Anti-EGFR antibody and use thereof

Abstract

A cell growth inhibitor that includes, as an antibody component, an artificially produced anti-EGFR antibody having specific binding capacity to EGFR which is characterized in that an epitope therefor is in a cysteine-rich subdomain 2 (C2 domain) and/or in a ligand-binding domain 1 (L1 domain) among four subdomains contained in the extracellular domain of EGFR.

Description

TECHNICAL FIELD

The present invention relates to an artificially designed antibody and use thereof. More specifically, the present invention relates to an artificial antibody which specifically binds to epidermal growth factor receptor of human cells and use thereof.

The present application claims the priority based on Japanese Patent Application No. 2010-128623 filed on Jun. 4, 2010, the entire content of which is incorporated herein by reference.

BACKGROUND ART

It is known that cell growth or proliferation is promoted by binding of the epidermal growth factor (hereinafter referred to as “EGF”) as a ligand to an extracellular domain of a receptor on the cell surface, i.e., epidermal growth factor receptor (hereinafter referred to as “EGFR”). Particularly, it has been found that EGFRs are overexpressed on the surface of various tumor cells and are deeply involved in growth and malignant conversion of the tumors.

Therefore, development of drugs which can block the binding of EGF to EGFRs to block signal transduction to which EGFRs are involved, resulting in suppression of growth of malignant tumor cells, particularly antibody drugs (anti-tumor drugs) mainly including antibodies which specifically bind to EGFRs (anti-EGFR antibodies) have been in progress. For example, anti-EGFR antibodies, matuzumab and cetuximab, have been known which can bind to EGFRs competitively with EGF, thereby inhibiting activation and dimerization of EGFRs, and their certain benefits have been shown in growth suppression (growth inhibition) of malignant tumor cells such as colon cancer cells. Patent Literature 1 discloses an example of conventional antibodies of this type and a production example thereof.

CITATION LIST

Patent Literature

Patent Literature 1: Japanese Patent Application Publication No. 2006-25794

Patent Literature 2: PCT International Publication No. WO 2003/044198

SUMMARY OF INVENTION

However, it has been reported that the conventional anti-EGFR antibodies such as those described above (e.g., cetuximab described above) have extremely low effect (cell growth suppression effect) and substantially not efficacious against KRAS mutant malignant tumor cells (cancer cells) such as certain types of colon cancer cells. Accordingly, there is a need for development of antibody drugs which have high cell growth suppression effect even against these KRAS mutant malignant tumor cells.

Thus, the present invention has been caused so as to solve the above conventional problem and one objective is to provide a new cell growth suppressing agent (cell growth inhibitor) which shows preferable cell growth suppression effect even against KRAS mutant cells which express EGFRs at a high rate and for which conventional antibody drugs, for example, have not been highly effective. Another objective of the present invention is to create a new anti-EGFR antibody which is used as a component of the cell growth inhibitor. Another objective of the present invention is to provide a method for suppressing (inhibiting) growth of target EGFR-expressing cells (particularly KRAS mutant malignant tumor cells) by using the anti-EGFR antibody disclosed herein.

The extracellular domain (typically consists of 621 amino acid residues) of human epidermal growth factor receptor (EGFR) contains four subdomains, which are, following a secretory signal sequence consisting of 24 amino acid residues, from the N-terminal of the amino acid sequence:

(1) “ligand-binding subdomain 1 (hereinafter referred to as “L1 domain”; a domain typically consisting of 165 amino acid residues at positions 25 to 189 from the N-terminal following the signal sequence)”;

(2) “cysteine-rich subdomain 1 (hereinafter referred to as “C1 domain”; a domain typically consisting of 144 amino acid residues at positions 190 to 333 following the above L1 domain)”;

(3) “ligand-binding subdomain 2 (hereinafter referred to as “L2 domain”; a domain typically consisting of 172 amino acid residues at positions 334 to 505 following the above C1 domain)”; and

(4) “cysteine-rich subdomain 2 (hereinafter referred to as “C2 domain”; a domain typically consisting of 140 amino acid residues at positions 506 to 645 following the above L2 domain)”, in this order. The conventional anti-EGFR antibodies such as those disclosed in the above Patent Literature 1 have the nature of mainly binding to the above (3) L2 domain.

The present inventors have artificially prepared anti-EGFR antibodies which are derived from the phage library in their possession and recognize epitopes different from those of conventional antibodies, and found that growth of so-called KRAS mutant cells (e.g., colon cancer cells), whose growth has not been shown to be effectively suppressed with conventional antibody drugs, can be suitably suppressed by using the obtained respective anti-EGFR antibodies or the combinations thereof, thereby completing the present invention.

Thus, one of the antibodies disclosed herein is an anti-EGFR antibody having specific binding capacity to epidermal growth factor receptor (EGFR) and produced artificially, characterized in that:

an epitope therefor is in a cysteine-rich subdomain 2 (C2) which is the fourth subdomain from the N-terminal of the extracellular domain of EGFR among four subdomains contained therein,

a heavy chain variable region (VH region) thereof has an amino acid sequence of SEQ ID NO: 1 or a modified amino acid sequence obtained by substitution, deletion and/or addition of one to several amino acid residues with respect to the amino acid sequence of SEQ ID NO: 1 and retaining the specific binding capacity, and

a light chain variable region (VL region) thereof has an amino acid sequence of SEQ ID NO: 2 or a modified amino acid sequence obtained by substitution, deletion and/or addition of one to several amino acid residues with respect to the amino acid sequence of SEQ ID NO: 2 and retaining the specific binding capacity.

The above anti-EGFR antibody is referred to as “C2 domain-binding anti-EGFR antibody” hereinbelow.

