Patent Application
20230000916
Immunotherapy involving the priming and expansion of T lymphocytes (T cells) holds the promise of effective treatment of cancer and infectious diseases. Current clinical uses of adoptive transfer therapy in patients with cancer and viral infections regularly involves the infusion of T cells that have been stimulated, cloned and expanded for many weeks in vitro on autologous dendritic cells (DC), virally infected B cells, and/or allogeneic feeder cells. However, adoptive T cell immunotherapy clinical trials routinely require billions of cells per patient. In order to produce these quantities of cells, T cells must be subjected to many fold expansion in vitro, requiring up to 40 population doublings. Furthermore, for optimal engraftment potential and possible therapeutic benefit at the time of re-infusion, it is important to ensure that the expanded T cells remain functional and are not senescent or exhausted.
Methods of expanding T cell clones and/or lines for adoptive immunotherapy have proven to have certain drawbacks. The standard culture of pure CD8+ cells is limited by apoptosis, diminution of biological function and/or proliferation, and obtaining a sufficient number of cells to be useful has been particularly difficult. Indeed, it is possible that such T cells that are currently infused into patients, may have a limited replicative capacity, and therefore, could not stably engraft to provide long-term protection from disease. Furthermore, the various techniques available for expanding human T cells have relied primarily on the use of accessory cells (i.e. cells that support or promote T cell survival and proliferation such as PBMCs, DCs, B cells, monocytes, etc.) and/or exogenous growth factors, such as interleukin-2 (IL-2), IL-7, and IL-15. The requirement for accessory cells presents a significant problem for long-term culture systems because these cells are relatively short-lived. Therefore, in a long-term culture system, APCs must be continually obtained and replenished. The necessity for a renewable supply of accessory cells is problematic for treatment of immunodeficiencies in which accessory cells are affected. Likewise the need for exogenous mixtures of cytokines to support expansion and function of cultured T cells adds considerably to the costs, especially when stable sources of GMP-grade materials are required.
Thus, there exists a need to provide ways to stimulate T cells to combat various acute and chronic diseases and to promulgate sufficient numbers of therapeutic T cells for adoptive immunotherapy. The present invention addresses this need.
As described herein, the present invention relates to single-chain variable fragments (scFvs) specific for CD3 and artificial antigen-presenting cells (aAPCs) comprising anti-CD3 scFvs, as well as compositions comprising said aAPCs and aAPC-derived membrane vesicles, as well as methods of expanding T cells comprising said anti-CD3 scFvs, artificial APCs, aAPC-derived membrane vesicles, and compositions thereof.
As such, in one aspect, the invention includes an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, and a transmembrane domain, wherein the antigen binding domain comprises:
In some embodiments, the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 6.
In some embodiments, the antigen binding domain comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7.
In some embodiments, the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 6, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7.
In some embodiments, the antigen binding domain is a single chain variable fragment (scFv).
In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 8.
In some embodiments, the non-human primate is Macaca fascicularis.
In some embodiments, the non-human primate is Macaca mulatta.
The aAPC of any preceding claim, wherein the chimeric receptor molecule further comprises an intracellular domain.
In some embodiments, the intracellular domain comprises the intracellular domain of CD3 zeta.
In some embodiments, the intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 19.
In another aspect, the invention includes an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
In some embodiments, the intracellular domain comprises the intracellular domain of CD3 zeta.
In some embodiments, the intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 19.
In another aspect, the invention includes an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3, and a transmembrane domain, wherein the antigen binding domain comprises:
In some embodiments, the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15.
In some embodiments, the antigen binding domain comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 16.
In some embodiments, the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 16.
In some embodiments, the antigen binding domain is a single chain variable fragment (scFv).
In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 17.
In some embodiments, the chimeric receptor molecule further comprises a hinge domain.
In some embodiments, the hinge domain is a CD8 hinge domain.
In some embodiments, the hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 21.
In some embodiments, the transmembrane domain is a CD8 transmembrane domain.
In some embodiments, the transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 22.
In some embodiments, the chimeric receptor molecule comprises the amino acid sequence set forth in SEQ ID NO: 23 or 24.
In some embodiments, the chimeric receptor molecule is encoded by a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 25 or 26.
In some embodiments, the chimeric receptor molecule consists of the amino acid sequence set forth in SEQ ID NO: 23 or 24.
In some embodiments, the chimeric receptor molecule is encoded by a nucleic acid consisting of the nucleic acid sequence set forth in SEQ ID NO: 25 or 26.
In some embodiments, the chimeric receptor molecule is constitutively expressed.
In some embodiments, the aAPC is an engineered K562 cell.
In some embodiments, the engineered K562 cell does not endogenously express one or more molecules selected from the group consisting of HLA class I, HLA class II, CD1d, CD16, CD64, CD83, CD86, 4-1BBL, OX40L, ICOSL, CD40L, PD-L1, PD-L2, B7-H3, and B7-H4.
In some embodiments, the aAPC further comprises an Fc receptor expressed at the cell surface.
In some embodiments, the Fc receptor is CD64.
In some embodiments, the aAPC further comprises a co-stimulatory molecule expressed at the cell surface.
In some embodiments, the co-stimulatory molecule is CD86.
In some embodiments, the aAPC further comprises an Fc receptor expressed at the cell surface, and a co-stimulatory molecule expressed at the cell surface.
In some embodiments, the Fc receptor is CD64, and the co-stimulatory molecule is CD86.
In some embodiments, the aAPC is loaded with an antibody, wherein the Fc fragment of the antibody is bound by the Fc receptor.
In some embodiments, the antibody has specificity for a molecule selected from the group consisting of CD3, CD28, PD-1, B7-H3, 4-1BB, OX40, ICOS, CD30, HLA-DR, MHCII, Toll Ligand Receptor and LFA-1.
In some embodiments, the aAPC further comprises a co-stimulatory ligand.
In some embodiments, the co-stimulatory ligand is selected from the group consisting of CD7, B7-1 (CD80), PD-L1, PD-L2, 4-1BBL, OX40L, ICOS-L, ICAM, CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, ILT3, ILT4, 3/TR6, and a ligand that specifically binds with B7-H3.
In some embodiments, the co-stimulatory ligand is 4-1BBL.
In some embodiments of the above aspects or any other aspect or embodiment of the invention, the aAPC expresses one or more cytokines selected from the group consisting of IL-2, IL-4, IL-5, IL-7, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-35, and TGF-β.
In some embodiments of the above aspects or any other aspect or embodiment of the invention, the aAPC expresses IL-7.
In some embodiments of the above aspects or any other aspect or embodiment of the invention, the aAPC expresses IL-15.
In some embodiments of the above aspects or any other aspect or embodiment of the invention, the aAPC expresses IL-7 and IL-15.
In some embodiments of the above aspects or any other aspect or embodiment of the invention, the aAPC expresses an IL-15R.
In some preferred embodiments, the IL-15R is IL-15Ra.
In some preferred embodiments, the cytokine is constitutively expressed.
In another aspect, the invention includes an artificial antigen presenting cell (aAPC) comprising:
In another aspect, the invention includes an artificial antigen presenting cell (aAPC) comprising:
In some embodiments, the aAPC further comprises an IL-15R.
In some embodiments, the IL-15R is IL-15Ra.
In another aspect, the invention includes a composition comprising the aAPC of any preceding claim.
In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.
In another aspect, the invention includes a method for stimulating and expanding a T cell, comprising contacting the T cell with the artificial presenting cell (aAPC) of any of the above aspects or any aspect or embodiment of the present disclosure.
In some embodiments, the T cell is an autologous T cell.
In some embodiments, the T cell is a human T cell.
In another aspect, the invention includes a method for stimulating and expanding a regulatory T cell (Treg), comprising contacting the Treg with the artificial presenting cell (aAPC) of any of the above aspects or any other aspect or embodiment of the current invention.
In some embodiments, the regulatory T cell is a human T cell.
In some embodiments, the regulatory T cell is a non-human primate T cell.
In some preferred embodiments, the non-human primate is Macaca fascicularis.
In some preferred embodiments, the non-human primate is Macaca mulatta.
In another aspect, the invention includes a method for stimulating and expanding a T cell, comprising contacting the T cell with an artificial antigen presenting cell (aAPC), wherein the aAPC comprises:
wherein the aAPC is an engineered K562 cell.
In another aspect, the invention includes a method for stimulating and expanding a T cell, comprising contacting the T cell with an artificial antigen presenting cell (aAPC), wherein the aAPC comprises:
wherein the aAPC is an engineered K562 cell.
In another aspect, the invention includes a composition comprising membrane vesicles derived from an artificial antigen-presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
In some embodiments, the disruption of the aAPC is accomplished by a method selected from the group consisting of mechanical homogenization, ultrasonic homogenization, pressure homogenization, temperature cycling, and nitrogen cavitation.
In some embodiments, the disruption of the aAPC is accomplished by nitrogen cavitation.
In another aspect, the invention includes a composition comprising membrane vesicles derived from an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
In some embodiments, the disruption of the aAPC is accomplished by a method selected from the group consisting of mechanical homogenization, ultrasonic homogenization, pressure homogenization, temperature cycling, and nitrogen cavitation.
In some embodiments, the disruption of the aAPC is accomplished by nitrogen cavitation.
In another aspect, the invention includes a method for stimulating and expanding a T cell, comprising contacting the T cell with the composition of the above aspects or any other aspect or embodiment of the current invention.
In another aspect, the invention includes a method for stimulating and expanding a T cell, comprising contacting the T cell with a composition comprising membrane vesicles derived from an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
wherein the aAPC is an engineered K562 cell, and
wherein the membrane vesicles are generated by the disruption of the aAPC.
In some embodiments, the disruption of the aAPC is accomplished by a method selected from the group consisting of mechanical homogenization, ultrasonic homogenization, pressure homogenization, temperature cycling, and nitrogen cavitation.
In some embodiments, the disruption of the aAPC is accomplished by nitrogen cavitation.
In another aspect, the invention includes a method for stimulating and expanding a T cell, comprising contacting the T cell with a composition comprising membrane vesicles derived from an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
In some embodiments, the disruption of the aAPC is accomplished by a method selected from the group consisting of mechanical homogenization, ultrasonic homogenization, pressure homogenization, temperature cycling, and nitrogen cavitation.
In some embodiments, the disruption of the aAPC is accomplished by nitrogen cavitation.
The following detailed description of specific embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings exemplary embodiments. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.
It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of “or” means “and/or” unless stated otherwise. The use of the term “including,” as well as other forms, such as “includes” and “included,” is not limiting.
