Patent Application
20230192824
The instant application contains a Sequence Listing that has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference herein in its entirety. Said ASCII copy, created on Mar. 31, 2021, is named “Sequence _List_NC110768PCT_ST25.txt” and is 131 kilobytes in size.
The subject matter of the instant invention relates to antigen binding proteins that bind to class 5 enterotoxigenic Escherichia coli (ETEC) adhesins, methods of making and using these antigen binding proteins, and ETEC immunogenic compositions and vaccine formulations comprising said antigen binding proteins.
ETEC is a leading diarrheagenic bacterial pathogen among travelers and children in resource-limited regions. ETEC pathogenesis is initiated upon adherence of the bacteria to host intestinal cells using bacterial fimbrial colonization factors (CFs) and the subsequent secretion of enterotoxins. The ETEC class 5 fimbrial family contains some of the most prevalent CFs, and consists of eight members divided into three subclasses: 5a (CFA/I, CS4, CS14), 5b (CS1, CS17, CS19, PCF071) and 5c (CS2). See Table 1 (4,5).
In the past two decades, the molecular assembly and functional components of the class 5 fimbriae have been characterized, and data indicate that these CFs comprise a stalk-forming major subunit and a tip-localized minor adhesin subunit. Research indicates that the minor adhesin subunits of the class 5 fimbriae are the essential component for bacterial adherence, functioning as the “fimbrial tip adhesins.”
Ideally, while a multivalent ETEC vaccine would be directed to as many of the eight class 5 colonization factors as possible, a major challenge to the development of such broadly protective ETEC adhesin-based vaccine is the antigenic and sequence variability among the class 5 adhesins. Previous studies to identify cross-reactive functional epitopes present among the class 5 adhesins include initial experiments with 28 murine monoclonal antibodies generated by immunizing mice with each of three representative class 5 adhesins, CfaE (the CFA/I adhesin), CsbD (the CS17 adhesin) and CotD (the CS2 adhesin) (33, 34). Preliminary efforts at epitope mapping using these murine monoclonal antibodies have been reported, however, the amino acid and nucleic acid sequences of these murine Mabs remained uncharacterized (33, 34.) Thus, there exists a need for additional studies to develop these and other anti-adhesin antibodies and particularly, therapeutic antigen binding proteins that bind to one or more ETEC class 5 adhesins for use in methods of preventing or treating an ETEC-related infection in a subject.
In a first aspect, the invention broadly relates to antigen binding proteins that bind to one or more ETEC class 5 adhesins and thus prevent or reduce the ability of ETEC to infect a subject, e.g., by disrupting the adherence of ETEC CFs to the subject’s intestinal cells. In a particular embodiment, the antigen binding protein is an isolated antigen binding protein. In a particular embodiment, the isolated antigen binding protein is a monoclonal antibody (mAb or Mab) to an ETEC class 5 adhesin. In particular embodiments, the isolated antigen binding proteins are the mouse mAbs listed in Table 3, Table 4 and Table 5. In a particular embodiment, the mAb is selected from the group consisting of mouse mAbs P8D10, P6B8, P10A7, P5C7, P2H6 and P7F9.
In another aspect, the invention relates to an antigen binding protein that binds to an ETEC class 5 adhesin, wherein said ETEC class 5 adhesin is selected from the group consisting of ETEC class 5 adhesins encoded by amino acid sequences disclosed in
In another aspect, the invention relates to an antigen binding protein, or an immunologically active fragment or derivative thereof, that binds to an ETEC class 5 adhesin, wherein said antigen binding protein comprises one or more variable regions or active fragment thereof selected from the group consisting of the variable regions encoded in the amino acid sequences disclosed in
In another aspect, the invention relates to an antigen binding protein which is capable of binding an ETEC class 5 adhesin and which comprises heavy chain amino acid complementarity determining region (“CDR”) sequences CDR1, CDR2 and CDR3 and light chain amino acid sequences CDR1, CDR2 and CDR3 of a murine mAb variable region disclosed in
In additional embodiments, the antigen binding protein is capable of binding an ETEC class 5 adhesin and comprises the amino acid sequence depicted in
In another embodiment, the antigen binding protein is capable of binding an ETEC class 5 adhesin and comprises the amino acid sequence depicted in
In another embodiment, the antigen binding protein is capable of binding an ETEC class 5 adhesin and comprises the amino acid sequence depicted in
In another embodiment, the antigen binding protein is capable of binding an ETEC class 5 adhesin and comprises the amino acid sequence depicted in
In another embodiment, the antigen binding protein is capable of binding an ETEC class 5 adhesin and comprises the amino acid sequence depicted in
In another embodiment, the antigen binding protein is capable of binding an ETEC class 5 adhesin and comprises the amino acid sequence depicted in
In an additional embodiment, the antigen binding protein is capable of binding an ETEC class 5 adhesin and comprises the amino acid sequence depicted in
In additional aspects, the invention relates to nucleic acid molecules comprising a nucleotide sequence encoding one or more of the antigen binding proteins of the instant invention; nucleic acid vectors comprising one or more of said nucleic acid molecules, wherein said nucleic acid molecules are operably linked to a promoter capable of driving the expression of said nucleic acid molecules; and host cells comprising one or more of these nucleic acid vectors. The invention also includes compositions comprising said nucleic acid molecules, nucleic acid vectors, and host cells.
In an additional aspect, the invention relates to compositions comprising one or more of the antigen binding proteins of the instant invention. In a particular embodiment, the composition is a pharmaceutical composition. In particular embodiments, the pharmaceutical composition is selected from the group consisting of an ETEC immunogenic composition and an ETEC vaccine formulation. In additional embodiments, the pharmaceutical composition optionally comprises one or more adjuvants in an amount sufficient to enhance an immune response to the one or more of the antigen binding proteins.
In another aspect, the invention relates to methods of preventing or treating an ETEC-related infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition of the instant invention. In a particular embodiment, the composition is a pharmaceutical composition.
In yet another aspect, the invention relates to a kit for detecting ETEC bacteria comprising one or more of the antigen binding proteins of the instant invention.
While the specification concludes with the claims particularly pointing out and distinctly claiming the invention, it is believed that the present invention will be better understood from the following description.
All percentages and ratios used herein are by weight of the total composition unless otherwise indicated herein. All temperatures are in degrees Celsius unless specified otherwise. All measurements made are at 25° C. and normal pressure unless otherwise designated. The present invention can “comprise” (open ended) or “consist essentially of” the components of the present invention as well as other ingredients or elements described herein. As used herein, “comprising” means the elements recited, or their equivalent in structure or function, plus any other element or elements which are not recited. The terms “having” and “including” are also to be construed as open ended unless the context suggests otherwise. As used herein, “consisting essentially of” means that the invention may include components in addition to those recited in the claim, but only if the additional components do not materially alter the basic and novel characteristics of the claimed invention.
All ranges recited herein include the endpoints, including those that recite a range “between” two values. Terms such as “about,” “generally,” “substantially,” “approximately” and the like are to be construed as modifying a term or value such that it is not an absolute, but does not read on the prior art. Such terms will be defined by the circumstances and the terms that they modify as those terms are understood by those of skill in the art. This includes, at very least, the degree of expected experimental error, technique error and instrument error for a given technique used to measure a value. Unless otherwise indicated, as used herein, “a” and “an” include the plural, such that, e.g., “a pharmaceutically acceptable agent” can mean at least one pharmaceutically acceptable agent, as well as a plurality of pharmaceutically acceptable agents, i.e., more than one pharmaceutically acceptable agent.
Where used herein, the term “and/or” when used in a list of two or more items means that any one of the listed characteristics can be present, or any combination of two or more of the listed characteristics can be present. For example, if a composition of the instant invention is described as containing characteristics A, B, and/or C, the composition can contain A feature alone; B alone; C alone; A and B in combination; A and C in combination; B and C in combination; or A, B, and C in combination. The entire teachings of any patents, patent applications or other publications referred to herein are incorporated by reference herein as if fully set forth herein.
Therapeutics that can prevent or reduce the ability of ETEC to infect a subject are desired. Thus, in particular aspects, the present invention is directed to antigen binding proteins that bind to class 5 ETEC adhesins, methods of making and using these antigen binding proteins, and compositions comprising these antigen binding proteins, including, e.g., ETEC immunogenic compositions and vaccine formulations comprising these antigen binding proteins. Without intending to be limited to any particular mechanism of action, “preventing or reducing the ability of ETEC to infect a subject” includes the ability of a therapeutic of the instant invention to prevent or reduce the adherence of the ETEC bacteria to host intestinal cells by blocking the action of ETEC fimbrial tip adhesins, and thereby reduce or prevent infection and thus produce a therapeutic benefit to a subject. Specifically, provided herein are data regarding previously isolated mouse mAbs which bind to specific epitopes on ETEC adhesins (33, 34). Subsequent additional studies provided herein focus on additional epitope mapping and reanalysis of these murine mAbs. As explained below, these additional epitope studies reveal various errors and inaccuracies in previously reported data for these mAbs.
One of skill in the art will appreciate that, while useful for various purposes, murine mAbs such as those disclosed herein tend to be highly antigenic in humans. Thus, additional studies first described herein now provide the nucleic acid and amino acid sequence information for these previously reported murine mAbs. It is contemplated herein that the amino acid and nucleic acid sequence information of the variable regions of these mAbs, as well as additional data provided herein regarding cross-reactivity, epitopes, and potency of each murine mAb, may be employed by one of skill in the art using conventional methods to design anti-ETEC therapeutics including but not limited to, antigen binding proteins and compositions comprising these antigen binding proteins, as well as methods of protecting a subject in need thereof against ETEC infection comprising administration of these antigen binding proteins and compositions.
