1104 is summed with 0.0084 to produce 0.1188 for the above example. The same is true for X/Z and Z/X, and for Y/Z and Z/Y. This produces table 1004. This is an example of computing the rate of occurrence of each interval in each reference population, or 908.


For clarity, FIG. 10B illustrates how the values are obtained when going from table 1000 to table 1002. In this example, table 1006 shows table 1000 with variables B5-B7, C5-C7, and D5-D7 in each cell. Table 1008 shows how the frequencies from table 1006 are combined to produce the frequencies of the combinations shown in table 1002.


In some embodiments, the reference populations include individuals of mixed ancestry, and there is no need to generate synthetic reference populations. In this case, the genotype frequencies in table 1004 may be obtained as follows: For each reference population, for each possible value X/X, X/Y, X/Z, Y/Y, Y/Z, and Z/Z, the number of individuals in that reference population having that value at segment pair j, chromosome i, is determined. The number of individuals is divided by the total number of individuals in that reference population to obtain the genotype frequency. For example, if there are 1000 Asian/European individuals in the reference population and 17 of those individuals have genotype X/X at interval j on chromosome i, then the genotype frequency would be 17/1000=0.017, as shown in table 1004.


In some embodiments, some combination of synthetic and real reference populations is used to obtain the genotype frequencies in table 1004.


Tables 1000 and 1004 are examples of genotype frequency tables for a particular interval j on a particular chromosome i. In some embodiments, to display an indication of ancestral data for all 22 autosomes, there is a table for each interval on each chromosome. In some embodiments, as previously described, data is not available for all intervals since some genotyping chips do not have or have few markers in some segments. In various embodiments, data may be organized in a variety of ways. For example, the number of tables used may vary and/or other data structures besides tables may be used. In some embodiments, the data is implemented as a hash table for ease of lookup. Any appropriate type of lookup table may be used in various embodiments.


In addition, a variety of techniques may be used to obtain genotype frequencies. In various embodiments, any appropriate technique to obtain genotype frequencies may be used.



FIG. 11 is a flow chart illustrating an embodiment of a process for determining one or more graphic display parameters. For example, this process may be used to perform 604. At 1102, for each interval, the ratio of the largest frequency to the second largest frequency is computed. For example, a particular individual Greg has genotype X at interval j on chromosome i. (This is a phased example.) The frequencies associated with genotype X according to table 1000 are: AFR 0.12, ASN 0.02, and EUR 0.85. The ratio of the largest frequency to the second largest frequency is 0.85/0.12=7.08. At 1104, if the ratio is above a given threshold or above a given quantile, then the ancestral origin(s) associated with the largest frequency is assigned to the interval. In the above example, the ratio for Greg is 7.08. If the threshold is 5, then because 7.08>5, the ancestral origin of EUR is assigned to the interval j on chromosome i for Greg. If the threshold is 10, then the interval is unassigned. At 1106, a sliding window is used to fill in and/or smooth out the assignments. In various embodiments, this step is skipped or other types of smoothing or post processing are performed. As a result of the smoothing, an assignment of EUR may be changed to a different ancestral origin assignment, such as ASN. An example of how a sliding window fills in and/or smooths out assignments is more fully described below. At 1108, based on the final assignment, a graphic display parameter is selected for each interval. For example, a color is selected, where different colors correspond to different ancestral origins. In Greg's case, for interval j on chromosome i, if the assignment remains EUR after the processing of 1106, the color blue is selected for interval j on chromosome i. This is shown in display 100, where blue corresponds to European ancestral origin.



FIG. 12 is a diagram illustrating an embodiment of a sliding window used to smooth out ancestral origin assignments. In some embodiments, a dominant ancestral origin of a sliding window is estimated based on the segments in the sliding window, and that dominant ancestral origin is assigned to the first segment. The window slides by a segment, and the dominant ancestral origin of the segments in the sliding window is assigned to the second segment. In some embodiments, the dominant ancestral origin is estimated at least in part by determining the ancestral origin assigned to the majority of the segments in the sliding window.


Diagram 1202 illustrates consecutive segments of a chromosome, their assignments after 1104 and the ratio of the largest frequency to the second largest frequency for each. In this example, the threshold is 5. Therefore, if the ratio is below 5, an assignment was not made. A window of length W segments is used. In this example, W=4. In various embodiments W may be any appropriate length, such as 10-50. In some embodiments, the window length varies depending on the individual and/or chromosome. For example, if the assigned segments of a chromosome of an individual are all EUR, then the window length may be longer than if they are a mix of EUR and ASN. In diagram 1202, the window includes the first four segments with assignments EUR, EUR, EUR, and ASN. The majority is EUR, and so the first segment remains EUR, as shown in diagram 1204. In diagram 1204, the window has moved by one segment. The window now includes EUR, EUR, and ASN. The fifth segment does not count towards the vote because its ratio, 3, is below the threshold of 5. The majority is EUR, and so the second segment is still assigned EUR, as shown in diagram 1206. Similarly, at 1208, the third segment is assigned ASN. At 1210, the fourth segment is assigned ASN. At 1210, the window includes ASN and EUR, which is a tie. In some embodiments, the tie is broken by the segment with the higher ratio, in this case EUR with a ratio of 51, as shown at 1212. Ties may be broken in various ways in various embodiments.


In some embodiments, the window slides by more than one segment at a time. The distance by which a window slides each time is referred to as a slide length. A frame of segments is assigned the same ancestral origin at a time, where the frame has a length equal to the slide length. This may be the case because, depending on the display resolution, it may not be possible to display the ancestral origins at as fine a granularity as the segments. Therefore, it may be desirable to choose a slide length that is appropriate for the display resolution.


Other examples of post processing that may be performed at 1106 include sweeping for sharp discontinuities. For example, for each frame, if the neighboring frames have the same ancestral pair assignment, and it disagrees sharply with the ancestral-pair assignment of the frame, that frame is reverted to the ancestral-pair assignment of its neighbors. A sharp disagreement may be defined as one in which the intersection of the ancestral pairs is empty. This is seen in an example: frame 1 is African-European and frame 2 is Asian-Asian. Since frame 1 and frame 2 have no ancestry in common, i.e., their intersection is empty, the transition from frame 1 to frame 2 is sharp. If frame 1 were African-European and frame 2 were Asian-European, the intersection is “European”, so the transition is not sharp.



FIG. 13 is a diagram illustrating an embodiment of a karyotype view of a display of ancestral data for an individual. This view shows the 22 autosomes. In some embodiments, the X chromosome is also shown. This view shows African, Asian, and European segments. In some embodiments, instead of dividing the individual's genome into African, Asian, and European segments, the karyotype view shows seven populations at the continental level. In some embodiments, the user can also choose to display the results corresponding to ancestral origins at the continental scale, regional scale (e.g., Northern Europe, East Africa, Western China), or subregional/local (e.g., a country, such as Ukraine or Ireland, or an ethnic group, such as Cherokee or Han). In some embodiments, by default, segments are displayed corresponding to the finest scale assignment that has been made. Display 1300 may also show and “paint” the user's Y chromosome (if male) and mitochondrial genome on the same display. As the Y and mitochondrion are each inherited as one indivisible unit of DNA sequence (without recombination), the painting procedure can match the DNA sequence to the ancestral origin where the DNA sequence is the most common.