Generally, nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein is well-known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
That the disclosure may be more readily understood, select terms are defined below.
The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
“About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
“Activation,” as used herein, refers to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation. Activation can also be associated with induced cytokine production, and detectable effector functions. The term “activated T cells” refers to, among other things, T cells that are undergoing cell division.
As used herein, to “alleviate” a disease means reducing the severity of one or more symptoms of the disease.
The term “antibody,” as used herein, refers to an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. Tetramers may be naturally occurring or reconstructed from single chain antibodies or antibody fragments. Antibodies also include dimers that may be naturally occurring or constructed from single chain antibodies or antibody fragments. The antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab′)2, as well as single chain antibodies (scFv), humanized antibodies, and human antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, N.Y.; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
The term “antibody fragment” refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab′, F(ab′)2, and Fv fragments, linear antibodies, scFv antibodies, single-domain antibodies, such as camelid antibodies (Riechmann, 1999, Journal of Immunological Methods 231:25-38), composed of either a VL or a VH domain which exhibit sufficient affinity for the target, and multispecific antibodies formed from antibody fragments. The antibody fragment also includes a human antibody or a humanized antibody or a portion of a human antibody or a humanized antibody.
An “antibody heavy chain,” as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations.
An “antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations. κ and λ light chains refer to the two major antibody light chain isotypes.
By the term “synthetic antibody” as used herein, is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
“Humanized” and “chimeric” forms of non-human (e.g., murine) antibodies are immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab′, F(ab)2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized and chimeric antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized and chimeric antibodies can comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humanized and chimeric antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence. The humanized and chimeric antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. The World Health Organization (WHO) International Nonproprietary Name (INN) Expert Group has defined requirements for non-human derived antibodies to be considered “humanized”. According to guidelines, comparison of a candidate antibody to human sequences should be done through the International Immunogenetics Information System® (IMGT®) DomainGapAlign tool (www.imgt.org). This tool interrogates the IMGT® database of antibody germline variable region genes where the alignment score is made only against germline sequence variable region exons, thus omitting part of CDR3 and the J region from the analysis. For an antibody to be “humanized”, in addition to being “closer to human than to other species”, the top “hit” should be human and the identity to human sequences must be at least 85%, otherwise the antibody would be designated as “chimeric”. For further details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.
The term “antigen” as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen.
Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
As used herein, the term “autologous” is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
“Co-stimulatory ligand”, as the term is used herein, includes a molecule on an antigen presenting cell (e.g., an aAPC, dendritic cell, B cell, and the like) that specifically binds a cognate co-stimulatory molecule on a T cell, thereby providing a signal which, in addition to the primary signal provided by, for instance, binding of a TCR/CD3 complex with an MHC molecule loaded with peptide, mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like. A co-stimulatory ligand can include, but is not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3/TR6, ILT3, ILT4, HVEM, an agonist or antibody that binds Toll ligand receptor and a ligand that specifically binds with B7-H3.
A “co-stimulatory molecule” refers to the cognate binding partner on a T cell that specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory response by the T cell, such as, but not limited to, proliferation. Co-stimulatory molecules include, but are not limited to CD86, 4-1BBL, BTLA and a Toll ligand receptor.
A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
“Effective amount” or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to an amount that when administered to a mammal, causes a detectable level of immune suppression or tolerance compared to the immune response detected in the absence of the composition of the invention. The immune response can be readily assessed by a plethora of art-recognized methods. The skilled artisan would understand that the amount of the composition administered herein varies and can be readily determined based on a number of factors such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the particular compound being administered, and the like.
“Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.
The term “epitope” as used herein is defined as a small chemical molecule on an antigen that can elicit an immune response, inducing B and/or T cell responses. An antigen can have one or more epitopes. Most antigens have many epitopes; i.e., they are multivalent. In general, an epitope is roughly about 10 amino acids and/or sugars in size. Preferably, the epitope is about 4-18 amino acids, more preferably about 5-16 amino acids, and even more most preferably 6-14 amino acids, more preferably about 7-12, and most preferably about 8-10 amino acids. One skilled in the art understands that generally the overall three-dimensional structure, rather than the specific linear sequence of the molecule, is the main criterion of antigenic specificity and therefore distinguishes one epitope from another. Based on the present disclosure, a peptide used in the present invention can be an epitope.
As used herein, the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
The term “expand” as used herein refers to increasing in number, as in an increase in the number of T cells. In one embodiment, the T cells that are expanded ex vivo increase in number relative to the number originally present in the culture. In another embodiment, the T cells that are expanded ex vivo increase in number relative to other cell types in the culture. The term “ex vivo,” as used herein, refers to cells that have been removed from a living organism, (e.g., a human) and propagated outside the organism (e.g., in a culture dish, test tube, or bioreactor).
The term “expression” as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
“Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
“Identity” as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
The term “immune response” as used herein is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and/or activate lymphocytes to remove the antigen.
The term “immunosuppressive” is used herein to refer to reducing overall immune response.
“Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
A “lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo.
By the term “modified” as used herein, is meant a changed state or structure of a molecule or cell of the invention. Molecules may be modified in many ways, including chemically, structurally, and functionally. Cells may be modified through the introduction of nucleic acids.
By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
The term “oligonucleotide” typically refers to short polynucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, C, G), this also includes an RNA sequence (i.e., A, U, C, G) in which “U” replaces “T.”
Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
“Parenteral” administration of an immunogenic composition includes, e.g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques.
The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR, and the like, and by synthetic means.
As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
By the term “specifically binds,” as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific. In some instances, the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope “A”, the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody.
By the term “stimulation,” is meant a primary response induced by binding of a stimulatory molecule (e.g., a TCR/CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR/CD3 complex. Stimulation can mediate altered expression of certain molecules, such as downregulation of TGF-beta, and/or reorganization of cytoskeletal structures, and the like.
A “stimulatory molecule,” as the term is used herein, means a molecule on a T cell that specifically binds with a cognate stimulatory ligand present on an antigen presenting cell.
A “stimulatory ligand,” as used herein, means a ligand that when present on an antigen presenting cell (e.g., an aAPC, a dendritic cell, a B-cell, and the like) can specifically bind with a cognate binding partner (referred to herein as a “stimulatory molecule”) on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like. Stimulatory ligands are well-known in the art and encompass, inter alia, an MEW Class I molecule loaded with a peptide, an anti-CD3 antibody, a superagonist anti-CD28 antibody, and a superagonist anti-CD2 antibody.
The term “subject” is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A “subject” or “patient,” as used therein, may be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human.
A “target site” or “target sequence” refers to a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur. In some embodiments, a target sequence refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.
As used herein, the term “T cell receptor” or “TCR” refers to a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigen. The TCR is responsible for recognizing antigens bound to major histocompatibility complex molecules. TCR is composed of a heterodimer of an alpha (α) and beta (β) chain, although in some cells the TCR consists of gamma and delta (γ/δ) chains. TCRs may exist in alpha/beta and gamma/delta forms, which are structurally similar but have distinct anatomical locations and functions. Each chain is composed of two extracellular domains, a variable and constant domain. In some embodiments, the TCR may be modified on any cell comprising a TCR, including, for example, a helper T cell, a cytotoxic T cell, a memory T cell, regulatory T cell, natural killer T cell, and gamma delta T cell.
The term “therapeutic” as used herein means a treatment and/or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.
To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Artificial Antigen Presenting Cells (aAPCs)
The present invention relates to the discovery that artificial antigen presenting cells (aAPCs) expressing a chimeric receptor (e.g. chimeric antigen receptor (CAR)) specific for CD3, can promote the activation and expansion of T cells. In certain embodiments, the chimeric receptor is specific for human CD3 and/or non-human primate (e.g. Macaca fascicularis and/or Macaca mulatta) CD3. In certain embodiments, the aAPCs are based on the human erythromyeloid cell line K562. In certain embodiments, the aAPCs express stimulatory and/or co-stimulatory molecules, and/or secrete cytokines. The invention also provides methods and compositions for the expansion of T cell subsets, and especially regulatory T cells (Tregs) from both humans and non-human primates. Activation and expansion occurs more efficiently than commonly used methods, with the aAPCs endogenously expressing chimeric antigen receptors (CARs), and/or co-stimulatory molecules, and/or growth-supporting cytokines that would otherwise need to be provided from exogenous sources during preparation steps prior to use. The following provides description of the methods and various considerations necessary to practice the invention.
One aspect of the invention described herein relates to an aAPC engineered to comprise a chimeric receptor that binds specifically to CD3. The chimeric receptor comprises an antigen binding domain specific for CD3 and a transmembrane domain. The aAPC can optionally comprise an intracellular domain and/or hinge domain. In certain embodiments, the aAPC comprises at least one co-stimulatory molecule, and/or secretes at least one growth-promoting cytokine.
An antigen presenting cell (APC) is a cell which displays an antigen complexed with a major histocompatibility complex (WIC) on its surface. The T cell receptor (TCR) complex expressed by T cells will recognize the antigen/WIC complex, which results in the activation of the T cell. The role of an APC is to continuously process antigens and present them to T cells. Non-limiting examples of common, naturally occurring APCs include macrophages, B cells, and dendritic cells.
APCs are essential for the immune system to mount an effective adaptive immune response; the function of both cytotoxic and helper T cells requires the recognition of antigens presented by APCs. Antigen presentation determines the specificity of adaptive immunity and contributes to the immune response against intracellular and extracellular pathogens. APCs additionally play an important role in priming the immune system to recognize transformed cells, e.g., a malignant cell or tumor.
The present invention encompasses artificial antigen presenting cells (aAPCs) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for CD3 (e.g. human CD3 and/or non-human primate CD3). The antigen binding domain is the extracellular region of the chimeric receptor that binds to a specific target antigen (e.g. CD3). In certain embodiments, the antigen biding domain is specific for human CD3 and non-human primate CD3 (e.g. CD3 from Macaca fascicularis and/or Macaca mulatta).
The antigen binding domain can include any domain that binds to the antigen and may include, but is not limited to, a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment thereof. Thus, in one embodiment, the antigen binding domain portion comprises a mammalian antibody or a fragment thereof. In some embodiments, the antigen binding domain is selected from the group consisting of an antibody, an antigen binding fragment (Fab), and a single-chain variable fragment (scFv).