In particular, it is contemplated herein that the nucleic and amino acid sequences of the murine mAbs disclosed herein may be used to create antibodies with reduced antigenicity in human subjects, i.e., antibodies in which immunogenic murine regions have been replaced with non-immunogenic human regions. Specifically, it is contemplated herein that one of skill in the art may use conventional recombinant techniques to design chimeric, humanized, or human antibodies which comprise the antigen binding sequence specificity of the variable regions of the disclosed murine mAbs, or functional variants thereof, and thus create therapeutically effective anti-ETEC antigen binding proteins which present reduced antigenicity when presented to the human immune system. Also contemplated are recombinant nucleic acids encoding these antigen binding proteins as well as vectors and host cells related thereto. Conventional methods for creating these antigen binding proteins and other recombinant materials of the instant invention are discussed below and include, e.g., methods disclosed in Carter P et al., Proc Natl Acad Sci USA. 1992 May 15; 89(10):4285-9; Almagro, J and Fransson, J. Front Biosci. 2008 Jan 1; 13: 1619-33; Wu H et al, J Mol Biol. 1999 Nov 19; 294(1):151-62; Morrison, SL et al PNAS USA 1984 Nov, 81 (21):6851-5; and Boulianne GL et al., Nature 1984 Dec 13-19; 312(5995):643-6.
As used herein, the term “antigen binding protein” means any protein that binds to a specified target antigen The term “antigen binding protein” includes but is not limited to antibodies and binding parts thereof, such as immunologically functional fragments, or derivatives thereof.
It is contemplated herein that the antigen binding proteins and Mabs of the instant invention may be isolated antigen binding proteins and isolated Mabs. One of skill in the art will appreciate that an “isolated” antigen binding protein or an “isolated” Mab is one that has been separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses of the antigen binding proteins and Mabs and may include enzymes, hormones, and other proteinaceous or non-proteinaceous components. Purified forms are contemplated herein, i.e., the isolated antigen binding protein is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated. One of skill in the art will appreciate that antigen binding proteins and other polypeptides that are produced outside the organism in which they naturally occur, e.g., through chemical or recombinant means, are considered to be isolated and purified by definition, since they were never present in a natural environment.
In the instant application, the specified “target antigen” is an ETEC adhesin protein or fragment thereof, particularly the class 5 ETEC adhesins listed in Table 1: CfaE, CsfD, CsuD, CooD, CsbD, CsdD, CosD, and CotD. As described herein, because of their demonstrated increased stability, “target antigens” of the instant invention include recombinant “donor strand complemented” antigens based on the adhesins of Table 1, and are discussed in detail below.
One of skill in the art will appreciate that an antibody molecule of the IgG type comprises two light chains and two heavy chains linked via disulfide bonds. Both the light chain and the heavy chain contains a domain of relatively variable amino acid sequences, known as the variable region, which in turn contains hypervariable regions, also known as complementarity-determining regions (CDRs), that are interspersed among relatively conserved framework regions (FRs). Thus, as used herein, the term “variable region” refers to the antigen-binding site or paratope of an antibody which comprises a set of CDRs. Together, the CDR and FR determine the three-dimensional structure of the IgG binding site and thus, the antigen specificity of the antibody.
The complete IgG molecule also contains a domain of relatively conserved amino acid sequences, called the “constant region” consisting of three constant domains (CH1, CH2, and CH3). The IgG molecule is often referred to in terms of its functional fragments. Cleavage of an IgG with the protease papain produces two identical antigen-binding fragments (Fab) and an “Fc” fragment conferring the biological activity of the antibody, such as binding to the first component of the complement cascade or binding to Fc-receptor bearing cells, such as phagocytes, mast cells, neutrophils and natural killer cells. The Fc fragment comprises the heavy constant regions CH2 and CH3, and the Fab fragment comprises the heavy (CH1) and light (CL) constant regions and the variable regions of the heavy (VH) and light (VL) chains. The terms “Fab”, “Fab-fragment” and “Fab-region” are used interchangeably herein.
The term “epitope” used herein refers to the part of a protein antigen recognized by the immune system and to which the variable region of an antibody binds.
The term “antibody” as used herein refers to molecules with an immunoglobulin-like domain and includes monoclonal antibodies (for example IgG, IgM, IgA, IgD or IgE.) As understood by one of skill in the art, a monoclonal antibody refers to an antibody secreted by a single antibody-producing cell (clone). As discussed above, the secreted antibody usually contains heavy and light chains, and the variable regions of antibody have the antigen binding property. The terms “mAbs”, “Mabs” and like terms are familiar to one of skill in the art and are used interchangeably herein to refer to monoclonal antibodies.
Antigen binding proteins of the instant invention also include various fragments or engineered peptides that may be created by one of skill in the art using conventional methods Such fragments and engineered peptides include, e.g.: a single variable domain (e.g., VH, VHH, VL), a domain antibody (dAb®), antigen binding fragments, immunologically effective fragments, Fab, F(ab′)2, variable fragment (Fv), disulphide linked Fv, single chain Fv or single chain variable fragment (scFv), closed conformation multispecific antibodies, disulphide-linked scFv, diabodies, TANDABS™, etc. and modified versions of any of the foregoing familiar to one of skill in the art. Alternative antibody formats include, e.g., alternative scaffolds in which the one or more CDRs of any molecules in accordance with the disclosure can be arranged onto a suitable non-immunoglobulin protein scaffold or skeleton, such as an affibody, a SpA scaffold, an LDL receptor class A domain, an avimer, or an EGF-like domain. See, e.g., Yu et al. Annu Rev Anal Chem (Palo Alto Calif) 2017 June 12; 10(1):293-320.
In addition, protein engineering can be used by one of skill in the art to recombinantly generate variable regions, or graft or conjugate variable region sequences on a multi-domain and multi-function protein. Such proteins can have specific antigen binding properties, but are not typically referred to as monoclonal antibodies per se. Protein engineering can also be used by one of skill in the art to produce recombinant, polyclonal, bispecific, bivalent, multivalent and heteroconjugate antibodies.
Similarly, conventional methods and reagents may also be used by one of skill in the art to engineer and express scFv antibodies of the instant invention. As appreciated by one of skil in the art, a scFv antibody consists of variable regions of heavy (VH) and light (VL) chains, which are typically joined together by a flexible peptide linker. See, e.g., Ahmad et al., Clinical and Developmental Immunology, Vol. 2012, Article ID 980250, 15 pages, doi:10.1155/2012/980250. In particular embodiments, and as evidenced in the below examples, it is contemplated herein that scFv antibodies of the instant invention comprise the variable regions of the heavy and light chains of a murine mAbs disclosed herein, or functional fragments thereof, joined by a flexible peptide linker. It is contemplated herein that mono-pathogen scFv antibodies as well as multiple-pathogen scFv antibodies may be created, depending on the choice and number of mAbs selected for creating a scFv. See, e.g.,
While it is contemplated herein that native proteins may be used as target antigens or immunogens to create antibodies of the instant invention, the studies described in the examples provided herein employed stabilized ETEC adhesins created using recombinant techniques incorporating “donor strand complementation” (dsc). See, e.g., methods provided in U.S. Pat. 9,328,150 and Poole et al., Mol. Microbiol. 63, 1372-1384 (2007). According to such experimental protocols, a recombinant ETEC adhesin polypeptide construct may be created by connecting major or minor subunits derived from the same ETEC fimbrial type using polypeptide linkers, and this structure may be stabilized by linking the C-terminal most ETEC major subunit to a donor strand region from an ETEC major subunit, which can be either homologous or heterologous to the C-terminal major subunit. Thus, an immunogenic composition can comprise a whole or an immunogenic fragment containing a donor β strand region of the ETEC fimbrial major or minor subunits.
In some construct examples, in order to avoid inadvertent association of subunits, major ETEC fimbrial subunits can contain an N-terminal deletion of 14 to 19 amino acids (indicated by subscript.) Deletion of amino acid sequence length not involved in folding also reduces the likelihood of proteolytic degradation. Thus, for example, “dsc19CotD6xhis” refers to a recombinant donor strand complemented CotD ETEC adhesin antigen which comprises a 6 histidine residue C-terminal tag and an N-terminal deletion of 19 amino acids. Typically, the murine mAbs created using the recombinant antigens described herein do not include any epitopes containing residues from the donor strand.
One of skill in the art will appreciate that the prefix “dsc” may be used herein to distinguish recombinant antigen constructs of the instant invention from native antigens, e.g., “dscCfaE” and “CfaE”, respectively. Either may be used to create an antigen binding protein, for example an antibody of the instant invention. Unless otherwise indicated herein, however, for notational simplicity, the mAbs generated against the recombinant antigen constructs of the instant invention are referred to herein in an abbreviated fashion. For example, a mAb against “dsc19CfaE6xhis” disclosed in
It is contemplated herein that the terms “antigen binding protein”, “antibody” and like terms used herein also include immunologically functional fragments thereof. Unless otherwise indicated, the terms “immunologically functional fragment”, “immunologically active fragment”, “antibody fragment”, “fragment” or like terms may be used interchangeably herein and refer to a portion of an antigen binding protein of the instant invention which comprises an amino acid sequence sufficient to specifically bind a target antigen and produce a desired effect, e.g., block or reduce the likelihood of ETEC infection to produce a therapeutic effect in a subject, and/or detect a target ETEC antigen.
As understood herein, a “derivative” of an antigen binding protein of the instant invention includes, but is not limited to, an antigen binding protein of the instant invention which has been chemically or otherwise modified using conventional methods to include a tag or other feature for a desired purpose, e.g., in order to facilitate the detection of the antigen binding protein. In another embodiment, a derivative may comprise an antigen binding protein modified to comprise one or more additional therapeutic agents. One of skill in the art is familiar with such agents and methods of creating derivatives comprising such agents. Agents which may be used with the antigen binding proteins of the instant invention include but are not limited to antibiotic agents, artificial substances such as polymers or acetates, or other biological agents such as phosphates, lipids or carbohydrates.