Another antibody disclosed herein is an anti-EGFR antibody having specific binding capacity to epidermal growth factor receptor (EGFR) and produced artificially, characterized in that:

an epitope therefor is in a ligand-binding domain 1 (L1) which is the first domain from the N-terminal of the extracellular domain of EGFR among four subdomains contained therein,

a heavy chain variable region (VH region) thereof has an amino acid sequence of SEQ ID NO: 3 or a modified amino acid sequence obtained by substitution, deletion and/or addition of one to several amino acid residues with respect to the amino acid sequence of SEQ ID NO: 3 and retaining the specific binding capacity, and

a light chain variable region (VL region) thereof has an amino acid sequence of SEQ ID NO: 4 or a modified amino acid sequence obtained by substitution, deletion and/or addition of one to several amino acid residues with respect to the amino acid sequence of SEQ ID NO: 4 and retaining the specific binding capacity.

The above anti-EGFR antibody is referred to as “L1 domain-binding anti-EGFR antibody” hereinbelow.

The term “epitope” as used herein refers to a binding portion in EGFR which is recognized by the subject anti-EGFR antibody and which has high affinity (binding activity). Therefore, the expression “an epitope therefor is in a L1 domain (or C2 domain)” for example, means that the subject anti-EGFR antibody selectively binds to the L1 domain (or C2 domain) with high affinity (specificity) by antigen-antibody reaction compared to other subdomains in the extracellular domain.

The C2 domain-binding anti-EGFR antibody and L1 domain-binding anti-EGFR antibody generated by the present inventors can suitably suppress growth of high EGFR expressing cells including KRAS mutant cells (e.g., malignant tumor cells such as colon cancer cells). Accordingly, the above artificial antibodies disclosed herein can provide antibody drugs which has high efficacy in growth suppression of high EGFR expressing cells (e.g., KRAS mutant cancer cells).

A preferable aspect of the antibodies disclosed herein is characterized in that the antibodies are in the form of human IgG containing a heavy chain constant region (CH region) and a light chain constant region (CL region) of human IgG in addition to the VH region and the VL region. The configuration in the form of human IgG makes the antibodies more suitable for use in patients.

The present invention also provides a cell growth inhibitor which is prepared with the anti-EGFR antibodies disclosed herein.

Namely, the cell growth inhibitor disclosed herein is a cell growth suppressing agent (cell growth inhibitor) for suppressing growth of at least one epidermal growth factor receptor (EGFR)-expressing cell, comprising either or both of the antibodies which have features as described in the following (A) and (B):

(A) C2 Domain-Binding Anti-EGFR Antibody:

an artificially produced anti-EGFR antibody having specific binding capacity to EGFR, wherein:

an epitope therefor is in a cysteine-rich subdomain 2 (C2) which is the fourth subdomain from the N-terminal of the extracellular domain of EGFR among four subdomains contained therein,

a heavy chain variable region (VH region) thereof has an amino acid sequence of SEQ ID NO: 1 or a modified amino acid sequence obtained by substitution, deletion and/or addition of one to several amino acid residues with respect to the amino acid sequence of SEQ ID NO: 1 and retaining the specific binding capacity, and

a light chain variable region (VL region) thereof has an amino acid sequence of SEQ ID NO: 2 or a modified amino acid sequence obtained by substitution, deletion and/or addition of one to several amino acid residues with respect to the amino acid sequence of SEQ ID NO: 2 and retaining the specific binding capacity; and

(B) L1 Domain-Binding Anti-EGFR Antibody:

an artificially produced anti-EGFR antibody having specific binding capacity to EGFR, wherein:

an epitope therefor is in a ligand-binding domain 1 (L1) which is the first domain from the N-terminal of the extracellular domain of EGFR among four subdomains contained therein,

a heavy chain variable region (VH region) thereof has an amino acid sequence of SEQ ID NO: 3 or a modified amino acid sequence obtained by substitution, deletion and/or addition of one to several amino acid residues with respect to the amino acid sequence of SEQ ID NO: 3 and retaining the specific binding capacity, and

a light chain variable region (VL region) thereof has an amino acid sequence of SEQ ID NO: 4 or a modified amino acid sequence obtained by substitution, deletion and/or addition of one to several amino acid residues with respect to the amino acid sequence of SEQ ID NO: 4 and retaining the specific binding capacity.

The cell growth inhibitor typically comprises at least one pharmaceutically acceptable carrier.

Preferably, the antibody comprised in the cell growth inhibitor is in the form of human IgG containing, in addition to the VH region and the VL region, a heavy chain constant region (CH region) and a light chain constant region (CL region) of human IgG.

The cell growth inhibitor disclosed herein can suppress (inhibit) growth of not only general high EGFR expressing cells but also KRAS mutant cells because the antibody component thereof is the C2 domain-binding anti-EGFR antibody and/or L1 domain-binding anti-EGFR antibody whose epitope is different from those for conventional anti-EGFR antibodies.

Thus, according to the present invention, the cell growth inhibitor which targets a KRAS mutant malignant tumor cell as the EGFR-expressing cell and which suppresses growth of the KRAS mutant malignant tumor cell can be provided.

The present invention also provides a method for suppression of growth of at least one epidermal growth factor receptor (EGFR)-expressing cell, characterized in that it uses the C2 domain-binding anti-EGFR antibody and/or L1 domain-binding anti-EGFR antibody disclosed herein (preferably the one in the form of human IgG) and that it comprises applying the anti-EGFR antibody(s) to the target EGFR-expressing cell.

One suitable aspect of the method for suppression of cell growth may include a method in which the EGFR-expressing cell is a KRAS mutant malignant tumor cell and the method is used for suppressing growth of the KRAS mutant malignant tumor cell.

The present invention also provides various polynucleotides designed artificially (e.g., a plasmid used as an expression vector as described hereinbelow) which is used for production of the anti-EGFR antibodies disclosed herein by genetic engineering techniques. Typically, the present invention provides an polynucleotide designed artificially which comprises a nucleotide sequence encoding at least one amino acid sequence from SEQ ID NOs: 1 to 4 disclosed herein and which is for expressing a peptide comprising an amino acid sequence encoded by the nucleotide sequence (i.e., the amino acid sequence constituting any of VH and VL regions disclosed herein).