As used herein, the term “single-chain variable fragment” or “scFv” is a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of an immunoglobulin (e.g., mouse or human) covalently linked to form a VH::VL heterodimer. The heavy (VH) and light chains (VL) are either joined directly or joined by a peptide-encoding linker or spacer, which connects the N-terminus of the VH with the C-terminus of the VL, or the C-terminus of the VH with the N-terminus of the VL. In some embodiments, the antigen binding domain (e.g., CD3 binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VH-linker-VL. In some embodiments, the antigen binding domain (e.g., CD3 binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VL-linker-VH. Those of skill in the art would be able to select the appropriate configuration for use in the present invention.
The linker is usually rich in glycine for flexibility, as well as serine or threonine for solubility. The linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6):1910-1917 (2008) and WO 2014/087010, the contents of which are hereby incorporated by reference in their entireties. Various linker sequences are known in the art, including, without limitation, glycine serine (GS) linkers such as (GS)n, (GSGGS)n (SEQ ID NO: 27), (GGGS)n (SEQ ID NO: 28), and (GGGGS)n (SEQ ID NO: 29), where n represents an integer of at least 1. Exemplary linker sequences can comprise amino acid sequences including, without limitation, GGSG (SEQ ID NO: 30), GGSGG (SEQ ID NO: 31), GSGSG (SEQ ID NO: 32), GSGGG (SEQ ID NO: 33), GGGSG (SEQ ID NO: 34), GSSSG (SEQ ID NO: 35), GGGGS (SEQ ID NO: 36), GGGGSGGGGSGGGGS (SEQ ID NO: 37) and the like. Those of skill in the art would be able to select the appropriate linker sequence for use in the present invention. In one embodiment, an antigen binding domain (e.g., CD3 binding domain) of the present invention comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH and VL is separated by the linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 37), which may be encoded by the nucleic acid sequence ggtggcggtggctcgggcggtggtgggtcgggt ggcggcggatct (SEQ ID NO: 38).
Despite removal of the constant regions and the introduction of a linker, scFv proteins retain the specificity of the original immunoglobulin. Single chain Fv polypeptide antibodies can be expressed from a nucleic acid comprising VH- and VL-encoding sequences as described by Huston, et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). See, also, U.S. Pat. Nos. 5,091,513, 5,132,405 and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs having inhibitory activity have been described (see, e.g., Zhao et al., Hybridoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 Aug. 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007 97(6):955-63; Fife eta., J Clin Invst 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40). Agonistic scFvs having stimulatory activity have been described (see, e.g., Peter et al., J Bioi Chem 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).
As used herein, “Fab” refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have a Fc portion, for example, an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen).
As used herein, “F(ab′)2” refers to an antibody fragment generated by pepsin digestion of whole IgG antibodies, wherein this fragment has two antigen binding (ab′) (bivalent) regions, wherein each (ab′) region comprises two separate amino acid chains, a part of a H chain and a light (L) chain linked by an S—S bond for binding an antigen and where the remaining H chain portions are linked together. A “F(ab′)2” fragment can be split into two individual Fab′ fragments.
In some instances, the antigen binding domain may be derived from the same species in which the chimeric receptor will ultimately be used. For example, for use in humans, the antigen binding domain of the chimeric receptor may comprise a human antibody as described elsewhere herein, or a fragment thereof.
In certain embodiments, the antigen binding domain comprises a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs) and a light chain variable region comprising three light chain complementarity determining regions (LCDRs).
In certain embodiments, the antigen binding domain comprises a HCDR comprising any one of the amino acid sequences set forth in SEQ ID NOs: 1-3 and/or a LCDR comprising any one of the amino acid sequences set forth in SEQ ID NOs: 4-6.
In certain embodiments, the antigen binding domain comprises a HCDR comprising any one of the amino acid sequences set forth in SEQ ID NOs: 11-13 and/or a LCDR comprising any one of the amino acid sequences set forth in SEQ ID NOs: 14-16.
In certain embodiments, the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 6 and/or a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7.
In certain embodiments, the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15 and/or a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 16.
In certain embodiments, the antigen binding domain is a single chain variable fragment (scFv). In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 8. In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 17.
The antigen binding domain may be operably linked to another domain of the chimeric receptor, such as the transmembrane domain or the intracellular domain, both described elsewhere herein. In one embodiment, a nucleic acid encoding the antigen binding domain is operably linked to a nucleic acid encoding a transmembrane domain.
The antigen binding domains described herein (e.g the scFv that binds CD3) can be combined with any of the transmembrane domains described herein, or any of the intracellular domains described herein.
The transmembrane domain of a subject chimeric receptor is a region that is capable of spanning the plasma membrane of the aAPC. The transmembrane domain is for insertion into a cell membrane, e.g. the aAPC cell membrane. In some embodiments, the transmembrane domain is interposed between the antigen binding domain and the intracellular domain of a chimeric receptor.
In certain embodiments, the transmembrane domain is naturally associated with one or more of the domains in the chimeric receptor. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
The transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein, e.g., a Type I transmembrane protein. Where the source is synthetic, the transmembrane domain may be any artificial sequence that facilitates insertion of the CAR into a cell membrane, e.g., an artificial hydrophobic sequence. Examples of the transmembrane regions of particular use in this invention include, without limitation, transmembrane domains derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In some embodiments, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. Preferably a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
In certain embodiments, the transmembrane domain is a CD8 transmembrane domain. In certain embodiments, the transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 22.
The transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the intracellular domains described herein, or any of the other domains described herein that may be included in a chimeric receptor.
In some embodiments, the transmembrane domain further comprises a hinge region. A subject chimeric receptor of the present invention may also include an hinge region. The hinge region of the chimeric receptor is a hydrophilic region which is located between the antigen binding domain and the transmembrane domain. In some embodiments, this domain facilitates proper protein folding for the chimeric receptor. The hinge region is an optional component for the chimeric receptor. The hinge region may include a domain selected from Fc fragments of antibodies, hinge regions of antibodies, CH2 regions of antibodies, CH3 regions of antibodies, artificial hinge sequences or combinations thereof. Examples of hinge regions include, without limitation, a CD8a hinge, artificial hinges made of polypeptides which may be as small as, three glycines (Gly), as well as CH1 and CH3 domains of IgGs (such as human IgG4).
In some embodiments, a subject chimeric receptor of the present disclosure includes a hinge region that connects the antigen binding domain with the transmembrane domain, which, in turn, connects to the intracellular domain. The hinge region is preferably capable of supporting the antigen binding domain to recognize and bind to the target antigen on the target cells (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3(2): 125-135). In some embodiments, the hinge region is a flexible domain, thus allowing the antigen binding domain to have a structure to optimally recognize the specific structure and density of the target antigens on a cell such as tumor cell (Hudecek et al., supra). The flexibility of the hinge region permits the hinge region to adopt many different conformations.
In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge region is a hinge region polypeptide derived from a receptor (e.g., a CD8-derived hinge region).
The hinge region can have a length of from about 4 amino acids to about 50 amino acids, e.g., from about 4 aa to about 10 aa, from about 10 aa to about 15 aa, from about 15 aa to about 20 aa, from about 20 aa to about 25 aa, from about 25 aa to about 30 aa, from about 30 aa to about 40 aa, or from about 40 aa to about 50 aa.
Suitable hinge regions can be readily selected and can be of any of a number of suitable lengths, such as from 1 amino acid (e.g., Gly) to 20 amino acids, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids.
For example, hinge regions include glycine polymers (G)n, glycine-serine polymers (including, for example, (GS)n, (GSGGS)n (SEQ ID NO: 27) and (GGGS)n (SEQ ID NO: 38), where n is an integer of at least one), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured, and therefore can serve as a neutral tether between components. Glycine polymers can be used; glycine accesses significantly more phi-psi space than even alanine, and is much less restricted than residues with longer side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2: 73-142). Exemplary hinge regions can comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 30), GGSGG (SEQ ID NO: 31), GSGSG (SEQ ID NO: 32), GSGGG (SEQ ID NO: 33), GGGSG (SEQ ID NO: 34), GSSSG (SEQ ID NO: 35), and the like.
In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. Immunoglobulin hinge region amino acid sequences are known in the art; see, e.g., Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1):162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4): 1779-1789. As non-limiting examples, an immunoglobulin hinge region can include one of the following amino acid sequences: DKTHT (SEQ ID NO: 39); CPPC (SEQ ID NO: 40); CPEPKSCDTPPPCPR (SEQ ID NO: 41) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHT (SEQ ID NO: 42); KSCDKTHTCP (SEQ ID NO: 43); KCCVDCP (SEQ ID NO: 44); KYGPPCP (SEQ ID NO: 45); EPKSCDKTHTCPPCP (SEQ ID NO: 46) (human IgG1 hinge); ERKCCVECPPCP (SEQ ID NO: 47) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO: 48) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO: 49) (human IgG4 hinge); and the like.
The hinge region can comprise an amino acid sequence of a human IgG1, IgG2, IgG3, or IgG4, hinge region. In one embodiment, the hinge region can include one or more amino acid substitutions and/or insertions and/or deletions compared to a wild-type (naturally-occurring) hinge region. For example, His229 of human IgG1 hinge can be substituted with Tyr, so that the hinge region comprises the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 50); see, e.g., Yan et al., J. Biol. Chem. (2012) 287: 5891-5897. In one embodiment, the hinge region can comprise an amino acid sequence derived from human CD8, or a variant thereof.
In certain embodiments, chimeric receptor comprises a CD8 hinge domain. In certain embodiments, the hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 21.
Certain aspects of the invention include an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for CD3 (e.g. human and/or non-human primate CD3), a transmembrane domain, and an intracellular domain.
In certain embodiments, the intracellular domain comprises the intracellular domain of CD3 zeta. In certain embodiments, the intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 19.
In certain embodiments, the aAPC comprises a chimeric receptor molecule comprising the amino acid sequence set forth in SEQ ID NO: 23 or 24. In certain embodiments, the chimeric receptor molecule consists of the amino acid sequence set forth in SEQ ID NO: 23 or 24. In certain embodiments, the chimeric receptor molecule is encoded by a nucleic acid comprising or consisting of the nucleic acid sequence set forth in SEQ ID NO: 25 or 26. The chimeric receptor comprising the amino acid sequence set forth in SEQ ID NO:25 is also referred to herein as an F12Q chimeric receptor. The chimeric receptor comprising the amino acid sequence set forth in SEQ ID NO:26 is also referred to herein as an OKT3 chimeric receptor.