FIG. 14 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual of Eastern European and East Asian ancestry. This view uses the user's inferred ancestry to construct a spatial distribution showing where their ancestors are likely to have lived.


The blue discs on the world map indicate that this user has substantial ancestry deriving from Eastern Europe and East Asia. The intensity of the color encodes the proportion of the user's genome derived from that location on the Earth's surface. Alternatively, a contour plot or another density plot could be used. This painting would be expected for an individual having an Eastern European father and a Chinese mother.



FIG. 15 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual of African-American ancestry.


In this example, there are substantial contributions to the user's ancestry from West Africa, Northern Europe, and North America. Since the locations shown in the feature correspond to the locations of the world's people (just) prior to the era of intercontinental travel, this North American ancestry refers to Native American ancestry.


In some embodiments, the personal landscape view allows users to zoom in on their results. For users with wholly European ancestry or wholly East Asian ancestry, this allows them to see their results more readily.


In various embodiments, a user interface associated with any of the displays described herein provides controls to allow the user to interact with the data.


In some embodiments, users may also switch to a discrete representation of their results by toggling a “Mosaic” option. Rather than the smoothed landscapes depicted above, the user's ancestry is represented in terms of the world's national or regional boundaries. Countries colored more darkly contribute greater proportions of the user's ancestry.


In some embodiments, this view also allows the user to specify an arbitrary subset of the genome for visualization. Thus, if a user noticed an interesting stretch on Chromosome 6 in a karyotype view, they could look at the spatial distribution of ancestry from just Chromosome 6 in their personal landscape view.



FIG. 16 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual, in which markers are indicated.


In some embodiments, markers can be added at the most likely geographic origins of the user's parents, grandparents, or more distant ancestors. Information can be included on each ancestor's Y and mitochondrial haplogroups, if this data is available. In this example, the user's father with Y haplogroup R1b1c, and mitochondrial haplogroup E4 is shown; the mother has mitochondrial haplogroup U4.



FIG. 17 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual, in which multiple individuals are indicated. Other individuals, such as the user's family and friends, are shown on the same map.


In some embodiments, the data may be obtained from a database associated with a website that allows individuals to view and/or share with other users their genetic data. An example of such a website is www.23andme.com. Within a database of genetic data, likely relatives can be determined by haplotype matching. In some cases, users can provide their ancestral origin; in other cases, ancestral origin can be computed using the techniques described above. These putative relatives can be displayed on the same personal landscape map. If the putative relatives appear in regions that concur with the user's own ancestry, this lends extra credence to these relationships.



FIG. 18 is a diagram illustrating an embodiment of a personal landscape view of a display of ancestral data for an individual, in which migration information is indicated.


In this example, a migration of the user's ancestors is charted, by using known human migration patterns and the ultimate location of the user's haplotypes (before the era of intercontinental travel). For instance, in this example, the early migration out of Africa is shown, and from the techniques described above, it can be determined that the user's ancestors must have traveled to Asia and Europe, but not as far as the Americas.



FIG. 19 is a diagram illustrating an embodiment of a tabular view of a display of ancestral data for an individual. This view depicts a user's ancestral origins in a readily-grasped visual three column table. It derives loosely from the treemap visualization (e.g., explained under “Treemapping” of Wikipedia).


The three divisions in the table correspond to the three levels of hierarchy in the data set: continental, regional, and local. This is a tabular view representation that might correspond to the half-European/half-Asian individual discussed above. Each of the columns in the table divide the user's ancestry into proportions (that add up to 100%). The gray-colored regions correspond to unassigned regions of the user's genome, due to noninformative markers or due to lack of data. The columns provide increased spatial resolution of assignment as they proceed to the right, and the unassignable proportion also tends to increase. Thus the assignable portion of this user's genome can be seen to be about 50/50 European/East Asian in the leftmost column. All of the European ancestry that is assignable at the regional level comes from Eastern European populations, and at the local level can be seen to be derived from Ukrainian and Russian ancestors. All of the East Asian ancestry that is assignable at the regional level comes from Eastern Chinese populations, and at the local level can be seen to be derived from Han ancestors.


Although the foregoing embodiments have been described in some detail for purposes of clarity of understanding, the invention is not limited to the details provided. There are many alternative ways of implementing the invention. The disclosed embodiments are illustrative and not restrictive.

