Patent Application
20240094224
The XML file, entitled 98098SequenceListing.xml, created on Nov. 15, 2023, comprising 58,585 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.
The present invention, in some embodiments thereof, relates to methods of analyzing the antimicrobial peptide (AMP) profile of a tissue to obtain information regarding physiological states of the tissue, to AMP proxies for obtaining that information and for diagnosing and monitoring disease.
A beneficial balance between the mammalian host and its gut microbiome is critical for host homeostasis and host-microbe mutualism. Disruption of such balanced microbial composition and its collective functions, termed “dysbiosis”, has been associated with a multitude of intestinal and extra-intestinal health-related outcomes in humans, including inflammatory bowel disease (IBD), autoimmune disease, cardiometabolic disease, cancer and neurodegenerative disorders. Complex host-microbiome interactomes, orchestrating indigenous and dysbiotic microbiome colonization, entrenchment, and its pathophysiological consequences, are increasingly studied using metagenomic and metabolomic pipelines. However, elucidation of the vast and potentially bioactive repertoire of proteins and peptides associated with the gut microbiome, and their relation to disease remains elusive.
An important component of this vast repertoire of the host-derived proteome includes antimicrobial peptides (AMPs), a diverse group of evolutionarily conserved short defense proteins and peptides produced by various host cells in plants, invertebrates, amphibians, and mammals. Examples of well-characterized mammalian AMP families include lysozymes, cathelicidins, alpha- and beta-defensins, and regenerating islet-derived (Reg) proteins. The expression, secretion and activity of this diverse gut AMP repertoire in both epithelial and immune cells may be regulated by the commensal microbiome. Some AMPs constitutively shape the indigenous commensal repertoire and microbiome ecology. Other AMPs are secreted in response to pathogenic infection. Some AMPs are active against a broad range of bacteria, while others are known to be active only against specific strains.
The collective impact of the AMP repertoire on gut homeostasis in health and in microbiome-associated disease, and its potential diagnostic and therapeutic use remain elusive due to several key limitations. First, the vast majority of AMP-focused studies rely only on transcriptional activity of AMP expression while disregarding translational regulation, protein turn-over, and actual AMP levels following intestinal secretion. Second, most studies focus on decoding functions of individual AMPs or AMP families, while study of the complex AMP landscape and its potential impact on the microbiome in health and disease remains at its infancy. Third, the downstream impact of this global AMP landscape on commensal or pathogen colonization, de-novo development of disease-associated dysbiosis and disease manifestations remains poorly understood.
Likewise, reliable AMP proxies for assessing tissue health have not been available, due to the paucity and partial nature of the data surrounding the AMP landscape in health and disease.
Background art includes Zhong et al (2019), Leshem et al (2020), US Patent Application Publication No. 20110212104 to Beaumont et al, US Patent Application Publication No. 20210024997 to Shalek et al, Kang et al (2019) and Grant et al (2019).
According to an aspect of some embodiments of the present invention there is provided a method of determining a physiological state of a tissue of a subject, the method comprising:
measuring the levels of a plurality of antimicrobial proteins or peptides (AMPs) in a sample of a secretion, exudate or excretion of the tissue of the subject, wherein the plurality of AMPs is predominantly AMPs having shared abundance in the tissue and the secretion, exudate or excretion of the tissue in a predetermined physiological state and wherein a statistically significant correlation between the levels of the plurality of AMPs in the secretion, exudate or excretion and the levels of the plurality of AMPs in the tissue in the physiological state is identified, determining the presence of the physiological state of the tissue, and wherein levels of the plurality of AMPs constitutes a proxy for the physiological state of the tissue.
According to some embodiments of the invention the AMPs comprise:
According to an aspect of some embodiments of the present invention there is provided a method of determining a proxy for a physiological state of a tissue, the method comprising: (a) determining an antimicrobial protein and peptide (AMP) profile of a sample of the tissue, (b) determining the AMP profile of a sample of an exudate, secretion or excretion of the tissue and (c) identifying a plurality of AMPs having shared abundance in the tissue and the exudate, secretion or excretion in a given physiological state, wherein the plurality of AMPs having shared abundance constitutes the proxy.
According to some embodiments of the invention, the physiological state of the tissue is selected from the group consisting of inflammation, infection, autoimmune disease and metabolic disease.
According to some embodiments of the invention, the physiological state of the tissue is dysbiosis.
According to some embodiments of the invention, the annotated AMPs are from at least one database selected from the group consisting of Antimicrobial Peptide Database (APD), Data Repository of Antimicrobial Peptides (DRAMP 2.0), Database of Antimicrobial Activity and Structure of Peptides (DBAASP) and Collection of antimicrobial peptides (CAMP).
According to some embodiments of the invention, the bacterial ligand-binding domain binds bacterial lipopolysaccharides (LPS), bacterial lipoteichoic acids (LTA), bacterial lectins, and/or peptidoglycan precursor (Lipid II).
According to some embodiments of the invention the antibacterial defense response activity is selected from the group consisting of phagocytosis, bacterial membrane pore formation, radical oxygen species (ROS) production, hydrolytic enzyme release, limitation of free nutrient/inorganic-ions and promotion of growth of competing bacterial species.
According to some embodiments of the invention, the immunomodulatory activity is selected from the group consisting of chemoattraction of monocytes, neutrophils, dendritic cells, and T-cells, chemokine and cytokine production and neutrophil degranulation.
According to some embodiments of the invention, the tissue is gut mucosa and the excretion is feces. According to other embodiments, the tissue is lung and the secretion is alveolar fluid.
According to some embodiments of the invention, the tissue is vaginal, cervical or uterine tissue and the secretion and/or exudate is vaginal fluid.
According to some embodiments of the invention, the tissue is oral cavity tissue and the secretion is saliva.
According to some embodiments of the invention, the tissue is ocular tissue and the secretion is lacrimal fluid or tears.
According to some embodiments of the invention, the tissue is genitourinary tissue and the excretion is urine.
According to some embodiments of the invention, determining the levels of the plurality of AMPs is effected on a protein extract of the sample of the secretion, exudate or excretion.
According to some embodiments of the invention, the sample of a secretion, exudate or excretion is depleted of membrane proteins and membrane-bound organelle proteins.
According to some embodiments of the invention, the tissue is selected from the group consisting of gut tissue, vaginal/cervical/uterine tissue, nasopharynx, lung tissue, genitourinary tissue, ocular tissue and skin.
According to some embodiments of the invention, the tissue is selected from the group consisting of connective tissue, muscle, nervous tissue and epithelial tissue.
According to some embodiments of the invention, the physiological state of the tissue is affected by a condition selected from the group consisting of inflammation, infection, auto-immune disease and metabolic disorders.
According to some embodiments of the invention, when the tissue is human gut tissue and the secretion, exudate or excretion is stool, the physiological state is IBD, the AMPs are selected from the group consisting of PRTN3, AZU, S100A8, S100A9, S100A12, CTSG, LTF, PRB3, PGC, APCS, PGLYRP1, MPO, PRSS2, RNASE2, ELANE, ORM1, PLA2G1B, SOD2 and LGALS4.
According to some embodiments of the invention, when the tissue is human gut tissue and the secretion, exudate or excretion is stool, the physiological state is IBD, the AMPs are selected from the group consisting of AMPs having an amino acid sequence as set forth in SEQ ID Nos. 28-47.
According to some embodiments of the invention, the tissue is human gut tissue and the secretion, exudate or excretion is stool, the physiological state is Primary Sclerosing Cholangitis, and wherein the AMPs are selected from the group consisting of S100A8, S100A9, CEACAM8, ECP2, AZU, CTSG, PERM, Alpha-2-antichymotrypsin, PRTN3, EXP, RNAS4, ELANE, CSTA, Orosomucoid, Alpha Amylase 1 and MUC12.
According to some embodiments of the invention, the physiological state of the tissue is affected by dysbiosis.
According to some embodiments of the invention, the AMPs are identified by liquid chromatography, mass spectrometry or a combination of liquid chromatography and mass spectrometry.
According to some embodiments of the invention, the AMPs are identified by mass spectrometry-based label free quantification (LFQ).
According to some embodiments of the invention, the AMPs are identified by AMP binding moieties.
According to some embodiments of the invention, the AMP binding moieties are immobilized on an array.
According to an aspect of some embodiments of the present invention there is provided a kit for determining the physiological state of a tissue, comprising greater than 10 and fewer than 100 AMP-binding moieties, each binding moiety binding to a different AMP having shared abundance in the tissue and in an exudate, secretion or excretion of the tissue in a given physiological state.
According to some embodiments of the invention the binding moieties are selected from the group consisting of antibodies, aptamers and ligands of the greater than 10 and fewer than 100 AMPs.
According to some embodiments of the invention the tissue is gut tissue and the binding moieties are binding moieties binding to at least 10 of and fewer than 100 of the AMPs of Table S2.
According to some embodiments of the invention the tissue is gut tissue and the binding moieties are binding moieties binding to at least 10 of and fewer than 100 of the human orthologs of the murine AMPs of Table S2.
According to some embodiments of the invention the tissue is human gut tissue and the secretion, exudate or excretion is stool, the physiological state is IBD, and the AMPs are selected from the group consisting of PRTN3, AZU, S100A8, S100A9, S100A12, CTSG, LTF, PRB3, PGC, CP, APCS, PGLYRP1, MPO, PRSS2, RNASE2, ELANE, ORM1, PLA2G1B, SOD2 and LGALS4.
According to some embodiments of the invention, the tissue is human gut tissue and the secretion, exudate or excretion is stool, the physiological state is Primary Sclerosing Cholangitis, and wherein the AMPs are selected from the group consisting of S100A8, S100A9, CEACAM8, ECP2, AZU, CTSG, PERM, Alpha-2-antichymotrypsin, PRTN3, EXP, RNAS4, ELANE, CSTA, Orosomucoid, Alpha Amylase 1 and MUC12.
According to some embodiments of the invention the tissue is human gut tissue and the secretion, exudate or excretion is stool, the physiological state is IBD, and the AMPs are selected from the group consisting of AMPs having an amino acid sequence as set forth in SEQ ID Nos. 28-47.
According to an aspect of some embodiments of the present invention there is provided at least one tissue-associated AMP for use in treating or preventing an undesirable physiological state in a tissue of a subject.
According to some embodiments of the invention the tissue is gut tissue and the at least one tissue-associate AMP for use is a gut-associated AMP selected from the group consisting of Camp, Lnc2, Ltf, Mpo, Ngp, Prtn 3, Elane, Ctsg, Pglyrp1, S100a8, S100a9, Ear2, Epx, Prg2, Pla2g 1b, Reg3a, Reg3g and Reg4.
According to some embodiments of the invention the subject is a human and the gut associated AMP is the human ortholog of the murine gut-associated AMP selected from the group consisting of Camp, Lnc2, Ltf, Mpo, Ngp, Prtn 3, Elane, Ctsg, Pglyrp1, S100a8, S100a9, Ear2, Epx, Prg2, Pla2g 1b, Reg3a, Reg3g, Reg4.
According to some embodiments of the invention the tissue is gut tissue and said physiological state is dysbiosis.
According to some embodiments of the invention the tissue is gut tissue and the physiological state is IBD.
According to some embodiments of the invention the tissue is human gut tissue, and the gut-associated AMP is selected from the group consisting of PRTN3, AZU, S100A8, S100A9, S100A12, CTSG, LTF, PRB3, PGC, CP, APCS, PGLYRP1, MPO, PRSS2, RNASE2, ELANE, ORM1, PLA2G1B, SOD2 and LGALS4.
According to some embodiments of the invention, the tissue is gut tissue and the physiological state is Primary Sclerosing Cholangiatis.
According to some embodiments of the invention, the tissue is gut tissue and the gut-associatedAMPs are selected from the group consisting of S100A8, S100A9, CEACAM8, ECP2, AZU, CTSG, PERM, Alpha-2-antichymotrypsin, PRTN3, EXP, RNAS4, ELANE, CSTA, Orosomucoid, Alpha Amylase 1 and MUC12.
According to some embodiments of the invention the tissue is human gut tissue, and the gut-associated AMP is selected from the group consisting of AMPs having an amino acid sequence as set forth in SEQ ID Nos. 28-47.
Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
In the drawings:
The present invention, in some embodiments thereof, relates to methods of analyzing the antimicrobial peptide (AMP) profile of a tissue to obtain information regarding physiological states of the tissue, to AMP proxies for obtaining that information and for diagnosing and monitoring disease.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
The complexity of the internal environment has made it difficult to establish reliable correlations between host tissue health, the microbiome and the components of their interaction. For example, most studies of the GI host-microbiome interaction have analyzed host tissue gene expression patterns or levels of individual markers, but have not been able to account for the effects of the dynamics of GI physiology and the microbial ecosystem.
Whilst conceiving embodiments of the invention, the present inventors have now configured a novel approach for characterizing the innate immune response, and, in particular, antimicrobial peptides and proteins (AMPs). The approach is based on identification of AMPs according to functional as well as structural criteria. Based on this approach the present inventors explored the proteomic host AMP-microbiome interactome by systematically characterizing the landscape of known and candidate AMPs along the murine gastrointestinal (GI) tract and its impact on gut microbiome dynamics and disease phenotypes. By employing a mass spectrometry-based high-throughput AMP measurement pipeline integrating mucosal AMP analysis as a discovery approach and stool AMP profiling as a targeted and diagnostic proteomic tool, the present inventors have described a region-specific, microbiome-dependent AMP repertoire along the healthy murine gut (
Using this approach, the present inventors characterized proteomic AMP hallmark responses upon commensal mono-colonization, enteric pathogenic infection, and intestinal inflammation (
Importantly, by correlating niche-specific AMP signatures along the GI tract with the fecal AMP signature, the present inventors have shown that the fecal AMPs can serve as an accessible and faithful proxy for the proteomic AMP signature in the large intestine. Further, the present inventors have shown that the AMP landscape is predictive of the microbiome dynamics and intestinal inflammatory disease outcome, and demonstrated that application of AMP proxies in human IBD can faithfully differentiate between disease and healthy conditions and predict disease activity dynamics (
Thus, according to one aspect of the present invention there is provided a method of determining the physiological state of a tissue of a subject, the method comprising:
measuring the levels of a plurality of antimicrobial peptides (AMPs) in a sample of a secretion, exudate or excretion of the tissue of the subject, wherein the plurality of AMPs is predominantly AMPs having shared abundance in the tissue and in the secretion, exudate or excretion of the tissue in a predetermined physiological state, and wherein a statistically significant correlation between the levels of the plurality of AMPs in the secretion, exudate or excretion and the levels of the plurality of AMPs in the tissue in the physiological state is identified,
determining the presence of the physiological state of the tissue, wherein levels of the plurality of AMPs constitutes a proxy for the physiological state of the tissue.
As used herein, the term “physiological state of a tissue” refers to clinical parameters characterizing a tissue, e.g. function, structure, molecular markers, chemical status, metabolic status, histological status, morphological status, electrochemical status. These clinical parameters characterize the physiological state, which can be healthy or diseased or inbetween e.g., at risk or prone to develop a disease. Physiological state may also refer to gene expression, different states of differentiation, such as an intermediate state, an immune state (e.g., dysfunctional, naive, memory state) and a disease state (e.g., infected, malignant state). Tissues can have different states based upon the composition of cells in a microenvironment or location of the tissue. In some embodiments, the physiological state of the tissue refers to at least one of the immunological state, metabolic state, physical state and chemical state of the tissue.