Tolerable variations of the chimeric receptor or its component parts (e.g. antigen binding domain (HCDRs, LCDRs, VH, VL, or scFv), transmembrane domain, hinge, or intracellular domain) will be known to those of skill in the art. For example, in some embodiments the CAR or any one of its components comprises an amino acid sequence that has at least at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 1-26. For example, in some embodiments the chimeric receptor is encoded by a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence set forth in any one of SEQ ID NOs: 27-28.
In certain embodiments, the chimeric receptor molecule is constitutively expressed in the aAPC.
In certain embodiments, the aAPC does not endogenously express one or more molecules selected from the group consisting of HLA class I, HLA class II, CD1d, CD16, CD64, CD83, CD86, 4-1BBL, OX40L, ICOSL, CD40L, PD-L1, PD-L2, B7-H3, and B7-H4. In certain embodiments, the aAPC is an engineered K562 cell.
In certain embodiments, the aAPC further comprises an Fc receptor expressed on the cell surface. Various Fc receptors are known in the art, including, without limitation, CD64, CD32, CD16a, CD16b, CD23, and CD89. In certain embodiments, the Fc receptor is CD64.
In certain embodiments, the aAPC further comprises a co-stimulatory molecule expressed at the cell surface. Various co-stimulatory molecules are known in the art, including, without limitation, 4-1BB, OX40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, CD27, CD28, CD30, CD40, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83. In certain embodiments, the co-stimulatory molecule is CD86.
In certain embodiments, the aAPC further comprises an Fc receptor expressed at the cell surface, and a co-stimulatory molecule expressed at the cell surface. In certain embodiments, the Fc receptor is CD64, and the co-stimulatory molecule is CD86.
In certain embodiments wherein the aAPC comprises an Fc receptor, the aAPC is loaded with an antibody, and the Fc fragment of the antibody is bound by the Fc receptor. In certain embodiments, the antibody has specificity for a molecule selected from the group consisting of CD3, CD28, PD-1, B7-H3, 4-1BB, OX40, ICOS, CD30, HLA-DR, MHCII, Toll Ligand Receptor and LFA-1.
In certain embodiments, the aAPC further comprises a co-stimulatory ligand. In certain embodiments, the co-stimulatory ligand is selected from the group consisting of CD7, B7-1 (CD80), PD-L1, PD-L2, 4-1BBL, OX40L, ICOS-L, ICAM, CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, ILT3, ILT4, 3/TR6, and a ligand that specifically binds with B7-H3. In certain embodiments, the co-stimulatory ligand is 4-1BBL. Other co-stimulatory ligands are encompassed in the invention, as would be understood by one skilled in the art armed with the teachings provided herein. Such ligands include, but are not limited to, a mutant, a variant, a fragment and a homolog of the natural ligands described previously.
These and other ligands are well-known in the art and have been well characterized as described in, e.g., Schwartz et al., 2001, Nature 410:604-608; Schwartz et al., 2002, Nature Immunol. 3:427-434; and Zhang et al., 2004, Immunity. 20:337-347. Using the extensive knowledge in the art concerning the ligand, the skilled artisan, armed with the teachings provided herein would appreciate that a mutant or variant of the ligand is encompassed in the invention and can be transduced into a cell using a lentivirus to produce the aAPC of the invention, and such mutants and variants are discussed more fully elsewhere herein. That is, the invention includes using a mutant or variant of a ligand of interest and methods of producing such mutants and variants are well-known in the art.
In certain embodiments, the aAPC expresses one or more cytokines selected from the group consisting of IL-2, IL-4, IL-5, IL-7, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-35, and TGF-β. In certain embodiments, the aAPC expresses IL-7. In certain embodiments, the aAPC expresses IL-15. In certain embodiments, aAPC expresses IL-7 and IL-15. In certain embodiments, the cytokine is constitutively expressed. As known in the art, in some cases, co-expression of IL-15Rα and IL-15 is important for the stable expression of IL15Ra/IL15. See, e.g., Hasan et al. Clin. Exp. Immunol. (2016) 186(2):249-265. Accordingly, in certain embodiments, the aAPC expresses IL-15 and/or IL-15Rα. In certain embodiments, the aAPC expresses IL-15 and IL-15Rα. In certain embodiments, the aAPC expresses a complex of IL-15 and IL-15Rα. See e.g. Guo et al. Cytokine Growth Factor Rev (2017) December; 38: 10-21 and Tamzalit et al. PNAS Jun. 10, 2014 111 (23) 8565-8570. In certain embodiments, the aAPC secretes a complex of IL-15/IL-15Rα. In certain embodiments, the aAPC expresses IL-21. In certain embodiments, the IL-21 has been modified to be membrane-bound.
In certain embodiments an aAPC of the present disclosure comprises an Fc receptor and a co-stimulatory ligand. In certain embodiments, the aAPC comprises the Fc receptor CD64 and the co-stimulatory ligand 4-1BBL.
In certain embodiments, an aAPC of the present disclosure comprises an Fc receptor, a co-stimulatory molecule, and a co-stimulatory ligand. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory molecule CD86, and the co-stimulatory ligand 4-1BBL.
In certain embodiments, an aAPC of the present disclosure comprises an Fc receptor, a co-stimulatory ligand and an anti-CD3 chimeric receptor. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, and the OKT3 chimeric receptor. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, and the F12Q chimeric receptor.
In certain embodiments, an aAPC of the present disclosure comprises an Fc receptor, a co-stimulatory molecule, a co-stimulatory ligand and an anti-CD3 chimeric receptor. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory molecule CD86, the co-stimulatory ligand 4-1BBL, and the OKT3 chimeric receptor. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory molecule CD86, the co-stimulatory ligand 4-1BBL, and the F12Q chimeric receptor.
In certain embodiments, an aAPC of the present disclosure comprises an Fc receptor, a co-stimulatory ligand, an anti-CD3 chimeric receptor, and expresses IL-7, IL-15, and/or IL-15Rα. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the OKT3 chimeric receptor, and expresses IL-7, IL-15, and/or IL-15Rα. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the OKT3 chimeric receptor, and expresses IL-7 and IL-15. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the OKT3 chimeric receptor, and expresses IL-7, IL-15, and IL-15Rα. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the F12Q chimeric receptor, and expresses IL-7, IL-15, and/or IL-15Rα. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the F12Q chimeric receptor, and expresses IL-7 and IL-15. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the F12Q chimeric receptor, and expresses IL-7, IL-15, and IL-15Rα.
In certain embodiments, an aAPC of the present disclosure comprises an Fc receptor, a co-stimulatory ligand, a co-stimulatory molecule, an anti-CD3 chimeric receptor, and expresses IL-7, IL-15, and/or IL-15Rα. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the co-stimulatory molecule CD86, the OKT3 chimeric receptor, and expresses IL-7, IL-15, and/or IL-15Rα. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the co-stimulatory molecule CD86, the OKT3 chimeric receptor, and expresses IL-7 and IL-15. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the co-stimulatory molecule CD86, the OKT3 chimeric receptor, and expresses IL-7, IL-15, and IL-15Rα. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the co-stimulatory molecule CD86, the F12Q chimeric receptor, and expresses IL-7, IL-15, and/or IL-15Rα. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the co-stimulatory molecule CD86, the F12Q chimeric receptor, and expresses IL-7 and IL-15. In certain embodiments, the aAPC comprises the Fc receptor CD64, the co-stimulatory ligand 4-1BBL, the co-stimulatory molecule CD86, the F12Q chimeric receptor, and expresses IL-7, IL-15, and IL-15Rα.
In certain embodiments, the aAPC comprises a K562 cell transduced to express at least one immune stimulatory and/or co-stimulatory ligand and/or secrete at least one immune stimulatory cytokine. While the data disclosed herein demonstrate that about six nucleic acids encoding about six different molecules transduced into a K562 cell were stably and highly expressed in long-term culture, there is nothing to suggest that this is a limit in the number or kinds of molecules that can be introduced into these cells. Instead, any molecule or ligand, whether stimulatory, co-stimulatory, cytokine, antigen, Fcγ receptor, and the like, can be introduced into these cells to produce an aAPC of the invention.
The skilled artisan would appreciate, based upon the disclosure provided herein, that numerous immunoregulatory molecules can be used to produce an almost limitless variety of aAPCs once armed with the teachings provided herein. That is, there is extensive knowledge in the art regarding the events and molecules involved in activation and induction of T cells, and treatises discussing T cell mediated immune responses, and the factors mediating them, are well-known in the art. More specifically, a primary signal, usually mediated via the T cell receptor/CD3 complex on a T cell, initiates the T cell activation process. Additionally, numerous co-stimulatory molecules present on the surface of a T cell are involved in regulating the transition from resting T cell to cell proliferation. Such co-stimulatory molecules, also referred to as “co-stimulators”, which specifically bind with their respective ligands, include, but are not limited to, CD28 (which binds with B7-1 [CD80], B7-2 [CD86]), PD-1 (which binds with ligands PD-L1 and PD-L2), B7-H3, 4-1BB (binds the ligand 4-1BBL), OX40 (binds ligand OX40L), ICOS (binds ligand ICOS-L), and LFA (binds the ligand ICAM). Thus, the primary stimulatory signal mediates T cell stimulation, but the co-stimulatory signal is then required for T cell activation, as demonstrated by proliferation.
Thus, the aAPC of the invention encompasses a cell comprising a chimeric receptor that specifically binds with a TCR/CD3 complex such that a primary signal is transduced. Additionally, as would be appreciated by one skilled in the art, based upon the disclosure provided herein, the aAPC may further comprise at least one co-stimulatory ligand that specifically binds with at least one co-stimulatory molecule present on a T cell. Such co-stimulatory molecules include, but are not limited to, CD27, CD28, CD30, a ligand that specifically binds with CD83, 4-1BB, PD-1, OX40, ICOS, LFA-1, CD30L, NKG2C, B7-H3, MHC class I, BTLA, Toll ligand receptor and LIGHT.
In certain embodiments, the aAPC of the invention comprises at least one stimulatory ligand (e.g. a chimeric receptor) and at least one co-stimulatory ligand, such that the aAPC can stimulate and expand a T cell comprising a cognate binding partner stimulatory molecule that specifically binds with the stimulatory ligand on the aAPC such that interaction between the ligands on the aAPC and the corresponding molecules on the T cell mediate, among other things, T cell proliferation, and expansion as desired. One skilled in the art would appreciate that where the particular stimulatory and co-stimulatory molecules on a T cell of interest are known, an aAPC of the invention can be readily produced to expand that T cell. Conversely, where the stimulatory and co-stimulatory molecules on a T cell of interest are not known, a panel of aAPCs of the invention can be used to determine which molecules, and combinations thereof, can expand that T cell. Thus, the present invention provides tools for expansion of desirable T cells, as well as tools for elucidating the molecules on particular T cells that mediate T cell activation and proliferation.