In particular embodiments, the antigen binding protein of the instant invention is a chimeric antibody. Thus, in various embodiments, one of skill in the art may design one or more nucleotide sequences encoding, and amino acid sequences comprising, heavy and light chain immunoglobulin molecules, particularly sequences corresponding to the variable regions of the murine mAbs disclosed herein. In certain embodiments, sequences corresponding to CDRs are also provided. In a particular embodiment, a chimeric antibody of the instant invention includes antibodies which comprise the Fab fragment of a murine antibody disclosed herein which comprises the CDRs fused to the constant framework region of a human antibody. In particular embodiments, the antigen binding protein of the instant invention is a chimeric antibody comprising a human IgG or IgM constant region fused to mouse variable regions of an anti-ETEC monoclonal antibody disclosed herein. See e.g.,
In a particular prophetic embodiment, a mouse-human chimeric antibody comprising mouse variable regions of P6B8 mAb fused with constant regions of human IgG1 heavy chain and human immunoglobulin kappa light chain is contemplated herein as provided below in Example 12 and depicted in
The instant invention also includes humanized antibodies based on the murine mAbs disclosed herein. A “humanized antibody” is a chimeric antibody in which a larger part of the protein is derived from human sequences. Commonly, humanized antibodies consist of 5-10% sequences derived from non-human antibodies and 90-95% sequences derived from human antibodies. Thus, in particular embodiments, it is contemplated herein that a humanized antibody of the instant invention may comprise 90-95% sequences derived from human antibodies and 5-10% sequences derived from the murine antibodies disclosed herein. In another embodiment, a humanized antibody of the instant invention may comprise the CDRs of a murine mAb disclosed herein in combination with the conserved framework region of a human antibody. In a particular embodiment, the antigen binding protein is a humanized antibody comprising a human IgG or IgM constant region fused to a humanized mouse variable regions of an anti-ETEC monoclonal antibody such as a murine mAb disclosed herein. See e.g.,
It is understood herein that one of skill in the art may create chimeric and humanized antibodies using conventional methods and materials, including employing techniques for substituting amino acids, e.g., from a murine framework that provides antigen binding specificity, in order to increase the antigen binding specificity of an antigen binding protein of the instant invention. It is also understood that the antigen binding specificity of an antigen binding protein of the instant invention can be enhanced by substituting amino acids in variable regions of an anti-ETEC antibody using conventional methods and materials, including employing amino acid substitution techniques. In order to ensure that the binding specificity is maintained, in some embodiments certain human amino acid residues may be replaced with corresponding amino acids from the equivalent murine sequences. Thus, it is contemplated herein that in some instances, murine framework residues may be included in the human framework to increase antigen binding activity.
It is understood herein that the human IgG heavy and light constant domains may be derived from any one of IgG1, IgG2, IgG3, and IgG4 subclasses of human IgG antibodies, and it may comprise one, two, or three intact or truncated constant domains (CH1-3), which may optionally be mutated to alter effector function or provide for heteromultimer formation, or modified post-translationally (e.g. glycosylation) to improve the half-life of the antibody. In certain embodiments the IgG constant region is a human IgG1 constant region.
It is also contemplated herein that human antibodies based on the nucleic acid and amino acid sequence information of the disclosed murine mAbs may be created by one of skill in the art using conventional methods. For example, mice may be used to manufacture mAbs containing human Ig fragments according to conventional methods. Techniques for creating such antibodies are found, e.g., in Carter P et al., Proc Natl Acad Sci USA. 1992 May 15; 89(10):4285-9; Almagro, J and Fransson, J. Front Biosci. 2008 Jan 1; 13: 1619-33; and Wu H et al, J Mol Biol. 1999 Nov 19; 294(1):151-62. Thus, in various embodiments, antigen binding proteins of the instant invention include human antibodies created based on a murine Mab of the instant invention and comprising a human IgG constant region fused to human variable regions of a monoclonal antibody that specifically binds to an ETEC adhesin protein.
While one of skill in the art will appreciate that human antibodies can be generated by immunization of a humanized mouse with ETEC antigens, or sequencing human B cells, it is also contemplated herein that human antibodies of the instant invention can be achieved by replacing amino acids in murine antibodies to make fully human antibodies; e.g., by substituting amino acids in variable regions of an anti-ETEC murine mAb using conventional methods and materials, including employing amino acid substitution techniques.
In addition, it is also contemplated herein that an antigen binding protein of the instant invention may be designed which displays cross reactivity to more than one ETEC adhesin. For example, one of skill in the art will appreciate that antibody fragments, including but not limited to Fab, Fv, and scFvs, can be designed from any murine mAb disclosed herein which retain the potency to reduce ETEC binding and/or infection. As discussed above, it is also understood that the cross reactivity of an antigen binding protein of the instant invention can be enhanced by substituting amino acids in variable regions of an anti-ETEC antibody using conventional methods and materials, including employing amino acid substitution techniques. Specifically, as discussed above, it is also contemplated herein that combinations of two or more of such antibody fragments can be engineered to create a single protein molecule which contains dual specificity (bispecific) or multiple specificity for ETEC adhesins. Such dual-specific or heterodimeric antigen binding protein may be achieved using conventional methods to engineer a single antibody molecule which comprises variable regions derived from more than one murine mAbs disclosed herein including, e.g., P8D10, P6B8, P10A7, P5C7, P2H6 and P7F9. Similarly, bivalent or multivalent antibodies having the same affinity may be created. See, e.g., methods disclosed in Huston JS et al. Methods Enzymol. 1991; 203: 46-88; and Holliger P et al., Proc Natl Acad Sci USA. 1993 Jul 15; 90(14):6444-8. See, e.g.,
It is contemplated herein that recombinant antigen binding proteins of the instant invention may be designed to comprise three-dimensional configurations enabling high affinity binding of the specific antigen. To this end, information on particular antigen epitopes of interest is also provided herein, e.g., in
In another aspect, the present invention relates to nucleic acid molecules comprising nucleotide sequences that encode an antigen binding protein of the instant invention, or an immunologically active fragment or derivative thereof. In certain embodiments, the nucleic acid molecule encodes a chimeric, humanized, or human antibody that specifically binds to a Class 5 ETEC adhesin, comprising nucleic acid sequences encoding the heavy chain of said antibody, and nucleic acid sequences encoding the light chain of said antibody, based on data for the murine mAbs provided herein. In a particular embodiment, the nucleic acid molecule encodes a chimeric, humanized, or human antibody that specifically binds to the Class 5 ETEC adhesin CotD, and which is designed based on the sequence information provided for mAb P6B8 provided in
In still another aspect, the present invention relates to a vector comprising one or more nucleic acid sequences disclosed herein, and optionally a nucleotide sequence encoding a heterologous polypeptide such as an antigenic peptide tag or enzyme, operably linked to at least one expression control sequence such as a promoter/enhancer capable of driving the expression of the nucleic acid molecules. Such vectors may be created using conventional methods, and a variety of suitable mammalian cell, insect cell, and bacterial cell expression vectors which can produce mAb or antibody fragments are familiar to one of skill in the art. Suitable vectors for the uses contemplated herein are familiar to one of skill in the art and include, e.g., a variety of commercially available vectors such as pUC19, PBR322, AbVec, and TGEX (New England BioLabs, Ipswich, MA; Addgene, Watertown, MA; BioCat GmbH, Heidelberg, Germany.) Additional commercially available mammalian expression vectors, e.g., for creating humanized antibodies of the instant invention, are familiar to one of skill in the art and include, e.g., pFUSE (InvivoGen, San Diego, CA), pTRIOZ (InvivoGen, San Diego, CA), PSF-CMV-HUIGG1 HC ((MilliporeSigma, St. Louis, MO), PSF-CMV-HUKAPPA LC ((MilliporeSigma, St. Louis, MO), and PSF-CMV-HULAMBDA LC ((MilliporeSigma, St. Louis, MO.)
Similarly, promoters and enhancers suitable for uses contemplated herein are familiar to one of skill in the art and include, but are not limited to, commercially available promoters and enhancers such as cytomegalovirus CMV promoter (Sigma-Aldrich, St. Louis, Missouri), SV40 promoter (Promega, Madison, Wisconsin), elongation factor promoter (Sigma-Aldrich, St. Louis, Missouri), polyoma enhancer, bovine growth hormone promoter, and chicken beta-actin promoter (Snapgene, Chicago, Illinois).
The present invention further relates to host cells which comprise at least one vector as described herein and which produce an antigen binding protein, or active fragment or derivative thereof, according to the invention. Host cells for use with the methods of the instant invention include, but are not limited to mouse myeloma cells and/or Chinese Hamster Ovary cells (CHO), CHO-S cells, NS0 cells, Baby Hamster Kidney (BHK) cells, HEK293 cells; plant cells, such as tobacco, carrot and rice cells; or bacterial cells such as BL21, or insect cells such as Sf9 cells. It is contemplated herein that mammalian, e.g., human cells, may be used to create appropriately glycosylated antibodies and/or other post-translational modifications necessary for maintaining antibody function. Host cells such as these are familiar to one of skill in the art and are available from a variety of academic sources and/or commercial vendors familiar to one of skill in the art.
The instant invention is also directed to hybridoma cell lines expressing the antigen binding proteins of the instant invention. In certain embodiments, a hybridoma cell line is selected from at least one of the 28 hybridoma cell lines described in Table 3.
In another aspect, the invention relates to compositions comprising the antigen binding proteins, vectors, host cells and hybridomas of the instant invention. In particular embodiments, the compositions are pharmaceutical compositions which comprise one or more of the antigen binding proteins of the instant invention, or an immunologically active fragment or derivative thereof, alone or in combination with one or more additional pharmaceutically acceptable agents, and/or in combination with one or more pharmaceutically acceptable excipients, carriers, diluents, and/or adjuvants.
In various embodiments, such pharmaceutical compositions may comprise a mixture of antigen binding proteins of the instant invention, including one or more antigen binding proteins engineered to have affinity for more than one ETEC antigen.