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1A is a plasmid map depicting an overview of an expression plasmid vector “pHIgHzeo”;

FIG. 1B is a plasmid map depicting an overview of an expression plasmid vector “pHIgKneo”;

FIG. 2 is a drawing showing deleted parts of EGFR extracellular domain deletion mutant peptide obtained in Test Example (left) and binding parts of test antibodies (right);

FIG. 3 is a graph of the results of AlamarBlue® assay showing effects of test antibodies on growth of the A431 cell line over time;

FIG. 4 is a graph of the results of AlamarBlue® assay showing effects of test antibodies on growth of the A549 cell line over time;

FIG. 5 is a graph of the results of AlamarBlue® assay showing effects of test antibodies on growth of the NA cell line over time;

FIG. 6 is a graph of the results of AlamarBlue® assay showing effects of test antibodies on growth of the MDA-MB-231 cell line over time;

FIG. 7 is a graph of the results of AlamarBlue® assay showing effects of different concentrations (0.1, 1, 10, 100 μg/mL) of test antibodies on growth of the A549 cell line;

FIG. 8 is a graph of the results of AlamarBlue® assay showing effects of different concentrations (0.1, 1, 10, 100 μg/mL) of test antibodies on growth of the NA cell line;

FIG. 9 is a graph of the results of AlamarBlue® assay showing effects of different concentrations (0.1, 1, 10, 100 μg/mL) of test antibodies on growth of the SK-OV3 cell line;

FIG. 10 is a graph of the results of AlamarBlue® assay showing effects of different concentrations (0.1, 1, 10, 100 μg/mL) of test antibodies on growth of the HCT-116 cell line; and

FIG. 11 is a graph of the results of AlamarBlue® assay showing effects of different concentrations (0.1, 1, 10, 100 μg/mL) of test antibodies on growth of the Caki-2 cell line.

DESCRIPTION OF EMBODIMENTS

Preferable embodiments of the present invention are described hereinbelow. The matters which are not specifically referred to in the present specification and which are necessary for practice of the present invention (e.g., gene recombinant techniques, protein (antibody) purification and general matters relating to bioassays) may be understood as matters which a person skilled in the art can appropriately design based on conventional techniques in the fields of cell engineering, medical science, pharmaceuticals, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology and the like.

The present invention can be practiced based on the contents disclosed herein and common technical knowledge in the art.

All literatures cited herein are incorporated herein by reference in their entirety.

The term “antibody produced artificially” as used in the present specification means an antibody which is artificially produced typically by genetic engineering techniques and is different from an antibody produced by natural immunoreactions in human or animal in vivo.

The term “antibody” typically denotes an immunoglobulin containing a heavy chain and a light chain and encompasses immunoglobulin molecules in native form (typically IgG, e.g., human IgG) as well as various fragment antibodies such as Fab fragments and F(ab′)₂ fragments.

The “antibody” as used in the present specification encompasses an antibody molecule which may be formed by genetic engineering techniques. For example, so-called single-chain antibodies (scFvs) produced artificially which comprise an amino acid sequence of a VL region and an amino acid sequence of a VH region on a single peptide chain are also encompassed by the “antibody” used in the present specification.

The term “amino acid residue” as used in the present specification encompasses an N-terminal amino acid and a C-terminal amino acid of a peptide chain unless otherwise stated.

The term “modified amino acid sequence” as used in the present specification in the context of given amino acid sequences forming the VH or VL region means an amino acid sequence which is formed by substitution, deletion and/or addition (insertion) of one to several (e.g., one, two or three) amino acid residues without deteriorating the antigen binding capacity of the given amino acid sequences. For example, sequences resulting from so-called conservative amino acid replacement in which one to several (typically two or three) amino acid residues are conservatively substituted (e.g., sequences in which a basic amino acid residue is substituted by another basic amino acid residue and sequences in which an acidic amino acid residue is replaced by another acidic amino acid residue) or sequences obtained by adding (inserting) or deleting one to several (typically two or three) amino acid residues to or from the given amino acid sequences are typical examples encompassed by the modified amino acid sequence according to the present specification.

The term “polynucleotide” as used herein refers to a polymer (nucleic acids) of more than one nucleotides linked by phosphodiester bonds and is not limited by the number of nucleotides. The polynucleotide as used herein encompasses DNA fragments having various lengths.

The term “polynucleotide designed artificially” means a polynucleotide whose nucleotide chain alone (full length) does not occur naturally and which is artificially synthesized by chemical synthesis or biosynthesis (i.e., genetic engineering production). For example, recombinant plasmid DNAs, recombinant phage DNAs and the like comprising a nucleotide sequence encoding the amino acid sequence disclosed herein are typical examples encompassed by the artificially designed polynucleotide according to the present specification.

The cell growth inhibitor provided by the present invention is a composition which comprises at least one antibody created by the present inventors (i.e., the C2 domain-binding anti-EGFR antibody and/or L1 domain-binding anti-EGFR antibody) and is characterized in that it suppresses growth of at least one EGFR-expressing cell. Other components contained and preparation, storage, usage and the like as a drug may be the same as those for conventional antibody drugs (pharmaceutical compositions containing antibodies) without particular limitation. For example, pharmaceutically acceptable carriers may include saline, PBS and other buffers, Ringer's solution and the like. Additives may include various antibiotics, pH adjusting agents, antioxidants, chelating agents, pigments, preservatives, various vitamins, enzymes and the like.

The present inventors screened the phage display single-chain antibody library which was constructed and possessed by the present inventors and colleagues (Patent Literature 2, supra, may be referred to as an example for the production of this kind of library) using a known anti-human EGFR monoclonal antibody as a so-called guide molecule, selected some new single-chain antibodies (scFvs) having an epitope different from those of conventional anti-EGFR antibodies and identified amino acid sequences corresponding to the variable regions of these scFvs and nucleotide sequences encoding the amino acid sequences to complete the present invention.

Namely, one suitable anti-EGFR antibody disclosed herein (C2 domain-binding anti-EGFR antibody) is an antibody characterized in that the VH region thereof has an amino acid sequence of SEQ ID NO: 1 (or a modified amino acid sequence thereof) and/or the VL region thereof has an amino acid sequence of SEQ ID NO: 2 (or a modified amino acid sequence thereof), and is a novel, artificially produced antibody whose epitope is in the C2 domain.