In one aspect, the invention includes an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain. The antigen binding domain comprises a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs) and a light chain variable region comprising three light chain complementarity determining regions (LCDRs). HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3. LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5. The aAPC also comprises CD64, CD86, 4-1BBL, IL-7, and IL-15, and the aAPC is an engineered K562 cell.
In another aspect, the invention includes an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3, a transmembrane domain, and an intracellular domain. The antigen binding domain comprises a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs) and a light chain variable region comprising three light chain complementarity determining regions (LCDRs). HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 10, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 11, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 12. LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 13, LCDR2 comprises the amino acid sequence DTS, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 14. The aAPC also comprises CD64, CD86, 4-1BBL, IL-7, and IL-15, and the aAPC is an engineered K562 cell.
The skilled artisan would understand that the nucleic acids of the invention encompass an RNA or a DNA sequence encoding a protein of the invention, and any modified forms thereof, including chemical modifications of the DNA or RNA which render the nucleotide sequence more stable when it is cell free or when it is associated with a cell. Chemical modifications of nucleotides may also be used to enhance the efficiency with which a nucleotide sequence is taken up by a cell or the efficiency with which it is expressed in a cell. Any and all combinations of modifications of the nucleotide sequences are contemplated in the present invention.
Further, any number of procedures may be used for the generation of mutant, derivative or variant forms of a protein of the invention using recombinant DNA methodology well known in the art such as, for example, that described in Sambrook and Russell (2001, Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), and Ausubel et al. (2002, Current Protocols in Molecular Biology, John Wiley & Sons, NY). Procedures for the introduction of amino acid changes in a protein or polypeptide by altering the DNA sequence encoding the polypeptide are well known in the art and are also described in these, and other, treatises.
The present invention should also be construed to encompass “mutants,” “derivatives,” and “variants” of the peptides of the invention (or of the DNA encoding the same) which mutants, derivatives and variants are costimulatory ligands, cytokines, antigens (e.g., tumor cell, viral, and other antigens), which are altered in one or more amino acids (or, when referring to the nucleotide sequence encoding the same, are altered in one or more base pairs) such that the resulting peptide (or DNA) is not identical to the sequences recited herein, but has the same biological property as the peptides disclosed herein, in that the peptide has biological/biochemical properties of a costimulatory ligand, cytokine, antigen, and the like, of the present invention (e.g., expression by an aAPC where contacting the aAPC expressing the protein with a T cell, mediates proliferation of, or otherwise affects, the T cell).
Further, the invention encompasses an aAPC wherein the co-stimulatory ligand is a cognate binding partner that specifically binds with a co-stimulatory molecule, as well as where the ligand is an antibody that specifically binds with a costimulatory molecule, and any combination thereof; such that a single aAPC can comprise both nucleic acids encoding costimulatory ligands and/or antibodies specific for costimulatory molecules present on the T cell, and any combination thereof.
Additionally, the invention encompasses an aAPC transduced with a nucleic acid encoding at least one cytokine, at least one chemokine, or both. This is because the data disclosed elsewhere herein amply demonstrate that an aAPC transduced with a nucleic acid encoding an interleukin (e.g., IL-7, IL-15, and the like) stably expressed the interleukin. Moreover, using a LV vector comprising an internal ribosome entry site (IRES), the interleukin can be secreted from the aAPCs (e.g., a K562 transduced with a LV vector such as, but not limited to, pCLPS CD32-IRES-IL-7, -12, -15, -18, and -21). Other cytokines that can be expressed by aAPC include, but are not limited to, interferon-γ (IFNγ), tumor necrosis factor-α (TNFα), SLC, IL-2, IL-4, IL-23, IL-27 and the like. The invention further includes, but is not limited to, chemokine RANTES, MIP-1a, MIP-1b, SDF-1, eotaxin, and the like.
Thus, the invention encompasses a cytokine, including a full-length, fragment, homologue, variant or mutant of the cytokine. A cytokine includes a protein that is capable of affecting the biological function of another cell. A biological function affected by a cytokine can include, but is not limited to, cell growth, cell differentiation or cell death. Preferably, a cytokine of the present invention is capable of binding to a specific receptor on the surface of a cell, thereby affecting the biological function of a cell.
A preferred cytokine includes, among others, a hematopoietic growth factor, an interleukin, an interferon, an immunoglobulin superfamily molecule, a tumor necrosis factor family molecule and/or a chemokine. A more preferred cytokine of the invention includes a granulocyte macrophage colony stimulating factor (GM-CSF), tumor necrosis factor alpha (TNFα), tumor necrosis factor beta (TNFβ), macrophage colony stimulating factor (M-CSF), interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-10 (IL-10), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-21 (IL-21), interferon alpha (IFNα), interferon beta (IFNβ), interferon gamma (IFNγ), and IGIF, among many others.
A chemokine, including a homologue, variant, mutant or fragment thereof, encompasses an alpha-chemokine or a beta-chemokine, including, but not limited to, a C5a, interleukin-8 (IL-8), monocyte chemotactic protein 1 alpha (MIP1α), monocyte chemotactic protein 1 beta (MIP1β), monocyte chemoattractant protein 1 (MCP-1), monocyte chemoattractant protein 3 (MCP-3), platelet activating factor (PAFR), N-formyl-methionyl-leucyl-[3H]phenylalanine (FMLPR), leukotriene B4 (LTB4R), gastrin releasing peptide (GRP), RANTES, eotaxin, lymphotactin, IP10, 1-309, ENA78, GCP-2, NAP-2 and/or MGSA/gro. One skilled in the art would appreciate, once armed with the teachings provided herein, that the invention encompasses a chemokine and a cytokine, such as are well-known in the art, as well as any discovered in the future.
The skilled artisan would appreciate, once armed with the teachings provided herein, that the aAPC of the invention is not limited in any way to any particular antigen, cytokine, costimulatory ligand, antibody that specifically binds a costimulatory molecule, and the like. Rather, the invention encompasses an aAPC comprising numerous molecules, either all expressed under the control of a single promoter/regulatory sequence or under the control of more than one such sequence. Moreover, the invention encompasses administration of one or more aAPC of the invention where the various aAPCs encode different molecules. That is, the various molecules (e.g., costimulatory ligands, antigens, cytokines, and the like) can work in cis (i.e., in the same aAPC and/or encoded by the same contiguous nucleic acid or on separate nucleic acid molecules within the same aAPC) or in trans (i.e., the various molecules are expressed by different aAPCs).
In this way, as would be understood by one skilled in the art, based upon the disclosure provided herein, the dose and timing of administration of the aAPCs can be specifically tailored for each application. More specifically, where it is desirable to provide stimulation to a T cell using certain molecules expressed by an aAPC, or several aAPCs, followed by stimulation using another aAPC, or several aAPCs, expressing a different, even if overlapping, set of molecules, then a combination of cis and trans approaches can be utilized. In essence, the aAPCs of the invention, and the methods disclosed herein, provide an almost limitless number of variations and the invention is not limited in any way to any particular combination or approach. The skilled artisan, armed with the teachings provided herein and the knowledge available in the art, can readily determine the desired approach for each particular T cell.
The skilled artisan would understand, based upon the disclosure provided herein, that various combinations of molecules to be expressed in the aAPCs of the invention may be favored. While several of these combinations of molecules are indicated throughout the specification, including, but not limited to, the combinations exemplified in
Provided in the invention are methods for stimulating and expanding a T cell (e.g. a regulatory T cell (Treg). The methods comprise contacting the T cell with any of the artificial presenting cells (aAPCs) disclosed herein.
As demonstrated elsewhere herein, contacting a T cell with an aAPC comprising a chimeric receptor specific for CD3, and optionally, a costimulatory ligand that specifically binds a cognate costimulatory molecule expressed on the T cell surface, stimulates the T cell and induces T cell proliferation such that large numbers of specific T cells can be readily produced. The aAPC expands the T cell “specifically” in that only the T cells expressing the particular costimulatory molecule are expanded by the aAPC. Thus, where the T cell to be expanded is present in a mixture of cells, some or most of which do not express the costimulatory molecule, only the T cell of interest will be induced to proliferate and expand in cell number. The T cell can be further purified using a wide variety of cell separation and purification techniques, such as those known in the art and/or described elsewhere herein.
As would be appreciated by the skilled artisan, based upon the disclosure provided herein, the T cell of interest need not be identified or isolated prior to expansion using the aAPC. This is because the aAPC is selective and will only expand the T cell(s) expressing the cognate costimulatory molecule.
Preferably, expansion of certain T cells is achieved by using several aAPCs or a single aAPC, expressing various molecules, including, but not limited to, an antigen, a cytokine, a costimulatory ligand, and an antibody ligand that specifically binds with the costimulatory molecule present on the T cell. As disclosed elsewhere herein, the aAPC can comprise a nucleic acid encoding CD32 and/or CD64 such that the CD32 and/or the CD64 expressed on the aAPC surface can be “loaded” with any antibody desired so long as they bind CD32 and/or CD64, which are Fcγ receptors. This makes the “off the shelf” aAPC easily tailored to stimulate any desired T cell.
The invention encompasses a method for specifically inducing proliferation of a T cell expressing a known co-stimulatory molecule. The method comprises contacting a population of T cells comprising at least one T cell expressing the known co-stimulatory molecule with an aAPC comprising a lentivirus encoding a ligand of the co-stimulatory molecule. As disclosed elsewhere herein, where an aAPC expresses at least one co-stimulatory ligand that specifically binds with a co-stimulatory molecule on a T cell, binding of the co-stimulatory molecule with its cognate co-stimulatory ligand induces proliferation of the T cell. Thus, the T cell of interest is induced to proliferate without having to first purify the cell from the population of cells. Also, this method provides a rapid assay for determining whether any cells in the population are expressing a particular costimulatory molecule of interest, since contacting the cells with the aAPC will induce proliferation and detection of the growing cells thereby identifying that a T cell expressing a costimulatory molecule of interest was present in the sample. In this way, any T cell of interest where at least one costimulatory molecule on the surface of the cell is known, can be expanded and isolated.