In a particular embodiment, it is contemplated herein that the pharmaceutical compositions of the instant invention comprise ETEC immunogenic compositions and vaccine formulations. The terms “vaccine forumulation” and “vaccine” are used interchangeably herein. One of skill in the art will appreciate that an immunogenic composition or vaccine of the instant invention may be administered to a subject in need thereof not only to enhance an immune response against ETEC, but also to provide some enhanced level of protection against ETEC infection.
As understood herein, the term “pharmaceutically acceptable” is used to refer to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism.
Examples of pharmaceutically acceptable excipients, carriers, diluents and adjuvants are familiar to one of skill in the art and can be found, e.g., in Remington’s Pharmaceutical Sciences (latest edition), Mack Publishing Company, Easton, Pa. For example, pharmaceutically acceptable excipients include, but are not limited to, wetting or emulsifying agents, pH buffering substances, binders, stabilizers, preservatives, bulking agents, adsorbents, disinfectants, detergents, sugar alcohols, gelling or viscosity enhancing additives, flavoring agents, and colors. Pharmaceutically acceptable carriers include macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, trehalose, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles. Pharmaceutically acceptable diluents include, but are not limited to, water, saline, and glycerol.
Moreover, in particular embodiments, the pharmaceutical compositions of the instant invention may optionally comprise pharmaceutically acceptable substances that can produce and/or further enhance an immune response to an antigen in a subject. These substances include, but are not limited to, adjuvants. As understood by one of skill in the art, an adjuvant can be used to increase the immunogenic efficacy of an immunogenic composition or a vaccine formulation. It may also have the ability to increase the stability of an immunogenic composition or a vaccine formulation. Thus, adjuvants are agents that enhance the production of an antigen-specific immune response as compared to administration of the antigen in the absence of the agent. Moreover, faster and longer lasting immune responses may be possible in vivo through the addition of an adjuvant to an immunogenic composition or vaccine formulation. As understood herein, in a particular embodiment, an “effective amount” of an adjuvant is that amount which is sufficient to enhance an immune response to an ETEC immunogenic composition or vaccine of the instant invention.
Adjuvants suitable for use with the immunogenic compositions and vaccines of the instant invention are familiar to one of skill in the art and are available from a variety of commercial vendors. These include, for example, glycolipids; chemokines; compounds that induce the production of cytokines and chemokines; interferons; inert carriers, such as alum, bentonite, latex, and acrylic particles; pluronic block polymers; depot formers; surface active materials, such as saponin, lysolecithin, retinal, liposomes, and pluronic polymer formulations; macrophage stimulators, such as bacterial lipopolysaccharide; alternate pathway complement activators, such as insulin, zymosan, endotoxin, and levamisole; non-ionic surfactants; poly(oxyethylene)-poly(oxypropylene) tri-block copolymers; trehalose dimycolate (TDM); cell wall skeleton (CWS); complete Freund’s adjuvant; incomplete Freund’s adjuvant; macrophage colony stimulating factor (M-CSF); tumor necrosis factor (TNF); 3-O-deacylated MPL; CpG oligonucleotides; polyoxyethylene ethers, polyoxyethylene esters, polyinosine-polycytidylic acid (Poly(I:C)), aluminum hydroxide (Alum), Poly[di(carboxylatophenoxy)phosphazene] (PCPP), monophosphoryl lipid A, QS-21, heat labile enterotoxin (LT) toxoid, cholera toxin toxoid and formyl methionyl peptide.
In one embodiment, the adjuvant may be selected from the group consisting of antigen delivery systems (e.g. aluminum compounds or liposomes), immunopotentiators (e.g. toll-like receptor ligands), or a combination thereof (e.g., AS01 or ASO4.) These substances are familiar to one of skill in the art. In a particular embodiment, an adjuvant for use in the compositions and methods of the instant invention is selected from the group consisting of toll-like receptor ligands, aluminum phosphate, aluminum hydroxide, monophosphoryl lipid A, liposomes, and derivatives and combinations thereof. In a particular embodiment, the adjuvant may comprise a mixture of liposome, QS21 and monophosphoryl lipid A, e.g., “Army Liposomal Formulation” (ALF) adjuvant containing a synthetic monophosphoryl lipid A known commercially as 3D-PHAD™ (Avanti Polar Lipids), ALF containing QS21 (ALFQ), or ALF containing aluminum hydroxide (ALFA). See, e.g., Genito, C et al., 2017, Vaccine 35, 3865-3874; Alving, C. et al., 2012, Expert Rev Vaccines 11, 733-44; Alving, C. et al. (2012) Curr Opin Immunol 24, 310-5; Alving C. and Rao, M, (2008) Vaccine 26, 3036-3045; US 6,090,406; US 5,916,588.
As understood by one of skill in the art, the type and amount of pharmaceutically acceptable excipients, carriers and diluents included in the pharmaceutical compositions of the instant invention may vary, e.g., depending upon the desired route of administration and desired physical state, solubility, stability, and rate of in vivo release of the composition. For example, for administration by intravenous, cutaneous, subcutaneous, or other injection, a formulation is typically in the form of a pyrogen-free, parenterally acceptable aqueous solution of suitable pH and stability, and may contain an isotonic vehicle as well as pharmaceutical acceptable stabilizers, preservatives, buffers, antioxidants, or other additives familiar to one of skill in the art.
“Additional pharmaceutically acceptable agents” for use in the methods and compositions of the instant invention are familiar to one of skill in the art and include, e.g., a variety of commercially available active pharmaceutical ingredients, including but not limited to, additional antimicrobial agents familiar to one of skill in the art. Such antimicrobial agents include “antibacterial” agents, i.e., products that can destroy or inhibit the growth of bacteria, including but not limited to ETEC. Such products include, e.g., penicillins, cephalosporins, glycopeptide derivatives, carbopenems, aminoglycosides, macrolides, tetracyclines, chloramphenicol, lincomycins, sulfonamides, metronidazole, pyrimidine derivatives, rifampicin, and quinolones.
In a particular embodiment, antibacterial agents for use in combination with the methods and compositions of the instant invention include, e.g.,: amikacin, gentamicin, tobramycin, meropenem, imipenem, cefazolin, cefepime, cefoxitin, cephalothin, ceftazidime, cefotaxime, cefoperazone, ceftriaxone, cefuroxime, levofloxacin, ciprofloxacin, nitrofurantoin, trimethoprim-sulfamethoxazole, linezolid, vancomycin, erythromycin, clindamycin, daptomycin, mupirocin, ampicillin, piperacillin, oxacillin, penicillin, mezlocillin, amoxicillin, aztreonam, sulfosoxazole, chloramphenicol, streptomycin, tetracycline, minocycline, rifampin, and silver sulfadiazine. In addition, one of skill in the art will appreciate that antibiotics such as fluoroquinolones, azithromycin, levofloxacin, rifaximin, and/or loperamide are often used in treating ETEC-related diarrhea. Such products are commercially available in a variety of forms from a variety of vendors, and therapeutically effective amounts for conventional use are familiar to one of skill in the art.
The present invention also relates to methods for preventing or treating an ETEC infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one or more antigen binding proteins of the instant invention, and/or an immunologically active fragment, or derivative thereof. In a particular embodiment, the method comprises administering a pharmaceutical composition comprising one or more antigen binding proteins of the instant invention, e.g., an ETEC immunogenic composition or vaccine. Such administration may be with or without one or more adjuvants and/or with or without one or more additional active pharmaceutical ingredients.
It is understood herein that the pharmaceutical compositions of the instant invention, e.g., ETEC immunogenic compositions and vaccines disclosed herein, may be administered to a subject alone or in combination with other immunogenic compositions and vaccines, and/or in combination with one or more other active pharmaceutical ingredients including, e.g., other active therapeutic or immunoregulatory agents which can enhance a subject’s immune response to ETEC, or to other bacteria. Such additional vaccines and active agents may be administered to a subject in any manner, e.g., before, after, or concurrently with one or more immunogenic compositions or vaccines of the instant invention.
One of skill in the art will appreciate that the methods of the instant invention encompass adminstration of the immunogenic compositions and vaccine formulations disclosed herein to generate immunity in a subject if later challenged by ETEC infection. It is further understood herein, however, that the compositions, vaccine formulations, and methods of the present invention do not necessarily provide total immunity to ETEC and/or totally cure or eliminate all disease symptoms.
As used herein, “treating”, “treatment”, and like terms encompass reducing the severity and/or frequency of symptoms, eliminating symptoms and/or their underlying cause, preventing the occurrence of symptoms and/or their underlying cause, and improving or remediating damage. Thus, “treating” an ETEC infection refers to administering one or more antigen binding proteins of the instant invention to a subject to reduce or otherwise ameliorate the effects of an ETEC infection in the subject.
As used herein, the term “prevent”, “preventing” or like terms refers to reducing the likelihood of the occurrence of an event, and does not require the 100% elimination of the possibility of an event. Thus, as understood herein, “preventing” an ETEC infection includes a prophylactic use of the antigen binding proteins of the instant invention to reduce the ability of the ETEC pathogen to establish an active infection in a subject. As understood herein, treating a subject in need thereof may encompass both prevention and treatment.
As used herein, the terms “subject”, “a subject in need”, “a subject in need thereof” and like terms may be used interchangeably and include an animal, including but not limited to birds and mammals, suffering from and/or susceptible to one or more ETEC infections Human beings are also encompassed in these terms. In particular, subjects in need thereof include, but are not limited to, domesticated animals as well as non-human primates and human patients.