Claims
  • 1. A computer-implemented method comprising: obtaining genetic data of an individual;partitioning the genetic data into intervals based on known genetic intervals, wherein the known genetic intervals each contain one or more genotypes with corresponding frequencies of occurrence within reference populations, and wherein the reference populations are respectively associated with reference geographic origins of reference individuals with the corresponding genotypes;determining, based on the genetic data of the individual and the frequencies of occurrence for the intervals, geographic origins for one or more of the intervals of the individual;generating, for display on a graphical user interface, representations of the intervals indicating: one or more of the geographic origins for genotyped intervals, or that one or more of the geographic origins are unknown for un-genotyped intervals; andproviding, to the graphical user interface, the representations of the intervals.
  • 2. The computer-implemented method of claim 1, wherein the genetic data includes a pair of chromosomes of the individual, and wherein partitioning the genetic data into intervals comprises partitioning each of the chromosomes separately when the genetic data is phased and partitioning the pair of chromosomes when the genetic data is unphased.
  • 3. The computer-implemented method of claim 1, wherein the known genetic intervals are based on non-overlapping adjacent words of consecutive single-nucleotide polymorphisms.
  • 4. The computer-implemented method of claim 1, wherein the known genetic intervals are based on fixed-sized words of consecutive single-nucleotide polymorphisms.
  • 5. The computer-implemented method of claim 1, wherein the geographic origins include at least Europe, Asia, and Africa.
  • 6. The computer-implemented method of claim 1, wherein the graphical user interface includes a drop-down menu that lists a plurality of individuals, wherein the plurality of individuals contains the individual, and wherein selection of the individual by way of the drop-down menu causes the graphical user interface to display the representations of the intervals.
  • 7. The computer-implemented method of claim 1, wherein the graphical user interface includes a geographic map of the geographic origins that are known.
  • 8. The computer-implemented method of claim 1, wherein the graphical user interface includes a geographic map, and wherein the geographic map includes a spatial distribution of likely ancestral origins.
  • 9. The computer-implemented method of claim 1, wherein the graphical user interface includes a geographic map, and wherein the geographic map includes indications of likely ancestral origins for a Y haplogroup or a mitochondrial haplogroup of the individual.
  • 10. The computer-implemented method of claim 1, wherein the graphical user interface includes a geographic map, and wherein the geographic map includes indications of migration patterns for ancestors of the individual, wherein the migration patterns are based on known human migration patterns and a geographical location of a haplotype of the individual.
  • 11. The computer-implemented method of claim 1, wherein the intervals are arranged in the graphical user interface in a karyotype view including 22 autosomal chromosomes.
  • 12. The computer-implemented method of claim 11, wherein the intervals of the 22 autosomal chromosomes are represented as pairs, and wherein the geographic origins for intervals within each pair are separately indicated.
  • 13. The computer-implemented method of claim 1, wherein the geographic origins are each represented by different colors.
  • 14. The computer-implemented method of claim 1, further comprising: determining the frequencies of occurrence within one or more of the reference populations by: determining, for each respective known genetic interval of the known genetic intervals, a first number of individuals within the one or more of the reference populations exhibiting the respective known genetic interval; and dividing the first number by a second number representing a total of the individuals within the one or more of the reference populations.
  • 15. The computer-implemented method of claim 1, wherein the frequencies of occurrence include at least one synthetic rate of occurrence for a synthetic reference population of mixed geographic origins.
  • 16. The computer-implemented method of claim 1, wherein determining the geographic origins for one or more of the intervals of the individual comprises: determining, for a specific interval of the one or more intervals, a ratio of a largest frequency of occurrence to a second largest frequency of occurrence within the specific interval;determining that the ratio is above a given threshold or a given quantile; andbased on the ratio being above the given threshold or the given quantile, assigning, to the specific interval, a geographic origin associated with the largest frequency of occurrence.
  • 17. The computer-implemented method of claim 1, wherein determining the geographic origins for one or more of the intervals of the individual comprises: arranging, for a specific interval of the one or more intervals, a window of n consecutive intervals including the specific interval; andassigning, to the specific interval, a dominant geographic origin of the n consecutive intervals within the window.
  • 18. The computer-implemented method of claim 17, wherein n is a value from 10 to 50.
  • 19. A non-transitory computer-readable medium storing program instructions that, when executed by one or more processors of a computing system, cause the computing system to perform operations comprising: obtaining genetic data of an individual;partitioning the genetic data into intervals based on known genetic intervals, wherein the known genetic intervals each contain one or more genotypes with corresponding frequencies of occurrence within reference populations, and wherein the reference populations are respectively associated with reference geographic origins of reference individuals with the corresponding genotypes;determining, based on the genetic data of the individual and the frequencies of occurrence for the intervals, geographic origins for one or more of the intervals of the individual;generating, for display on a graphical user interface, representations of the intervals indicating: one or more of the geographic origins for genotyped intervals, or that one or more of the geographic origins are unknown for un-genotyped intervals; andproviding, to the graphical user interface, the representations of the intervals.
  • 20. A computing system comprising: one or more processors;memory; andprogram instructions, stored in the memory, that upon execution by the one or more processors cause the computing system to perform operations comprising: obtaining genetic data of an individual;partitioning the genetic data into intervals based on known genetic intervals, wherein the known genetic intervals each contain one or more genotypes with corresponding frequencies of occurrence within reference populations, and wherein the reference populations are respectively associated with reference geographic origins of reference individuals with the corresponding genotypes;determining, based on the genetic data of the individual and the frequencies of occurrence for the intervals, geographic origins for one or more of the intervals of the individual;generating, for display on a graphical user interface, representations of the intervals indicating: one or more of the geographic origins for genotyped intervals, or that one or more of the geographic origins are unknown for un-genotyped intervals; andproviding, to the graphical user interface, the representations of the intervals.
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation of and claims priority to U.S. patent application Ser. No. 18/180,691, filed Mar. 8, 2023, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 18/180,691 is a continuation of and claims priority to U.S. patent application Ser. No. 18/058,029, filed Nov. 22, 2022, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 18/058,029 is a continuation of and claims priority to U.S. patent application Ser. No. 17/682,761, filed Feb. 28, 2022, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 17/682,761 is a continuation of and claims priority to U.S. patent application Ser. No. 16/226,116, filed Dec. 19, 2018, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 16/226,116 is a continuation of and claims priority to U.S. patent application Ser. No. 15/267,053, filed Sep. 15, 2016, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 15/267,053 is a continuation of and claims priority to U.S. patent application Ser. No. 12/381,992, filed Mar. 18, 2009, which is hereby incorporated by reference in its entirety. U.S. patent application Ser. No. 12/381,992 claims priority to U.S. provisional patent application No. 61/070,310, filed Mar. 19, 2008, which is hereby incorporated by reference in its entirety.