The methods of the present invention can determine the physiological state of a tissue according to well-known parameters. Exemplary parameters of the immunological state of a tissue include, but are not limited to the balance of pro-inflammatory cytokines (e.g. IL-1beta, TNFalpha, IL-12, IL-18, GCSF and IFNgamma) and anti-inflammatory cytokines (e.g. IL-10, IL-11, IL-1ra, IL-4, IL-13 and TGFbeta) in the tissue, measuring the presence of immune cells such as CD8+ Tcells, natural killer (NK) and natural killer T (NKT) cells, gammadelta T cells, antigen-presenting cells, alphabeta T cells, regulatory T (Treg) cells, beta-lymphocytes and phagocytes in the tissue.
Exemplary parameters reflecting the metabolic state of a tissue include, but are not limited to oxygen consumption, energy metabolism (e.g. carbohydrate and lipid metabolism), fluctuations in metabolic gene and protein expression, blood perfusion, electro-chemical activity and levels of enzymatic (e.g. glycolysis, Krebs cycle and enzymes) activity.
Exemplary parameters reflecting the physical state of a tissue include, but are not limited to thermal properties (e.g. heat conductivity, thermal conductivity, specific heat capacity, thermal resistance), optical properties (e.g. absorption coefficient and scattering coefficient, refractive index), mechanical properties (e.g. viscoelasticity, elasticity, stiffness, tensile and compressive strength, contractability [muscle]), acoustic properties (e.g. sound speed, attenuation, non-linearity), dielectric properties (e.g. permittivity, conductivity) and weight.
Exemplary parameters reflecting the chemical state of a tissue include, but are not limited to pH, dry weight and water content, biochemical composition (e.g. fat, lipid, carbohydrate, protein, nucleic acid, etc.) and chemical composition (elements and molecules) of the tissue.
As used herein, the term “tissue” refers to a group of structurally and functionally related cells typically of more than one type and their intracellular material. Biological tissues can be grouped according to cell type, as in epithelial, endothelial, stromal and connective tissues, or according to function, such as connective tissue; nervous, contractile (e.g. muscle) and endocrine tissue; alimentary (e.g. gastro-intestinal) tissue and pulmonary (e.g. lung) tissue. Examples include, but are not limited to, brain tissue, retina, skin tissue, hepatic tissue, pancreatic tissue, bone, cartilage, connective tissue, blood tissue, muscle tissue, cardiac tissue brain tissue, vascular tissue, renal tissue, genitourinary tissue, ocular tissue, pulmonary tissue, gonadal tissue, hematopoietic tissue. In specific embodiments, the tissue is said tissue is selected from the group consisting of gut tissue, vaginal/cervical/uterine tissue, nasopharynx, lung tissue, genitourinary tissue, ocular tissue and skin.
In particular embodiments, the physiological state of gut tissue is determined. Gut tissue is typically comprised of a mucosal layer, submucosal layer, muscular layer and a serous layer, though embodiments of the invention can relate to parts thereof. The mucosa, which lines the lumen of the digestive tract, comprises epithelium, connective tissue and a smooth muscle layer. In specific embodiments, the methods determine physiological state of the gut mucosa.
In one step of some embodiments of the methods of the invention, the physiological state of a tissue of a subject is determined by measuring levels of a plurality of antimicrobial peptides in a sample of a secretion, exudate or excretion of the tissue. As used herein, the term “antimicrobial peptide” refers to oligo- or polypeptides that kill microorganisms or inhibit their growth. “Antimicrobial peptides” (AMPs) may include peptides that result from the cleavage of larger proteins or peptides that are synthesized ribosomally or non-ribosomally. Generally, antimicrobial peptides are cationic molecules with spatially separated hydrophobic and charged regions. Exemplary antimicrobial peptides include linear peptides that form an alpha-helical structure in membranes or peptides that form beta-sheet structures optionally stabilized with disulfide bridges in membranes. Representative antimicrobial peptides include, but are not limited to cathelicidins, defensins, dermcidin, and more specifically magainin 2, protegrin, tachyplesin, protegrin-1, melittin, dermaseptin 01, cecropin, caerin, ovispirin, alamethicin, pandinin 1, pandinin 2, and mastoparans B.
It will be appreciated that AMPs can be identified by the entire AMP protein or peptide, but will also refer to fragments of an AMP (i.e. a partial amino acid sequence of the AMP) which are indicative of the presence of the AMP. Such fragments may be the products of proteolytic digestion or chemical processes, for example, gut AMPs which are partially digested by endogenous proteases, such as trypsin, or partially digested by microbial proteases from commensal and/or pathological organisms comprising the gut microbiome. One example of such fragments, produced by trypsin digestion is the list of peptides representing AMPs identified in fecal samples in Table S2 below.
Using proteomic techniques, the inventors have established novel criteria for determining the AMP profile of a tissue or other biological sample, and have elucidated the AMP profile of the gut mucosa, at different locations and in response to changes in the gut microbiome (see, for example,
Thus, in some embodiments the method comprises measuring a plurality of AMPs, wherein the AMPs comprise:
Thus the AMPs may be known, annotated AMPs or proteins or peptides which are AMP “candidates”, having at least two of the properties (b)(i)-(vi). In some embodiments the AMP “candidates” have two, three, four or more of properties (b)(i)-(vi).
As used herein, annotated AMPs include, but are not limited to, AMPs identified in the published literature, e.g. databases. Annotated AMPs can be AMPs from at least one database, including but not limited to Uniprot, the Antimicrobial Peptide Database (APD), Data Repository of Antimicrobial Peptides (DRAMP 2.0), Database of Antimicrobial Activity and Structure of Peptides (DBAASP) and Collection of antimicrobial peptides (CAMP).
Additional AMPs identified from the proteome are candidate AMPs (peptides or proteins not identified as AMPs in published literature), having at least two of criteria (b)(i)-(vi).
Thus, in some embodiments the candidate AMP is a secreted peptide or protein. Proteins or peptides can be identified as secreted according to the published literature, as annotated as “secreted” in a protein or peptide database (e.g. Uniprot dot org), or predicted secreted using signal peptide prediction software (e.g. SignalP from the Center For Biologicals Sequence Analysis CBS).
In some embodiments, the candidate AMP is identified according to structural similarity to known AMPs. Structural similarity can include the presence of specific protein folds, domains or structural motifs similar to known AMPs, or as identified by structural prediction algorithms (e.g. pfam dot xfam), as well as high level of sequence identity or similarity to known AMPs, as identified by sequence local alignment algorithms (e.g. BLAST, CLUSTAL, and the like). In specific embodiments, the candidate AMPs have structural similarity when having two or more of amino acids arginine, lysine or histidine, having a net charge between −5 and +10, having hydrophobic content between 10% and 80% and less than 200 amino acids in length.
In some embodiments, the candidate AMP is identified by the presence of a bacterial ligand-binding domain. Bacterial ligand binding domains can be identified in the published literature, as annotated in the Uniprot database, or as identified as such by structure prediction algorithms (e.g. pfam dot xfam). In specific embodiments, the bacterial ligand binding domain includes motifs capable of binding bacterial lipopolysaccharades (LPS), bacterial lectins, bacterial lipoteichoic acids (LTA) and/or peptidoglycan precursor (Lipid II).
In some embodiments, the candidate AMP is identified by the presence of an enhanced antibacterial defense response activity. Antibacterial defense response activity can include, but is not limited to phagocytosis, bacterial membrane pore formation, radical oxygen species (ROS) production, limitation of free nutrient/inorganic ions and hydrolytic enzyme release. In some embodiments, antibacterial defense response activity can also include promotion of growth of competing bacterial species, which limit proliferation of (e.g. undesired) species.
Some AMPs exert their activity via immune-modulation. Thus, in some embodiments, the candidate AMP is identified by the presence of an immune-modulatory activity Immune-modulatory activity of candidate AMPs can include, but is not limited to chemoattraction of monocytes, neutrophils, dendritic cells, and T-cells, chemokine and cytokine production and neutrophil degranulation.
Candidate AMPs can also be identified by their differential abundance. In some embodiments, proteins or peptides the levels of which increase or decrease along with those of known (e.g. annotated) AMPs can be candidates for AMPs. For example, where levels of a known AMP or AMPs are elevated in a tissue in response to a pathogenic infection (e.g. C. difficil infection of the gut), commensal colonization or inflammation (e.g. IBD), a protein or peptide of interest can be considered a candidate AMP when, in addition to possessing at least one other of criteria (b)(i)-(v), it is also elevated in the same tissue upon the same infection or inflammation. In some embodiments, greater importance is attributed to the criterion of differential abundance when determining the identity of AMPs from candidate AMPs.
Example 1 of the Examples section details the identification of AMPs from the murine gut according to one embodiment of the invention. Proteomic analysis of samples from the ileal, cecal and colonic regions of the gut mucosa revealed 141 proteins and peptides, of which 116 were identified as annotated AMPs (Table S1), as well as 25 AMP candidates (Table S1A) having at least two of the criteria of (b)(i)-(vi), comprising an AMP profile of the gut. Thus, in some embodiments, the AMPs are gut AMPs selected from the group consisting of Angiotensin-converting enzyme 2, Adiponectin, Neutral ceramidase, Zinc-alpha-2-glycoprotein, CD177 antigen, Chitinase-like protein 3, Tetranectin, Clusterin, Cystatin-A; Cystatin-A, N-terminally processed, Cystatin-B, Cathepsin D, Cathepsin E, Cathepsin L1; Cathepsin L1 heavy chain; Cathepsin L1 light chain, Hyaluronan-binding protein 2, Integrin alpha-M, Integrin beta-2, Mesencephalic astrocyte-derived neurotrophic factor, Matrix metalloproteinase-9, Mucosal pentraxin, Cytosolic phospholipase A2 gamma, Group XV phospholipase A2, Lithostathine-1, Lithostathine-2, Resistin-like gamma and Protein S100-A13.
In particular embodiments, the AMPs are gut AMPs having amino acid sequences selected from the group consisting of SEQ ID NO: 3-27. In other embodiments, the AMPs are gut AMPs having amino acid sequences at least 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical to a sequence selected from SEQ ID NO: 3-27.
In particular embodiments, the tissue is human gut tissue and the gut AMPs are human orthologs of murine AMPs identified by the methods of the invention.
In some embodiments, the tissue is human gut tissue and the gut AMPs are human orthologs of amino acid sequences selected from the group consisting of SEQ ID NO: 3-27.
While determining the AMP profile of the gut, and the AMP profile of corresponding stool samples from the same mice, the present inventors revealed a number of AMPs which were present in both the gut and stool samples, and whose abundance fluctuated (increased or decreased) in significant correlation between the two sample types, demonstrating that the patterns of change of the gut AMPs in the course of pathogenic bacterial infection are reflected in those of a number of the fecal AMPs analyzed in the same manner (see
Thus, in one aspect of some embodiments of the invention, one step of the method comprises measuring the levels of a plurality of antimicrobial proteins or peptides (AMPs) in a sample of a secretion, exudate or excretion of the tissue of the subject, wherein the plurality of AMPs is predominantly AMPs having shared abundance in the tissue and in the secretion, exudate or excretion of the tissue in a predetermined physiological state. In some embodiments, the tissue is gut tissue, the excretion is feces (stool), and the AMPs having shared abundance in the gut and in the feces are selected from the group consisting of the AMPs listed in Table S2 hereinbelow. In particular embodiments, the tissue is human gut tissue, and the AMPs having shared abundance in the gut and feces are human orthologs of murine AMPs selected from the group consisting of the AMPs listed in Table S2.
As used herein, the term “plurality of AMPs” refers to a group of AMPs, numbering more than 1. In some embodiments, the plurality of AMPs comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 27, 30, 32, 35, 37, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 AMPs. In specific embodiments, the plurality of AMPs comprises greater than 5 and fewer than 50 AMPs, greater than 10 and fewer than 100 AMPs.
As used herein, the terms “secretion”, “exudate” or “excretion” refer to waste products, fluids or solids produced and released by the tissue, fluids or solids which have come in contact with the tissue, and can be accessed without sampling the tissue. Exemplary secretions and their related tissues include, but are not limited to perspiration and the skin, milk and the breast/mammary gland, gastric fluid and the stomach mucosa, and intestinal mucus and the gut mucosa. Exudates are fluids that filter from the circulatory system to lesions or areas of inflammation, usually the result of changes in vascular permeability. Exemplary exudates and their related tissues include, but are not limited to pus and infected tissue, and catarrhal exudate and the lining of the nasopharynx.
All living tissues excrete waste products of their metabolism. Also available for sampling are the waste products of digestion. Exemplary excretions (excreta, excrement) and their related tissues include, but are not limited to feces and the large intestine/colon, urine and the urinary tract, and mucus and the airways.
As used herein, the phrase “shared abundance” refers to a statistically significant correlation between the fluctuations or perturbations (increase, decrease) in levels of the AMP or AMPs in the tissue and in the “secretion”, “exudate” or “excretion” thereof. In some embodiments, where a specific AMP thereof reveals the same trends in abundance in both the tissue and in the secretion, exudate or excretion thereof, is classified as having “shared abundance”. In other embodiments, the statistical correlation of the trends is determined according to statistical tests including, but not limited to Mann-Whitney U test (for independent comparison), Wilcoxon signed-rank test (for paired comparison) with FDR correction and calculation of Log 2 fold changes. Further, non-random behavior of the proteomic AMP signature against the background of the entire proteomic landscape may be analyzed by applying pre-ranked protein set enrichment analysis using the “fast gene set enrichment analysis” method (Korotkevich et al., 2019), with ranks calculated as signed fold change ′−log 10 p-value. Intersecting protein signatures can also be identified using Venn diagrams. For proteomic comparison of more than one group, in some embodiments, the Kruskal—Wallis one-way analysis of variance (for independent comparison) or one-way repeated measures ANOVA on rank transformed values (for paired comparison) can be used.
In an exemplary embodiment, fecal (stool) AMPs have a shared abundance with gut AMPs when their levels increase or decrease with a statistically significant correlation in response to colonization by a commensal bacteria, or in response to infection by a pathogenic microorganism (e.g. C difficil), or in response to disease (inflammation, e.g. IBD). “Shared abundance” may also refer to a consistent parallel course of fluctuation of the AMP(s) over the duration of a condition, for example, commensurate increases or decreases in the levels of gut AMPs and fecal (stool) AMPs at the onset, peak and recovery phases of a pathogenic gut infection (see, for example
Thus, in embodiments of the method of the invention, the plurality of AMPs is predominantly AMPs having shared abundance in the tissue and in the secretion, exudate or excretion of the tissue in a predetermined physiological state. As used herein, the term “in a predetermined physiological state” refers to one or more physiological states of the tissue for which there are AMP(s) from the secretion, exudate or excretion of the tissue having a known shared abundance in the tissue.
As used herein, the term “predetermined physiological state” refers to one or more (e.g. plurality) of physiological state or states for which AMPs having shared abundance in the tissue and in the secretion, exudate or excretion of the tissue have been identified, and for which levels measured in a sample from the secretion, exudate or excretion of the tissue can provide information regarding the physiological state of the tissue. In some embodiments, the predetermined physiological state refers to at least one of the immunological state, metabolic state, physical state and chemical state of the tissue.
Thus, in some embodiments, measuring the levels of the plurality of AMPs having shared abundance in a sample of a secretion, exudate or excretion of a tissue and in the tissue itself can determine the presence (or absence) of the predetermined physiological state of the tissue, without need for assaying the AMP levels of the tissue itself.
Thus, the levels of the plurality of the AMPs constitute a proxy for the physiological state of the tissue. As used herein, the term “proxy” refers to a “substitute” or a parameter or a set of parameters that is not a direct assessment of the physiological state, but is associated with it and can be used in place of the direct measure, albeit with acceptance of a possible greater degree of error in a resulting determination of the physiological state.