It is contemplated hereint that the pharmaceutical compositions contemplated herein may be administered to a subject in need thereof according to various regimens, i.e., in an amount and in a manner, and for a time sufficient to provide a clinically meaningful benefit to the subject. Suitable administration regimens for use with the methods of the instant invention may be determined by one of skill in the art according to conventional methods. For example, it is contemplated herein that a therapeutically effective amount of one or more antigen binding proteins of the instant invention may be administered to a subject as a single dose, or a series of multiple doses administered over a period of days, or a single dose followed by a boosting dose thereafter. In a particular embodiment, a “prime-boost” schedule may be employed, i.e., one or more earlier priming immunizations are administered followed by one or more subsequent boosting immunizations. It is contemplated herein that the same (“homologous”) or different (“heterologous”) vaccines may be administered in a prime- boost schedule. A “boosting dose” may comprise the same dosage amount as the initial priming dose or a different dosage amount.
As contemplated herein, an immunogenic composition or vaccine of the instant invention may be administered to a subject prior to exposure to infection, or after infection.
The administrative regimen, e.g., the quantity to be administered, the number of treatments, and effective amount per unit dose, etc. will depend on the judgment of the practitioner and are peculiar to each subject. Factors to be considered in this regard include physical and clinical state of the subject, route of administration, the intended goal of treatment, as well as the potency, stability, and toxicity of the particular composition.
As used herein, one of skill in the art will appreciate that a “therapeutically effective amount” of a pharmaceutical composition of the instant invention is that amount necessary to achieve a desired pharmacologic and/or physiologic effect in a subject (by local and/or systemic action), e.g., preventing and/or inhibiting ETEC adherence or growth in the subject. Such amounts can be readily determined by one of skill in the art. For example, therapeutically effective amounts of an ETEC immunogenic pharmaceutical composition may be gleaned by one of skill in the art in laboratory experiments, and through conventional dosing trials and routine experimentation. Therapeutically effective amounts of the pharmaceutical compositions of the instant invention may depend upon the age, weight, species (if non-human) and medical condition of the subject to be treated, and whether the antigen binding proteins are administered alone or in combination with one or more additional pharmaceutically acceptable agents, e.g., an antimicrobial agent, including but not limited to one or more additional anti-ETEC agents, and/or adjuvants.
One of skill in the art will appreciate that in some cases, a “therapeutically effective amount” may encompass more than one administered dosage amount. Indeed, when a series of immunizations is administered in order to produce a desired immune response in the subject, one of skill in the art will appreciate that in that case, a “therapeutically effective amount” may encompass more than one administered dosage amount.
As discussed above, one of skill in the art will appreciate that the antigen binding proteins of the instant invention may be administered alone, or in combination with one or more additional pharmaceutically acceptable agents, therapeutic treatments or regimens discussed herein, in any manner or combination that may be deemed therapeutically effective, e.g., before, after, or concurrently with the antigen binding proteins of the instant invention; separately in different formulations and dosage forms; at different times, and/or routes of administration, or in combination with the antigen binding proteins in a single formulation.
Various compositions, formulations, and dosage forms designed to treat ETEC infection in a subject in need thereof are contemplated herein, and may be created according to conventional methods by one of skill in the art. Indeed, it is contemplated herein that pharmaceutical compositions and dosage forms may be administered to a subject by a variety of routes according to conventional methods, including but not limited to parenteral (e.g., by intracisternal injection and infusion techniques), intradermal, transmembranal, transdermal (including topical), ocular, intramuscular, intraperitoneal, intravenous, intra-arterial, intralesional, subcutaneous, oral, sublingual, intranasal (e.g., inhalation or by aerosol administration), intracerebrospinal, intra-articular, intrasynovial, intrathecal, and topical, routes of administration.
Administration can also be by continuous infusion or bolus injections, particularly intravenous administration of one or antigen binding proteins or derivatives or fragments thereof as a bolus or by continuous infusion over a period of time, e.g., in the form of an ETEC immunogenic composition or vaccine formulation. Such compositions, formulations, dosage forms, and methods of delivery may be suitable for treating bacterial infections, e.g., on the skin, in the bloodstream, deep tissue, oral cavity, ocular cavity, gastrointestinal tract, urinary tract or any other location in a subject in which a bacterial infection may be present.
The term “dose”, “dosage”, “dosage form” and like terms used herein refer to physically discrete units suitable for administration to a subject, each dosage comprising a predetermined quantity of antigen binding proteins as an active pharmaceutical ingredient calculated to produce a desired response. For example, as contemplated herein, the pharmaceutical compositions of the instant invention are preferably sterile and contain an amount of the antigen binding proteins in a unit of weight or volume suitable for administration to a subject. The volume of the composition administered to a subject (dosage unit) will depend on the method of administration and is discernible by one of skill in the art. For example, in the case of an injectable, the volume administered typically may be between 0.1 and 1.0 ml, preferably approximately 0.5 ml. Amounts for clinical use can be ascertained by one of skill in the art without undue experimentation.
As discussed above, it is contemplated herein that the antigen binding proteins of the instant invention may be administered in various ways according to the methods of the instant invention, e.g., alone or in combination with one or more additional pharmaceutically acceptable agents, therapeutic treatments, or regimens, in order to enhance treatment efficacy. As one of skill in the art will appreciate, the type and amount of additional pharmaceutically acceptable agents, therapeutic treatments or regimens for use in the methods and compositions of the instant invention will depend upon the type of infection to be treated; e.g., alone, or in conjunction with one or more other pharmaceutically acceptable antimicrobial compounds.
It is contemplated herein that a therapeutically effective amount of said one or more additional pharmaceutically acceptable agents for conventional use are familiar to one of skill in the art; amounts for use in the methods and compositions of the instant invention may also be readily determined by one of skill in the art according to conventional methods. In one embodiment, it is contemplated herein that therapeutically effective amounts of an additional pharmaceutically acceptable agent, e.g., a conventional antimicrobial agent, may be reduced when administered in combination with one or more of the antigen binding proteins disclosed herein (or vice versa). In addition, it is also contemplated herein that when said one or more additional pharmaceutically acceptable agents is administered in conjunction with one or more antigen binding proteins disclosed herein, the agent may only need to be administered to a subject for a fraction of the time that said agent would typically need to be administered when administered alone (and vice versa).
It is contemplated herein that any of the antigen binding proteins of the instant invention may be used in methods and kits for detecting ETEC bacteria, ETEC fimbriae and adhesin, and even previous exposure to ETEC, or infection by ETEC according to conventional methods. For example, anti-adhesin mAbs disclosed herein can serve as positive controls or standards for diagnostic kits to see if patient sera are reactive to ETEC antigens or not. In a particular embodiment, the antigen binding proteins may be labeled to incorporate a detectable marker, e.g., a tag, fluorophore, enzyme, radioisotope or other substance familiar to one of skill in the art. In a particular example, the kit may comprise one or more containers comprising an antigen binding protein of the instant invention, detection reagents, and instruction for use thereof. The anti-adhesin antigen binding proteins can also be used to evaluate conformational stability and potency of ETEC vaccines and proteins which are based on ETEC fimbriae and adhesins. For example, as disclosed in Example 7 and Table 4, the P6B8 mAb can detect conformational epitopes of ETEC adhesin. One of skill in the art will appreciate that if vaccine antigens demonstrate diminished reactivity to the anti-adhesin antibody, e.g., due to degradation which might possibly occur during storage, a vaccine may not be as immunogenic and thus may demonstrate a loss of efficacy.
The anti-adhesin antigen binding proteins of the instant invention can also be used to quantify ETEC vaccines and proteins, which are based on ETEC fimbriae and adhesins. For example, the anti-adhesin mAbs of the instant invention can be used to quantify ETEC proteins using ELISA such as demonstrated in Example 11.
Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments, and examples provided herein, are merely illustrative of the principles and applications of the present invention. It is therefore to be understood that numerous modifications can be made to the illustrative embodiments and examples, and that other arrangements can be devised without departing from the spirit and scope of the present invention as defined by the appended claims. All patent applications, patents, literature and references cited herein are hereby incorporated by reference in their entirety.
As indicated below, some of the data provided in Examples 1-8 have been previously published (33, 34).
The creation of the murine mAbs listed in Table 3 was previously reported (33, 34). As previously described, in order to increase stability and expression yield of ETEC adhesin, the donor strand complemented dscCsuD, dscCsfD, dscCsbD, dscCooD and dscCotD (CS14, CS4, CS17, CS1 and CS2 adhesins, respectively) were cloned into pET24(a)+ (Novagen, Darmstadt, Germany) between XhoI and NdeI sites, which was similar to the construction of dscCfaE plasmid (15). The C-terminal donor strand of each adhesin was from the N-terminal 14 to 19 residues of CsuA, CsfA, CsbA, CooA and CotA (CS14, CS4, CS17, CS1 and CS2 pilins, respectively) mature sequences. The sequences of dsc antigens are shown in
As discussed above, “donor strand complemented” (dsc) antigens provide enhanced antigen stability and were used to construct the mAbs of the instant invention (33). Specifically, dsc19CfaE, dsc19CsbD and dsc19CotD antigens disclosed in
dsc19CfaE was purified by resuspending BL21(DE3)/pET24-dsc19CfaE cell paste in 1:4 (w/v) binding buffer A (20 mM phosphate, 500 mM sodium chloride, 50 mM imidazole, pH 7.4) with benzonase (Novagen) at 6.25 unit/ml. The bacterial resuspension was passed twice through microfluidizer (Model 1109, Microfluidic), and the cell lysate was centrifuged at 17,000 g at 4° C. for 1 hour. The supernatant was loaded onto a HisTrap HP column (Amersham Biosciences, Waltham, MA) at a flow rate of 3 ml/min, and proteins were eluted with a linear gradient to 300 mM imidazole over 20 column volumes (CVs). Fractions containing dsc19CfaE were pooled and diluted in 1:10 (v/v) binding buffer B (25 mM MES, pH 6.0), and loaded onto a HiTrap SP column (Amersham Biosciences) at a flow rate of 2 ml/min. The bound proteins were eluted with a linear gradient to 500 mM sodium chloride over 20 CVs. Fractions containing dsc19CfaE were pooled and dialyzed against phosphate buffered saline pH 6.7 overnight at 4° C.