US Referenced Citations (231)
Number Name Date Kind
5692501 Minturn Dec 1997 A
6570567 Eaton May 2003 B1
6703228 Landers Mar 2004 B1
7142205 Chithambaram Nov 2006 B2
7567894 Durand Jul 2009 B2
7729863 Ostrander Jun 2010 B2
7797302 Kenedy Sep 2010 B2
7818281 Kennedy Oct 2010 B2
7818310 Kenedy Oct 2010 B2
7844609 Kenedy Nov 2010 B2
7848914 Durand Dec 2010 B2
7917438 Kenedy Mar 2011 B2
7933912 Kenedy Apr 2011 B2
7941329 Kenedy May 2011 B2
7941434 Kenedy May 2011 B2
7951078 Scheuner May 2011 B2
7957907 Sorenson Jun 2011 B2
7983893 Durand Jul 2011 B2
8024348 Kenedy Sep 2011 B2
8051033 Kenedy Nov 2011 B2
8055643 Kenedy Nov 2011 B2
8065324 Kenedy Nov 2011 B2
8099424 Kenedy Jan 2012 B2
8108406 Kenedy Jan 2012 B2
8156158 Rolls Apr 2012 B2
8185461 Kenedy May 2012 B2
8187811 Eriksson May 2012 B2
8195446 Durand Jun 2012 B2
8200509 Kenedy Jun 2012 B2
8207316 Bentwich Jun 2012 B1
8209319 Kenedy Jun 2012 B2
8214192 Durand Jul 2012 B2
8214195 Durand Jul 2012 B2
8224835 Kenedy Jul 2012 B2
8255403 Kenedy Aug 2012 B2
8285486 Martin Oct 2012 B2
8326648 Kenedy Dec 2012 B2
8386519 Kenedy Feb 2013 B2
8428886 Wong Apr 2013 B2
8443339 Letourneau May 2013 B2
8452619 Kenedy May 2013 B2
8458097 Kenedy Jun 2013 B2
8458121 Kenedy Jun 2013 B2
8463554 Hon Jun 2013 B2
8467976 Lo Jun 2013 B2
8473273 Durand Jun 2013 B2
8510057 Avey Aug 2013 B1
8543339 Wojcicki Sep 2013 B2
8589437 Khomenko Nov 2013 B1
8606761 Kenedy Dec 2013 B2
8645118 Durand Feb 2014 B2
8645343 Wong Feb 2014 B2
8655899 Kenedy Feb 2014 B2
8655908 Kenedy Feb 2014 B2
8655915 Kenedy Feb 2014 B2
8666271 Saiki Mar 2014 B2
8666721 Durand Mar 2014 B2
8685737 Serber Apr 2014 B2
8719045 Yoon May 2014 B2
8731819 Dzubay May 2014 B2
8738297 Sorenson May 2014 B2
8786603 Rasmussen Jul 2014 B2
8788283 Kenedy Jul 2014 B2
8788286 Kenedy Jul 2014 B2
8798915 Dzubay Aug 2014 B2
8855935 Myres Oct 2014 B2
8990198 Rolls Mar 2015 B2
8990250 Chowdry Mar 2015 B1
9026423 Durand May 2015 B2
9031870 Kenedy May 2015 B2
9116882 Macpherson Aug 2015 B1
9170992 Kenedy Oct 2015 B2
9213944 Do Dec 2015 B1
9213947 Do Dec 2015 B1
9218451 Wong Dec 2015 B2
9262567 Durand Feb 2016 B2
9323632 Durand Apr 2016 B2
9336177 Hawthorne May 2016 B2
9367663 Deciu Jun 2016 B2
9367800 Do Jun 2016 B1
9390225 Barber Jul 2016 B2
9405818 Chowdry Aug 2016 B2
9582647 Kenedy Feb 2017 B2
9836576 Do Dec 2017 B1
9864835 Avey Jan 2018 B2
9886576 Urakabe Feb 2018 B2
9977708 Do May 2018 B1
10025877 Macpherson Jul 2018 B2
10127346 Dewey Nov 2018 B2
10162880 Chowdry Dec 2018 B1
10275569 Avey Apr 2019 B2
10296847 Do May 2019 B1
10379812 Kenedy Aug 2019 B2
10432640 Hawthorne Oct 2019 B1
10437858 Naughton Oct 2019 B2
10516670 Hawthorne Dec 2019 B2
10572831 Do Feb 2020 B1
10643740 Avey May 2020 B2
10658071 Do May 2020 B2
10691725 Naughton Jun 2020 B2
10699803 Do Jun 2020 B1
10755805 Do Aug 2020 B1
10777302 Chowdry Sep 2020 B2
10790041 Macpherson Sep 2020 B2
10803134 Kenedy Oct 2020 B2
10841312 Hawthorne Nov 2020 B2
10854318 Macpherson Dec 2020 B2
10891317 Chowdry Jan 2021 B1
10896233 Kenedy Jan 2021 B2
10936626 Naughton Mar 2021 B1
10957455 Kenedy Mar 2021 B2
10991467 Kenedy Apr 2021 B2
10999285 Hawthorne May 2021 B2
11003694 Kenedy May 2021 B2
11031101 Hon Jun 2021 B2
11049589 Hon Jun 2021 B2
11170047 Macpherson Nov 2021 B2
11170873 Avey Nov 2021 B2
11171962 Hawthorne Nov 2021 B2
11322227 Hon May 2022 B2
20020095585 Scott Jul 2002 A1
20020133495 Hugh, Jr. Sep 2002 A1
20030113727 Girn Jun 2003 A1
20030113729 Daquino Jun 2003 A1
20030130798 Hood Jul 2003 A1
20030135096 Dodds Jul 2003 A1
20030172065 Sorenson Sep 2003 A1
20030179223 Ying Sep 2003 A1
20030186244 Margus Oct 2003 A1
20040002818 Kulp Jan 2004 A1
20040088191 Holden May 2004 A1
20040146870 Liao Jul 2004 A1
20040175700 Geesaman Sep 2004 A1
20040229213 Legrain Nov 2004 A1
20040229231 Frudakis Nov 2004 A1
20040241730 Yakhini Dec 2004 A1
20050039110 De La Vega Feb 2005 A1
20050191731 Judson Sep 2005 A1
20050250151 Mei Nov 2005 A1
20060003354 Krantz Jan 2006 A1
20060046256 Halldorsson Mar 2006 A1
20060100872 Yokoi May 2006 A1
20060142949 Helt Jun 2006 A1
20060161460 Smitherman Jul 2006 A1
20060166224 Norviel Jul 2006 A1
20060257888 Zabeau Nov 2006 A1
20060287876 Jedlicka Dec 2006 A1
20070037182 Gaskin Feb 2007 A1
20070150978 Byrum Jun 2007 A1
20070178500 Martin Aug 2007 A1
20070250809 Kennedy Oct 2007 A1
20070277267 Byrum Nov 2007 A1
20080004848 Avey Jan 2008 A1
20080081331 Myres Apr 2008 A1
20080131887 Stephan Jun 2008 A1
20080154566 Myres Jun 2008 A1
20080189047 Wong Aug 2008 A1
20080227063 Kenedy Sep 2008 A1
20080228043 Kenedy Sep 2008 A1
20080228410 Kenedy Sep 2008 A1
20080228451 Kenedy Sep 2008 A1
20080228677 Kenedy Sep 2008 A1
20080228698 Kenedy Sep 2008 A1
20080228699 Kenedy Sep 2008 A1
20080228700 Kenedy Sep 2008 A1
20080228701 Kenedy Sep 2008 A1
20080228702 Kenedy Sep 2008 A1
20080228704 Kenedy Sep 2008 A1
20080228705 Kenedy Sep 2008 A1
20080228706 Kenedy Sep 2008 A1
20080228708 Kenedy Sep 2008 A1
20080228722 Kenedy Sep 2008 A1
20080228753 Kenedy Sep 2008 A1
20080228756 Kenedy Sep 2008 A1
20080228757 Kenedy Sep 2008 A1
20080228765 Kenedy Sep 2008 A1
20080228766 Kenedy Sep 2008 A1
20080228767 Kenedy Sep 2008 A1
20080228768 Kenedy Sep 2008 A1
20080228797 Kenedy Sep 2008 A1
20080243843 Kenedy Oct 2008 A1
20080255768 Martin Oct 2008 A1
20080270366 Frank Oct 2008 A1
20090043752 Kenedy Feb 2009 A1
20090099789 Stephan Apr 2009 A1
20090112871 Hawthorne Apr 2009 A1
20090118131 Avey May 2009 A1
20090119083 Avey May 2009 A1
20090182579 Liu Jul 2009 A1
20090198519 Mcnamar Aug 2009 A1
20090299645 Colby Dec 2009 A1
20100042438 Moore Feb 2010 A1
20100063830 Kenedy Mar 2010 A1
20100063835 Kenedy Mar 2010 A1
20100063865 Kenedy Mar 2010 A1
20100070292 Kenedy Mar 2010 A1
20100070455 Halperin Mar 2010 A1
20100076950 Kenedy Mar 2010 A1
20100076988 Kenedy Mar 2010 A1
20100145981 Wojcicki Jun 2010 A1