Another suitable anti-EGFR antibody disclosed herein (L1 domain-binding anti-EGFR antibody) is an antibody characterized in that the VH region thereof has an amino acid sequence of SEQ ID NO: 3 (or a modified amino acid sequence thereof) and/or the VL region thereof has an amino acid sequence of SEQ ID NO: 4 (or a modified amino acid sequence thereof), and is a novel, artificially produced antibody whose epitope is in the L1 domain.

The antibodies disclosed herein can be easily produced by genetic engineering techniques because the amino acid sequences of the variable regions which bind to the epitopes are apparent.

For example, single chain antibodies (scFvs) obtained from the above library may be sufficiently used as the antibody drug; however, in order to improve binding affinity in vivo and impart physical stability, it is preferable that they are in a complete antibody form (e.g., human IgG). As shown in Examples hereinbelow, they can be easily produced by amplifying by conventional PCR (Polymerase Chain Reaction) technique a nucleotide sequence encoding the VH region (VH gene) and a nucleotide sequence encoding the VL region (VL gene) from a plasmid vector comprising a nucleotide sequence encoding the scFv, introducing them in an antibody expression vector (such as a plasmid) having constant regions (CH and CL regions) and expressing in certain host cells (typically animal cells such as CHO (Chinese Hamster Ovary) cells).

Thus, the present invention provides a method for production of the anti-EGFR antibodies characterized in that it utilizes nucleotide information (i.e., nucleotide sequences) encoding the amino acid sequences of the VH and/or VL region(s) disclosed herein.

The cell growth inhibitor disclosed herein contains at least one of the C2 domain-binding anti-EGFR antibody and/or L1 domain-binding anti-EGFR antibody created by the present inventors as an antibody component, and as a result, as apparent from Examples described hereinbelow, can effectively suppress growth of KRAS mutant, high EGFR expressing cells (e.g., metastatic colon cancer cells), for which conventional antibodies of similar type have not been efficacious, as well as of high EGFR expressing cells without KRAS mutation.

Thus, the present invention can provide a method for controlling malignant tumor containing KRAS mutant, high EGFR expressing cells such as metastatic colon cancer, characterized in that it comprises administering to a patient at least one of the C2 domain-binding anti-EGFR antibody and/or L1 domain-binding anti-EGFR antibody disclosed herein (i.e., a drug composition containing the antibody(s)).

Dosages, dosage frequencies and dosage modes (oral, subcutaneous injection, intravenous injection, enema, etc.) may be varied according to the conditions (symptoms) of target patients, morphology of the administration target (malignant tumor), the form of the cell growth inhibitor used (drug composition), the form of the antibody(s) (e.g., whether it is in the form of scFv or complete human IgG), the concentration of the contained antibody(s), the presence or absence of auxiliary component(s) other than the antibody(s) and the concentration thereof and the like, and thus are design choices. A person skilled in the art can, as appropriate, based on the knowledge in known antibody engineering techniques as well as the knowledge in pharmaceuticals, clinical medicine, physiology or hygiene, prepare the cell growth inhibitor in a suitable form and administer (apply) the cell growth inhibitor (antibody drug) in the suitable form to the body of a given patient or cultures of tissue and cells from the patient. As the present invention is not characterized by this point per se, further detailed description is omitted.

The present invention is further described in detail based on the following Examples. However, the present invention is not intended to be limited by the following Examples.

TEST EXAMPLE 1

Production of Anti-EGFR Antibodies

The phage display single-chain antibody (scFv) library which was prepared beforehand was screened by using a mouse-derived anti-human EGFR monoclonal antibody which was created by the present inventors and colleagues and is commercially available as “B4G7” monoclonal antibody as a guide molecule. ScFv displaying phages which bound in the vicinity of the guide molecule were selectively collected and in the end four novel anti-EGFR single-chain antibodies (scFVs) in total and genes encoding the antibodies were obtained.

The obtained scFv genes were amplified by PCR using predetermined primers to identify the nucleotide sequences of the VH region and the amino acid sequences encoded thereby and the nucleotide sequences of the VL region and the amino acid sequences encoded thereby.

Amino acid sequence and nucleotide sequence information on the obtained four antibody samples (designated as sample Nos. 45, 38, 40 and 42) is as follows.

TABLE 1
Amino acid sequence and nucleotide sequence of sample No. 45
<VH region: SEQ ID NO: 1>
GlnValGlnLeuGlnGluTrpGlyAlaGlyLeuLeuLysProSerGluThrLeuSerLeuThrC
ysA1aValTyrGlyGlySerPheSerAspTyrTyrTrpSerTrpIleArgG1nProProGlyLy
sGlyLeuGluTrpIleGlyGluIleSerHisSerGlySerThrGlyTyrAsnProSerLeuLys
SerArgVa1AlaIleSerValAspThrProLysAsnGlnPheSerLeuLysLeuAsnSerValT
hrAlaAlaAspThrAlaLeuTyrTyrCysAlaArgLeuThrThrValValGlyGlyAsnTrpPh
eAspProTrpGlyGlnGlyThrLeuValThrValSerSerAla
<VH region: SEQ ID NO: 9>
CAGGTGCAGCTGCAGGAGTGGGGCGCAGGACTGTTGAAGCCTTCGGAGACCCTGTCCCTCACCT
GCGCTGTGTACGGTGGGTCCTTCAGTGATTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAA
GGGGCTGGAGTGGATCGGAGAAATCAGTCATAGCGGAAGTACCGGCTACAACCCGTCCCTCAAG
AGTCGAGTCGCCATATCAGTTGACACGCCCAAGAACCAGTTCTCCCTGAAGCTGAACTCTGTGA
CCGCCGCGGACACGGCTCTATATTATTGTGCGAGACTGACAACAGTGGTTGGGGGCAACTGGTT
CGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGCG
<VL region: SEQ ID NO: 2>
GlnSerValLeuThrGlnProProSerA1aSerGlyThrProGlyGlnGlyValThrIleSerC
ysSerGlySerSerAlaAspIleGlyAlaAsnTyrVa1TyrTrpTyrGlnGlnLeuProG1yTh
rAlaProLysLeuLeuIleTyrSerIleAsnGlnArgProSerGlyValProAspArgPheSer
GlySerLysSerGlyThrSerAlaSerLeuAlaIleSerGlyLeuArgSerGluAspGluAlaA
spTyrTyrCysAlaThrTrpAspAspSerLeuGlyGlyTrpAlaPheGlyGlyGlyThrLysVa
lGluIleLysArgThrValAla
<VL region: SEQ ID NO: 10>
CAGTCTGTTCTGACTCAGCCCCCTTCCGCGTCTGGGACCCCCGGGCAGGGGGTCACCATCTCTT
GTTCTGGAAGGAGTGCCGACATCGGAGCAAATTATGTATACTGGTACCAGCAACTTCCAGGAAC
GGCCCCCAAACTCCTCATCTATTCTATTAATCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCT
GGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCaTCAGTGGGCTCCGGTCCGAGGATGAGGCTG
ATTATTACTGTGCAACATGGGATGACAGCCTGGGTGGCTGGGCATTCGGCGGAGGGACCAAGGT
GGAAATCAAACGAACTGTGGCG