The invention includes a method for specifically expanding a T cell population subset. More particularly, the method comprises contacting a population of T cells comprising at least one T cell of a subset of interest with an aAPC capable of expanding that T cell, or at least an aAPC expressing at least one costimulatory ligand that specifically binds with a cognate costimulatory molecule on the surface of the T cell. As demonstrated previously elsewhere herein, binding of the co-stimulatory molecule with its binding partner co-stimulatory ligand induces proliferation of the T cell, thereby specifically expanding a T cell population subset. One skilled in the art would understand, based upon the disclosure provided herein, that T cell subsets include T helper (TH1 and TH2) CD4 expressing, cytotoxic T lymphocyte (CTL) (Tc1 or Tc2) T regulatory (TREG), TC/S, naïve, memory, central memory, effector memory, and γδT cells. Therefore, cell populations enriched for a particular T cell subset can be readily produced using the method of the invention.
In certain embodiments, the T cell to be expanded is an autologous T cell. In certain embodiments, the T cell is a human T cell. a regulatory T cell (Treg). In certain embodiments, the T cell is a non-human primate T cell. In certain embodiments, the non-human primate is Macaca fascicularis. the non-human primate is Macaca mulatta.
In one aspect, the invention provides a method for stimulating and expanding a human and/or non-human primate regulatory T cell (Treg). The method comprises contacting the Treg with an artificial antigen presenting cell (aAPC), wherein the aAPC comprises a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain. The antigen binding domain comprises a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs) and a light chain variable region comprising three light chain complementarity determining regions (LCDRs). HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3. LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5. The aAPC also comprises CD64, CD86, 4-1BBL, IL-7, and IL-15, and the aAPC is an engineered K562 cell.
In another aspect, the invention provides a method for stimulating and expanding a human and/or non-human T cell comprising contacting the cell with a composition comprising membrane vesicles generated from any of the artificial antigen-presenting cells (aAPCs) disclosed herein. In some embodiments, the aAPC membrane vesicles are generated by disrupting the aAPCs of the invention in such a way as to result in vesicles that retain functional cell-surface proteins expressed by the aAPCs, thereby retaining the vesicles ability to stimulate T cells and support expansion of T cell cultures. Such aAPC-derived vesicle compositions offer several advantages over co-culture with fully intact aAPC cells including, but not limited to, obviating the need for inactivation of the aAPCs through treatments such as cytotoxic chemicals, irradiation, or the like that may negatively affect the cultured T cells; optimizing the production of large-scale cultures due to the aAPC membrane vesicles not being metabolically active or requiring removal from the resulting population of expanded T cells; and enabling the more efficient transduction of the expanding T cells with viral vectors, including lentiviral vectors, due to significantly reduced interaction between the viral particles and the aAPC membrane vesicles.
In some embodiments, the aAPC membrane vesicles are generated by the disruption of the aAPC cells. A number of methods of cell disruption are well-known in the art including, but not limited to, mechanical homogenization such as with a handheld or motorized device, ultrasonic homogenization, pressure homogenization, temperature treatments comprising repeated cycles of freezing and thawing, osmotic lysis in hypotonic solutions, chemical lysis including the use of various detergents or solvents, nitrogen cavitation, among others. The skilled artisan would recognize which method of disruption would be most applicable to specific applications of generating membrane vesicles, including aAPC vesicles. In some embodiments, the method of disruption of aAPCs is nitrogen cavitation. This method involves placing a culture of aAPCs in a pressure vessel, often called a “bomb”, and equilibrating the cells at high pressure under a nitrogen-rich atmosphere, thereby resulting in increased nitrogen and other gasses dissolved in the cytoplasm of the cells. The sudden exposure of the cells to atmospheric pressure results in nitrogen bubbles forming in the cytoplasm of the cells, which results in cell lysis. Pressure and release time can be varied to result in differing degrees of cell lysis and preservation of cellular, membrane, protein, and organelle structures. For example, relatively low pressures will disrupt the plasma membrane and endoplasmic reticulum only, while high pressures will result in the disruption of the nucleus and other organelles including lysosomes and mitochondria. In some embodiments, the pressure vessel, often called a “bomb”, consists of a thick stainless steel or similar metal casing that is capable of withstanding high pressure, with an inlet for delivery of nitrogen gas from a tank and an outlet port with an adjustable discharge valve. The skilled artisan would recognize the precise conditions of nitrogen cavitation sufficient to produce the aAPC membrane vesicles of the invention and their use in the methods of the invention.
The invention encompasses the preparation and use of pharmaceutical compositions comprising an aAPC of the invention as an active ingredient. In some embodiments, the composition comprises mixtures of membrane vesicles derived from the aAPCs of the invention. Such a pharmaceutical compositions may consist of the active ingredient alone (e.g. the cells of the invention and preparations thereof), as a combination of at least one active ingredient (e.g., an effective dose of an APC) in a form suitable for administration to a subject or use in activating and expanding T cells from a subject, or the pharmaceutical composition may comprise the active ingredient and one or more pharmaceutically acceptable carriers, one or more additional (active and/or inactive) ingredients, or some combination of these.
As used herein, the term “pharmaceutically acceptable carrier” means a chemical composition with which the active ingredient may be combined and which, following the combination, can be used to administer the active ingredient to a subject or activate and expand T cells from a subject. The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.
Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as non-human primates (e.g. monkeys, e.g. Macaca fascicularis, Macaca mulatta), cattle, pigs, horses, sheep, cats, and dogs, birds including commercially relevant birds such as chickens, ducks, geese, and turkeys, fish including farm-raised fish and aquarium fish, and crustaceans such as farm-raised shellfish.
Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, intra-lesional, buccal, ophthalmic, intravenous, intra-organ or another route of administration or use. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.
A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or for use in the activation and expansion of T cells from a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w/w) active ingredient.
In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.
Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.
As used herein, “parenteral administration” of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, and kidney dialytic infusion techniques.
Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents.
The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
The aAPC or aAPC-derived membrane vesicles of the invention and/or T cells expanded using the aAPC or aAPC-derived membrane vesicles, can be administered to an animal, preferably a human. When the T cells expanded using an aAPC or aAPC-derived membrane vesicle of the invention are administered, the amount of cells administered can range from about 1 million cells to about 300 billion. Where the aAPCs or aAPC-derived membrane vesicles themselves are administered, either with or without T cells expanded thereby, they can be administered in an amount ranging from about 100,000 to about ten billion cells or vesicles wherein the cells and vesicles are infused into the animal, preferably, a human patient in need thereof. While the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of animal and type of disease state being treated, the age of the animal and the route of administration.
The aAPCs or aAPC-derived membrane vesicles may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the animal, etc.
An aAPCs or aAPC-derived membrane vesicles (or cells expanded thereby) may be co-administered with the various other compounds (cytokines, chemotherapeutic and/or antiviral drugs, among many others). Alternatively, the compound(s) may be administered an hour, a day, a week, a month, or even more, in advance of the aAPCs or aAPC-derived membrane vesicles (or cells expanded thereby), or any permutation thereof. Further, the compound(s) may be administered an hour, a day, a week, or even more, after administration of aAPCs or aAPC-derived membrane vesicles (or cells expanded thereby), or any permutation thereof. The frequency and administration regimen will be readily apparent to the skilled artisan and will depend upon any number of factors such as, but not limited to, the type and severity of the disease being treated, the age and health status of the animal, the identity of the compound or compounds being administered, the route of administration of the various compounds and the aAPCs or aAPC-derived membrane vesicles (or cells expanded thereby), and the like.
Further, it would be appreciated by one skilled in the art, based upon the disclosure provided herein, that where the aAPCs or aAPC-derived membrane vesicles are to be administered to a mammal, the cells are treated so that they are in a “state of no growth”; that is, the cells are incapable of dividing when administered to a mammal. As disclosed elsewhere herein, the cells can be irradiated to render them incapable of growth or division once administered into a mammal. Other methods, including haptenization (e.g., using dinitrophenyl and other compounds), are known in the art for rendering cells to be administered, especially to a human, incapable of growth, and these methods are not discussed further herein. Moreover, the safety of administration of aAPCs that have been rendered incapable of dividing in vivo has been established in Phase I clinical trials using aAPCs transfected with plasmid vectors encoding some of the molecules discussed herein.
The invention is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the invention is not limited to these Examples, but rather encompasses all variations that are evident as a result of the teachings provided herein.
Plasmids: pTRPE-CD86 was synthesized by Genscript, pTRPE-IL-15/IL-15 receptor alpha (IL-15/15Ra), pTRPE-IL-7 mcherry, pTRPE-F12Q (F12Q) and pTRPE-OKT3.8 (OKT3) were cloned in CCI.
Generation of aAPC cell lines: K562 cells that express Fc receptor CD64 and 4-1BB ligand (4-1BBL) were transduced to express the CD86 construct, which resulted in the K562.64.4-1BBL.86 cell line (APC3.0). Further, K562.64.4-1BBL.86 (APC3.0) and K562.64.4-1BBL (APC2.0) cell lines were transduced to express the anti-CD3 OKT3 construct, resulting in the K562.64.41BBL.OKT3 (APC2.1) and K562-64.86.4-1BBL.OKT3 (APC3.1) cell lines respectively. Then APC2.1 and APC3.1 were transduced to express both IL-7 mcherry and IL-15/15R constructs resulting in the K562.64.4-1BBL.OKT3.IL-7mcherry.IL-15/15R (APC4.1) cell line and K562-65.4-1BBL.86.OKT3IL-7mcherry.IL-15/15R (APC5.1) cell line, respectively. Expression of the CD64, 4-1BBL, CD86, OKT3, IL-7, IL-15/15R surface proteins was verified by flow cytometry. Various clones of the newly-created APC4.1 and APC5.1 were established by single-cell sorting followed by expansion in vitro. Particularly, several clones of APC4.1 that maintained expression of CD64, 4-1BBL, OKT3, IL-7, IL-15R were then selected for further culture (
Antibodies for flow cytometry: CD64-PE-cy7 (Biolegend, Cat #305022), 41BBL-APC (Cat #311506), CD86-BV650 (Biolegend, Cat #305428) and IL-15Rα-FITC (eBioscience, Cat #11-7159-42) were purchased for flow cytometry. Biotin-goat-anti-mouse IgG Fab (Jackson Immuno Research, Cat #115-065-072) and streptavidin-PE (BD, Cat #554061) were used for detection of anti-CD3 OKT3. Biotinylated Human CD3 epsilon Protein (AcroBiosystems Cat #CDE-H82E1) and streptavidin-PE were used for detection of anti CD3 F12Q.
Irradiation of aAPCs: AAPCs were expanded in RPMI 1640+5% human serum and cells were resuspended to 2.5×107 cells per mL and irradiated under 100 Gy using irradiator XRAD 320iX.