Thus, according to an aspect of some embodiments of the invention there is provided a method of determining a proxy for a physiological state or states of a tissue, the method the method comprising:
Methods for identifying AMPs having a shared abundance in the tissue and in the sample of an exudate, secretion or excretion of the tissue can include establishing an AMP profile for both the tissue and the sample of an exudate, secretion or excretion of the tissue, and identifying AMPs having commensurate differential and temporal fluctuations in both the tissue and the sample of an exudate, secretion or excretion of the tissue.
The present inventors have also shown that the profiles of annotated and candidate AMPs identified according to the methods of the invention in fecal (stool) samples from subjects with chronic intestinal inflammatory disease reflect the differential dynamics patterns characteristic of the extensive and complex alteration of the gut AMP profile and microbiome signature throughout the active disease as well as recuperation (see
Thus, in some embodiments, there is provided a method of diagnosing and/or monitoring a disease of a tissue of a subject, the method comprising measuring the levels of a plurality of antimicrobial proteins or peptides (AMPs) in a sample of a secretion, exudate or excretion of said tissue of the subject, wherein the plurality of AMPs is predominantly AMPs having a statistically significant correlation with the changes in microbiome of the tissue and clinical parameters of the subject in a predetermined disease state and wherein a statistically significant correlation between said levels of said plurality of AMPs in said secretion, exudate or excretion and said levels of said plurality of AMPs in with the changes in microbiome of the tissue and clinical parameters of the subject in said predetermined disease state of said tissue is identified, determining the presence and/or severity or stage of said disease state of said tissue, and wherein levels of said plurality of AMPs constitutes a proxy for the disease state of the tissue.
The present inventors have revealed that both the gut and the fecal AMP profiles of subjects with pronounced gut inflammatory disease reflect the increase in neutrophil infiltration and intestinal epithelial damage, observed as an increase in PMN-produced AMPs (e.g. Camp, Lnc2, Ltf, Mpo, Ngp, Prtn 3, Elane, cathepsin G (Ctsg), Pglyrp1, S100a8, S100a9, and eosinophil AMPs Ear2, Epx and Prg2) and reduction in intestinal epithelial-produced AMPs (e.g. Ang4, Itln 1, Lgals4, Mptx 1, Retnlb and Zg16). Intestine epithelial AMPs Pla2g1b (phospholipase A2) and Reg proteins (Reg3a, Reg3g and Reg4) were also reduced at the onset of gut inflammatory disease but recovered in later disease phases. It will be appreciated that when the tissue is human tissue, and the samples are human samples, the AMPs indicative of the physiological state of the tissue are human AMPs, and, in particular, human orthologs of the indicated murine AMPs.
Thus, in some embodiments, the predetermined disease state is inflammatory disease of the gut, and the plurality of AMPs having a statistically significant correlation with the changes in microbiome of the tissue and clinical parameters of the subject in a predetermined disease state comprises one or more of Cathelicidin antimicrobial peptide (Camp), Lipocalin 2 (Lnc2), Lactotransferrin (Ltf), Myeloperoxidase (Mpo), Neutrophilic granule protein (Ngp), proteinase 3 (Prtn 3), neutrophil elastase (Elane), cathepsin G (Ctsg), Peptidoglycan recognition protein 1 (Pglyrp1), Protein S100A8 (S100a8), Protein S100A9 (S100a9), eosinophil cationic protein 2 (Ear2), eosinophil peroxidase (Epx), Bone Marrow Proteoglycan (Prg2), Angiogenin-4 (Ang4), Intelectin 1a (Itln 1), Galectin 4 (Lgals4), Mucosalntraxin (Mptx 1), Resistin-like beta (Retnlb) and zymogen granule membrane protein 16 (Zg16).
Employing such a plurality of AMPs, detection in a fecal (stool) sample of increased levels of one or more of Camp, Lnc2, Ltf, Mpo, Ngp, Prtn 3, Elane, Ctsg, Pglyrp1, S100a8, S100a9, Ear2, Epx and Prg2, and concomitant reduced levels of one or more of Ang4, Itln 1, Lgals4, Mptx 1, Retnlb and Zg16 suggests the presence of an inflammatory disease of the gut tissue. Likewise, reduced levels of Pla2g 1b and Reg3a, Reg3g and Reg4 and increased levels of one or more of Camp, Lnc2, Ltf, Mpo, Ngp, Prtn 3, Elane, Ctsg, Pglyrp1, S100a8, S100a9, Ear2, Epx and Prg2 can indicate early gut inflammatory disease, while reversion to normal levels of Pla2g 1b and Reg3a, Reg3g and Reg4 in a fecal (stool) sample can indicate progression towards recuperation from the gut inflammatory disease.
It will be appreciated that when the tissue is human tissue, and the fecal (stool) samples are human samples, the AMPs having shared abundance indicative of the physiological state of the tissue are human AMPs, and, in particular, human orthologs of the indicated murine AMPs.
In some embodiments, the AMP profiles can be established by first employing “label-free quantitative proteomics” (protease digestion, mass spectrometry and identification of the peptides by database searching) to identify the peptide “landscape” of the digested samples of the tissue and of the sample of an exudate, secretion or excretion of the tissue, as described herein, followed by identification of AMPs, including known, annotated AMPs as well as candidate AMPs, fulfilling the criteria described herein.
In some embodiments, the AMPs are identified by liquid chromatography techniques, mass spectrometry techniques, or by a combination of liquid chromatography and mass spectrometry techniques (LC-MS). Mass spectrometry techniques suitable for use with the methods of the invention include, but are not limited to Matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF), Triple quadrupole mass spectrometry (TQMS or QqQ), Quadropole-Trap mass spectrometry (Q3), Hybrid linear ion trap (Orbitrap) mass spectrometry and Quadropole-Orbitrap mass spectrometry. Liquid chromatography techniques suitable for use with the methods of the invention include, but are not limited to reverse-phase (RP), ion exchange (including anion- or cation exchange, strong anion- or strong cation exchange), size exclusion, hydrophilic- and hydrophobic interaction, affinity chromatography and high performance liquid chromatography (HPLC).
In some embodiments, identification of AMPs from the tissue or from the exudate, secretion or excretion of the tissue is accomplished using AMP-binding moieties. As used herein, AMP binding moieties refers to any agent capable of specifically binding to an AMP, thus providing a means for isolating and identifying the AMP from a mixture of peptides or proteins. In some embodiments, the binding moieties can include, but are not limited to antibodies, antibody fragments, aptamers and the like.
The term “antibody” as used in this invention includes intact molecules as well as functional fragments thereof (that are capable of binding to an epitope of an antigen).
As used herein, the term “epitope” refers to any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
According to a specific embodiment, the antibody fragments include, but are not limited to, single chain, Fab, Fab′ and F(ab′)2 fragments, Fd, Fcab, Fv, dsFv, scFvs, diabodies, minibodies, nanobodies, Fab expression library or single domain molecules such as VH and VL that are capable of binding to an epitope of the antigen in an HLA restricted manner.
Suitable antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as an Fv, a single chain Fv Fv (scFv), a disulfide-stabilized Fv (dsFv), an Fab, an Fab′, and an F(ab′)2, or antibody fragments comprising the Fc region of an antibody.
As used herein, the terms “complementarity-determining region” or “CDR” are used interchangeably to refer to the antigen binding regions found within the variable region of the heavy and light chain polypeptides. Generally, antibodies comprise three CDRs in each of the VH (CDR HI or HI; CDR H2 or H2; and CDR H3 or H3) and three in each of the VL (CDR LI or LI; CDR L2 or L2; and CDR L3 or L3).
The identity of the amino acid residues in a particular antibody that make up a variable region or a CDR can be determined using methods well known in the art and include methods such as sequence variability as defined by Kabat et al. (See, e.g., Kabat et al., 1992, Sequences of Proteins of immunological Interest, 5th ed., Public Health Service, NIH, Washington D.C.), location of the structural loop regions as defined by Chothia et al. (see, e.g., Chothia et al., Nature 342:877-883, 1989.), a compromise between Kabat and Chothia using Oxford Molecular's AbM antibody modeling software (now Accelrys®, see, Martin et al., 1989, Proc. Natl Acad Sci USA. 86:9268; and world wide web site www(dot)bioinf-org(dot)uk/dabs), available complex crystal structures as defined by the contact definition (see MacCallum et al., J. Mol, Biol. 262:732-745, 1996) and the “conformational definition” (see, e.g., Makabe et al., Journal of Biological Chemistry, 283:1156-1166, 2008).
As used herein, the “variable regions” and “CDRs” may refer to variable regions and CDRs defined by any approach known in the art, including combinations of approaches.
Functional antibody fragments comprising whole or essentially whole variable regions of both light and heavy chains are defined as follows:
Methods of producing polyclonal and monoclonal antibodies as well as fragments thereof are well known in the art (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).
As used herein, “aptamer” refers to short oligonucleotide or peptide molecules that bind to a specific target molecule (e.g. AMP). Aptamers typically include nucleic acid (DNA, RNA, XNA, split) and peptide aptamers. Similar to peptide aptamers are the larger protein “affimers”.
The AMP binding moieties can be used to identify AMPs in a liquid or solid phase. In some embodiments, the AMP binding moieties are immobilized on a substrate (e.g. chromatographic column, solid state array) for identification as well as isolation and purification of the AMPs. Thus, in some embodiments, the AMP binding moieties are immobilized on an array.
Identification of AMPs can be accomplished using the “forward” or “reverse” array technique-in the forward array, the AMP binding moiety is immobilized to the solid phase, and the AMP is identified (and/or isolated) following capture on the array. In the reverse array, the protein extract (comprising AMPs, e.g. of the tissue or the exudate, secretion or excretion of the tissue) is immobilized on the solid phase, and then contacted (e.g. incubated) with the AMP binding moiety (which can include a reporter moiety) for identification and isolation.
In some embodiments, such an AMP-binding moiety array can comprise greater than 10 and fewer than 100, between 5 and 100, between 10 and 100, between 5 and 50, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90 or about 100 AMP binding moieties. In some embodiments the AMP binding moiety array comprises AMP binding moieties binding to the entire complement of AMPs comprising the plurality of AMPs constituting the proxy of the invention. Custom antibody and aptamer arrays are commercially available, for example, from Creative Biolabs (Shirley, NY).
It will be appreciated that the protease (e.g. trypsin) digestion will by definition result in a population of peptides cleaved from larger proteins and peptides present in a whole protein extract of the sample. Thus, in some embodiments, some of the AMP peptides identified by the proteomics approach are derived from the same, larger amino acid sequence, and there can be more than a single representative AMP sequence identified for each AMP (see, for example, Table S2).
In order to establish the proxy for a given physiological state (or states) of the tissue, the relationship between the AMP profile of the tissue and that of the exudate, secretion or excretion of the tissue is characterized, identifying shared AMPs. In some embodiments, the AMPs having shared abundance are determined according to the statistical significance of their correlation using statistical analysis, for example, Procrustes analysis.
Once a set (plurality, group) of AMPs having shared abundance in the tissue and in the exudate, secretion or excretion of the tissue for a given physiological state of the tissue has been identified, that plurality of AMPs can be considered a proxy for the physiological state or states of the tissue.
In certain embodiments, the physiological state comprises a disease state. The disease state may include a disease microenvironment and the expression of genes within the microenvironment of the tissue. The disease state may include an immune state. The disease state may indicate resistance or sensitivity to a treatment. The disease state may indicate the severity of a disease. Diseases or pathogens that lead to a disease state may include, but are not limited to metabolic diseases, cancer, an autoimmune disease, an inflammatory disease, or an infection. In specific embodiments, the disease state of the tissue is affected by a dysbiosis.
As used herein, the term “dysbiosis” refers to the disruption of the balanced microbial composition and collective functions of the microbiome inhabiting a subject or inhabiting a particular tissue (e.g. intestine) in a subject. The term typically refers to a decrease in beneficial microbial populations relative to deleterious microbial populations, or a change in the ratio of those populations such that microbial species that are normally only present in small numbers proliferate to a degree whereby they are present at elevated numbers. Gut dysbiosis can be a pathological imbalance in a microbial community characterized by a shift in the composition, diversity or function of microbial species, which can result in, or reflect the presence of a disease. Dysbiosis has been associated with a multitude of intestinal and extra-intestinal health-related outcomes in humans, including inflammatory bowel disease (IBD), autoimmune disease (e.g. systemic lupus erythmatosis SLE, multiple sclerosis MS, rheumatoid arthritis RA), cardiometabolic disease (e.g. atherosclerosis), metabolic disease (e.g. obesity, type 2 diabetes, non-alcoholic fatty liver disease NAFLD and non-alcoholic steatohepatitis NASH), cancer (e.g. colorectal cancer, hepatocellular carcinoma, breast cancer) and neurodegenerative disorders (e.g. Amyotropic Lateral Sclerosis, ALS, Parkinson's disease, autism spectrum disorder).
Thus, in some embodiments, the physiological state of the tissue is affected by cancer. Examples of cancer include but are not limited to carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include without limitation: squamous cell cancer (e.g., epithelial squamous cell cancer), lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung and large cell carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioma, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, as well as CNS cancer, melanoma, head and neck cancer, bone cancer, bone marrow cancer, duodenum cancer, oesophageal cancer, thyroid cancer, or hematological cancer.