TABLE 2
Amino acid sequence and nucleotide sequence of sample No. 38
<VH region: SEQ ID NO: 3>
GlnValGlnLeuGlnGluSerGlyProGlyLeuValLysProSerGluThrValSerLeuThrC
ysSerValSerGlyAspSerLeuSerHisAsnTyrTrpSerTrpIleArgGlnProProGlyLy
sGlyLeuGluTrpIleGlyTyrIleTyrProSerGlyThrSerGlyThrThrLysTyrAsnPro
SerLeuLysSerArgValThrIleSerSerAspThrSerLysAsnGlnPheSerLeuArgLeuT
hrSerValThrAlaAlaAspThrAlaIleTyrTyrCysAlaLysGluAlaIleThrAlaAsnAl
aTrpProValSerAspTyrTrpGlyGlnGlyThrLeuValThrValSerSerAla
<VH region: SEQ ID NO: 11>
CAGGTGCAGCTACAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCGTGTCCCTCACCT
GCAGTGTCTCTGGTGACTCCCTCAGTCATAACTACTGGAGTTGGATCCGGCAGCCACCAGGGAA
GGGACTGGAGTGGATTGGGTATATCTATCCTAGTGGGACTAGTGGGACCACCAAGTACAATCCC
TCCCTCAAGAGTCGAGTCACCATATCAAGCGACACGTCCAAGAACCAGTTCTCCCTGAGGTTGA
CCTCTGTGACCGCTGCGGACACGGCCATATATTATTGTGCGAAAGAGGCAATCACCGCCAATGC
CTGGCCGGTGTCGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGCG
<VL region: SEQ ID NO: 4>
AspIleValLeuThrGlnSerProAlaThrLeuSerLeuSerProGlyGluArgA1aThrLeuS
erCysArgAlaSerGlnSerVa1SerSerTyrLeuAlaTrpPheGlnGlnLysProGlyGlnA1
aProArgLeuLeuIleTyrAspA1aSerAsnArgAlaThrGlyValProAlaArgPheSerGly
SerGlySerGlyThrAspPheThrLeuThrIleThrSerLeuGluProGluAspPheAlaValT
yrTyrCysGlnG1nArgGlyAspTrpProLeuThrPheGlyGlyG1yThrLysValGluIleLy
sArgThrVa1Ala
<VL region: SEQ ID NO: 12>
GATATTGTATTGACCCAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCT
CCTGCAGGGCCAGTCAGAGTGTTAGCAGCTACTTAGCCTGGTTCCAACAGAAACCTGGCCAGGC
TCCCAGGCTCCTCATCTATGATGCATCCAACAGGGCCACTGGCGTCCCAGCCAGGTTCAGTGGC
AGTGGGTCTGGGACAGACTTCACTCTCACCATCACCAGCCTAGAGCCTGAAGATTTTGCAGTTT
ATTACTGTCAGCAGCGTGGCGACTGGCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAAATCAA
ACGAACTGTGGCG

TABLE 3
Amino acid sequence and nucleotide sequence of sample No. 40
<VH region: SEQ ID NO: 5>
GlnValGlnLeuValGlnSerGlyProG1yLeuValLysProSerGluThrLeuSerLeuThrC
ysThrValSerGlyGlySerValSerSerG1yThrTyrCysTrpSerTrpIleArgGlnProPr
oG1yLysG1yLeuGluTrpIleAlaTyrIleCysAsnSerG1ySerThrSerTyrAsnProSer
LeuLysSerArgGlyThrIleSerVa1AspThrSerLysAsnG1nPheSerLeuArgLeuSerS
erValThrAlaAlaAspThrAlaValTyrTyrCysAlaArgLeuSerLeuIleMetValTyrHi
sIlePheAspTyrTrpGlyGlnGlyThrLeuVa1ThrVa1SerSerA1a
<VH region: SEQ ID NO: 13>
CAGGTGCAGCTGGTGCAATCTGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCT
GCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTACTTACTGCTGGAGCTGGATCCGGCAGCCCCC
AGGGAAGGGACTGGAGTGGATTGCGTATATCTGTAACAGTGGGAGCACCAGCTACAACCCCTCC
CTCAAGAGTCGAGGCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTAAGGCTGAGCT
CTGTGACCGCTGCGGACACGGCCGTATATTACTGTGCGAGATTGTCGCTAATAATGGTGTATCA
TATCTTTGACTACTGGGGGCAGGGAACCCTGGTCACCGTCTCCTCAGCG
<VL region: SEQ ID NO: 6>
AspIleValMetThrG1nThrProAspSerLeuAlaValSerLeuGlyGluArgA1aThrIleA
snCysLysSerSerGlnAsnLeuLeuTyrThrSerSerAsnGinThrTyrLeuAlaTrpTyrG1
nGlnLysProGlyGlnProProLysLeuLeuIleTyrTrpA1aSerThrArgGluSerGlyVa1
ProAspArgPheSerGlySerGlySerGlyThrAspPheThrLeuThrLeuSerSerLeuGlnP
roGluAspVa1AlaAlaTyrTyrCysGlnG1nTyrTyrArgThrProIleThrPheGlyProG1
yThrLysValGluIleLysArgThrValAla
<VL, region: SEQ ID NO: 14>
GATATTGTGATGACGCAGACTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCA
ACTGCAAGTCCAGTCAGAATCTCTTATACACTTCCAGTAATCAGACCTACTTAGCTTGGTACCA
GCAGAAACCAGGACAGCCTCCTAAATTGCTCATTTACTGGGCATCTACGCGGGAGTCCGGGGTC
CCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTGACCATCAGCAGCCTGCAGC
CTGAAGATGTGGCAGCATATTACTGTCAGCAATATTATAGGACTCCTATCACTTTCGGCCCTGG
GACCAAGGTGGAGATCAAACGAACTGTGGCG