T cell expansion in vitro: Cryopreserved elutriated lymphocytes or leukapheresis of multiple myeloma patients (n=3) were thawed and CD4 and CD8 T cells were selected using CD4 and CD8 microbeads (Miltenyi Biotec, Cat #130-045-101 and 130-045-201). T cells were stimulated with CTS CD3/CD28 Dynabeads (Thermo Fisher, Cat #40203D) at a T to beads ratio of 1:3 or with soluble anti-CD3/CD28 Cloudz (Quad Technologies, per manufacturer's protocol) or with different aAPCs at a T to irradiated aAPC ratio of 1:1 with different culture media for 7 days. 2×106 T cells were plated in G-REX 24-well plates (Wilson Wolf, Cat #80192M) in different culture media containing cytokines 5 ng/mL IL-7 (Miltenyi Biotec, Cat #170-076-111) and IL-15 (Miltenyi Biotec, Cat #170-076-114) except for T cells stimulation with APC4.1 and APC5.1. Several culture media formulations have been used to compare the T cell expansion. OpTmizer (Thermo Fisher, Cat #A1048501) or 1B2H with and without 5% CTS Immune Cell SR (Thermo Fisher, Cat #A2596101) were compared to X-VIVO15 (Lonza, Cat #04-744Q)-based modified medium, which was described previously (cite?). The cell number and volume were measured by Coulter Counter Multisizer 4. Supernatants were collected for detection of IL-7 and IL-15 by ELISA in the media.
In order to develop artificial APCs capable of expanding human T cells in vitro without the need for tedious preparation steps involving coating cells with exogenous antibodies, a series of studies were undertaken to create a K562-based APC expressing a membrane-bound, scFv version of the anti-human CD3 antibody OKT3. A flowchart of the development steps is illustrated in
Various clones of the newly-created K562.OKT3 cell line were established by single-cell sorting followed by expansion in vitro. Two clones possessing the highest expression of the OKT3 CAR were then selected for further culture (
The selected aAPC lines where then used to stimulate the expansion of human T cells in vitro. Normal donor T cells were co-incubated with various K562 cell lines for 9-12 days during which the number of T cells was assessed at various time points (
While OKT3-based aAPCs are capable of expanding human T cells, a need existed for an aAPC that was capable of expanding T cells of both human and non-human primate origins. In order to select an antibody with the highest possible affinity for both species, a number of already-constructed Bi-specific T-cell Engager (BiTE) molecules were screened (see PCT/EP2009/062795). These molecules were specific for melanoma chondroitin sulphate proteoglycan (MCSP) and CD3 of both human and cynomolgus monkey origin (
The F12Q-based CAR was then transduced into K562 parental cells and K562 cells expressing CD86 and CD64, followed by clonal selection for those cells possessing the highest CD3 CAR expression and the greatest ability to expand human and primate T cells. A flowchart of these studies is illustrated in
F12Q CAR-expressing K562.64.86 cells were used to expand T cells from a human donor and two non-human primates: rhesus and cynomolgus monkeys. As a control, OKT3-CAR based a APCs were used for comparison. Consistent with the cross-species specificity of the F12Q antibody, F12Q-CAR based aAPCs efficiently promoted the expansion of T cells from all three species (
In order to allow for the specific staining of anti-CD3 CAR expressing aAPCs for identification using flow cytometry, a soluble CD3-epsilon protein and PE-conjugated streptavidin counterstain was utilized. Titration studies using various concentrations of the CD3E protein ranging from 0.6025 μg/ml to 5 μg/ml demonstrated clear staining with minimal background (
The development of CD3-CAR expressing aAPC cells represents a substantial improvement over previous iterations of K562-based aAPCs in that the endogenously-expressed, membrane-bound anti-CD3 scFv constructs obviate in vitro loading of anti-CD3 antibody onto Fc receptors prior to co-culture with T cells, a step which previous generations of aAPC required. In addition to saving time and labor in a process which has become increasingly important as CAR-based immunotherapies develop into more common clinical treatments, anti-CD3 CARs also eliminate the constant expense of sourcing and testing anti-CD3 antibodies.
The use of exogenous cytokines such as IL-7 and IL-15 in T cell cultures promotes optimal expansion and maintenance of effector functions, even after multiple rounds of in vitro stimulation. Similar to the use of anti-CD3 CARs, the modification of aAPC to secrete IL-7 and IL-15 provides the benefits of these factors without the need to supplement cultures with purified preparations. K562 OKT3-CAR expressing aAPCs were transduced to secrete IL-7 with a construct that also expresses the red fluorescent protein (RFP) mCherry as a trackable marker. Cells were then further engineered to secrete a heterocomplex of IL-15 linked to the IL-15R alpha chain (sushi domain) via a linker. This modified version of IL-15 has been shown to be a higher affinity IL-15 agonist than the recombinant cytokine alone. The progression of K562-based aAPC development is illustrated in
Ten clones were established from transduced “APC4.1” cells (CD64+4-1BBL+OKT3-CAR+IL-7+IL-15+CD86neg) and expression of transduced molecules was assessed by flow cytometry (
The presence of cytokines in culture media after 8 days of T cell expansion was then determined. In these studies, the ability of APC5.1 and APC4.1 cells to continuously produce IL-7 and IL-15 was assessed in comparison to various culture conditions with exogenous IL7 and IL-15 added, including APC2.0, 3.0, 2.1, and 3.1 aAPC cells, anti-CD3 antibody (2D11), as well as commercially available anti-CD3/anti-CD28 coated beads. Additionally, two kinds of serum-free culture media were evaluated: X-VIVO and OpTmizer. Measurement of IL-7 (
The continued presence of aAPCs in culture after stimulating the expansion of T cells can be detrimental to the health of the resulting T cells, in that the non-T cells contribute to overcrowding and consume nutrients otherwise necessary to support the T cells. As such, traditional T cell culture protocols often include treatments of stimulator cells that arrest their growth, including irradiation or treatment with mitomycin C. This step is also key in the production of T cells for immunotherapy, as it minimizes the amount of purification would need to be done to the culture to remove non-T cells prior to infusion into patients. APC4.1 and APC5.1 aAPCs were irradiated prior to use in T cell expansion co-cultures. After 7 days, the cultures were assessed for remaining aAPC cells by staining cells with the viability dye 7-AAD and assessing for mCherry expression (
Cell-based immunotherapies such as chimeric antigen receptor (CAR) expressing T cells require the production of large numbers of T cells from individual patients using GMP-compatible methods. While current methods often make use of WAVE bioreactor technology, GREX bioreactors offer the possibility of expanding equivalent numbers of cells in shorter amounts of time with lower costs (
The high-volume expansion of CD4+ regulatory T cells (Tregs) offers the ability to use adoptive T cell therapy to reduce or ameliorate immune disorders arising from inappropriate or excessive immune activation. To determine whether the aAPCs and culture methods of the current disclosure could efficiently expand regulatory T cells, CD4+ Treg were sorted from donor peripheral blood and expanded by co-culture with APC3.1 in XVIVO medium with 5% human AB serum, 1× glutamax, 1× pen/strep and 200 IU/mL IL-2 for 13 days. Cells were then restimulated with APC3.1 on day 9.
The production of functional nanoparticles or membrane vesicles from the APCs of the present disclosure would offer several benefits for large-scale T cell expansion over intact aAPCs. For applications requiring the simultaneous transduction of expanding T cells, the use of aAPC-derived vesicles could increase the efficiency of viral transduction systems. For example, the aAPC-derived vesicles would be less able to interact with the viral particles, thus preventing the aAPC portion of the culture mixture from absorbing significant amounts of virus. Likewise, aAPC-derived vesicles obviate the need for inactivation of the aAPCs through treatments such as cytotoxic chemicals, irradiation, or the like that may negatively affect the cultured T cells. Further, aAPC vesicles are not metabolically active and do not require subsequent purification procedures to remove them from the resulting population of expanded T cells. While many methods of cell disruption are known in the art and would be appropriate for the generation of aAPC-derived vesicles or nanoparticles, the method of nitrogen cavitation offers several advantages in that the method is simple and requires minimal cell manipulation and no chemical detergents.
The following enumerated embodiments are provided, the numbering of which is not to be construed as designating levels of importance.
Embodiment 1 provides an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, and a transmembrane domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5.
Embodiment 2 provides the aAPC of embodiment 1, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 6.
Embodiment 3 provides the aAPC of embodiments 1 or 2, wherein the antigen binding domain comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7.
Embodiment 4 provides the aAPC of any preceding embodiment, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 6, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7.
Embodiment 5 provides the aAPC of any preceding embodiment, wherein the antigen binding domain is a single chain variable fragment (scFv).
Embodiment 6 provides the aAPC of embodiment 5, wherein the scFv comprises the amino acid sequence set forth in SEQ ID NO: 8.
Embodiment 7 provides the aAPC of any preceding embodiment, wherein the non-human primate is Macaca fascicularis.
Embodiment 8 provides the aAPC of any preceding embodiment, wherein the non-human primate is Macaca mulatta.
Embodiment 9 provides the aAPC of any preceding embodiment, wherein the chimeric receptor molecule further comprises an intracellular domain.
Embodiment 10 provides the aAPC of embodiment 9, wherein the intracellular domain comprises the intracellular domain of CD3 zeta.
Embodiment 11 provides the aAPC of embodiment 9, wherein the intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 19.
Embodiment 12 provides an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5.
Embodiment 13 provides the aAPC of embodiment 12, wherein the intracellular domain comprises the intracellular domain of CD3 zeta.
Embodiment 14 provides the aAPC of embodiment 12, wherein the intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 19.
Embodiment 15 provides an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3, and a transmembrane domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 10, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 11, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 12; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 13, LCDR2 comprises the amino acid sequence DTS, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 14.
Embodiment 16 provides the aAPC of embodiment 15, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15.
Embodiment 17 provides the aAPC of embodiment 15 or 16, wherein the antigen binding domain comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 16.
Embodiment 18 provides the aAPC of any preceding embodiment, wherein the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 16.
Embodiment 19 provides the aAPC of any preceding embodiment, wherein the antigen binding domain is a single chain variable fragment (scFv).
Embodiment 20 provides the aAPC of embodiment 19, wherein the scFv comprises the amino acid sequence set forth in SEQ ID NO: 17.
Embodiment 21 provides the aAPC of any preceding embodiment, wherein the chimeric receptor molecule further comprises a hinge domain.
Embodiment 22 provides the aAPC of embodiment 21, wherein the hinge domain is a CD8 hinge domain.