Other non-limiting examples of cancers or malignancies include, but are not limited to: Acute Childhood Lymphoblastic Leukemia, Acute Lymphoblastic Leukemia, Acute Lymphocytic Leukemia, Acute Myeloid Leukemia, Adrenocortical Carcinoma, Adult (Primary) Hepatocellular Cancer, Adult (Primary) Liver Cancer, Adult Acute Lymphocytic Leukemia, Adult Acute Myeloid Leukemia, Adult Hodgkin's Disease, Adult Hodgkin's Lymphoma, Adult Lymphocytic Leukemia, Adult Non-Hodgkin's Lymphoma, Adult Primary Liver Cancer, Adult Soft Tissue Sarcoma, AIDS-Related Lymphoma, AIDS-Related Malignancies, Anal Cancer, Astrocytoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Brain Stem Glioma, Brain Tumours, Breast Cancer, Cancer of the Renal Pelvis and Urethra, Central Nervous System (Primary) Lymphoma, Central Nervous System Lymphoma, Cerebellar Astrocytoma, Cerebral Astrocytoma, Cervical Cancer, Childhood (Primary) Hepatocellular Cancer, Childhood (Primary) Liver Cancer, Childhood Acute Lymphoblastic Leukemia, Childhood Acute Myeloid Leukemia, Childhood Brain Stem Glioma, Glioblastoma, Childhood Cerebellar Astrocytoma, Childhood Cerebral Astrocytoma, Childhood Extracranial Germ Cell Tumours, Childhood Hodgkin's Disease, Childhood Hodgkin's Lymphoma, Childhood Hypothalamic and Visual Pathway Glioma, Childhood Lymphoblastic Leukemia, Childhood Medulloblastoma, Childhood Non-Hodgkin's Lymphoma, Childhood Pineal and Supratentorial Primitive Neuroectodermal Tumours, Childhood Primary Liver Cancer, Childhood Rhabdomyosarcoma, Childhood Soft Tissue Sarcoma, Childhood Visual Pathway and Hypothalamic Glioma, Chronic Lymphocytic Leukemia, Chronic Myelogenous Leukemia, Colon Cancer, Cutaneous T-Cell Lymphoma, Endocrine Pancreas Islet Cell Carcinoma, Endometrial Cancer, Ependymoma, Epithelial Cancer, Esophageal Cancer, Ewing's Sarcoma and Related Tumours, Exocrine Pancreatic Cancer, Extracranial Germ Cell Tumour, Extragonadal Germ Cell Tumour, Extrahepatic Bile Duct Cancer, Eye Cancer, Female Breast Cancer, Gaucher's Disease, Gallbladder Cancer, Gastric Cancer, Gastrointestinal Carcinoid Tumour, Gastrointestinal Tumours, Germ Cell Tumours, Gestational Trophoblastic Tumour, Hairy Cell Leukemia, Head and Neck Cancer, Hepatocellular Cancer, Hodgkin's Disease, Hodgkin's Lymphoma, Hypergammaglobulinemia, Hypopharyngeal Cancer, Intestinal Cancers, Intraocular Melanoma, Islet Cell Carcinoma, Islet Cell Pancreatic Cancer, Kaposi's Sarcoma, Kidney Cancer, Laryngeal Cancer, Lip and Oral Cavity Cancer, Liver Cancer, Lung Cancer, Lymphoproliferative Disorders, Macroglobulinemia, Male Breast Cancer, Malignant Mesothelioma, Malignant Thymoma, Medulloblastoma, Melanoma, Mesothelioma, Metastatic Occult Primary Squamous Neck Cancer, Metastatic Primary Squamous Neck Cancer, Metastatic Squamous Neck Cancer, Multiple Myeloma, Multiple Myeloma/Plasma Cell Neoplasm, Myelodysplastic Syndrome, Myelogenous Leukemia, Myeloid Leukemia, Myeloproliferative Disorders, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Hodgkin's Lymphoma During Pregnancy, Nonmelanoma Skin Cancer, Non-Small Cell Lung Cancer, Occult Primary Metastatic Squamous Neck Cancer, Oropharyngeal Cancer, Osteo-/Malignant Fibrous Sarcoma, Osteosarcoma/Malignant Fibrous Histiocytoma, Osteosarcoma/Malignant Fibrous Histiocytoma of Bone, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumour, Ovarian Low Malignant Potential Tumour, Pancreatic Cancer, Paraproteinemias, Purpura, Parathyroid Cancer, Penile Cancer, Pheochromocytoma, Pituitary Tumour, Plasma Cell Neoplasm/Multiple Myeloma, Primary Central Nervous System Lymphoma, Primary Liver Cancer, Prostate Cancer, Rectal Cancer, Renal Cell Cancer, Renal Pelvis and Urethra Cancer, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Sarcoidosis Sarcomas, Sezary Syndrome, Skin Cancer, Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Neck Cancer, Stomach Cancer, Supratentorial Primitive Neuroectodermal and Pineal Tumours, T-Cell Lymphoma, Testicular Cancer, Thymoma, Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Urethra, Transitional Renal Pelvis and Urethra Cancer, Trophoblastic Tumours, Urethra and Renal Pelvis Cell Cancer, Urethral Cancer, Uterine Cancer, Uterine Sarcoma, Vaginal Cancer, Visual Pathway and Hypothalamic Glioma, Vulvar Cancer, Waldenstrom's Macroglobulinemia, or Wilms' Tumour. In some embodiments, the physiological state of the tissue is affected by cancer of the gastro-intestinal system, liver cancer and/or breast cancer. In other specific embodiments the physical state of the tissue is affected by colorectal cancer, gastric cancer, esophageal cancer, cholangiocarcinoma and gastrointestinal lymphoma.
In some embodiments, the physiological state of the tissue is affected by an auto-immune disease. As used throughout the present specification, the terms “autoimmune disease” or “autoimmune disorder” used interchangeably refer to a diseases or disorders caused by an immune response against a self-tissue or tissue component (self-antigen) and include a self-antibody response and/or cell-mediated response. The terms encompass organ-specific autoimmune diseases, in which an autoimmune response is directed against a single tissue, as well as non-organ specific autoimmune diseases, in which an autoimmune response is directed against a component present in two or more, several or many organs throughout the body.
Non-limiting examples of autoimmune diseases include but are not limited to acute disseminated encephalomyelitis (ADEM); Addison's disease; ankylosing spondylitis; antiphospholipid antibody syndrome (APS); aplastic anemia; autoimmune gastritis; autoimmune hepatitis; autoimmune thrombocytopenia; Behcet's disease; coeliac disease; dermatomyositis; diabetes mellitus type I; Goodpasture's syndrome; Graves' disease; Guillain-Barre syndrome (GBS); Hashimoto's disease; idiopathic thrombocytopenic purpura; inflammatory bowel disease (IBD) including Crohn's disease and ulcerative colitis; mixed connective tissue disease; multiple sclerosis (MS); myasthenia gravis; opsoclonus myoclonus syndrome (OMS); optic neuritis; Ord's thyroiditis; pemphigus; pernicious anaemia; polyarteritis nodosa; polymyositis; primary biliary cirrhosis; primary myoxedema; psoriasis; rheumatic fever; rheumatoid arthritis; Reiter's syndrome; scleroderma; Sjogren's syndrome; systemic lupus erythematosus; Takayasu's arteritis; temporal arteritis; vitiligo; warm autoimmune hemolytic anemia; or Wegener's granulomatosis. In particular embodiments, the physiological state of the tissue is affected by systemic lupus erythmatosis SLE, multiple sclerosis MS and/or rheumatoid arthritis RA, Inflammatory Bowel Disease (Crohn's disease and ulcerative colitis) and celiac disease.
The disease may be an allergic inflammatory disease. The allergic inflammatory disease may be selected from the group consisting of asthma, allergy, allergic rhinitis, allergic airway inflammation, atopic dermatitis (AD), chronic obstructive pulmonary disease (COPD), inflammatory bowel disease (IBD), multiple sclerosis, arthritis, psoriasis, eosinophilic esophagitis, eosinophilic pneumonia, eosinophilic psoriasis, hypereosinophilic syndrome, graft-versus-host disease, uveitis, cardiovascular disease, pain, multiple sclerosis, lupus, vasculitis, chronic idiopathic urticaria and Eosinophilic Granulomatosis with Polyangiitis (Churg-Strauss Syndrome). The asthma may be selected from the group consisting of allergic asthma, non-allergic asthma, severe refractory asthma, asthma exacerbations, viral-induced asthma or viral-induced asthma exacerbations, steroid resistant asthma, steroid sensitive asthma, eosinophilic asthma and non-eosinophilic asthma. The allergy may be to an allergen selected from the group consisting of foods, pollen, mold, dust mites, animals, and animal dander. IBD may comprise a disease selected from the group consisting of ulcerative colitis (UC), Crohn's Disease, collagenous colitis, lymphocytic colitis, ischemic colitis, diversion colitis, Behcet's syndrome, infective colitis, indeterminate colitis, and other disorders characterized by inflammation of the mucosal layer of the large intestine or colon. In other embodiments, the disease may be an internal organ disorder which is associated with inflammation of the gut, such as primary sclerosing cholangitis (PSC). The arthritis may be selected from the group consisting of osteoarthritis, rheumatoid arthritis and psoriatic arthritis.
In some embodiments, the physiological state of the tissue can be affected by an infection, including, but not limited to bacterial, viral, fungal and protozoan infections. Examples of pathogenic bacteria that can affect the physiological state of the tissue include without limitation any one or more of (or any combination of) Acinetobacter baumanii, Actinobacillus sp., Actinomycetes, Actinomyces sp. (such as Actinomyces israelii and Actinomyces naeslundii), Aeromonas sp. (such as Aeromonas hydrophila, Aeromonas veronii biovar sobria (Aeromonas sobria), and Aeromonas caviae), Anaplasma phagocytophilum, Anaplasma marginate, Alcaligenes xylosoxidans, Acinetobacter baumanii, Actinobacillus actinomycetemcomitans, Bacillus sp. (such as Bacillus anthracis, Bacillus cereus, Bacillus subtilis, Bacillus thuringiensis, and Bacillus stearothermophilus), Bacteroides sp. (such as Bacteroides fragilis), Bartonella sp. (such as Bartonella bacilliformis and Bartonella henselae, Bifidobacterium sp., Bordetella sp. (such as Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica), Borrelia sp. (such as Borrelia recurrentis, and Borrelia burgdorferi), Brucella sp. (such as Brucella abortus, Brucella canis, Brucella melintensis and Brucella suis), Burkholderia sp. (such as Burkholderia pseudomallei and Burkholderia cepacia), Campylobacter sp. (such as Campylobacter jejuni, Campylobacter coli, Campylobacter lari and Campylobacter fetus), Capnocytophaga sp., Cardiobacterium hominis, Chlamydia trachomatis, Chlamydophila pneumoniae, Chlamydophila psittaci, Citrobacter sp. Coxiella burnetii, Corynebacterium sp. (such as, Corynebacterium diphtherias, Corynebacterium jeikeum and Corynebacterium), Clostridium sp. (such as Clostridium perfringens, Clostridium difficile, Clostridium botulinum and Clostridium tetani), Eikenella corrodens, Enterobacter sp. (such as Enterobacter aerogenes, Enterobacter agglomerans, Enterobacter cloacae and Escherichia coli, including opportunistic Escherichia coli, such as enterotoxigenic E. coli, enteroinvasive E. coli, enteropathogenic E. coli, enterohemorrhagic E. coli, enteroaggregative E. coli and uropathogenic E. coli) Enterococcus sp. (such as Enterococcus faecalis and Enterococcus faecium) Ehrlichia sp. (such as Ehrlichia chafeensia and Ehrlichia canis), Erysipelothrix rhusiopathiae, Eubacterium sp., Francisella tularensis, Fusobacterium nucleatum, Gardnerella vaginalis, Gemella morbillorum, Haemophilus sp. (such as Haemophilus influenzae, Haemophilus ducreyi, Haemophilus aegyptius, Haemophilus parainfluenzae, Haemophilus haemolyticus and Haemophilus parahaemolyticus, Helicobacter sp. (such as Helicobacter pylori, Helicobacter cinaedi and Helicobacter fennelliae), Kingella kingii, Klebsiella sp. (such as Klebsiella pneumoniae, Klebsiella granulomatis and Klebsiella oxytoca), Lactobacillus sp., Listeria monocytogenes, Leptospira interrogans, Legionella pneumophila, Leptospira interrogans, Peptostreptococcus sp., Mannheimia hemolytica, Moraxella catarrhalis, Morganella sp., Mobiluncus sp., Micrococcus sp., Mycobacterium sp. (such as Mycobacterium leprae, Mycobacterium tuberculosis (MTB), Mycobacterium paratuberculosis, Mycobacterium intracellulare, Mycobacterium avium, Mycobacterium bovis, and Mycobacterium marinum), Mycoplasm sp. (such as Mycoplasma pneumoniae, Mycoplasma hominis, and Mycoplasma genitalium), Nocardia sp. (such as Nocardia asteroides, Nocardia cyriacigeorgica and Nocardia brasiliensis), Neisseria sp. (such as Neisseria gonorrhoeae and Neisseria meningitidis), Pasteurella multocida, Plesiomonas shigelloides. Prevotella sp., Porphyromonas sp., Prevotella melaninogenica, Proteus sp. (such as Proteus vulgaris and Proteus mirabilis), Providencia sp. (such as Providencia alcalifaciens, Providencia rettgeri and Providencia stuartii), Pseudomonas aeruginosa, Propionibacterium acnes, Rhodococcus equi, Rickettsia sp. (such as Rickettsia rickettsii, Rickettsia akari and Rickettsia prowazekii, Orientia tsutsugamushi (formerly: Rickettsia tsutsugamushi) and Rickettsia typhi), Rhodococcus sp., Serratia marcescens, Stenotrophomonas maltophilia, Salmonella sp. (such as Salmonella enterica, Salmonella typhi, Salmonella paratyphi, Salmonella enteritidis, Salmonella cholerasuis and Salmonella typhimurium), Serratia sp. (such as Serratia marcesans and Serratia liquifaciens), Shigella sp. (such as Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei), Staphylococcus sp. (such as Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hemolyticus, Staphylococcus saprophyticus), Streptococcus sp. (such as Streptococcus pneumoniae (for example chloramphenicol-resistant serotype 4 Streptococcus pneumoniae, spectinomycin-resistant serotype 6B Streptococcus pneumoniae, streptomycin-resistant serotype 9V Streptococcus pneumoniae, erythromycin-resistant serotype 14 Streptococcus pneumoniae, optochin-resistant serotype 14 Streptococcus pneumoniae, rifampicin-resistant serotype 18C Streptococcus pneumoniae, tetracycline-resistant serotype 19F Streptococcus pneumoniae, penicillin-resistant serotype 19F Streptococcus pneumoniae, and trimethoprim-resistant serotype 23F Streptococcus pneumoniae, chloramphenicol-resistant serotype 4 Streptococcus pneumoniae, spectinomycin-resistant serotype 6B Streptococcus pneumoniae, streptomycin-resistant serotype 9V Streptococcus pneumoniae, optochin-resistant serotype 14 Streptococcus pneumoniae, rifampicin-resistant serotype 18C Streptococcus pneumoniae, penicillin-resistant serotype 19F Streptococcus pneumoniae, or trimethoprim-resistant serotype 23F Streptococcus pneumoniae), Streptococcus agalactiae, Streptococcus mutans, Streptococcus pyogenes, Group A streptococci, Streptococcus pyogenes, Group B streptococci, Streptococcus agalactiae, Group C streptococci, Streptococcus anginosus, Streptococcus equismilis, Group D streptococci, Streptococcus bovis, Group F streptococci, and Streptococcus anginosus Group G streptococci), Spirillum minus, Streptobacillus moniliformi, Treponema sp. (such as Treponema carateum, Treponema petenue, Treponema pallidum and Treponema endemicum, Tropheryma whippelii, Ureaplasma urealyticum, Veillonella sp., Vibrio sp. (such as Vibrio cholerae, Vibrio parahemolyticus, Vibrio vulnificus, Vibrio parahaemolyticus, Vibrio vulnificus, Vibrio alginolyticus, Vibrio mimicus, Vibrio hollisae, Vibrio fluvialis, Vibrio metchnikovii, Vibrio damsela and Vibrio furnisii), Yersinia sp. (such as Yersinia enterocolitica, Yersinia pestis, and Yersinia pseudotuberculosis) and Xanthomonas maltophilia.
In certain exemplary embodiments, the physiological state of the tissue is affected by a fungal infection. Examples of fungi that can affect the state of the tissue include without limitation any one or more of (or any combination of), Aspergillus, Blastomyces, Candidiasis, Coccidiodomycosis, Cryptococcus neoformans, Cryptococcus gatti, Histoplasma, Mucroymcosis, Pneumocystis, Sporothrix, fungal eye infections ringworm, Exserohilum, and Cladosporium.
In certain embodiments, the fungus is a yeast. Examples of yeast that can affect the state of the tissue include without limitation one or more of (or any combination of), Aspergillus species, a Geotrichum species, a Saccharomyces species, a Hansenula species, a Candida species, a Kluyveromyces species, a Debaryomyces species, a Pichia species, or combination thereof. In certain exemplary embodiments, the fungus is a mold. Exemplary molds include, but are not limited to, a Penicillium species, a Cladosporium species, a Byssochlamys species, or a combination thereof.
In certain example embodiments, the pathogen may be a virus. The virus may be a DNA virus, a RNA virus, or a retrovirus.
In certain embodiments, the pathogen may be a protozoon. Examples of protozoa include without limitation any one or more of (or any combination of), Euglenozoa, Heterolobosea, Diplomonadida, Amoebozoa, Blastocystic, and Apicomplexa. Euglenoza include, but are not limited to, Trypanosoma cruzi (Chagas disease), T. brucei gambiense, T. brucei rhodesiense, Leishmania braziliensis, L. infantum, L. mexicana, L. major, L. tropica, and L. donovani. Heterolobosea include, but are not limited to, Naegleria fowleri. Diplomonadid include, but are not limited to, Giardia intestinalis (G. lamblia, G. duodenalis). Amoebozoa include, but are not limited to, Acanthamoeba castellanii, Balamuthia madrillaris, Entamoeba histolytica. Blastocystis include, but are not limited to, Blastocystic hominis. Apicomplexa include, but are not limited to, Babesia microti, Cryptosporidium parvum, Cyclospora cayetanensis, Plasmodium falciparum, P. vivax, P. ovale, P. malariae, and Toxoplasma gondii.