TABLE 4
Amino acid sequence and nucleotide sequence of sample No. 42
<VH region: SEQ ID NO: 7>
G1nVa1GlnLeuValGluSerGlyAlaGluValArgLysProGlyAlaSerValLysValSerC
ysGlnAlaSerGlyTyrThrPheThrAspHisTyrLeuHisTrpLeuArgGlnAlaProGlyGl
nGlyLeuGluTrpMetGlyTrpIleAsnProAsnIleIleGluA1aArgTyrValAlaArgLys
PheArgGlySerVa1AsnLeuThrArgAspThrAlaIleGlnThrVa1TyrIleG1uMetSerA
rgLeuThrSerAspAspThrA1aThrTyrPheCysA1aArgAlaLeuLysGluGlyGlyTyrSe
rTyrGlyTyrTyrAspHisTrpG1yProGlyThrLeuValThrValSerSerAla
<VH region: SEQ ID NO: 15>
CAGGTGCAGCTGGTGGAGTCTGGGGCTGAGGTGAGGAAGCCTGGGGCCTCAGTGAAGGTCTCCT
GTCAGGCCTCTGGATACACCTTCACCGACCACTATCTCCACTGGCTGCGACAGGCCCCCGGACA
AGGGCTTGAGTGGATGGGGTGGATCAATCCCAACATCATTGAAGCCAGATACGTCGCACGGAAG
TTTAGAGGCAGTGTCAACCTGACCAGGGACACGGCCATCCAGACAGTGTACATAGAAATGAGCC
GCCTGACATCTGACGACACGGCCACCTACTTCTGTGCGAGAGCGTTAAAGGAGGGCGGATATAG
TTATGGTTATTACGACCATTGGGGCCCGGGAACCCTGGTCACTGTCTCCTCAGCG
<VL region: SEQ ID NO: 8>
G1uIleValMetThrGlnSerProCysProSerProLeuGluSerArgProProSerProAlaG
lyLeuValArgAlaSerTrpIleAlaMetMetA1aThrProIleTrpThrG1yThrCysArgSe
rGlnG1ySerLeuHisSerSerSerIleTyrThrLeuSerHisArgAlaProGlyValProAsp
ArgPheSerG1ySerGlySerGlyThrAspPheThrLeuLysIleSerArgValGluAlaG1uA
spValGlyValTyrTyrCysLeuGlnArgIleAspPheProPheThrPheGlyProGlyThrLy
sValGluIleLysArgThrValAla
<VL region: SEQ ID NO: 16>
GAAATTGTGATGACTCAGTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAG
GTCTAGTCAGAGCCTCTTGGATAGCGATGATGGCGACACCTATTTGGACTGGTACCTGCAGAAG
CCAGGGCAGTCTCCACAGCTCCTCGATCTATACCCTTTCCCATCGGGCCCCTGGAGTCCCAGAC
AGGTTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGG
ATGTTGGAGTTTATTACTGCCTGCAACGTATAGACTTTCCATTCACTTTCGGCCCAGGGACCAA
GGTGGAAATCAAACGAACTGTGGCG

By using the sequence information obtained of the scFvs of the samples, human IgGs were then prepared by gene recombination techniques. Expression plasmid vectors “pHIgHzeo” and “pHIgKneo” shown in the plasmid maps in FIGS. 1A and 1B, respectively, were used. Full nucleotide sequences of pHIgHzeo and pHIgKneo are shown in SEQ ID NOs: 17 and 18, respectively.

As shown in the plasmid map in FIG. 1A, pHIgHzeo contains genes (CH1 to CH3) encoding the human IgG1 heavy chain constant region (CH region). On the other hand, as shown in the plasmid map in FIG. 1B, pHIgKneo contains a gene (CK1) encoding the human IgG1 light chain (κ chain) constant region (CL region). These plasmid vectors have, as shown in the figures, two cleavage sites for the restriction enzyme Esp3I (recognition sites of Esp3I are agagacg at positions 619 to 625 and gtctcg at positions 2336 to 2341 of SEQ ID NO: 17; and gagacg at positions 622 to 627 and gtctcg at positions 2319 to 2324 of SEQ ID NO: 18), so that a nucleotide sequence encoding the amino acid sequence of the VH region of interest (hereinafter referred to as “VH coding gene”) or a nucleotide sequence encoding the amino acid sequence of the VL region (hereinafter referred to as “VL coding gene”) can be inserted at the site(s) (cleavage site(s)) cleaved after treatment with Esp3I.

Specifically, to 50 ng of each plasmid vector treated with the enzyme Esp3I was added 10 ng of the VH coding gene and VL coding gene of any of the samples respectively and a recombinant pHIgHzeo in which the VH coding gene of interest (i.e., any nucleotide sequence of SEQ ID NO: 9, 11, 13 or 15) is incorporated at the Esp3I cleavage site was obtained by using commercially available In-Fusion Advantage PCR Cloning Kit (Clontech) according to the instruction of the product. In the similar manner, a recombinant pHIgKneo in which the VL coding gene of interest (i.e., a nucleotide sequence of SEQ ID NO: 10, 12, 14 or 16) is incorporated at the Esp3I cleavage site was obtained.