Embodiment 23 provides the aAPC of embodiment 21, wherein the hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 21.
Embodiment 24 provides the aAPC of any preceding embodiment, wherein the transmembrane domain is a CD8 transmembrane domain.
Embodiment 25 provides the aAPC of any preceding embodiment, wherein the transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 22.
Embodiment 26 provides the aAPC of any preceding embodiment, wherein the chimeric receptor molecule comprises the amino acid sequence set forth in SEQ ID NO: 23 or 24.
Embodiment 27 provides the aAPC of any preceding embodiment, wherein the chimeric receptor molecule is encoded by a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 25 or 26.
Embodiment 28 provides the aAPC of any preceding embodiment, wherein the chimeric receptor molecule consists of the amino acid sequence set forth in SEQ ID NO:
23 or 24.
Embodiment 29 provides the aAPC of any preceding embodiment, wherein the chimeric receptor molecule is encoded by a nucleic acid consisting of the nucleic acid sequence set forth in SEQ ID NO: 25 or 26.
Embodiment 30 provides the aAPC of any preceding embodiment, wherein the chimeric receptor molecule is constitutively expressed.
Embodiment 31 provides the aAPC of any preceding embodiment, wherein the aAPC is an engineered K562 cell.
Embodiment 32 provides the aAPC of any preceding embodiment, wherein the engineered K562 cell does not endogenously express one or more molecules selected from the group consisting of HLA class I, HLA class II, CD1d, CD16, CD64, CD83, CD86, 4-1BBL, OX40L, ICOSL, CD40L, PD-L1, PD-L2, B7-H3, and B7-H4.
Embodiment 33 provides the aAPC of any preceding embodiment, wherein the aAPC further comprises an Fc receptor expressed at the cell surface.
Embodiment 34 provides the aAPC of embodiment 33, wherein the Fc receptor is CD64.
Embodiment 35 provides the aAPC of any preceding embodiment, wherein the aAPC further comprises a co-stimulatory molecule expressed at the cell surface.
Embodiment 36 provides the aAPC of embodiment 35, wherein the co-stimulatory molecule is CD86.
Embodiment 37 provides the aAPC of any preceding claim, wherein the aAPC further comprises an Fc receptor expressed at the cell surface, and a co-stimulatory molecule expressed at the cell surface.
Embodiment 38 provides the aAPC of embodiment 37, wherein the Fc receptor is CD64, and the co-stimulatory molecule is CD86.
Embodiment 39 provides the aAPC of any one of embodiments 33-38, wherein the aAPC is loaded with an antibody, wherein the Fc fragment of the antibody is bound by the Fc receptor.
Embodiment 40 provides the aAPC of embodiment 39, wherein the antibody has specificity for a molecule selected from the group consisting of CD3, CD28, PD-1, B7-H3, 4-1BB, OX40, ICOS, CD30, HLA-DR, MHCII, Toll Ligand Receptor and LFA-1.
Embodiment 41 provides the aAPC of any preceding embodiment, wherein the aAPC further comprises a co-stimulatory ligand.
Embodiment 42 provides the aAPC of embodiment 41, wherein the co-stimulatory ligand is selected from the group consisting of CD7, B7-1 (CD80), PD-L1, PD-L2, 4-1BBL, OX40L, ICOS-L, ICAM, CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, ILT3, ILT4, 3/TR6, and a ligand that specifically binds with B7-H3.
Embodiment 43 provides the aAPC of embodiment 41 or 42, wherein the co-stimulatory ligand is 4-1BBL.
Embodiment 44 provides the aAPC of any preceding embodiment, wherein the aAPC expresses one or more cytokines selected from the group consisting of IL-2, IL-4, IL-5, IL-7, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-35, and TGF-β.
Embodiment 45 provides the aAPC of any preceding embodiment, wherein the aAPC expresses IL-7.
Embodiment 46 provides the aAPC of any preceding embodiment, wherein the aAPC expresses IL-15.
Embodiment 47 provides the aAPC of any preceding embodiment, wherein the aAPC expresses IL-7 and IL-15.
Embodiment 48 provides the aAPC of any preceding embodiment, wherein the aAPC expresses an IL-15R.
Embodiment 49 provides the aAPC of embodiment 49, wherein the IL-15R is IL-15Rα.
Embodiment 50 provides the aAPC of any one of embodiments 44-49, wherein the cytokine is constitutively expressed.
Embodiment 51 provides an artificial antigen presenting cell (aAPC) comprising:
a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5;
CD64;
CD86; and
4-1BBL, and
expresses IL-7 and IL-15,
wherein the aAPC is an engineered K562 cell.
Embodiment 52 provides an artificial antigen presenting cell (aAPC) comprising:
a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 10, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 11, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 12; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 13, LCDR2 comprises the amino acid sequence DTS, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 14;
CD64;
CD86; and
4-1BBL, and
expresses IL-7 and IL-15,
wherein the aAPC is an engineered K562 cell.
Embodiment 53 provides the aAPC of embodiment 51 or 52, wherein the aAPC further comprises an IL-15R.
Embodiment 54 provides the aAPC of embodiment 53, wherein the IL-15R is IL-15Rα.
Embodiment 55 provides a composition comprising the aAPC of any preceding embodiment.
Embodiment 56 provides the composition of embodiment 55, further comprising a pharmaceutically acceptable carrier.
Embodiment 57 provides a method for stimulating and expanding a T cell, comprising contacting the T cell with the artificial presenting cell (aAPC) of any one of embodiments 1-56.
Embodiment 58 provides the method of embodiment 57, wherein the T cell is an autologous T cell.
Embodiment 59 provides the method of embodiment 57 or 58, wherein the T cell is a human T cell.
Embodiment 60 provides a method for stimulating and expanding a regulatory T cell (Treg), comprising contacting the Treg with the artificial presenting cell (aAPC) of any one of embodiments 1-56.
Embodiment 61 provides the method of embodiment 60, wherein the regulatory T cell is a human T cell.
Embodiment 62 provides the method of embodiment 60, wherein the regulatory T cell is a non-human primate T cell.
Embodiment 63 provides the method of embodiment 62, wherein the non-human primate is Macaca fascicularis.
Embodiment 64 provides the method of embodiment 62, wherein the non-human primate is Macaca mulatta.
Embodiment 65 provides a method for stimulating and expanding a T cell, comprising contacting the T cell with an artificial antigen presenting cell (aAPC), wherein the aAPC comprises:
a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5;
CD64;
CD86; and
4-1BBL, and
expresses IL-7 and IL-15,
wherein the aAPC is an engineered K562 cell.
Embodiment 66 provides a method for stimulating and expanding a T cell, comprising contacting the T cell with an artificial antigen presenting cell (aAPC), wherein the aAPC comprises:
a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5;
CD64;
CD86;
4-1BBL;
IL-15Rα, and
expresses IL-7 and IL-15,
wherein the aAPC is an engineered K562 cell.
Embodiment 67 provides a composition comprising membrane vesicles derived from an artificial antigen-presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5;
CD64;
CD86; and
4-1BBL, and
expresses IL-7 and IL-15,
wherein the aAPC is an engineered K562 cell, and
wherein the membrane vesicles are generated by the disruption of the aAPC.
Embodiment 68 provides the composition of embodiment 67, wherein the disruption of the aAPC is accomplished by a method selected from the group consisting of mechanical homogenization, ultrasonic homogenization, pressure homogenization, temperature cycling, and nitrogen cavitation.
Embodiment 69 provides the composition of embodiment 68, wherein the disruption of the aAPC is accomplished by nitrogen cavitation.
Embodiment 70 provides a composition comprising membrane vesicles derived from an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5; and
CD64; and
CD86; and
4-1BBL; and
IL-15Rα; and
expresses IL-7 and IL-15,
wherein the aAPC is an engineered K562 cell, and
wherein the membrane vesicles are generated by the disruption of the aAPC.
Embodiment 71 provides the composition of embodiment 69, wherein the disruption of the aAPC is accomplished by a method selected from the group consisting of mechanical homogenization, ultrasonic homogenization, pressure homogenization, temperature cycling, and nitrogen cavitation.
Embodiment 72 provides the composition of embodiment 71, wherein the disruption of the aAPC is accomplished by nitrogen cavitation.
Embodiment 73 provides a method for stimulating and expanding a T cell, comprising contacting the T cell with the composition of embodiments 67 to 69 or embodiments 70 to 72.
Embodiment 74 provides a method for stimulating and expanding a T cell, comprising contacting the T cell with a composition comprising membrane vesicles derived from an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5;
CD64;
CD86; and
4-1BBL, and
expresses IL-7 and IL-15,
wherein the aAPC is an engineered K562 cell, and
wherein the membrane vesicles are generated by the disruption of the aAPC.
Embodiment 75 provides the method of embodiment 74, wherein disruption of the aAPC is accomplished by a method selected from the group consisting of mechanical homogenization, ultrasonic homogenization, pressure homogenization, temperature cycling, and nitrogen cavitation.
Embodiment 76 provides the method of embodiment 75, wherein the disruption of the aAPC is accomplished by nitrogen cavitation.
Embodiment 77 provides a method for stimulating and expanding a T cell, comprising contacting the T cell with a composition comprising membrane vesicles derived from an artificial antigen presenting cell (aAPC) comprising a chimeric receptor molecule comprising an antigen binding domain having specificity for human CD3 and a non-human primate CD3, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain comprises:
a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3; and
a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 4, LCDR2 comprises the amino acid sequence GTK, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 5; and
CD64; and
CD86; and
4-1BBL; and
IL-15Rα; and
expresses IL-7 and IL-15,
wherein the aAPC is an engineered K562 cell, and
wherein the membrane vesicles are generated by the disruption of the aAPC.
Embodiment 78 provides the method of embodiment 77, wherein the disruption of the aAPC is accomplished by a method selected from the group consisting of mechanical homogenization, ultrasonic homogenization, pressure homogenization, temperature cycling, and nitrogen cavitation.
Embodiment 79 provides the method of embodiment 78, wherein the disruption of the aAPC is accomplished by nitrogen cavitation.
The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or sub combination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
It is to be understood that wherever values and ranges are provided herein, all values and ranges encompassed by these values and ranges, are meant to be encompassed within the scope of the present invention. Moreover, all values that fall within these ranges, as well as the upper or lower limits of a range of values, are also contemplated by the present application.
The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
The present application is entitled to priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 62/941,062 filed Nov. 27, 2019, which is hereby incorporated by reference in its entirety herein.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2020/062220 | 11/25/2020 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62941062 | Nov 2019 | US |