In specific embodiments, the physiological state of the tissue can be affected by an infection, including, but not limited to C difficil, enterohemorrhagic E coli, salmonella, intestinal TB, intestinal CMV, helicobacter, campylobacter, rotavirus, norovirus.
While applying the novel criteria for determining an AMP to the peptides of murine gut mucosal tissue, the present inventors have surprisingly uncovered previously unrecognized AMPs, fulfilling the two or more of criteria (b)(i)-(vi). Thus, there is provided an antimicrobial peptide selected from the group consisting of Ace, Adipoq, Asah2, Azgp 1, Cd177, Clec3b, Clu, Csta, Cstb, Cstd, Cste, Cstl, Habp2, Itgam, Itgb2, Manf, Mmp9, Pla2g4c, Pla2g15, Reg1, Reg2, S100a13, Retnlg, Mptxl and Chil3. In some embodiments, Retnlg is a resistin-like AMP, and possesses increased abundance in the gut in the physiological state of infection and/or inflammation. In some embodiments, Retnlg AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 20. In some embodiments, the resistin-like AMP is the human ortholog of murine Retnlg AMP.
In some embodiments, Mptxl is a pentraxin-like AMP, and possesses increased abundance in the gut with commensal colonization of the gut, and decreased abundance in the physiological state of gut infection and/or inflammation. In some embodiments, Mptxl AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 22. In some embodiments, the pentraxin-like AMP is the human ortholog of murine Mptx-1 AMP.
In some embodiments, Chil3 is a bacteria-binding lectin-like AMP, and possesses increased abundance in the gut with commensal colonization of the gut, as well as abundance in the physiological state of gut infection and/or inflammation. In some embodiments, Chil3 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 15. In some embodiments, the bacterial-binding lectin-like AMP is the human ortholog of murine Chil3 AMP.
In some embodiments, Ace is an angiotensin converting enzyme 2 AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Ace AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 17. In some embodiments, the angiotensin converting enzyme 2 AMP is the human ortholog of murine Ace AMP.
In some embodiments, Adipoq is an adiponectin AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Adipoq AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 27. In some embodiments, the adiponectin AMP is the human ortholog of murine Adipoq AMP.
In some embodiments, Asah2 is a neutral ceramidase AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Asah2 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 18. In some embodiments, the neutral ceramidase AMP is the human ortholog of murine Asah2 AMP.
In some embodiments, Azgpl is a zinc-alpha-2 glycoprotein AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Azgpl AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 26. In some embodiments, the zinc-alpha-2 glycoprotein AMP is the human ortholog of murine Azgpl AMP.
In some embodiments, Cd177 is a CD177 antigen AMP, and possesses increased abundance in the gut in the physiological state of infection and/or inflammation. In some embodiments, CD177 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 21. In some embodiments, the CD177 antigen AMP is the human ortholog of murine Cd177 AMP.
In some embodiments, Clu is a clusterin AMP, and possesses increased abundance in the gut with commensal colonization of the gut, as well as abundance in the physiological state of gut infection and/or inflammation. In some embodiments, Clu AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 6. In some embodiments, the clusterin AMP is the human ortholog of murine Clu AMP.
In some embodiments, Csta (also known as CYTA) is a Cystatin-A AMP, and possesses increased abundance in the gut in the physiological state of bacterial infection. In some embodiments, Csta AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 12. In some embodiments, the Cystatin-A AMP is the human ortholog of murine Csta AMP.
In some embodiments, Cstb (also known as CYTB) is a cystatin-B AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Cstb AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 10. In some embodiments, the Cystatin B AMP is the human ortholog of murine Cstb AMP.
In some embodiments, Ctsd is a cathepsin-D AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Ctsd AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the cathepsin-D AMP is the human ortholog of murine Cst-D AMP.
In some embodiments, Ctse is a cathepsin E AMP, and possesses increased abundance in the gut in the physiological state of infection. In some embodiments, Ctse AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 23. In some embodiments, the cathepsin E AMP is the human ortholog of murine Ctse AMP.
In some embodiments, Ctsl is a cathepsin L1 AMP, and possesses increased abundance in the gut in the physiological state of infection and/or inflammation. In some embodiments, Ctsl AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 4. In some embodiments, the cathepsinL AMP is the human ortholog of murine Ctsl AMP.
In some embodiments, Habp2 is a hyaluronan binding protein 2 AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Habp2 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 16. In some embodiments, the hyaluronan binding protein 2 AMP is the human ortholog of murine Habp2 AMP.
In some embodiments, Itgam is an integrin alpha-M AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Itgam AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 5. In some embodiments, the integrin alpha M AMP is the human ortholog of murine Itgam AMP.
In some embodiments, Itgb2 is an integrin beta 2 AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Itgb2 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 11. In some embodiments, the integrin beta 2 AMP is the human ortholog of murine Itgb2 AMP.
In some embodiments, Manf is a mesencephalic astrocyte-derived neuroptophic factor AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Manf AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 13. In some embodiments, the mesencephalic astrocyte-derived neuroptophic factor AMP is the human ortholog of murine Manf AMP.
In some embodiments, Mmp9 is a matrix metalloproteinase 9 AMP, and possesses increased abundance in the gut in the physiological state of infection and/or inflammation. In some embodiments, Mmp9 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 24. In some embodiments, the matrix metalloproteinase 9 AMP is the human ortholog of murine Mmp9 AMP.
In some embodiments, Pla2g4c is a cytosolic phospholipase A2 gamma AMP, and possesses increased abundance in the gut in the physiological state of infection and/or inflammation. In some embodiments, Pla2g4c AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the cytosolic phospholipase A2 gamma AMP is the human ortholog of murine Pla2g4c AMP.
In some embodiments, Pla2g15 is a group XV phospholipase A2 AMP, and possesses increased abundance in the gut in the physiological state of inflammation. In some embodiments, Pla2g15 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 14. In some embodiments, the group XV phospholipase A2 AMP is the human ortholog of murine Pla2g15 AMP.
In some embodiments, Reg1 is a lithostathine-1 AMP, and possesses increased abundance in the gut in the physiological state of infection and/or inflammation. In some embodiments, Reg1 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 7. In some embodiments, the lithostathine-1 AMP is the human ortholog of murine Reg1 AMP.
In some embodiments, Reg2 is a lithostathine-2 AMP, and possesses increased abundance in the gut in the physiological state of infection and/or inflammation. In some embodiments, Reg2 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 8. In some embodiments, the lithostathine-2 AMP is the human ortholog of murine Reg2 AMP.
In some embodiments, S100a13 is a S100-A13 calcium binding protein AMP, and possesses increased abundance in the gut in the physiological state of infection and/or inflammation. In some embodiments, S100a13 AMP is at least 75, at least 80, at least 85, at least 90, at least 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the amino acid sequence of SEQ ID NO: 25. In some embodiments, the S100-A13 AMP is the human ortholog of murine S100a13 AMP.
The term “peptide” as used herein encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C. A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinunder.
Peptide bonds (—CO—NH—) within the peptide may be substituted, for example, by N-methylated amide bonds (—N(CH3)-CO—), ester bonds (—C(═O)—O—), ketomethylene bonds (—CO—CH2-), sulfinylmethylene bonds (—S(═O)—CH2-), α-aza bonds (—NH—N(R)—CO—), wherein R is any alkyl (e.g., methyl), amine bonds (—CH2-NH—), sulfide bonds (—CH2-S—), ethylene bonds (—CH2-CH2-), hydroxyethylene bonds (—CH(OH)—CH2-), thioamide bonds (—CS—NH—), olefinic double bonds (—CH═CH—), fluorinated olefinic double bonds (—CF═CH—), retro amide bonds (—NH—CO—), peptide derivatives (—N(R)—CH2-CO—), wherein R is the “normal” side chain, naturally present on the carbon atom.
These modifications can occur at any of the bonds along the peptide chain and even at several (2-3) bonds at the same time.
Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted by non-natural aromatic amino acids such as 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring-methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl-Tyr.
The peptides of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc).
The term “amino acid” or “amino acids” is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine. Furthermore, the term “amino acid” includes both D- and L-amino acids.
Tables 1 and 2 below list naturally occurring amino acids (Table 1), and non-conventional or modified amino acids (e.g., synthetic, Table 2) which can be used with some embodiments of the invention.
The peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
Since the present peptides are preferably utilized in therapeutics or diagnostics which require the peptides to be in soluble form, the peptides of some embodiments of the invention preferably include one or more non-natural or natural polar amino acids, including but not limited to serine and threonine which are capable of increasing peptide solubility due to their hydroxyl-containing side chain.
The peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
The peptides of some embodiments of the invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis. For solid phase peptide synthesis, a summary of the many techniques may be found in J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, W. H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973. For classical solution synthesis see G. Schroder and K. Lupke, The Peptides, vol. 1, Academic Press (New York), 1965.
In general, these methods comprise the sequential addition of one or more amino acids or suitably protected amino acids to a growing peptide chain. Normally, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group. The protected or derivatized amino acid can then either be attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage. The protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support) are removed sequentially or concurrently, to afford the final peptide compound. By simple modification of this general procedure, it is possible to add more than one amino acid at a time to a growing chain, for example, by coupling (under conditions which do not racemize chiral centers) a protected tripeptide with a properly protected dipeptide to form, after deprotection, a pentapeptide and so forth. Further description of peptide synthesis is disclosed in U.S. Pat. No. 6,472,505.
A preferred method of preparing the peptide compounds of some embodiments of the invention involves solid phase peptide synthesis.
Large scale peptide synthesis is described by Andersson Biopolymers 2000; 55(3):227-50.
It will be appreciated that the methods of the invention can be used to diagnose and monitor physiological and/or disease states of the tissue, or of the organ in which the tissue resides, or of the subject.
According to this aspect of the present invention, the subject from whom the sample of the exudate, secretion or excretion of the tissue has been obtained can be diagnosed according to the levels of the plurality AMP. If the test AMP profile comprises AMPs having shared abundance with the corresponding plurality of AMPs in the tissue in a pathological physiological state, it is indicative that the subject has a disease.
Alternatively, or additionally, if the test AMP profile comprises AMPs which have shared abundance with the corresponding plurality of AMPs in the tissue in a healthy physiological state, it is indicative that the subject does not have a disease.
In order to diagnose a subject as having a disease, typically at least 1, more preferably at least 5, more preferably at least 10, more preferably at least 20, more preferably at least 30, more preferably at least 40, more preferably at least 50, more preferably about 100 of the AMPs have a shared abundance similar to the AMPs from the tissue in a pathological state, indicating a disease. In some embodiments, about 5-25, about 1-30, about 5-75, about 15-100, about 20-95, about 10-45, about 20-80, about 25-65 of the AMPs have a shared abundance similar to the AMPs from the tissue in a pathological state, indicating a disease.
For example, when a test subject's fecal AMP profile has increased levels of one or more PMN-associated AMPs including, but not limited to Prtn3, Azul, Ltf, Ctsg, S100a8, S100a9, S100a12, and/or AMPs PRB3, PGC, APCS, PGLYRP1, MPO, PRSS2 or ELANE along with the decreased abundance of one or more intestinal epithelial AMPs including, but not limited to Lgals4, Gp2, Asah2, this is indicative that the subjects gut tissue has a diseased physiological state, and that the test subject has active Crohn's disease.
In another example, when the test subject's fecal AMP profile has increased levels of at least 2, at least 3 or all 5 of S100a8, CEACAM8, Mpo (Perm), Prtn3 and IgA2, along with a decreased abundance of Muc2, Muc4, Muc12 and CECAM6, this is indicative that the subject's gut tissue has a diseased physiological state, and that the test subject has Ulcerative Colitis. When the test subject's fecal AMP profile has increased levels of at least 2, at least 3 or all 5 of S100a8, S100a9, CEACAM8, Mpo (Perm) and Prtn3, this is indicative that the subject's gut tissue has a diseased physiological state, and that the test subject has Crohn's Disease.
In still another example, when the test subject's fecal AMP profile has increased levels of at least 2, at least 3 or at least 5 or more of S100a8, S100a9, CEACAM8, Ecp2, Azu, Ctsg, Mpo (Perm), alpha-1-antichymotrypsin, Prtn3, Exp, Rnas4, Elane, CtsA, orosomucoid or alpha-amylase, along with a decreased abundance of Muc12, this is indicative that the subject's gut tissue has a diseased physiological state, and that the test subject has Primary Sclerosing Cholangitis.
In yet another example, when a test subject's fecal AMP profile has increased levels of at least two, at least 3, at least 5, at least 10 of Ltf, Ngp, S100a9, Lcn2, Cd177, Chil3, S100a8, Mpo, Camp, Itgb2, Itgam, Retnlg, Elmo1, Ido1, Elane, Epx, Prg2, Mmp9, Ear2, Lcp 1, Fam49b, B2 m, Nos2, Fn1, Ctsg, Pon2, Apoe, Psap, Isg15, Pglyrp1, Gzma, Pltp, Apoa1, Arg1 and Gsdmdc 1, this is indicative that the subjects gut tissue has a diseased physiological state, and that the test subject has a late-stage bacterial gut infection. A fecal AMP profile having increased levels of at least two, at least 3, at least 5, at least 10 of Ltf, Ngp, S100a9, Lcn2, Cd177, Chil3, S100a8, Mpo, Camp, Itgb2, Itgam, Retnlg, Elmo1, Ido1, Elane, Dmbt1, Epx, Prg2, Pon1, Apoa1, Slpi, Mmp9, Ctsg, this is indicative that the subjects gut tissue has a diseased physiological state, and that the test subject has an early to mid-stage bacterial gut infection. Thus, the methods of the invention can be used to determine the stage of a disease or condition, to monitor treatment and/or provide prognostic assessment of a physiological state of a tissue or of a disease or condition.
It will be appreciated that wherein the gut tissue is human gut tissue, the AMPs are human AMPs or human orthologs of the already-identified murine AMPs.
It will be appreciated that the AMP binding moieties of some embodiments of the invention which are described hereinabove for detecting the plurality of AMPs may be included in a diagnostic kit/article of manufacture preferably along with appropriate instructions for use and labels indicating FDA approval for use in determining a physiological state of a tissue of a subject, or for diagnosing and/or monitoring a disease or condition and/or severity thereof in the subject.
Such a kit can include, for example, at least one container including at least two of the above described diagnostic agents (e.g., AMP-binding antibodies, aptamers) and an imaging reagent packed in another container (e.g., enzymes, secondary antibodies, buffers, chromogenic substrates, fluorogenic material). The kit may also include appropriate buffers and preservatives for improving the shelf-life of the kit.
Thus, according to some embodiments of the invention, there is provided a kit for determining the physiological state of a tissue, comprising greater than 10 and fewer than 100 AMP-binding moieties, each binding moiety binding to a different AMP having shared abundance in the tissue and in an exudate, secretion or excretion of the tissue in a given physiological state.
In some embodiments, the kit comprises AMP binding moieties selected from the group consisting of antibodies, aptamers and ligands of the greater than 10 and fewer than 100 AMPs.
The present inventors have shown the association of increased abundance of some AMPs in the gut (and, concomitantly, in the feces) with changes in the physiological state of the gut tissue (e.g. inflammatory states, IBD), indicating that the anti-microbial properties of some of the gut-associated AMPs could be active components of the successful inhibition of cytotoxic and/or inflammatory processes and agents of the gut. Thus, the present invention, in some embodiments, also envisages therapeutic application of the AMPs.