20100169262 Kenedy Jul 2010 A1
20100169313 Kenedy Jul 2010 A1
20100169338 Kenedy Jul 2010 A1
20100191513 Listgarten Jul 2010 A1
20100281401 Tebbs Nov 2010 A1
20110078168 Kenedy Mar 2011 A1
20110130337 Eriksson Jun 2011 A1
20110184656 Kenedy Jul 2011 A1
20110257889 Klammer Oct 2011 A1
20120270190 Kenedy Oct 2012 A1
20120270794 Eriksson Oct 2012 A1
20120301864 Bagchi Nov 2012 A1
20130080068 Dewey Mar 2013 A1
20130080365 Dewey Mar 2013 A1
20130085728 Tang Apr 2013 A1
20130149707 Sorenson Jun 2013 A1
20130345988 Avey Dec 2013 A1
20140006433 Hon Jan 2014 A1
20140045705 Bustamante Feb 2014 A1
20140067280 Vockley Mar 2014 A1
20140067355 Noto Mar 2014 A1
20150227610 Chowdry Aug 2015 A1
20150248473 Kenedy Sep 2015 A1
20150347566 Kenedy Dec 2015 A1
20160026755 Byrnes Jan 2016 A1
20160103950 Myres Apr 2016 A1
20160171155 Do Jun 2016 A1
20160277408 Hawthorne Sep 2016 A1
20160350479 Han Dec 2016 A1
20200273542 Song Aug 2020 A1
20200321073 Zhi Oct 2020 A1
Foreign Referenced Citations (7)
Number Date Country
2004097712 Nov 2004 WO
WO-2004097712 Nov 2004 WO
2006089238 Aug 2006 WO
2009002942 Dec 2008 WO
2009042975 Apr 2009 WO
2012099890 Jul 2012 WO
2017009788 Jan 2017 WO
Non-Patent Literature Citations (195)
Entry
Ratsch, et al., “Learning Interpretable SVMs for Biological Sequence Classification” BMC Bioinformatics, Mar. 20, 2006, 7(Suppll):S9, pp. 1-14.
Roach JC, et al., Analysis of genetic inheritance in a family quartet by whole-genome sequencing. Science. Apr. 30, 2010;328(5978):636-9. doi: 10.1126/science.1186802. Epub Mar. 10, 2010. PMID: 20220176; PMCID: PMC3037280.
Sankararaman, et al., “Estimating Local Ancestry in Admixed Populations,” The American Journal of Human Genetics, vol. 82, Feb. 2008, pp. 290-303.
Sankararaman, et al., “On the inference of ancestries in admixed populations,” Genome Research, Mar. 2008, vol. 18, pp. 668-675.
Scheet, et al., “A Fast and Flexible Statistical Model for Large-Scale Population Genotype Data: Applications to Inferring Missing Genotypes and Haplotypic Phase,” The American Journal of Human Genetics, vol. 78, Apr. 2006, pp. 629-644.
Sengupta, et al., “Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists,” The American Journal of Human Genetics, vol. 78, Feb. 2006, pp. 202-221.
Shriver, et al., “Ethnic-Affiliation Estimation by Use of Population-Specific DNA Markers,” American Journal of Human Genetics, vol. 60, 1997, pp. 957-964.
Shriver, et al., “Genetic ancestry and the Search for Personalized Genetic Histories,” Nature Reviews Genetics, vol. 5, Aug. 2004, pp. 611-618.
Shriver, M.D et al., “The Genomic Distribution of Population Substructure in Four Populations Using 8,525 Autosomal SNPs”, Human Genomics, 2004, vol. 1, No. 4, pp. 274-286.
Stephens, et al., “A Comparison of Bayesian Methods for Haplotype Reconstruction from Population Genotype Data,” Am. J. Hum. Genet., vol. 73, 2003, pp. 1162-1169.
Stephens, et al., “A New Statistical Method for Haplotype Reconstruction from Population Data,” Am. J. Hum. Genet., vol. 68, 2001, pp. 978-989.
Stephens, et al., “Accounting for Decay of Linkage Disequilibrium in Haplotype Inference and Missing-Data Imputation,” Am. J. Hum. Genet., vol. 76, 2005, pp. 449-462.
Sundquist, et al., “Effect of genetic divergence in identifying ancestral origin using HAPAA” Genome Research, vol. 18, No. 4, Apr. 2008, pp. 676-682.
Tang, et al., “Reconstructing Genetic Ancestry Blocks in Admixed Individuals,” The American Journal of Human Genetics, vol. 79, No. 1, Jul. 2006, pp. 1-12.
Tang, Hua, et al., “Estimation of Individual Admixture: Analytical and Study Design Considerations”, Genetic Epidemiology 28: 289-301 (2005).
The International HapMap Consortium, “A haplotype map of the human genome” vol. 437, Oct. 27, 2005, pp. 1300-1320. doi:10.1038/nature04226.
The International HapMap Consortium, “A second generation human haplotype map of over 3.1 million SNPs,” Nature, vol. 449, Oct. 18, 2007, pp. 851-860. < doi: 10.1038/nature06258>.
Thiele, H., et al., HaploPainter: a tool for drawing Pedigrees with complex haplotypes, vol. 21 No. 8, 2005, pp. 1730-1732.
U.S. Appl. No. 12/381,992, filed Mar. 18, 2009.
U.S. Appl. No. 15/181,083, filed Jun. 13, 2016.
U.S. Appl. No. 15/181,088, filed Jun. 13, 2016.
U.S. Appl. No. 15/950,023, filed Apr. 10, 2018.
U.S. Appl. No. 16/044,364, filed Jul. 24, 2018.
U.S. Appl. No. 16/219,597, filed Dec. 13, 2018.
U.S. Appl. No. 16/226,116, filed Dec. 19, 2018.
U.S. Appl. No. 16/282,221, filed Feb. 21, 2019.
U.S. Appl. No. 16/844,758, filed Apr. 9, 2020.
U.S. Appl. No. 16/915,868, filed Jun. 29, 2020.
U.S. Appl. No. 16/946,829, filed Jul. 8, 2020.
U.S. Appl. No. 17/161,140, filed Jan. 28, 2021.
U.S. Appl. No. 17/387,940, filed Jul. 28, 2021.
U.S. Appl. No. 17/443,946, filed Jul. 28, 2021.
U.S. Appl. No. 17/444,989, filed Aug. 12, 2021.
U.S. Appl. No. 17/662,040, filed May 4, 2022.
U.S. Appl. No. 17/682,761, filed Feb. 28, 2022.
U.S. Appl. No. 17/707,790, filed Mar. 29, 2022.
Uddin, et al., “Variability of Haplotype Phase and Its Effect on Genetic Analysis,” Electrical and Computer Engineering, 2008, CCECE 2008, Canadian Conference on, IEEE, 2008, pp. 000596-000600.
Underhill, et al., “Use of Y Chromosome and Mitochondrial DNA Population Structure in Tracing Human Migrations,” Annu. Rev. Genet., vol. 41, 2007, pp. 539-564.
Van Rossum, G., “Python reference manual” Computer Science/Department of Algorithmics and Architecture, CS-R9525, Apr. 10, 1995, version 1.2, pp. 1-59.
Ward, J.J. et al., “Secondary Structure Prediction with Support Vector Machines”, Bioinformatics, 2003, vol. 19, No. 13, pp. 1650-1655.
Yang, et al., “Examination of Ancestry and Ethnic Affiliation Using Highly Informative Diallelic DNA Markers: Application to Diverse and Admixed Populations and Implications for Clinical Epidemiology and Forensic Medicine,” Human Genetics, vol. 118, 2005, pp. 382-392.