The purification of dsc19CsbD was previously reported in Savarino et al, 2019 Hyperimmune Bovine Colostral Anti-CS17 Antibodies Protect Against Enterotoxigenic Escherichia coli Diarrhea in a Randomized, Doubled-Blind, Placebo-Controlled Human Infection Model; DOI: 10.1093/infdis/jiz135). The BL21(DE3)/pET24-dsc19CsbD cell paste was resuspended in 1:4 (w/v) phosphate buffered saline pH 7.4 (PBS). The bacterial resuspension was passed twice through microfluidizer (Model 1109, Microfluidic), and the cell lysate was centrifuged at 17,000 g at 4° C. for 1 hour. After the supernatant was removed, the cell pellets were washed twice by resuspension in PBS and centrifugation as described above. The washed pellets were resuspended in solubilization buffer (100 mM sodium chloride, 50 mM imidazole, 2 M urea, 20 mM sodium phosphate pH 7.4). The resuspended pellets were mixed and stirred at 30° C. for 1 hour and then centrifuged at 17,000 g for 1 hour. The supernatant was loaded onto a HisTrap FF column (Amersham Biosciences) and urea was removed from the column using a linear gradient to 100% HisTrap wash buffer (500 mM sodium chloride, 50 mM imidazole, 20 mM sodium phosphate pH 7.4) over 10 CVs. Proteins were eluted by a linear gradient to 57% HisTrap elution buffer (500 mM sodium chloride, 500 mM imidazole, 20 mM sodium phosphate pH 7.4) over 20 CVs. Fractions containing dsc19CsbD were pooled. Purification of dsc19CotD was identical to the purification procedure of dsc19CsbD except for using BL21(DE3)/pET24-dsc19CotD cell paste.
The following mouse immunization and hybridom generation were briefly reported previsouly (34). Female Balb/c mice were immunized with 4 doses (5 µg per dose) of each adhesin (dsc19CfaE, dsc19CsbD or dsc19CotD) at two-week intervals. Three days after the last immunization, splenocytes of the immunized mice were fused at 1:10 with mouse myeloma cell line P3NS1 in the presence of polyethylene glycol. After the fused cells were incubated with HAT selective medium for 10 days in tissue culture microtiter plates, the supernatants of stable hybridomas were tested for antibody production on the ELISA plates coated with each adhesin. The culture supernatants were diluted at 1:1 ratio with phosphate buffered saline, pH 7.4 with 0.05% Tween 20 and 0.1% BSA (PBST-BSA) and added into plates. Bound antibodies were detected by incubation with goat anti-mouse IgG horseradish peroxidase conjugates diluted at 1:1500 in PBST-BSA, and the optical densities (OD) at 450 nm were measured after incubation with the ortho-phenylenediamine and peroxide substrate. The OD values of the positive hybridomas were at least 0.1 higher than those of the background level. There were 28 positive hybridomas. Nine of them were anti-dscCfaE, 11 of them were anti-dscCsbD, and eight of them were anti-dscCotD. See Table 3 for a list of the 28 hybridomas/mAbs (33).
Monoclonal antibodies were purified as previously reported (33). Briefly, about 40 ml of supernatant of the hybridoma cell cultures was adjusted to pH 8.0 with sodium hydroxide and applied to 0.5 ml of the protein G resin (Genscript) at 0.5 ml/min. After washing with 15 ml of PBS, pH 7.4, the mAbs were eluted with 5 ml of 100 mM glycine, pH 2.5. The eluate was immediately neutralized by 1 M Tris, pH 8.5. The fractions containing purified mAbs were dialyzed against water, lyophilized and resuspended in PBS, pH 7.4. The final mAb concentrations were determined by the BCA assay (Pierce). See (33).
ELISA procedures were performed using conventional methods as previously described (32). Briefly, antigens were diluted in the PBS, pH 7.4 and coated on a 96-well microtiter plate with 100 µl of each adhesin and mutants at 2 µg/ml. Each condition was duplicated. After the plate was incubated at 37° C. for 1 hour, each well was washed three times with 250 µl of PBS. Then each well was blocked with 250 µl of PBS with 5% fetal calf serum at 37° C. for 1 hour. After washing three times with 250 µl of PBS, 0.05% Tween 20 (PBST), each well was added 100 µl of each mouse mAb at 2 µg/ml and incubated at 37° C. for 1 hour. The plate was washed five times with 250 µl of PBST and each well was added 100 µl of goat anti-mouse IgG horseradish peroxidase-conjugated secondary antibodies and incubated at 37° C. for 2 hours. After washing three times with 250 µl of PBST, each well was added 100 µl of ortho-phenylenediamine substrates and incubated at 25° C. for 20 minutes. Optical densities (OD) were measured by a plate reader at 450 nm. See also (33) which includes a subset of data provided herein in
HAI assays were performed using conventional methods as previously described (5). The wild type class 5 ETEC strains used in this study were CFA/I (H10407), CS1 (WS1974A), CS2 (C91f), CS4 (BANG10-SP), CS14 (WS3294A), CS17 (LSN02-013966/A), CS17 (WS6788A), and CS17 (WS4240A). Briefly, bacteria were resuspended in PBS with 0.5% D-mannose (PBSM) until the OD at 650 nm reached 40. The minimal hemagglutination titer (MHT) was determined by mixing 25 µl of each serial twofold bacterial dilution with equal volumes of 3% washed bovine erythrocytes and PBSM in the ceramic tile wells. The tile was rocked on ice for 20 minutes. The second highest bacterial dilution (one titer higher than the MHT) showing the positive mannose-resistant hemagglutination (MRHA) was used as the bacterial working solution. To determine the HAI activity or the minimum inhibition concentration (MIC) of each mAb, a serial twofold antibody dilution was made from starting concentration of 500 µg/ml, and incubated with an equal volume of the bacterial working solution at room temperature for 20 minutes. Bovine erythrocytes were then added into the wells and the tile was rocked on ice for 20 minutes. The MIC was expressed as the lowest concentration of the mAb which completely inhibited the MRHA. Data are provided in Table 5 (33). Data indicate that the mAbs against CfaE, CsbD and CotD generally have strong homologous HAI activity, whereas some heterologous HAI activities have been observed, but not as potent as homolgous inhibition.
The cross-reactive pattern of each mAb was examined by ELISA aiming to identify broadly reactive mAbs. The raw optical density measurements in the ELISA assays are displayed in
Data indicate that the 28 anti-adhesin mAbs exhibited distinctive cross-reactive patterns similar to the previously reported data (33). Specifically, we observed individual adhesin specific, intra-subclass specific, inter-subclass specific and class-wide cross-reactivity. Two anti-CfaE mAbs P1F9 and P8D10 reacted only to the immunogen CfaE (
All 11 anti-CsbD mAbs were cross-reactive to CS1 adhesin CooD probably due to high sequence identity (97%) between CsbD and CooD (
Given the previously reported distinctive reactivity patterns of the 28 anti-adhesin mAbs to the class 5 adhesins discussed above, we proceeded to re-map the epitope residues of the mAbs, especially those with cross-reactivity to the heterologous adhesins. New analysis discussed below reveal errors in the previously published epitope maps of P10A7, P5C7, P2H6, and P7F9 (see Table 4.) Specifically, S86 in CfaE is a newly identified residue in the epitopes of P10A7 and P5C7. S88 and Y182 in CsbD are now identified herein as key residues in the epitope of P7F9.
We previously mapped epitope residues for each mAb by combining results from the ELISA (see data in
#AD stands for adhesin domain; PD stands for pilin domain.
Reanalysis of data in
‡The mAbs with minimum inhibition concentrations (MIC) ≤10 µ/ml, 10-100 µg/ml, 100-250 µg/ml, were defined in this study to have strong, moderate, and low functional activity, respectively.
§The CS17 LSN02-013966/A strain contains CsbD L85I/H144A allelic variation from the CS17 WS6788A strain.
†The CS17 WS4240A strain contains CsbD L85I allelic variation from the CS17 WS6788A strain.
Anti-CsbD mAb P2H6 reacted less to CsbD E20738A (harboring N62S/S74T/T84N/L85R/H144A/Y145N/Y293H allelic variations) or CsbD T84N/L85R than primary CsbD, CsbD AD, CsbD LSN02-013966/A (harboring L85I/H144A allelic variations) or CsbD H144A/Y145N (
Interestingly, another anti-CsbD mAb P7F9 reacted positively to all CsbD variants, however, much less to CfaE T91V, CfaE R181A and CfaE R182A compared to primary CfaE (
In the additional anti-CotD mAb ELISA with specific CotD mutants (
The epitope feature (conformational or linear), domain specificity and isotype of the mAbs were determined to complement the epitope analysis. When comparing to the binding to the native adhesins (immunogens) in the ELISA assays (
As previously reported, the presence of mAbs cross reactive to heterologous class 5 adhesins prompted us to investigate if the cross-reactivity patterns observed in the ELISA assays would be retained in the functional hemagglutination inhibition (HAI) assay. To test the potency and functional cross-reactivity of each mAb, we determined the minimum concentrations of mAbs to inhibit MRHA of bovine erythrocytes elicited by eight class 5 ETEC (Table 5) (33). Data provided therein indicate that all five anti-CfaE adhesin-domain specific mAbs (P8D10, P6C11, P6H4, P10A7 and P5C7) were very potent inhibitors of homologous ETEC (CFA/IH10407) hemagglutination with the minimum inhibition concentrations (MIC) less than 10 µg/ml. Among them, P10A7 and P5C7 also showed strong or moderate functional cross-reactivity to the heterologous primary CS17 ETEC (CS17 WS6788A), suggesting the three residues (R67, S86 and R181) within epitopes of P10A7 and P5C7 were functional epitope residues shared between CfaE and CsbD. Of the four anti-CfaE pilin-domain specific mAbs, P3B2, P1F9 and P2E11 had high or moderate hemagglutination inhibition activity (HAI) against the CF-homologous strain, which was unexpected since the putative receptor-binding domain of CfaE has been localized to the adhesin domain of CfaE (24) (
Among the anti-CsbD mAbs, seven of nine mAbs specific to the adhesin domain were highly potent MRHA inhibitors for the CF-homologous strain (CS17 WS6788A). These mAbs were generally less potent inhibitors for the other two CS17 strains, presumably based on allelic variation. Five CsbD mAbs, P7C2, P9A5, P2H6, P6G1 and P2A9, also showed functional cross-reactivity to the CS1 heterologous class 5b strain (Table 5), suggesting there are common functional epitopes, such as T84 in CsbD, shared between CsbD and CooD. No HAI activity of the other two adhesin-domain specific mAbs (P7F9 and P5A12) was observed to any of the eight ETEC strains within the normal range of tested concentrations (≤ 250 µg/ml), which was unexpected when initially reported because P7F9 was shown to be broadly reactive to all six adhesins by ELISA (Table 5) and its epitope included the conserved R181 (
Among six anti-CotD mAbs specific to the adhesin domain, three of them (P7F6, P3F4 and P6B8) were high potent inhibitors of MRHA against the CS2-homologous ETEC strain; however, the other three mAbs (P3D11, P9A10 and P9G7) showed moderate or low levels of HAI to the CF-homologous ETEC strain. Two anti-CotD mAbs (P2B8 and P12A2) specific to the pilin domain displayed low HAI activity to the CS2-homologous strain. None of the anti-CotD mAbs exhibited significant functional cross-reactivity to the CF-heterologous class 5 ETEC strains (33).