Thus, in some aspects of some embodiments, there is provided a method for treating or preventing a physiological state of a tissue comprising administering to the tissue at least one AMP associated with the physiological state of the tissue. In some embodiments, the tissue is gut tissue and the AMP is a gut-associated AMP selected from the group consisting of Camp, Lnc2, Ltf, Mpo, Ngp, Prtn 3, Elane, Ctsg, Pglyrp1, S100a8, S100a9, Ear2, Epx and Prg2, Pla2g 1b, Reg3a, Reg3g and Reg4. In some embodiments, there is provided at least one AMP for prevention and/or treatment of a diseased physiological state of a tissue. In specific embodiments, the tissue is gut tissue and the diseased physiological state is inflammation or bacterial infection. In other embodiments, the tissue is gut tissue and the physiological state is dysbiosis, and the at least one AMP is administered to modulate the gut microbiome towards a healthy physiological state. In some embodiments, the at least one gut-associated AMP can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or all 18 of the group's gut-associated AMPs.
In particular embodiments, the tissue is human gut tissue, and the at least one AMP is a human AMP, or a human ortholog of an indicated murine AMP selected from the group consisting of Camp, Lnc2, Ltf, Mpo, Ngp, Prtn 3, Elane, Ctsg, Pglyrp1, S100a8, S100a9, Ear2, Epx and Prg2, Pla2g1b, Reg3a, and Reg4.
In some embodiments, the tissue is human gut tissue and the diseased physiological state is inflammatory bowel disease (IBD), and the at least one AMP is a human AMP selected from the group consisting of PRTN3, AZU, S100A8, S100A9, S100A12, CTSG, LTF, PRB3, PGC, CP, APCS, PGLYRP1, MPO, PRSS2, RNASE2, ELANE, ORM1, PLA2G1B, SOD2 and LGALS4. In particular embodiments, the at least one AMP is selected from the group consisting of SEQ ID Nos. 28-47. In some emodiments, the at least one human AMP can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or all 20 of the group's human AMPs.
The AMPs of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.
As used herein a “pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
Herein the term “active ingredient” refers to the AMPs accountable for the biological effect.
Hereinafter, the phrases “physiologically acceptable carrier” and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.
Herein the term “excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
Techniques for formulation and administration of drugs may be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.
Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections. For gut-related treatments, oral, rectal and intestinal administration is preferred.
Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.
Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (AMPs) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., gut inflammation) or prolong the survival of the subject being treated.
Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in “The Pharmacological Basis of Therapeutics”, Ch. 1 p. 1).
Dosage amount and interval may be adjusted individually to provide levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.
The term “treating” refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.
As used herein, the term “preventing” refers to keeping a disease, disorder or condition from occurring in a subject who may be at risk for the disease, but has not yet been diagnosed as having the disease.
As used herein, the term “subject” includes mammals, preferably human beings at any age which suffer from the pathology. Preferably, this term encompasses individuals who are at risk to develop the pathology.
As used herein the phrase “treatment regimen” refers to a treatment plan that specifies the type of treatment, dosage, schedule and/or duration of a treatment provided to a subject in need thereof (e.g., a subject diagnosed with a pathology). The selected treatment regimen can be an aggressive one which is expected to result in the best clinical outcome (e.g., complete cure of the pathology) or a more moderate one which may relief symptoms of the pathology yet results in incomplete cure of the pathology. It will be appreciated that in certain cases the more aggressive treatment regimen may be associated with some discomfort to the subject or adverse side effects (e.g., a damage to healthy cells or tissue). The type of treatment can include a surgical intervention (e.g., removal of lesion, diseased cells, tissue, or organ), a cell replacement therapy, an administration of a therapeutic drug (e.g., receptor agonists, antagonists, hormones, chemotherapy agents) in a local or a systemic mode, an exposure to radiation therapy using an external source (e.g., external beam) and/or an internal source (e.g., brachytherapy) and/or any combination thereof. The dosage, schedule and duration of treatment can vary, depending on the severity of pathology and the selected type of treatment, and those of skills in the art are capable of adjusting the type of treatment with the dosage, schedule and duration of treatment.
It is expected that during the life of a patent maturing from this application many relevant methods for identifying antimicrobial peptides and proteins will be developed and the scope of the AMP is intended to include all such new technologies a priori.
As used herein the term “about” refers to ±10%.
The terms “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”.
The term “consisting of” means “including and limited to”.
The term “consisting essentially of” means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.
Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
As used herein the term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
As used herein, the term “treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non-limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, “Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols in Molecular Biology”, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, “A Practical Guide to Molecular Cloning”, John Wiley & Sons, New York (1988); Watson et al., “Recombinant DNA”, Scientific American Books, New York; Birren et al. (eds) “Genome Analysis: A Laboratory Manual Series”, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; “Cell Biology: A Laboratory Handbook”, Volumes I-III Cellis, J. E., ed. (1994); “Current Protocols in Immunology” Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton & Lange, Norwalk, C T (1994); Mishell and Shiigi (eds), “Selected Methods in Cellular Immunology”, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; “Oligonucleotide Synthesis” Gait, M. J., ed. (1984); “Nucleic Acid Hybridization” Hames, B. D., and Higgins S. J., eds. (1985); “Transcription and Translation” Hames, B. D., and Higgins S. J., Eds. (1984); “Animal Cell Culture” Freshney, R. I., ed. (1986); “Immobilized Cells and Enzymes” IRL Press, (1986); “A Practical Guide to Molecular Cloning” Perbal, B., (1984) and “Methods in Enzymology” Vol. 1-317, Academic Press; “PCR Protocols: A Guide To Methods And Applications”, Academic Press, San Diego, C A (1990); Marshak et al., “Strategies for Protein Purification and Characterization—A Laboratory Course Manual” CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
Animal Model
Mice. All animal studies were approved by the Weizmann Institute of Science Institutional Animal Care and Use committee (IACUC), application number 10100119-2. Specific-pathogen-free (SPF) C57BL/6 mice were purchased from Harlan Envigo and acclimatized to the animal facility environment for 2 weeks before starting experiments. C57BL/6 Germ-free (GF) mice were born and kept in the GF facility of the Weizmann Institute of Science and routinely monitored for sterility. All mice were maintained under a strict 12-h light-dark cycle, with lights on at 6 am and off at 6 pm. Eight-week-old mice were used in all experiments.
Dissection of different regions along the murine gastrointestinal tract. Age- and gender-matched SPF and GF mice were sacrificed by CO2 asphyxiation, and a laparotomy was performed by employing a vertical midline incision. Three different parts of the digestive tract were exposed and harvested: the ileum (the distal third of the small intestine), the cecum, and the distal part of the colon. For each section, the luminal contents were removed, the remaining tissue was cut open longitudinally, rinsed with sterile phosphate buffered saline (PBS−/−) for three times, and collected for mucosal proteomics.
Segmental filamentous bacteria (SFB) mono-colonization in GF mice. Fresh frozen cecal contents from mSFB-monocolonized or rSFB-monocolonized were resuspended in sterile PBS−/− in a vinyl isolator, filtered through a 100-μm cell strainer, and immediately transferred to GF C57BL/6 mice by oral gavage (200 μl resuspension/mouse). GF mice orally inoculated with sterile PBS−/− were used as negative controls. After 2 weeks of colonization, mice were sacrificed, terminal ileal mucosal samples were harvested and divided into three aliquots. Finally, the samples were subjected to proteomics, metagenomics, and RNA-sequencing, respectively.
Citrobacter rodentium infection in SPF mice. A kanamycin-resistant C. rodentium strain, DBS100 (ICC180), was used for infection. SPF mice were infected by oral gavage with 200 μl of bacterial solution cultured overnight, containing approximately 1×109 colony-forming units (CFU). Both the distal colonic mucosal and stool samples were collected from mice without infection (day0), during the peak of infection (day7) and at the infection recovery phase (day14), and subjected to proteomics, microbiome sequencing and RNA-sequencing (only for colon samples). The pathogen load was quantified by counting the stool CFU. In detail, stool samples were weighed, homogenized in sterile PBS−/−, serially diluted in PBS−/− and plated on LB kanamycin plates. After incubating overnight at 37° C., bacterial CFUs were counted and normalized to the stool weight.
Dextran sulfate sodium (DSS)-induced colitis. SPF mice were treated with 2% (weight/volume) DSS (molecular weight, 36,000-50,000 Da; MP Biomedicals, Solon, OH) added to the drinking water for 7 days followed by the resumption of regular water. Disease severity was monitored by weighing the mice daily. Fresh stool samples were collected before DSS treatment (day 0), at the early inflammatory phase (day3, day5), late inflammatory phase (dayl6) and the end of the weight recovery phase (day31), and subjected to proteomics and metagenomic sequencing. Colon samples were harvested at day5 for histology by hematoxylin-eosin staining, as well as for flow cytometry (see below).
Interleukin-18 (IL-18) supplementation in GF mice. GF mice were injected intraperitoneally with recombinant IL-18 (MBL, Cat #B004-2, powder dissolved in sterile PBS−/) for 5 days at a dose of 1 μg/mouse/injection, twice daily. GF mice injected with sterile PBS−/− only were used as negative controls. Distal colonic mucosal samples were harvested and subjected to proteomics. During the experiment, the mice were kept sterile using a cage-autonomous system.
Flow Cytometry
Colon tissues were dissected from mice treated with DSS at day5 or untreated mice. Colonic contents were removed by extensive washing, and the colonic epithelial cells were dissociated in Hanks' Balanced Salt Solution (HBSS−/−) containing 2 mM EDTA at 4° C. for 15 min for 3 times. Following extensive shaking, the epithelial fractions were combined, pelleted and resuspended in cold PBS−/−, and stained with antibodies against EpCAM and CD45 (Biolegend, San Diego, CA) for 30 min on ice, followed by staining with the viability dye DAPI. The remaining colon tissue was then digested with DNase I and collagenase in fetal calf serum (FCS)-containing HBSS−/− at 37° C. for 40 min, filtered, pelleted and resuspended in PBS−/− containing 2% FCS. Single-cell suspensions were blocked and stained with antibodies against CD45, CD11b, Ly6G, MHCII for 30 min on ice, followed by staining with the viability dye DAPI. Stained cells were analyzed on a BD-LSR Fortessa cytometer and were analyzed with FlowJo v8 software. Total counts of specific live cell types (epithelial cells, neutrophils) were compared between different groups using Mann-Whitney U test.
Mass Spectrometry-Based Proteomics
Sample preparation. Samples were subjected to in-solution tryptic digestion using suspension trapping (S-trap). Briefly, mucosal tissues were first homogenized in cold sterile PBS−/−. After centrifugation, the clear supernatant containing soluble proteins was supplemented with lysis buffer to a final concentration of 5% SDS in 50 mM Tris-HCl pH 7.4. Mouse and human stool samples were directly homogenized in lysis buffer containing 5% SDS in 50 mM Tris-HCl pH 7.4. Lysates were then incubated at 96° C. for 5 min, followed by six cycles of 30 sec of sonication (Bioruptor Pico, Diagenode, USA). Protein concentration was measured using the BCA assay (Thermo Scientific, USA). An amount of 50 ug total protein was reduced with 5 mM dithiothreitol and alkylated with 10 mM iodoacetamide in the dark. Each sample was loaded onto S-Trap microcolumns (Protifi, USA) according to the manufacturer's instructions. After loading, samples were washed with 90:10% methanol/50 mM ammonium bicarbonate. Samples were then digested with trypsin (1:50 trypsin/protein) for 1.5 h at 47° C. The digested peptides were eluted using 50 mM ammonium bicarbonate. Trypsin was added to this fraction and incubated overnight at 37° C. Two more elutions were made using 0.2% formic acid and 0.2% formic acid in 50% acetonitrile. The three elutions were pooled together and vacuum-centrifuged to dryness. Stool samples were subjected to an additional cleaning step using solid-phase extraction (Oasis HBL, Waters, MA, USA) according to manufacturer instructions. For samples to be analyzed by parallel reaction monitoring (PRM), an equal amount of peptide mix containing 21 stable isotope-labeled (SIL) synthetic peptides (Table S2) was spiked into the digests. Samples were kept at −80° C. until further analysis.
Liquid chromatography. ULC/MS grade solvents were used for all chromatographic steps. Dry digested samples were dissolved in 97:3% H2O/acetonitrile+0.1% formic acid. Each sample was loaded and analyzed using split-less nano-Ultra Performance Liquid Chromatography (10 kpsi nanoAcquity; Waters, Milford, MA, USA). The mobile phase was: A) H2O+0.1% formic acid and B) acetonitrile+0.1% formic acid. Desalting of the samples was performed online using a Symmetry C18 reversed-phase trapping column (180 μm internal diameter, 20 mm length, 5 μm particle size; Waters). The peptides were then separated using an HSS T3 nano-column (75 μm internal diameter, 250 mm length, 1.8 μm particle size; Waters) at 0.35 μL/min. For label-free quantitative (LFQ) proteomic analysis, peptides were eluted from the column into the mass spectrometer using the following gradient: 4% to 25% B in 155 min, 25% to 90% B in 5 min, maintained at 90% for 5 min, and then back to initial conditions. For PRM analysis, the gradient was: 4% to 30% B in 97 min, 30% to 90% B in 5 min, maintained at 90% for 5 min, and then back to initial conditions.
Mass Spectrometry. The nanoUPLC was coupled online through a nanoESI emitter (10 μm tip; New Objective; Woburn, MA, USA) to a quadrupole orbitrap mass spectrometer (Q Exactive HFX or HF, Thermo Scientific) using a Flexion nanospray apparatus (Proxeon). For LFQ analysis, data were acquired in data-dependent acquisition (DDA) mode, using a Top10 method. MS1 resolution was set to 120,000 (at 200 m/z), mass range of 375-1650 m/z, AGC of 3e6, and maximum injection time was set to 60 msec. MS2 resolution was set to 15,000, quadrupole isolation 1.7 m/z, AGC of 1e5, dynamic exclusion of 45 sec, and maximum injection time of 60 msec. For PRM analysis, data was acquired in PRM mode with scheduled monitoring of 148 native (unlabeled) peptides and 21 SIL synthetic peptides, corresponding to 68 proteins (Table S2). MS1 resolution was set to 120,000 (at 200 m/z), mass range of 375-1650 m/z, AGC of 1e6 and maximum injection time was set to 60 msec. MS2 resolution was set to 30,000, quadrupole isolation 1.7 m/z, AGC of 2e5, and maximum injection time of 100 msec.
Data processing. LFQ raw data were processed with MaxQuant v1.6.0.16. The data were searched with the Andromeda search engine against a database containing the mouse (Mus musculus) or human (Homo sapiens) protein sequences (corresponding to sample origin) as downloaded from Uniprot.org, and appended with common laboratory protein contaminants. Enzyme specificity was set to trypsin and up to two missed cleavages were allowed. A fixed modification was set to carbamidomethylation of cysteines and variable modifications were set to oxidation of methionines and deamidation of asparagines and glutamines. Peptide precursor ions were searched with a maximum mass deviation of 4.5 ppm and fragment ions with a maximum mass deviation of 20 ppm. Peptide and protein identifications were filtered at a false discovery rate (FDR) of 1% using the decoy database strategy (MaxQuant's “Revert” module). The minimal peptide length was 7 amino-acids, and the minimum Andromeda score for modified peptides was 40. Peptide identifications were propagated across samples using the match-between-runs option checked. Searches were performed with the label-free quantification option selected. The quantitative comparisons were calculated using Perseus v1.6.0.7. Decoy hits were filtered out and only proteins that had at least 50% valid values in at least one experimental group were kept. Missing data were replaced using imputation, assuming normal distribution with a downshift of 1.8 standard deviations and a width of 0.3 of the original ratio distributions.