Yoon, Byung-Jun, “Hidden Markov Models and their Applications in Biological Sequence Analysis,” Current Genomics, vol. 10, 2009, pp. 402-415.
Yousef, Malik, et al., “Recursive Cluster Elimination (RCE) for Classification and Feature Selection From Gene Expression Data,” BMC Bioinformatics, vol. 8, May 2007, pp. 1-12.
Yu, Haiyuan et al., “Total Ancestry Measure: quantifying the similarity in tree-like classification, with genomic applications” Bioinformatics, vol. 23, No. 16, May 31, 2007, pp. 2163-2173.
Zhou, Nina, et al., “Effective Selection of Informative SNPs and Classification on the HapMap Genotype Data,” BMC Bioinformatics, vol. 8, No. 1, 2007, pp. 1-9.
Office Action, U.S. Appl. No. 14/924,562, mailed Jun. 5, 2019.
Office Action, U.S. Appl. No. 14/924,562, mailed Jan. 8, 2020.
Office Action, U.S. Appl. No. 14/938,111, mailed Sep. 25, 2018.
Office Action, U.S. Appl. No. 14/938,111, mailed Jun. 24, 2019.
Office Action, U.S. Appl. No. 15/181,083, mailed Jan. 23, 2018.
Office Action, U.S. Appl. No. 15/181,088, mailed Jun. 25, 2019.
Office Action, U.S. Appl. No. 15/267,053, mailed Sep. 26, 2018.
Office Action, U.S. Appl. No. 15/950,023, mailed Dec. 30, 2020.
Office Action, U.S. Appl. No. 15/950,023, mailed Jun. 29, 2021.
Office Action, U.S. Appl. No. 15/950,023, mailed Jan. 25, 2022.
Office Action, U.S. Appl. No. 15/950,023, mailed Aug. 12, 2022.
Office Action, U.S. Appl. No. 16/044,364, mailed Feb. 11, 2019.
Office Action, U.S. Appl. No. 16/226,116, mailed Nov. 1, 2021.
Office Action, U.S. Appl. No. 16/240,641, mailed Nov. 19, 2021.
Office Action, U.S. Appl. No. 16/282,221, mailed Feb. 4, 2022.
Office Action, U.S. Appl. No. 16/446,465, mailed Oct. 11, 2019.
Office Action, U.S. Appl. No. 16/844,758, mailed Oct. 5, 2020.
Office Action, U.S. Appl. No. 16/844,758, mailed Feb. 2, 2021.
Office Action, U.S. Appl. No. 16/844,758, mailed Oct. 1, 2021.
Office Action, U.S. Appl. No. 16/844,758, mailed Apr. 11, 2022.
Office Action, U.S. Appl. No. 16/844,758, mailed Sep. 1, 2022.
Office Action, U.S. Appl. No. 16/915,868, mailed Oct. 20, 2020.
Office Action, U.S. Appl. No. 16/915,868, mailed Feb. 10, 2021.
Office Action, U.S. Appl. No. 16/946,829, mailed Nov. 16, 2022.
Office Action, U.S. Appl. No. 16/947,107, mailed Mar. 13, 2023.
Office Action, U.S. Appl. No. 16/947,107, mailed Aug. 17, 2023.
Office Action, U.S. Appl. No. 17/161,140, mailed Jun. 3, 2021.
Office Action, U.S. Appl. No. 17/161,140, mailed Oct. 1, 2021.
Office Action, U.S. Appl. No. 17/161,140, mailed Apr. 15, 2022.
Office Action, U.S. Appl. No. 17/249,520, mailed Jun. 1, 2021.
Office Action, U.S. Appl. No. 17/249,520, mailed Dec. 29, 2021.
Office Action, U.S. Appl. No. 17/249,520, mailed Nov. 23, 2022.
Office Action, U.S. Appl. No. 17/249,520, mailed Feb. 7, 2023.
Office Action, U.S. Appl. No. 17/387,940, mailed Jan. 24, 2022.
Office Action, U.S. Appl. No. 17/662,040, mailed Jul. 10, 2023.
Office Action, U.S. Appl. No. 17/682,761, mailed Jun. 7, 2022.
Office Action, U.S. Appl. No. 17/707,790, mailed Dec. 15, 2022.
Office Action, U.S. Appl. No. 18/157,595, mailed May 1, 2023.
Office Action, U.S. Appl. No. 18/157,595, mailed Aug. 24, 2023.
Pasaniuc et al., “Highly Scalable Genotype Phasing By Entropy Minimization,” Engineering in Medicine and Biology Society, 2006, EMBS'06, 28th Annual International Conference of the IEEE, 2006, 5 pages.
Pasaniuc, et al., “Inference of locus-specific ancestry in closely related populations,” Bioinformatics, 25(12) Jun. 2009, pp. i213-i221.
Patterson, et al., “Population Structure and Eigenanalysis,” PLoS Genetics, vol. 2, No. 12, e190, Dec. 2006, pp. 2074-2093.
Phillips, et al., “Inferring Ancestral Origin Using a Single Multiplex Assay of Ancestry-Informative Marker SNPs,” Forensic Science International, Genetics, vol. 1, 2007, pp. 273-280.
Pool, et al., “Inference of Historical Changes in Migration Rate From the Lengths of Migrant Tracts,” Genetics, 181(2), Feb. 2009, pp. 711-719.
Price, et al. “Sensitive Detection of Chromosomal Segments of Distinct Ancestry in Admixed Populations,” PLoS Genetics, vol. 5, No. 6, Jun. 19, 2009 (e1000519) pp. 1-18.
Pritchard, et al., “Association Mapping in Structured Populations,” Am. J. Hum. Genet., vol. 67, 2000, pp. 170-181.
Pritchard, et al., “Inference of population structure using multilocus genotype data” Genetics 155, (2000) pp. 945-959.
Purcell, et al., “PLINK: a toolset for whole-genome association and population-based linkage analysis”, Am. J. Hum. Genet., vol. 81, Sep. 2007, pp. 559-575.
Rabiner, L., “A Tutorial on Hidden Markov Models and Selected Applications in Speech Recognition,” Proceedings of the IEEE, vol. 77, No. 2, Feb. 1989, pp. 257-286.
Ma, et al., “PatternHunter: faster and more sensitive homology search” Bioinformatics, vol. 18, No. 3 (2002) pp. 440-445.
Mahieu, L., [webpage] “My (free) Ancestry.com DNA results—a comparison to FamilyTreeDNA,” Genejourneys (Internet Blog), published online Mar. 6, 2012, pp. 1-3. [retrieved May 23, 2018].
McCarthy, et al., “A reference panel of 64,976 haplotypes for genotype imputation” Nature genetics, 48(10), Oct. 2016, pp. 1279-1283.
Moore, C., [webpage] “LivingSocial's AncestrybyDNA Offer is Not the AncestryDNA Test!” Your Genetic Genealogist (Internet Blog), published online Sep. 18, 2012, pp. 1-2. [retrieved May 23, 2018].
Moore, C., [webpage] “New Information on Ancestry.com's AncestryDNA Product,” Your Genetic Genealogist (Internet Blog), published online Mar. 30, 2012, pp. 1-3. [retrieved May 23, 2018].
Ng, et al., “On discriminative vs. generative classifiers: A comparison of logistic regression and naive Bayes” Advances in neural information processing systems, 14:841, 2002.
Notice of Allowance, U.S. Appl. No. 13/800,683, mailed Jan. 20, 2016.
Notice of Allowance, U.S. Appl. No. 13/800,683, mailed May 3, 2016.