Caco-2 cells differentiate into an intestine tissue-like monolayer, to which ETEC has been shown strong binding. Thus, in addition to evaluating the blocking effect of mAb using erythrocytes, the more physiologically related Caco-2 cell model provides a useful assay to characterize inhibitory effects of the mAbs. Specifically, we evaluated whether the binding of H10407 ETEC to Caco-2 cells was reduced by mAb P8D10.
Briefly, the ETEC H10407 strain was grown on CFA agar plate at 37° C. overnight. The bacteria were harvested and resuspended in phosphate buffered saline (PBS, pH 7.4) until the OD650 reached 1.5, approximately equivalent to 1.2 × 109 bacteria/ml. The anti-CfaE Mab P8D10 was added into the resuspended bacteria at final concentration of 0.4 mg/ml. The bacteria alone (250 µl) and the admixture (250 µl) of bacteria and P8D10 were added into wells of Caco-2 cells, which contained 750 ul of Caco-2 growth media with 1% mannose. After the Caco-2 cell wells were incubated at 37° C. for 3 hours, the wells were carefully washed with 1 ml of PBS five times. After washing, the Caco-2 cells were detached and lysed from the wells by incubation with 1 ml of 0.1% triton X-100 at room temperature for 10 minutes. A serial 10-fold dilution of the lysed Caco-2 cells was plated on LB agar plates, which were incubated at 37° C. overnight. The recovered bacteria (bacteria bound to the Caco-2 cells) were determined by the colony forming unit (CFU) counts. Data are provided in
Hybridoma cells P8D10, P7C2, P9A5, P6B8, P5C7, P1F9, P1F7, P7F6, and P3F4 were provided to a commercial vendor for antibody variable domain sequencing. (GenScript, Piscataway, NJ). Following the technical manual of TRIzol® Reagent (Cat. No.: 15596-026; Ambion, Foster City, CA) total RNA was successfully isolated from all of the hybridomas except hybridoma cells P1F7, P7F6, and P3F4.
Total RNA obtained from hybridomas P8D10, P7C2, P9A5, P6B8, P5C7, and P1F9 was reverse-transcribed into cDNA using either isotype-specific anti-sense primers or universal primers following the technical manual of PrimeScript™ 1st Strand cDNA Synthesis Kit (Cat. No.: 6110A; Takara, Mountain View, CA.) Antibody fragments of heavy chain and light chain were amplified according to the standard operating procedure (SOP) of rapid amplification of cDNA ends (RACE) of GenScript. Amplified antibody fragments were cloned into a standard cloning vector separately. Colony PCR was performed to screen for clones with inserts of correct sizes. The consensus sequence was provided. In each case, five clones were sequenced for each VH and VL, and all five clones expressed >99% sequence identity. The sequence and annotation information obtained for the hybridomas is provided in
As newly reported herein, the anti-CfaE mAb P10A7 may be used to quantify CfaEB protein in crude BL21(DE3)/pET24-dsc19CfaEB(his)6 bacterial cell lysate. This bacterial cell lysate was generated using a previously published method (10), and employing CfaEB with a C-terminal 6xHis tag. The capture ELISA principle is shown in
Data suggest that the OD value started to saturate at or aboy/ml of CfaEB. A series concentration from 0.025 ug/ml to y/ml of purified CfaEB was also tested, and the optical density of each concentration was plotted (black dots) and fitted in a linear regression (black line) as shown in
Experimental details of ELISA: 96-well maxisorp Nunc F plastic plates were coated overnight at 4° C. with 2 µ/ml, 100 µl/well of the capture antibodies, rabbit anti-His polyclonal antibodies (Genscript, Cat. No. A00174) in phosphate buffered saline, pH 7.4 (PBS). After incubation, the plates were washed 3 times with PBS. Each well was blocked with 200 µl of 5% fetal bovine serum (FBS, Gibco) and incubated for 1 h at 37° C.with PBST (PBS containing 0.05% Tween-20), a series dilution of purified CfaEB (0.03 to 1 µg/ml), a series dilution of samples (800x, 1600x, 2000x, 2400x, 3200x), and negative control were prepared in PBS, pH 7.4, and 100 µl of each was added to the wells. Each condition was triplicated and the plates were incubated for 1 h at 37° C. and subsequently washed 3 times with PBST. Each well was added with 100 µl of mouse anti-CfaE mAb P10A7 at 2 µg/ml and incubated for 2 h at 37° C. followed by 5 times PBST washes. The plates were added with 100 µl/well goat anti-mouse immunoglobulin G (IgG) horseradish peroxidase (HRP)-conjugated secondary antibody (Jackson ImmounoResearch) 1:1000 diluted in 5% FBS, and incubated for 1 h at 37° C. The plates were washed 3 times with PBST and 100 µl of substrate (1 mg/ml o-phenylenediamine (Sigma) in sodium citrate buffer (Sigma), pH 4.5 containing 0.4 µl/ml of hydrogen peroxide) were added to each well. After being incubated for 15 to 20 minutes at room temperature, the plates were measured at 450 nm on a Synergy HTX plate reader (Bio-Tek Instruments). The negative control OD value was substracted from the OD value of samples. The mean background corrected OD value of the triplicates and the concentrations of CfaEB were plotted.
Given the sequence information of the variable regions of the murine mAbs disclosed herein, it is further contemplated herein that human-mouse chimeric mAbs comprising the variable regions of these murine mAbs and constant regions of human antibodies may be made by one of skill in the art using conventional methods. Thus, in particular embodiments, the invention includes chimeric antibodies comprising variable regions (VH and VL) of the heavy chain and light chains of a mouse mAb disclosed herein, and constant regions (CH and CL) of human IgG heavy chains and human immunoglobulin kappa light chains.
In additional particular embodiments, it is contemplated herein that a chimeric mouse-human monoclonal antibody may be designed and created by fusing mouse variable regions with constant regions of human IgG1 heavy chain and human immunoglobulin kappa light chains. Particular examples disclosed herein comprise the variable regions of murine mAbs P5C7 or P6B8 fused with constant regions of human IgG1 heavy chain and human immunoglobulin kappa light chain such as provided in
Chimeric antibodies may be generated using conventional methods. See e.g.,
Humanized antibodies are also contemplated. For example, a humanized scFv of the instant invention may be created. Such humanized scFv may comprise a scFv with one or more CDR regions of the murine mAbs disclosed herein in a human antibody scaffold (“acceptor”). See, e.g., the scheme depicted in
It is contemplated herein that construction of humanized antibodies may comprise using human acceptor frameworks as similar as possible to the murine antibody frameworks by performing standard sequence searching of available databases, e.g., the Protein Data Bank (PDB). The human frameworks may also be modified to include residues from the murine FR regions where useful to preserve antigen-binding activity. Such structurally critical murine framework residues may be identified, e.g., using computer-assisted molecular modeling of the variable regions of the murine antibodies. See, e.g., Hou et al., Journal of Biochemistry Vol 144, Issue 1, July 2008, pp 115-120.
In additional particular embodiments, it is contemplated herein that scFv antibodies of the instant invention may be designed and created by one of skill in the art using conventional methods and reagents. For example, one of skill in the art will appreciate that a scFv antibody can be designed using conventional methods by tandemly linking the nucleic acids encoding the VH and VL regions of a mAb of the instant invention. In particular embodiments, the scFv linking format could be VH-linker-VL or VL-linker-VH. Possible suitable linkers are familiar to one of skill in the art and include nucleic acid linkers encoding a peptide sequence which allows the scFv to retain the function of the parent mAb. Linkers of length between 15 amino acids and 20 amino acids are typically used.
In a particular example, possible nucleic acid linkers include nucleic acid sequences encoding a 15-amino acid peptide consisting of three repeating sequences of glycine-glycine-glycine-glycine-serine, i.e., (GGGGS)3 (SEQ ID NO:97)). See, e.g., Huston, J.S. et al. Methods Enzymol 1991; 203:46-88. Additional possible linkers are familiar to one of skill in the art and include, e.g, the 18-mer (GGSSRSSSSGGGGSGGGG) (SEQ ID NO: 98) or the 20-mer (G4S)4 (SEQ ID NO: 99). Linker sequences may also contain additional features designed to improve the functions of the scFv antibody. See, e.g., Andris-Widhopf, J., Steinberger, P., Fuller, R., Rader, C., & Barbas, C. F. (2011). Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences. Cold Spring Harbor protocols, 2011(9); Schaefer, J. V, Honegger, A., & Pluckthun, A. (2010). Construction of scFv Fragments from Hybridoma or Spleen Cells by PCR Assembly. (R. Kontermann & S. Dübel, Eds.)