PRM data was processed with the Skyline algorithm. Extracted ion chromatograms for all relevant peptide precursors and fragments were imported and manually curated for removing interfering signals and determining peak boundaries. The signal from SIL peptides was used to validate assignment of peak identity of the corresponding light (native) peptides. Peak assignment validation of native peptides without a corresponding SIL peptide was done by constructing a peptide identification library in Skyline using the above LFQ analysis results and comparing to PRM data. Peptide assignments of PRM fragment clusters which did not have a high confidence match to the relevant peptide in the library (dotp score<0.80) in any sample were filtered out. Total fragment area was exported from Skyline to Microsoft Excel, normalized to total ion current and log-transformed for statistical analysis.
Proteomics data analysis. Mass spectrometry intensities were log-transformed. Principal component analysis (PCA) was carried out based on log-transformed intensity. Permutational multivariate analysis of variance (PERMANOVA) was performed for pairwise comparisons on a distance matrix between group levels with corrections for multiple testing using the RVAideMemoire R package (available at the CRAN-R website under “packages”/“RVAideMemoire”). We generated clustered heatmaps using hierarchical clustering on Euclidean distance with average linkage. Differential protein expression was tested applying Mann-Whitney U test (for independent comparison) or Wilcoxon signed-rank test (for paired comparison) with FDR correction, and Log 2 fold changes were calculated. We tested for non-random behavior of the proteomic AMP signature against the background of the entire proteomic landscape by applying pre-ranked protein set enrichment analysis using the “fast gene set enrichment analysis” method. Ranks were calculated as signed fold change×−log 10 p-value. Venn diagrams were created to identify intersecting protein signatures. Kruskal—Wallis one-way analysis of variance (for independent comparison) or one-way repeated measures ANOVA on rank transformed values (for paired comparison) was used for the proteomic comparison of more than 2 groups.
The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD024793.
Microbiome Sequencing and Analysis
DNA purification. DNA from intestinal mucosa (ileum, distal colon) or stool was extracted and purified using a Purelink Microbiome DNA purification kit (Invitrogen, Thermo-Fisher Scientific, Waltham, MA).
Sequencing of 16S rRNA gene and analysis. For 16S amplicon sequencing, PCR amplification was performed for the 16S rRNA gene, followed by 500-bp paired-end sequencing (Illumina MiSeq, San Diego, CA). Amplicons spanning variable region 4 (V4) of the 16S rRNA gene were formed by using the following barcoded primers: Fwd 515F, AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTGCCAGCMGCCGCG GTAA (SEQ ID NO: 1); Rev 806R, CAAGCAGAAGACGGCATA CGAGATXXXXXXXXXXXXAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT; in which X represents a barcode base. W=A or T; M=A or C; H=A or C or T (SEQ ID NO: 2). Illumina's bcl2fastq script was used to generate the fastq files. Matched paired-end FASTQ files were processed using the Qiime2 software (q2cli version 2019.7.0). Demultiplexing was performed according to sample-specific barcodes. Bases of poor quality were trimmed. The sequences were denoised binned to amplicon sequencing variants (ASVs) employing the dada2 plugin for Qiime2. Taxonomic assignment was performed using the naive Bayes feature classifier and the Greengenes 13_8 database.
Shotgun metagenomics sequencing and processing. For shotgun sequencing, Illumina libraries were prepared using a Nextera DNA Sample Prep kit (Rumina, FC-121-1031), according to the manufacturer's protocol, and sequenced on the Illumina NextSeq platform with a read length of 80 bp. Illumina's bcl2fastq script was implemented to generate the fastq files. Reads were QC trimmed using Trimmomatic choosing the parameters PE-threads 10-phred33-validatePairs ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 MINLEN:50. KneadData (v0.7.2) was used with default parameters to remove host reads using mm9 as the reference. The cleared fastq files were subsampled using Seqtk (1.2-r94) (www(dot)github(dot)com/lh3/seqtk). Taxonomic assignment of bacterial DNA was carried out relying on exact alignment of k-mers with Kraken2 (v1.1.1) against the Genome Taxonomy Database (see Ecogenomic website www(dot)gtdb(dot)ecogenomic(dot)org/). To improve the accuracy of genus and species level classification, Bayesian re-estimation of bacterial abundance with Bracken (v1.0) was employed. The counts for both genus and species levels were separated, and the count tables to the lowest sequencing depth on an experiment-wise basis (˜500 k) were subsampled. Additionally, bacteria which failed to reach a total abundance of at least 0.01 were removed. Functional annotation was implemented using protein alignment with DIAMOND, thereby only the first hit was considered, an e value <0.0001 was accepted. We then used EMPANADA for sample-specific assignment of gene families to pathways.
Numerical ecology analysis. The microbial community ecology was analyzed with R (v3.6.3), mainly relying on the vegan and ade4 packages. The ASV abundance tables were normalized by subsampling the libraries to the lowest sequencing depth in the respective experiment and either by total sums scaling normalization (TSS). For ordination, principal component analysis applying center log-ratio transformation (CLR) was employed. Differential abundance testing of individual bacterial genera or species was carried out using Mann—Whitney U test (for independent comparison between two groups) or Wilcoxon signed-rank test (for paired comparison between two groups), and log 2 fold changes were calculated. P-values were adjusted for the FDR.
RNA-Sequencing and Analysis
RNA purification. Total RNA from intestinal mucosal samples (terminal ileum, distal colon) were extracted and purified using RNAeasy kit (QIAGEN, 74104, Germantown, MD) according to the manufacturer's instructions.
RNA-sequencing. Ribosomal RNA was selectively depleted by RnaseH (New England Biolabs, M0297) according to a modified version of a published method (7). Specifically, a pool of 50 bp DNA oligos (25 nM, IDT) that is complementary to murine rRNA18S and 28S, was resuspended in 75 ml of 10 mM Tris pH 8.0. Total RNA (1000 ng in 10 ml H2O) was mixed with an equal amount of rRNA oligo pool. The RNA was added to 2 μl diluted oligo pool and 3 μl 5×rRNA hybridization buffer (0.5M Tris-HCl, 1M NaCl, titrated with HCl to pH 7.4). Samples were incubated at 95° C. for 2 min, then the temperature was slowly reduced (_0.1_C/s) to 37° C. RNaseH enzyme mix (2 μl of 10 U RNaseH, 2 μL 10×RNaseH buffer, 1 mL H2O, total 5 μl mix) was prepared 5 min before the end of the hybridization and preheated to 37° C. The enzyme mix was added to the samples when they reached 37° C. and they were incubated at this temperature for 30 min. Samples were purified with 2.2×SPRI beads (Ampure XP, Beckmann Coulter, Indianapolis, IN) according to the manufacturers' instructions. Residual oligos were removed with DNase treatment (ThermoFisher Scientific, AM2238) by incubation with 51.11 DNase reaction mix (1 μl Trubo DNase, 2.5 μl Turbo DNase 10× buffer, 1.5 μl H2O) that was incubated at 37° C. for 30 min. Samples were again purified with 2.2×SPRI beads and suspended in 3.6 μl priming mix (0.3 ml random primers of New England Biolab, E7420, 3.3 μl H2O, Ipswich, MA). Samples were subsequently primed at 65° C. for 5 min. Samples were then transferred to ice and 2 μl of the first strand mix was added (1 μl 5× first strand buffer, NEB E7420; 0.125 μl RNase inhibitor, NEB E7420; 0.25 μl Prot® Script II reverse transcriptase, NEB E7420; and 0.625 μl of 0.2 μg/ml Actinomycin D, Sigma, A1410). The first strand synthesis and all subsequent library preparation steps were performed using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB, E7420) according to the manufacturers' instructions (all reaction volumes reduced to a quarter). Libraries that passed quality control were loaded with a concentration of 2 pM on 75 cycle high output flow cells (Illumina, FC-404-2005) and sequenced on a NextSeq 500 (I lumina) with the following cycle distribution: 8 bp index 1, 8 bp index 2, 75 bp read 1.
RNA-sequencing analysis. Illumina's bcl2fastq script was used to convert the raw files to fastq files. Fastq files were quality filtered using fastp (v0.20.0) with default parameters. Reads were aligned to the murine reference transcriptome with Gencode annotation (GRCm38.p6, Release M24) and quantified gene expression using STAR (v2.7.3a). Differential expression analysis was carried out with the DESeq2 package with default parameters. Gene Ontology analysis was carried out with g:Profiler with default settings. Comparisons of protein expression on the transcriptomic and the proteomic levels were carried out using heatmaps or Venn diagrams.
Proteome-Microbiome Integration Analysis
To assess the association between bacterial (SFB and C. rodentium) abundance and the AMP landscape, the gradient of the respective microbe's relative abundance in the ordination space was incorporated using the vegan function ordisurf with fitting a generalized additive model (GAM). The function ordisurf fits a smooth surface using penalized splines. In addition, Spearman's rank correlation analysis was performed to assess the association between bacterial abundance and individual AMP abundance.
To assess the association between proteome and microbiome on a landscape level, Procrustes rotation of two configurations was used, as available in the vegan package. Euclidean distances were calculated for both data domains. AMPs were used as the target matrix X and bacterial species as the matrix to be rotated Y. The protest function was used to obtain Monte Carlo p-values for testing of rotational agreement significance using 9,999 permutations.
For the identification of pairwise associations between individual proteins and either species or metagenomic functional pathways sparse partial least squares (sPLS) modeling as provided in the mixOmics data integration project was implemented. A particular advantage of sPLS is that it can accommodate numerous noisy and collinear (correlated) variables, and can also simultaneously model several response variables Y. It is efficient in large p, small n scenarios. Variable selection is achieved by introducing LASSO penalization on the pair of loading vectors. Bacterial species or pathways were regressed against the AMP expression levels. Only species with a total abundance of at least 0.01 and a persistence of 25% of the samples were considered. CLR was applied to the response variables. Multilevel decomposition was applied to account for repeated measurements. The model was tuned by M-fold cross-validation with 5 folds and 100 iterations. The mean squared error was estimated, R2 and Q2. An X variable was considered to contribute significantly to the prediction when Q2 h≥(1-0.952)=0.0975, as recommended by the developers. The cim function was used to illustrate the variable associations identified at a correlation threshold of 0.70 (for murine DSS model) or 0.35 (for human data).
Predictive Modeling of Disease Status Using AMP Proteomic and Microbiome Landscape
A support vector machine (SVM) with a linear kernel implemented in R package e1071 (see CRAN-R project website under “packages” and “e1071) was used to classify the phases of DSS-induced colitis as this classifier is both high performing and parsimonious. Separate classifiers were trained using either AMPs or metagenomic species information as input features. “Leave group out” cross-validation was used to avoid overfitting due to cage effects, whereby samples from one cage were left out in every training iteration. In each step, the prediction was performed on the cage set aside. The performance was evaluated using a confusion matrix with accuracy.
For the prediction of the area under the curve (AUC) of weight loss as a proxy of disease severity in mice challenged with DSS, gradient boosting regression algorithms were used to model both AMP and microbiome features, with the default parameters of sklearn python package (www(dot)scikit-learn(dot)org/stable/) with a single change to the minimal number of leaves to five, in order to avoid cage discriminating splits. An additional model for the microbiome data with a pre-processing step of PCA was built, in order to reduce the dimensionality of the data. In this model the PCA was computed only on the training data and the test sample was projected based on the training data, and then employed gradient boosting regression algorithm. The same leave one cage out cross-validation scheme described above was employed for analysis. The performance was evaluated using Pearson correlation coefficient between predicted and observed weight loss, and mean square error (MSE).
For the classification of human Crohn's disease versus healthy status, sigmoid kernel SVM classifiers were trained on the fecal AMP profile, fecal microbiome composition profile, and combined profiles, using a stratified K-fold cross validation (K=5) to avoid gender bias. Classification performance was summarized by ROC curves.
Human Study Design
The human study was approved by the Schneider Children's Hospital Institutional Review Board (IRB approval number 0722-19-RMC). In total, 54 children were recruited, including 26 pediatric Crohn's disease (CD) patients whose diagnosis were based on standard endoscopic, radiographical and histological criteria, and 28 healthy controls (HC). Participants from these 2 arms were matched by age and gender to avoid both confounding factors. All subjects fulfilled the following inclusion criteria: males and females, aged 6-18. Exclusion criteria included: (i) chronic treatment with any drug upon enrollment for healthy controls; (ii) the use of systemic antibiotics, probiotics or proton pump inhibitors 3 months prior to enrollment; (iii) diagnosed with type 1 or type 2 diabetes; (iv) any chronic disease (other than IBD for the first arm); (v) any psychiatric disorders; (vi) alcohol or substance abuse; (vii) gut-related surgery, including bariatric surgery; (viii) pregnancy, breastfeeding or fertility treatments for female participants; (ix) morbid obesity (BMI>95th percentile for their age and gender). After signing the informed consent, participants enrolled in both arms collected stool samples using the same protocol: a single stool sample was collected at home and then frozen in a home freezer up to 7 days and then brought on site in a cold cooler. Samples were then frozen and stored at −80° C. before protein was extracted for proteomics and DNA was extracted for shotgun metagenomic sequencing, as described above respectively.
The proteomics-metagenomics pipeline was designed to systematically identify and quantify the intestinal AMP landscape in mice as depicted in
In complementing the discovery approach and the inherent technical limitations of stool proteomics, these known AMPs and AMP candidates were then monitored using a parallel fecal targeted AMP-focused proteomic approach (‘targeted approach’) enabling increased sensitivity and high confidence in AMP identification and quantification in the complex stool and GI mucosal sample matrix. Specifically, 148 tryptic peptides corresponding to 68 known or putative AMPs were measured in stool using a custom-designed parallel reaction monitoring (PRM) pipeline (Table S2)(sequences not shown).
Stable isotope-labeled (SIL) peptides were synthesized for a subset of 21 of these peptides, spiked into the stool samples, and monitored along with their unlabeled native counterparts in the same experiment, thus serving as internal standards for validation of the respective AMP identity. To further study the inter-relationships between the AMP signature and intestinal microbiome configuration, 16S rRNA gene or shotgun metagenomics sequencing of the same respective samples were performed, as described below.