Notice of Allowance, U.S. Appl. No. 13/801,056, mailed May 18, 2015.
Notice of Allowance, U.S. Appl. No. 13/801,056, mailed Aug. 12, 2015.
Notice of Allowance, U.S. Appl. No. 13/801,386, mailed Jul. 24, 2017.
Notice of Allowance, U.S. Appl. No. 13/801,552, mailed Feb. 4, 2015.
Notice of Allowance, U.S. Appl. No. 13/801,552, mailed Jun. 26, 2015.
Notice of Allowance, U.S. Appl. No. 13/801,552, mailed Aug. 12, 2015.
Notice of Allowance, U.S. Appl. No. 13/801,653, mailed Dec. 28, 2017.
Notice of Allowance, U.S. Appl. No. 14/938,111, mailed Apr. 29, 2019.
Notice of Allowance, U.S. Appl. No. 14/938,111, mailed Jan. 9, 2020.
Notice of Allowance, U.S. Appl. No. 15/181,083, mailed Aug. 14, 2018.
Notice of Allowance, U.S. Appl. No. 15/181,083, mailed Nov. 15, 2018.
Notice of Allowance, U.S. Appl. No. 15/181,088, mailed Feb. 26, 2020.
Notice of Allowance, U.S. Appl. No. 16/044,364, mailed Nov. 12, 2019.
Notice of Allowance, U.S. Appl. No. 16/446,465, mailed Apr. 2, 2020.
Notice of Allowance, U.S. Appl. No. 17/161,140, mailed Aug. 23, 2022.
Notice of Allowance, U.S. Appl. No. 17/444,989, mailed Feb. 25, 2013.
Notice of Allowance, U.S. Appl. No. 17/682,761, mailed Aug. 10, 2022.
Notice of Allowance, U.S. Appl. No. 18/058,029, mailed Feb. 7, 2023.
Notice of Allowance, U.S. Appl. No. 18/180,691, mailed Feb. 25, 2013.
Office Action, U.S. Appl. No. 12/381,992, mailed Aug. 2, 2011.
Office Action, U.S. Appl. No. 12/381,992, mailed Dec. 20, 2011.
Office Action, U.S. Appl. No. 12/381,992, mailed Aug. 6, 2013.
Office Action, U.S. Appl. No. 12/381,992, mailed Feb. 27, 2013.
Office Action, U.S. Appl. No. 12/381,992, mailed Aug. 7, 2014.
Office Action, U.S. Appl. No. 12/381,992, mailed Dec. 22, 2014.
Office Action, U.S. Appl. No. 12/381,992, mailed May 22, 2015.
Office Action, U.S. Appl. No. 12/381,992, mailed Nov. 3, 2015.
Office Action, U.S. Appl. No. 12/381,992, mailed Mar. 16, 2016.
Office Action, U.S. Appl. No. 13/800,683, mailed Aug. 12, 2015.
Office Action, U.S. Appl. No. 13/801,056, mailed Jan. 29, 2015.
Office Action, U.S. Appl. No. 13/801,386, mailed Jul. 8, 2015.
Office Action, U.S. Appl. No. 13/801,386, mailed Jan. 11, 2016.
Office Action, U.S. Appl. No. 13/801,386, mailed Oct. 27, 2016.
Office Action, U.S. Appl. No. 13/801,552, mailed Mar. 16, 2015.
Office Action, U.S. Appl. No. 13/801,653, mailed Sep. 30, 2015.
Office Action, U.S. Appl. No. 13/801,653, mailed May 31, 2016.
Office Action, U.S. Appl. No. 13/801,653, mailed Apr. 19, 2017.
Office Action, U.S. Appl. No. 14/924,552, mailed Feb. 9, 2018.
Office Action, U.S. Appl. No. 14/924,552, mailed Sep. 4, 2018.
Office Action, U.S. Appl. No. 14/924,562, mailed Jan. 30, 2018.
Office Action, U.S. Appl. No. 14/924,562, mailed Sep. 13, 2018.
23andMeBlog [webpage] “New Feature: Ancestry Painting,” by 23andMe, Ancestry, published online Mar. 25, 2008, pp. 1. [retrieved May 23, 2018] .
Advisory Action, U.S. Appl. No. 15/950,023, mailed Nov. 23, 2022.
Akbani, R et al., “Applying Support Vector Machines to Imbalanced Datasets”, In Machine Learning: ECML 2004; Boulicaut, J.- F., Esposito, F., Giannotti, F., Pedreschi, D., Eds.; Lecture Notes in Computer Science; Springer Berlin Heidelberg: Berlin, Heidelberg, 2004; vol. 3201, pp. 39-50.
Alexander, et al., “Fast model-based estimation of ancestry in unrelated individuals”, Genome Research 19, (2009) pp. 1655-1664.
Ball, C et al., “ancestryDNA—AncestryDNA Matching White Paper—Discovering genetic matches across a massive, expanding genetic database” AncestryDNA, Jul. 15, 2020, pp. 1-34.
Ball, C et al., “ancestryDNA—DNA Circles White Paper—2014” AncestryDNA 2014, pp. 1-43.
Ball, C et al., [Webpage] “ancestryDNA—Genetic Communities White Paper: Predicting fine-scale ancestral origins from the genetic sharing patterns among millions of individuals” Ancestry.com, Genetic Communities, pp. 1-28. [retrieved on Jan. 22, 2021].
Bettinger, B., [webpage] “AncestryDNA Launches New Ethnicity Estimate,” The Genetic Genealogist (Internet Blog), published online Sep. 12, 2013, pp. 1-4. [retrieved May 23, 2018],.
Bettinger, B., [webpage] “AncestryDNA Officially Launches,” The Genetic Genealogist (Internet Blog), published online May 3, 2012, pp. 1-2. [retrieved May 23, 2018].
Bettinger, B., [webpage] “The Monday Morning DNA Testing Company Review — AncestryByDNA, The Genetic Genealogist (Internet Blog), published Feb. 26, 2007, p. 1. [retrieved May 23, 2018].
Bohringer, S., et al., “A Software Package for Drawing Ideograms Automatically,” Online J Bioinformatics, vol. 1, 2002, pp. 51-61.
Boser, et al., “A training algorithm for optimal margin classifiers” In Proceedings of the fifth annual workshop on computational learning theory, ACM, 1992, pp. 144-152.
Brion, M., et al., “Introduction of a Single Nucleodite Polymorphism—Based ”Major Y—Chromosome Haplogroup Typing Kit Suitable for Predicting the Geographical Origin of Male Lineages, Electrophoresis, vol. 26, 2005, pp. 4411-4420.
Browning, Brian L., and Sharon R Browning, “Efficient multilocus association testing for whole genome association 42 studies using localized haplotype clustering”, Genetic Epidemiology: The Official Publication of the International Genetic Epidemiology Society 31, No. 5 (2007): 365-375.
Browning, Sharon R, and Brian L. Browning,“Rapid and accurate haplotype phasing and missing-data inference for whole-genome association studies by use of localized haplotype clustering,” The American Journal of Human Genetics, No. 5 (2007): 1084-1097.
Burroughs et al., “Analysis of Distributed Intrusion Detection Systems Using Bayesian Methods,” Performance, Computing and Communications Conference, 2002, 21st IEEE International. IEEE, 2002, pp. 329-334.
Cann, et al., “A human genome diversity cell line panel” Science, 296(5566), Apr. 12, 2002, vol. 296 No. 5566, pp. 261-262.