The obtained recombinant expression vectors were introduced in general competent cells, Escherichia coli TOP10 competent cells, and transformants were selected on 10% sucrose-containing SOB medium plates added zeocin or kanamycin at the concentration of 50 μg/mL.

In order to obtain positive clones in which desired genes (inserts) were correctly fused, i.e., to obtain VH recombinant pHIgHzeo and VL recombinant pHIgKneo, colony PCR was carried out with two sets of primers, i.e., a set of pFUSEseq-f and CHseq-r represented by SEQ ID NOs: 19 and 20, respectively, for VH and a set of IgKss-f and Ckseq-r represented by SEQ ID NOs: 21 and 22, respectively, for VL, and the inserts were verified.

The positive clones (E. coli TOP10) in which the inserts were correctly fused were isolated and grown on the 10% sucrose-containing SOB medium.

Among the thus obtained recombinant expression vectors, the VH recombinant pHigHzeo and VL recombinant pHIgKneo which correctly corresponded to the samples of interest (Nos. 45, 38, 40 and 42) were mixed in equal amount and introduced into commercially available FreeStyle™ CHO-S cells (Invitrogen), which were then cultured according to the conventional manner to produce divalent antibodies, complete human IgGs (hIgGs). The obtained IgGs corresponding to avobe four say samples are designated as hIgG45, hIgG38, hIgG40 and hIgG42 by using the sample numbers.

TEST EXAMPLE 2

Verification of Epitope Located Region

The thus obtained four artificially produced anti-EGFR antibodies (human IgGs) were studied for EGFR binding portions.

Namely, four different genes encoding EGFR extracellular domain deletion mutant peptides in which one of four subdomains (L1, C1, L2 and C2) was deleted from the EGFR extracellular domain were prepared by PCR using appropriate primers. The gene encoding the EGFR extracellular domain peptide without deletion was also prepared.

The expression virus vectors containing the above genes were constructed and used to transfect BJ cells in order to obtain BJ cells which express the EGFR extracellular domain deletion mutant peptides or the EGFR extracellular domain peptide without deletion.

FIG. 2 shows on its left side deleted parts of EGFR extracellular domain deletion mutant peptides. The portions shown with Δ in this figure are the deleted parts (the numbers denote the positions and regions of deleted amino acid residues from the N-terminal). As shown in this figure, all of the EGFR extracellular domain peptides constructed in this Test Example have a signal sequence (SS) on the N-terminal side and an EGFR transmembrane domain (TM) on the C-terminal side which is provided with the V5-tag on the C-terminal side thereof.

Accordingly, the EGFR extracellular domain deletion mutant peptides or the EGFR extracellular domain peptide without deletion expressed in BJ cells together with hIgG45, hIgG38, hIgG40 and hIgG42 obtained in Test Example 1 and commercially available anti-EGFR monoclonal antibodies “B4G7” and “cetuximab” as controls were used in conventional Western blot analysis.

By comparative analysis of binding capacity of test antibodies to test peptides in this Western blotting, i.e., by analyzing which subdomain among four subdomains forming the extracellular domain was deleted at the time of loss of the binding capacity, the portions to which test antibodies bind were elucidated as shown on the right side of FIG. 2. The test antibodies with “+” on the right side of FIG. 2 bind to the deleted subdomains shown in the corresponding rows in the left side of FIG. 2.

Namely, as apparent from the results shown in FIG. 2, it was verified that hIgG45, hIgG38, hIgG40 and hIgG42 obtained in Test Example 1 have binding portions (epitopes) in C2, L1, C1 and C2 domains, respectively.

TEST EXAMPLE 3

Evaluation of Cell Growth Suppression (Inhibition) Capacity of Anti-EGFR Antibodies (1)

The obtained antibodies were provided to various cultured cells and the cell growth suppression (inhibition) capacities thereof were evaluated in an in vitro cell culture test. The cell lines used are four, which are known A431, A549, NA and MDA-MB-231. Namely, A431 is a human squamous cell carcinoma cell line, A549 is a human lung squamous cell carcinoma cell line, NA is a human oral squamous cell carcinoma cell line and MDA-M13-231 is a human breast cancer cell line.

Specifically, the antibody at a predetermined concentration was added to the above cell line with using “AlamarBlue®” (Invitrogen) which is a dye for cell growth evaluation and the degree of cell growth after a predetermined culture time (24, 48 or 72 hours) was measured as the OD value of the above dye.

Namely, cells were seeded in wells of a 96-well plate containing the DMEM medium containing 10% FCS at the cell concentration of 1×10⁴ cells/well and incubated under 37° C., 5% CO₂ for 2 days until the mid-log phase. The medium was exchanged with the FCS-free DMEM medium (free from phenol red in order to avoid the affect from the color of the medium) and the incubation was continued for further overnight. The medium was then exchanged with the DMEM medium containing 0.1% FCS, any of the test antibodies was added at a predetermined concentration (0.1 μg/mL or 10 μg/mL) and the incubation was continued. Controls were the one without antibody and the one added with the B4G7 antibody at the same concentration. The dye AlamarBlue® was added so as to obtain the final concentration of 10% per well.

At 24, 48 and 72 hours after addition of the antibody, absorbance was measured at 570 nm and 600 nm with a conventional spectrophotometer. The results are shown in FIG. 3 (A431 cell line), FIG. 4 (A549 cell line), FIG. 5 (NA cell line) and FIG. 6 (MDA-MB-231 cell line). As apparent from these graphs, it was found that IgG45 and IgG38 have significant cell growth suppression (inhibition) effect on A431, A549 and NA cell lines which express EGFR at a relatively high rate. Particularly, high cell growth suppression (inhibition) effect was found against the A549 cell line which derives from KRAS mutant malignant tumor cells. FIG. 2 shows that IgG42 and IgG45 had different reactivity against the cell lines as described above, which otherwise bound to the same portion (i.e., the C2 domain) in appearance. The reason for this is believed that actual epitopes for IgG42 and IgG45 are in two different narrower portions in the C2 domain. This shows that IgG45 and/or IgG38 can act as effective antibody drugs against KRAS mutant malignant tumors such as A549 for which the effect by conventional anti-EGFR antibodies (e.g., B4G7 used as the control in the present Test Example) could not be seen.