The AMP landscape along the murine gastrointestinal tract follows a region-specific configuration. To begin with, the intestinal proteomic landscape of 8-week-old C57BL6 mice, kept in germ-free (GF) versus specific pathogen-free (SPF) conditions, sampled in the ileum, cecum and colon was characterized. A total of 4692 proteins were detected by LFQ (discovery) proteomics from 59911 unique peptides. Principal component analysis (PCA) showed that the global proteomic landscape varied by GI region and colonization status, with the differences between GF and SPF mice being more distinct in the cecal and ileal mucosa than in the colonic mucosa (
First, the proteomic landscape among different GI regions of SPF naïve mice was compared. 2087 differentially abundant proteins (q<0.10) between ileum and colon, 2156 between ileum and cecum, 1201 between colon and cecum were detected (
To further explore the enteric AMP landscape, the known and potential AMPs derived from the discovery proteomic assessment were analyzed. Importantly, the AMP signature varied according to GI locations based on the first two principal components (PCs) (
Proteomic AMP signatures in the commensal colonized gut. The induction of intestinal AMPs in the presence of gut microbiome prompted the exploration of relationships between the host AMP signature and specific commensal intestinal colonization patterns. First, the murine AMP responses upon mucosal attachment of a single commensal bacteria, segmented filamentous bacteria (SFB) were identified. Previously, SFB colonization in the murine ileum was shown to induce expression of genes associated with antimicrobial defense. 8-week-old C57BL6 GF mice were mono-colonized for 2 weeks with SFB indigenous to either mice (mSFB) or rats (rSFB), or with sterile vehicle (PBS) as a negative control (
AMP proteomic evaluation derived from the LFQ proteomic analysis of the TI of colonized mice demonstrated that mSFB mono-colonization led to a significant AMP induction as compared to GF mice inoculated with PBS or rSFB, as featured by distinct clustering of mSFB mice by PCA (
Commensal induction of the mucosal AMP landscape could also be indirectly mediated by the induction of intestinal innate immune signaling pathways. For example, it has been shown that commensal-mediated colonic interleukin-18 (IL18) production was both necessary and sufficient to regulate the transcript levels of some AMPs. Therefore, the proteomic pipeline was utilized to indicate whether IL18 induces AMP proteomic changes in homeostatic conditions. To this aim, recombinant IL18 or vehicle control (PBS) was administered to GF mice by intraperitoneal injection under sterile conditions (
Pathogenic gut infection induces acute proteomic AMP signature shifts. Distinct changes of individual murine AMPs following enteric pathogenic invasion, such as Salmonella and Clostridium infection have been reported. To uncover the AMP landscape changes occurring during a pathogenic infection, 8-week-old C57BL6 SPF mice were orally infected with Citrobacter rodentium, an attaching and effacing pathogen which simulates human enteropathogenic and enterohaemorrhagic Escherichia coli infection. The discovery proteomics pipeline was applied to colonic, cecal and ileal samples to identify specific GI locations possibly affected by C. rodentium colonization (
To further test the hypothesis that the AMP signature in the colon can be detected with an alternative non-invasive method, targeted proteomic analysis was undertaken on stool samples collected at the same infection phases as the mucosal samples (
Based on these results, we next characterized the relationships between the colonic and fecal AMP features. Indeed, the colonic AMP signatures were significantly correlated with the global stool AMP landscape by Procrustes analysis (p<0.001, Correlation=0.64,
Proteomic AM P analysis is superior to RNA-based AMP characterization. The vast majority of previous AMP-related studies utilized mRNA assessment of individual AMPs extracted from the colonic mucosa(epithelial cell layer, to estimate their protein levels at different conditions. However, the expression and function of most AMPs are tightly regulated by diverse translational, post-translational and secretion-related mechanisms, partly to avoid non-specific damage to host cell membranes. To directly compare the utility of transcriptional AMP assessment to that obtained by the global proteomic pipeline, the host AMP transcriptional responses to intestinal commensal colonization or to pathogenic infection was defined and compared to the respective protein AMP responses. First, RNA-sequencing and analysis of transcripts from the TI mucosa collected 2 weeks after mSFB, rSFB, or vehicle control (PBS) inoculation in GF mice was performed. The transcriptomic landscape in mSFB-inoculated GF mice clustered slightly differently from the rSFB- or PBS-inoculated GF mice (
Further, the transcriptional signature with the discovery proteomic landscape measured upon mSFB colonization was compared. Notably, among the 24 differentially abundant AMPs detected by discovery proteomics (q<0.05), only two were also differentially expressed at the transcriptional level (Reg3b and Reg3g,
Next, a global transcriptional analysis of the colonic mucosal samples harvested before and during murine C. rodentium pathogenic infection was conducted. Mice infected with C. rodentium featured a colonic transcriptional landscape shift at day 7, which was distinct from that of uninfected mice, with this divergent signature sustained at day 14 (
Further, the similarities and differences between the transcriptional signature and the proteomic landscape at day 7 post-infection relative to day 0 were assessed. Both shared and unique differentially abundant AMPs (q<0.05) were identified at the transcriptional and protein level (
AMP dynamics are indicative of intestinal inflammation stages. To investigate the potential roles of the AMP landscape in contributing to disease-associated dysbiosis and consequent disease phenotypes, acute intestinal inflammation was induced through oral administration of dextran sulfate sodium (DSS) to mice. This murine DSS-induced colitis model is characterized by weight loss, bloody diarrhea, destruction of epithelial cells, and dysregulation of mucosal immune responses, thus resembling some key features of human IBD. To evaluate the AMP dynamics along disease course, stool discovery proteomics of samples collected before DSS exposure (day 0), at the early inflammatory phases (day 3 and 5), late inflammatory and tissue destruction phase (day 16), and at the end of the recovery phase (day 31,
Next the AMP signatures based on known and candidate AMPs detected by the LFQ analysis were examined. Similar to the proteomic landscape, the global AMP landscape featured time-dependent alterations across PC1, coupled with PC2 distinctions between the AMP landscape in early pre-clinical phases (day 3 and day 5), the pre-induction period (day 0) and later phases (day 16 and day 31,
The alpha defensins of both IEC and PMN origin, mostly featured decreased abundance in the early disease phases, while recovering in the recovery phase (
In addition to PMN- and IEC-produced AMPs, other top differentially abundant AMPs upon early (day 5,
As DSS-induced colitis is also hallmarked and driven by marked microbiome dysbiosis, we next sought to assess the relationships between fecal AMPs and microbiome dynamics upon DSS challenge. Based on metagenomics sequencing, the fecal microbiome composition in DSS treated-mice became distinct from untreated mice at both early DSS phases (day 3 and day 5) and later phases (day 16 and day 31,
The most expanded species included Bacteroides intestinalis, Bacteroides_B dorei, Bacteroides_B vulgatus, and Erysipelatoclostridium cocleatum at both day 5 (
To verify the abovementioned results in the early inflammatory phases, an independent DSS colitis repeat experiment (
Proteomic AMP signature predicts colonic inflammatory disease features. The significant correlations noted above between the proteomic AMP landscape and multiple microbiome and auto-inflammatory disease features prompted the investigation of the potential of fecal AMP profile to constitute a predictor of disease phenotypes, as a proof of concept of potential future use in disease diagnosis, prognostic assessment, and risk stratification. To this aim, both support vector machine (SVM) classification and gradient boosting regression machine learning algorithms were enlisted, as these may be capable of generating reliable predictions modelling complex non-linear features.
First, the proteomic fecal AMP predictive potential in assessing the stage of inflammation was evaluated in the murine DSS-induced model of intestinal inflammation, utilizing a multiclass SVM classifier with a linear kernel to distinguish between different phases of colonic inflammation (day 0, day 3, day 5, day 16 and day 31). Subsequently, SVM models were trained, applying a leave group out cross-validation scheme, leaving samples from one cage out in every training round and using it as the testing set, in order to handle the dependency between the samples in the same cage. Using this approach, an impressive performance of fecal AMP features in differentiating between baseline (day 0, accuracy 1.0), early pre-symptomatic phases (day 3 and day 5, accuracy 0.75 and 1.0, respectively), late inflammation during weight loss (day 16, accuracy 0.88) and the end of weight recovery phase (day 31, accuracy 0.75,
Next, the more difficult task of predicting an individual disease severity feature (weight loss) was assessed based on the fecal AMP signature, or alternatively by fecal microbiome features, and compared the predictive power of both. Indeed, disease severity of individual mice, as proxied by weight loss, could be readily predicted by the fecal AMP signature using the area under the curve (AUC) of weight loss over time as the target variable. To this aim, a gradient boosting regression algorithm applying the same leave one cage out cross-validation scheme was employed. A simple naïve baseline model was devised, estimating the AUC of weight loss from the mean of the training samples, and had a mean squared error (MSE) of 0.013. Notably, using the fold-changes of early-phase fecal AMP features (day 5 relative to day 0) to predict the individual-specific weight loss induced by DSS, a Pearson correlation coefficient of 0.64 between the predicted and observed weight loss with an MSE of 0.006 (
Given that the alterations in the AMP landscape may contribute to colitis-associated dysbiosis, the impact of changes in the abundance of individual AMPs on the abundance of specific bacterial species and functional pathways during acute colonic inflammation was investigated. Sparse partial least squares (sPLS) regression modeling was applied for the integration and selection of variables from different biological domains, attempting to predict the microbiome features with respect to fecal AMP signatures. Multiple strong pairwise associations (absolute threshold >0.7) were revealed between individual AMPs and both bacterial species (
The fecal proteomic AMP signature in human IBD. Finally, the AMP measurement pipeline was applied to human fecal samples. Human stool sample processing was similar to the abovementioned murine fecal sample processing, while the data were searched against the human protein database. Using this pipeline, the clinical utility of fecal AMP signature in differentiating Crohn's disease (CD) from healthy status was determined. To this end, 26 pediatric Crohn's disease (CD) patients and 28 age- and gender-matched healthy controls (Table S6) were recruited, and stool tandem discovery proteomics and shotgun metagenomics sequencing (
Shotgun metagenomics sequencing of stool samples collected from the same participants revealed similar patterns of variation in the microbial taxonomic profiles that largely separated CD patients from healthy controls (
To identify the association between fecal AMP and microbiome, Procrustes analysis was performed by integrating the proteomic and metagenomic datasets. Notably, the fecal AMP landscape was significantly correlated with microbial community composition (
To evaluate if alterations in the fecal AMP or microbial composition could be utilized to differentiate CD versus healthy status, sigmoid kernel SVM classifiers were trained on the AMP and bacterial species profiles, both separately and combined, using a stratified K-fold cross-validation (K=5) to avoid gender bias. SVM classifiers trained on fecal AMP features (mean AUC 0.86) versus microbial species (mean AUC 0.86) performed similarly well (
To further identify potential AMP signatures that are associated with disease severity, the CD patients were stratified into active and inactive disease according to the pediatric Crohn's disease activity index (PCDAI) scores collected upon recruitment (
Based on PCA, a clearer separation of the AMP profile was observed between active and inactive disease status than the microbiome features, although neither was significant, likely due to low sample size (
Further investigation into fecal AMP signatures in IBD revealed significant modifications of AMPs in fecal samples from large cohorts of Ulcerative Colitis and Crohn's Disease patients, compared to those from healthy control patients.
Proteomic AMP signature can be predictive in Primary Sclerosing Cholangitis. Primary Sclerosing Cholangitis is a disease of the bile ducts. In primary sclerosing cholangitis, inflammation causes scars within the bile ducts, gradually causing serious liver damage. A majority of people with primary sclerosing cholangitis also have inflammatory bowel disease.
Investigation into fecal AMP signatures in Primary Sclerosing Cholangitis (PSC) revealed significant modifications of AMPs in fecal samples from large cohorts of PSC patients, compared to those from healthy control patients.
Table 7 below shows the results of the IBD and PSC AMP profiles from the clinical data.
AMPs identified in the clinical results detailed in Table S7, their gene name and their Uniprot Accession number include:
The murine intestinal AMP proteomic landscape in steady-state and intestinal perturbation was characterize in protein-level detail, demonstrating the superiority of protein-level over transcriptomic AMP assessment, and highlighting the efficacy of establishing a lower GI landscape by stool AMP profiling. Utilizing correlational and predictive machine learning-based analysis, it was shown that that the host AMP landscape could accurately predict microbiome dynamics and disease severity features in murine intestinal disorders. Finally, a similar proteomic AMP-based pipeline was developed for humans, demonstrating that non-invasive fecal AMP features can enable accurate differentiation and classification between human IBD and healthy status.
These data have several potentially important implications. First, they highlight that, in contrast to previous paradigms, context-specific AMP dynamics are marked by global protein-level signature shifts, rather than single AMP alterations, or those proxied by their mRNA levels. As such, the proteomic pipeline of the invention not only accurately validates previously reported individual mRNA AMP changes, it importantly demonstrates that these occur within a much larger framework of highly regulated AMP signature dynamics. Such population-level AMP elucidation also enabled the identification of several new AMP candidates, based on structure and protein level dynamics similarities to known AMPs. For example, Retnlg (structurally similar to other resistin-like AMPs Retnlb and Retnla, with increased abundance in C. rodentium infection and DSS colitis), Mptx 1 (belonging to the pentraxins family, with increased abundance in SFB colonization and decreased abundance in C. rodentium infection and DSS-colitis), and Chil3 (a bacteria-binding lectin with increased abundance in SFB colonization, C. rodentium infection and DSS colitis) were identified by the pipeline of the invention as new AMP candidates.
Second, such context-specific global AMP dynamics enable an expanded insight into host regulation of the interactions with its microbiome in homeostasis and disease. For example, during commensal mono- or poly-inoculation, IECs dominate in their AMP secretion responsiveness, possibly in selecting bacterial colonizers in specific intestinal niches, and in shaping host immune responses to diverse commensal organisms. As such, commensal mSFB adhesion and colonization in the murine ileum can leads to secretion of an array of IEC-produced AMPs, which, in turn, are strongly associated with the mucosal mSFB abundance.
Intriguingly, infection by enteric bacterial pathogens elicits a significant suppression of IEC-produced AMPs (e.g., Reg4, Ang4), possibly representing an evolved pathogen-mediated exploitation of the invaded host, in facilitating its colonization while outcompeting commensals. The host's response in this ‘arms race’ includes a massive induction of AMPs originating from recruited immune cells, which are highly positively associated with mucosal-attached or fecal C. rodentium abundance, therefore likely aimed at limiting pathogen expansion. In contrast, a chemical inflammatory insult with a primary perturbation at the IEC level leads to a massive and improper approximation of the intestinal microbiome and the mucosal immune system. This results in a massive alteration in the secreted AMP landscape, which closely reflects (and predicts) this compositional and functional dysbiotic state. Consequently, this inflammatory AMP signature is characterized by a significant decrease in IEC-produced AMPs, coupled with a profound increase of PMN-secreted AMPs, ECM-associated AMPs and lipoproteins collectively driving a de-novo bloom of colitis-associated bacteria, inflammation and tissue damage. This inflammatory phase is followed by, and inter-connected with wound healing and tissue repair aimed at curbing the inflammation and correcting tissue damage. Intriguingly, in the recovery phase, reconstitution of the IEC layer and part of the IEC-associated AMPs, coupled with the persistence of infiltrating immune cells and their respective AMPs, leads to a peculiar state marked by a mixed immune-IEC AMP repertoire. The methods of the present invention can contribute to disentangling the complex relationships between the roles of specific AMP subsets in contributing to host-microbiome crosstalk and associated clinical symptoms in auto-inflammatory diseases such as IBD, and recovery from disease exacerbation in these disorders.
Finally, the results highlight the significance of the potential utilization of host fecal AMP signatures in predicting microbiome dynamics and disease outcomes. Indeed, and in contrast to the labile AMP mRNA, a high consistency between the fecal and mucosal protein AMP landscapes was established, highlighting their potential to non-invasively proxy mucosal AMP features. In steady-state, patient-specific AMP repertoires may complement the fecal microbiome in generating individualized signatures. During disease, such AMP signatures and their dynamics may precede and predict disease exacerbation, even before the development of clinical symptoms, while acting as accurate predictors of individualized disease severity, propensity for complications, and treatment responsiveness. Indeed, fecal calprotectin (S100a9/S100a8 complex) has been shown to correlate with IBD disease severity. Even more ambitiously, mechanistic understanding of global AMP functions in the gastrointestinal niche may enable deployment of them as microbiome modulators, as part of AMP-targeted treatment.
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
It is the intent of the Applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.
| Number | Date | Country | Kind |
|---|---|---|---|
| 283563 | May 2021 | IL | national |
This application is a Continuation of PCT Patent Application No. PCT/IL2022/050574 having International filing date of May 30, 2022, which claims the benefit of priority of Israel Patent Application No. 283563 filed on May 30, 2021. The contents of the above applications are all incorporated by reference as if fully set forth herein in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/IL2022/050574 | May 2022 | US |
| Child | 18522466 | US |