Cavalli-Sforza et al., The History and Geography of Human Genes, 1994, pp. 77-81, 90-93, 169-171.
Cavalli-Sforza, L., “The Human Genome Diversity Project: past, present and future,” Nature Reviews, Genetics, vol. 6, Apr. 2005, pp. 333-340.
Chiang, et al., “Conflation of Short Identity-by-Descent Segments Bias Their Inferred Length Distribution”, G3 Genes| Genomes|Genetics, vol. 6, No. 5, May 1, 2016, pp. 1287-1296.
Crawford, et al., “Evidence for substantial fine-scale variation in recombination rates across the human genome,” Nature Genetics, vol. 36, No. 7, Jul. 2004, pp. 700-706.
Dean, M., et al., “Polymorphic Admixture Typing in Human Ethnic Populations,” American Journal of Human Genetics, vol. 55:4, 1994, pp. 788-808.
Delaneau, et al., “A Linear complexity phasing method for thousands of genomes,” Nature Methods, vol. 9, No. 2, Feb. 2012, pp. 179-184.
Dempster, et al., “Maximum likelihood from incomplete data via the EM algorithm” Journal of the Royal Statistical Society, Series B, 39(1), 1977, pp. 1-38.
DODECAD Project, [webpage] “Clusters Galore results, K=73 for Dodecad Project members (up to DOD581)” Dodecad Ancestry Project (Internet Blog), published Mar. 31, 2011, pp. 1-11. [retrieved May 23, 2018].
Druet, Tom, et al., “A Hidden Markov Model Combining Linkage and Linkage Disequilibrium Information for Haplotype Reconstruction and Quantitative Trait Locus Fine Mapping,” Genetics vol. 184, No. 3, Jun. 2010, pp. 789-798.
Extended European Search Report, European Patent Application No. 20843426.6, mailed Jul. 7, 2023.
Falush, et al., “Inference of population structure using multilocus genotype data:linked loci and correlated allele frequencies” Genetics 164, (2003) pp. 1567-1587.
Feng et al., “Mining Multiple Temporal Patterns of Complex Dynamic Data Systems,” Computational Intelligence and Data Mining, IEEE, 2009, 7 pages.
Fujimura, J. H., et al., Different Differences: The Use of 'genetic Ancestry' versus Race in Biomedical Human Genetic Research, Soc. Stud Sci. Feb. 2011 ; 41(1): 5-30.
Gu et al., “Phenotypic Selection for Dormancy Introduced a Set of Adaptive Haplotypes from Weedy Into Cultivated Rice,” Genetics Society of America, vol. 171, Oct. 2005, pp. 695-704.
Gusev, et al., “Whole population, genome-wide mapping of hidden relatedness,” Genome Research, vol. 19, 2009, pp. 318-326.
Halder, Indrani, et al., “A Panel of Ancestry Informative Markers for Estimating Individual Biogeographical Ancestry and Admixture From Four Continents: Utility and Applications,” Human Mutation, vol. 29, No. 5, 2008, pp. 648-658.
He, et al., “Multiple Linear Regression for Index SNP Selection on Unphased Genotypes,” Engineering in Medicine and Biology Society, EMBS Annual International Conference of the IEEE, Aug. 30-Sep. 3, 2006, pp. 5759-5762.
Howie, et al., “A Flexible and Accurate Genotype Imputation Method for the Next Generation of Genome-Wide Association Studies,” PLOS Genetics, vol. 5, No. 6, Jun. 2009, pp. 1-15.
International HapMap Consortium “A second generation human haplotype map of over 3.1 million SNPs” Nature 449 (764) Oct. 18, 2007, pp. 851-861.
International Search Report, PCT App. No. PCT/US2020/042628, mailed Dec. 29, 2020.
International Search Report, PCT App. No. PCT/US2021/045880, mailed Nov. 15, 2021.
Jaakkola, et al., “Exploiting generative models in discriminative classifiers” Advances in neural information processing systems, (1999) pp. 487-493.
Kerchner, [webpage] “DNAPrint Test Results—East Asian vs Native American Minority Admixture Detection,” PA Deutsch Ethnic Group DNA Project, created Jun. 26, 2004, updated May 27, 2005, pp. 1-9. [retrieved May 23, 2018].
Khatri et al., Ontological Analysis of Gene Expression Data, 2005, Bioinformatics, vol. 21, No. 18 2005, pp. 3587-3595.
Kraak, M-J, “Visualising Spatial Distributions,” Geographical Information Systems: Principles, Techniques, Applications and Management, New York, John Wiley and Sons, 1999, pp. 157-173.
Lafferty, et al., “Conditional random fields: Probabilistic models for segmenting and labeling sequence data” Proceedings of the 18th International Conference on Machine Learning (ICML-2001), Jun. 28, 2001, pp. 1-10.
Li, et al. “Worldwide Human Relationships Inferred from Genome-Wide Patterns of Variation,” Science, vol. 319, Feb. 22, 2008, pp. 1100-1104.
Li, et al., “Mapping short DNA sequencing reads and calling variants using mapping quality scores,” Genome Research, Aug. 19, 2008, pp. 1851-1858.
Li, et al., “Modeling linkage disequilibrium and identifying recombination hotspots using single-nucleotide polymorphism data” Genetics 165, (2003) pp. 2213-2233.
Liang et al., “A Deterministic Sequential Monte Carlo Method for Haplotype Inference,” IEEE Journal of Selected Topics in Signal Processing, vol. 2, No. 3, Jun. 2008, pp. 322-331.
Lin et al. “Polyphase Speech Recognition,” Acoustics, Speech and Signal Processing, IEEE International Conference on 2008, IEEE, 2008, 4 pages.
Extended European Search Report, European Patent Application No. 21856763.4, mailed Nov. 16, 2023.
Office Action, U.S. Appl. No. 18/157,595, mailed Jan. 2, 2024.
Office Action, U.S. Appl. No. 18/503,841, mailed Jan. 9, 2024.
Stasko et al., Focus+Context Display and Navigation Techniques for Enhancing Radial, Space-Filling Hierarchy Visualizations, Proc. of the IEEE Symposium on Information Visualization, Feb. 2000.
Related Publications (1)
Number Date Country
20240062115 A1 Feb 2024 US
Provisional Applications (1)
Number Date Country
61070310 Mar 2008 US
Continuations (6)
Number Date Country
Parent 18180691 Mar 2023 US
Child 18472019 US
Parent 18058029 Nov 2022 US
Child 18180691 US
Parent 17682761 Feb 2022 US
Child 18058029 US
Parent 16226116 Dec 2018 US
Child 17682761 US
Parent 15267053 Sep 2016 US
Child 16226116 US
Parent 12381992 Mar 2009 US
Child 15267053 US