TEST EXAMPLE 4

Evaluation of Cell Growth Suppression (Inhibition) Capacity of Anti-EGFR Antibodies (2)

Next, in order to study the concentration (dose) dependency of cell growth suppression capacity of the test antibodies, the AlamarBlue® assay was carried out as described above and cell viability (%) at respective concentrations (0.1, 1, 10 and 100 μg/mL) of the antibodies was evaluated.

The cell lines used were A549 and NA as described above as well as SK-OV3 (human ovarian carcinoma cell line), HCT-116 (human colon cancer cell line) and Cald-2 (human renal carcinoma cell line).

The absorbance was measured at 72 hours after addition of the antibody at a predetermined amount under the culture conditions described in Test Example 3. Cell viability (%) was calculated according to the following formula:Viability(%)=[(OD standard value for treatment without antibody−OD standard value for treatment with IgG)/OD standard value for treatment without antibody]×100.

The results are shown in FIG. 7 (A549 cell line), FIG. 8 (NA cell line), FIG. 9 (SK-OV3 cell line), FIG. 10 (HCT-116 cell line) and FIG. 11 (Caki-2 cell line).

As apparent from these graphs, it was found that, among the antibodies tested, IgG45 and IgG38 can stably (typically, at a concentration of 1 μg/mL or more, particularly a concentration of 10 μg/mL or more) show significant cell growth suppression (inhibition) effect against malignant tumor cells which express EGFR at a relatively high rate and in which the KRAS gene is mutated.

Suitable examples of useful anti-EGFR antibodies (i.e., IgG45 and IgG38) provided by the present invention have been described by way of the above Test Examples. However, the present invention is not limited to these embodiments. For example, Fab and F(ab′)₂ fragments obtained by conventional enzyme treatment of the above complete human IgG45 and complete human IgG38 are typical examples encompassed by the present antibodies.

Industrial Applicability

As described above, the anti-EGFR antibodies disclosed herein have high cell growth suppression (inhibition) activity particularly against malignant tumor cells (high EGFR expressing cells) in which the KRAS gene is mutated, and therefore the cell growth inhibitor containing the antibodies can be used as the composition for medicines such as anticancer drugs.

[Sequence Listing Free Text]

SEQ ID NOs: 1 to 8: Synthetic peptides

SEQ ID NOs: 9, 11, 13 and 15: Variable regions of the heavy chain for artificial IgG

SEQ ID NOs: 10, 12, 14 and 16: Variable regions of the light chain for artificial IgG

SEQ ID NOs: 17 and 18: Plasmid DNAs

SEQ ID NOs: 19 to 22: Primers

Claims

1. A composition comprising: (1) a pharmaceutically acceptable carrier; and(2) an active ingredient capable of suppressing growth of at least one epidermal growth factor receptor (EGFR)-expressing cell, the active ingredient comprising either or both of (A) an anti-EGFR antibody having specific binding capacity to EGFR, including:a heavy chain variable region (VH region) having the amino acid sequence of SEQ ID NO: 1, anda light chain variable region (VL region) having the amino acid sequence of SEQ ID NO: 2, wherein:the anti-EGFR antibody has specific binding capacity to an epitope of EGFR,the epitope is in a cysteine-rich subdomain 2 (C2) being a fourth subdomain from a N-terminal of an extracellular domain among four subdomains contained in EGFR; and(B) an anti-EGFR antibody having specific binding capacity to EGFR, including:a heavy chain variable region (VH region) having the amino acid sequence of SEQ ID NO: 3, anda light chain variable region (VL region) having an-the amino acid sequence of SEQ ID NO: 4, wherein:the anti-EGFR antibody has specific binding capacity to an epitope of EGFR,the epitope is in a ligand-binding domain 1 (L1) being a first subdomain from a N-terminal of an extracellular domain among four subdomains contained in EGFR.

2. The composition of claim 1, wherein at least one of the antibody (A) and the antibody (B) further comprises a heavy chain constant region (CH region) and a light chain constant region (CL region) of human IgG in addition to the VH region and the VL region, and has a form of human IgG.

3. The composition of claim 1, wherein the EGFR-expressing cell is a KRAS mutant malignant tumor cell and the composition suppresses growth of the KRAS mutant malignant tumor cell.

4. An anti-EGFR antibody having specific binding capacity to epidermal growth factor receptor (EGFR), comprising: a heavy chain variable region (VH region) having the amino acid sequence of SEQ ID NO: 1; anda light chain variable region (VL region) having the amino acid sequence of SEQ ID NO: 2;wherein:the anti-EGFR antibody has specific binding capacity to an epitope of EGFR, andthe epitope is in a cysteine-rich subdomain 2 (C2) being a fourth subdomain from a N-terminal of an extracellular domain among four subdomains contained in EGFR.

5. An anti-EGFR antibody having specific binding capacity to epidermal growth factor receptor (EGFR), comprising: a heavy chain variable region (VH region) having the amino acid sequence of SEQ ID NO: 3; anda light chain variable region (VL region) having the amino acid sequence of SEQ ID NO: 4;wherein:the anti-EGFR antibody has specific binding capacity to an epitope of EGFR, andthe epitope is in a ligand-binding domain 1 (L1) being a first domain from a N-terminal of a extracellular domain among four subdomains contained in EGFR.

6. The anti-EGFR antibody of claim 4, further comprising a heavy chain constant region (CH region) and a light chain constant region (CL region) of human IgG in addition to the VH region and the VL region, and having a form of human IgG.

7. A method for suppressing a cell growth, comprising: applying the anti-EGFR antibody of claim 4 to at least one target epidermal growth factor receptor (EGFR)-expressing cell so as to suppress growth of the EGFR-expressing cell.

8. The method of claim 7, wherein the EGFR expressing cell is a KRAS mutant malignant tumor cell and the growth of the KRAS mutant malignant tumor cell is suppressed.

9. A method for treating a patient with an anti-EGFR antibody in need thereof, comprising the step of: administering to the patient the composition of claim 1 in an effective amount to suppress growth of EGFR-expressing cells.