Various leader sequences include, e.g., pelB leader sequence
or its variants including
malE leader sequence
or its variants including
DsbA leader sequence
OmpA leader sequence
PhoA leader sequence
It is contemplated herein that various linkers and leader sequences may be used by one of skill in the art to design the scFvs of the instant invention.
In a particular embodiment, a prophetic P8D10 scFv antibody design and sequence are given in
One of skill in the art will appreciate that various plasmid vectors and host cells may be used to express a scFv antibody of the instant invention. Indeed, scFvs are amendable to expression in prokaryotic cells (low cost production), and multipathogen or multivalent scFVs can be engineered without loss of activity. In particular embodiments, it is contemplated herein that the P8D10 scFv DNA sequence may be cloned into an expression vector including, e.g., pET vectors (Novagen), pBAD vectors (Invitrogen), pT7 vectors (Sigma), pTriEx vectors (Novagen), pLys vectors (Novagen), pCDF vectors (Novagen), pACYC vectors (Novagen), pCOLA vectors (Novagen), and other vectors previously disclosed herein. The vector harboring P8D10 scFv may then be transformed or transfected into expression cells including but not limited to BL21 cells (Novagen), BL21 (DE3) cells (Novagen), BLR cells (Novagen), BLR (DE3) cells (Novagen), HMS174 (DE3) cells (Novagen), Tuner (DE3) cells (Novagen), Origami (DE3) cells (Novagen), Rosetta (DE3) cells (Sigma), strains derived from Escherichia coli B strain, strains derived from Escherichia coli K12 strain, and other cells described herein. In a particular embodiment, it is contemplatead herein that the P8D10 scFv DNA sequence may be cloned into a pET-24a plasmid vector (Novagen). The pET-24a plasmid harboring P8D10 scFv may be then transformed into BL21 (DE3) cells (Novagen). The BL21(DE3)/pET-24a-P8D10-scFV cells may be grown in Select APS media (BD sciences) with kanamycin, and the P8D10 scFv protein expression induced by addition of IPTG (Isopropyl β- d-1-thiogalactopyranoside). Another delivery vehicle for scFv could be Lactococcus lactis or other probiotic strains generally regarded as safe. The scFv can be expressed on the bacterial surface or secreted into the intestinal lumen. In addition to the foregoing prophetic example of a P8D10 scFV, several actual scFvs have been generated and assayed as provided in detail in the below example.
As contemplated above, since the mouse mAb P8D10 has very potent homologous HAI activity, and its variable domains have been sequenced, this anti-CfaE mAb was chosen to make several mouse and humanized scFvs. As described in detail below, three scFvs were made based on the variable domain sequences of mAb P8D10. All three scFvs demonstrated functional activity in the HAI assay, and the two humanized scFvs demonstrated more potency than the mouse scFv.
Construct Design: Mouse and humanized scFvs were created according to conventional methods. They were concurrently designed, cloned, expressed and purified. First, three scFv constructs were designed, each of which comprised a pelB leader sequence (to facilitate periplasm expression), anti-CfaE mAb P8D10 variable domain sequences (VH and VL domains), and a linker of (GGGGS)3 (SEQ ID NO:97 ) to connect VH and VL domains. See
The DNA sequences of these constructs were commercially synthesized (Eurofins Genomics, Tokyo, Japan). The synthesized nucleotide sequence for the mouse scFv (VH-VL) was initially
TATGCTGATGACTTCAAGGGACGCTTTGCCTTCTCTTTGGAAACCTCTGC
This synthesized nucleotide sequence was flanked by NdeI and XhoI sites, respectively (italicized regions). An internal NdeI site (CATATG) was inadvertently put in the nucleotide sequence initially (bold), and was later replaced with CCTATG using a commercially available site-directed mutagenesis kit according to manufacture instructions (Quikchange reaction; Agilent Technologies, Santa Clara, CA). The primers used in the Quikchange reaction were:
and
The resulting nucleotide sequence after the Quikchange reaction is
No amino acid changes resulted from the Quikchange reaction.
The synthesized nucleotide sequence for the humanized P8D10 scFv (VH-VL) is:
The nucleotide sequence of the humanized P8D10 scFv (VH-VL) is flanked by NdeI and XhoI sites in the synthesized sequence, respectively (italicized regions).
The synthesized nucleotide sequence for the humanized P8D10 scFv (VL-VH) is:
The nucleotide sequence of the humanized P8D10 scFv (VL-VH) is flanked by NdeI and XhoI sites in the synthesized sequence, respectively (italicized regions).
Cloning, Expression, Purification: The three P8D10 scFv were cloned, expressed and purified the same way using conventional methods and commercially available materials. Specifically, the synthesized mouse and humanized nucleotide sequences for the three P8D10 scFvs (described above) were commercially provided in pUC vectors, respectively (Eurofins Genomics, Tokyo, Japan). Each pUC vector was digested by NdeI and XhoI restriction enzymes, and the nucleotide insertion encoding the P8D10 scFv was purified and inserted into NdeI and XhoI sites of a pET-24a vector (Novagen brand, Millipore Sigma, Burlington, MA). The resulting pET-24a plasmid containing the P8D10 scfv sequence was transformed into BL21(DE3) bacterial cells (Novagen brand; Millipore Sigma, Burlington, MA). The transformed BL21(DE3) cells were grown in Select APS media (BD Biosciences, San Jose, CA) at 32° C. until the OD600 reached 0.6 - 0.8, and the bacterial culture was induced with 0.1 mM IPTG at 16° C. for about 18 hours. The harvested bacterial cell paste was resuspended in a buffer containing 20 mM Tris, 250 mM sodium chloride, 5 mM imidazole at pH 8.0, and microfluidized twice. The bacterial cell lysate was centrifuged for 45 minutes at 17000 g-force and 4° C. After centrifugation, the P8D10 scFv was purified from the soluble fraction of the cell lysate by a nickel affinity column, and followed by cation exchange chromatography. Briefly, after the soluble fraction of the cell lysate was loaded onto a nickel affinity column (Novagen, Burlington, MA), the column was washed by a buffer containing 20 mM Tris, 250 mM sodium chloride, 5 mM imidazole at pH 8.0, and the fractions containing P8D10 scFv were eluted by a buffer containing 20 mM Tris, 250 mM sodium chloride, 300 mM imidazole at pH 8.0. The eluate from the nickel affinity column was diluted 20 times by a buffer containing 20 mM 2-(N-morpholino)ethanesulfonic acid (MES) at pH 5.5, and the diluted solution was loaded onto a SP cation exchange column (Cytiva, Marlborough, MA). After washing the SP column with a buffer containg 20 mM MES, 50 mM sodium chloride at pH 5.5, the P8D10 scFv was eluted from the SP column with two step gradients. The first step gradient buffer was 20 mM MES, 300 mM sodium chloride at pH 5.5, and the second step gradient buffer was 20 mM MES, 400 mM sodium chloride at pH 5.5. The eluted fractions were examined on a 15% SDS-PAGE gel and fractions containing the P8D10 scFv were pooled and concentrated. Notably,
Creation of Humanized scFvs: In order to create a 3D structural model of the mouse scFv, VH and VL amino acid sequences of mouse mAb P8D10 were individually searched against available mouse antibody structures and sequences in the Protein Data Bank (PDB) and sequence identities to the P8D10 variable sequences were ranked. See Table 6 and Table 7 below, and
Although it is possible to model the P8D10 scFv structure by individually modeling VH and VL domains from different PDB antibodies, structural models are more accurate when both VH and VL are modeled within one PDB structure. Thus, the structure in PDB ID 1IAI was selected to make a structural model for the P8D10 mouse scFv structure (VH-VL). See
To facilitate scFv humanization, the mouse P8D10 VH and VL sequences were separately searched using BlastP (https://blast.ncbi.nlm.nih.gov/Blastcgi?PAGE=Proteins) against the non-redundant protein sequences containing human immunoglobulin (Ig) sequences. (The BlastP website has a protein database called “non-redundant protein sequences”.) The top three closest human Ig variable domain sequences were identified and aligned with the P8D10 VH and VL sequences as depicted in
As depicted in
Two different humanized P8D10 scFv antibodies were thus designed and are depicted in
The functional activities of the three scFvs created in Example 13 were evaluated in an hemagglutination inhibition (HAI) assay according to the same protocol provided above in Example 5 with the exception that the test articles here were the full length P8D10 mAb and the three P8D10 scFv. The results (MIC) are provided in
An additional assay was employed using conventional methods and materials to evaluate the reduction of mouse residues in the humanized scFvs. Briefly, full length P8D10 mouse mAb, P8D10 mouse VH-VL scFv, P8D10 humanized VH-VL scFv and P8D10 humanized VL-VH scFv were diluted in phosphate buffered saline at pH 7.4 (PBS) and coated on a 96-well microtiter plate with 100 µl of the antibodies at two different concentrations (2 µg/ml and 5 ug/ml). Each condition was repeated two times. After the plate was incubated at 37° C. for 1 hour, each well was washed three times with 250 µl of PBS. Then each well was blocked with 250 µl of PBS with 5% fetal calf serum at 37° C. for 1 hour. After washing three times with 250 µl of PBS, 0.05% Tween 20 (PBST), each well received 100 µl of goat anti-mouse IgG horseradish peroxidase-conjugated antibodies (Jackson Immuno Research #115-035-003) and incubated at 37° C. for 2 hours. After washing three times with 250 µl of PBST, each well received 100 µl of ortho-phenylenediamine substrates (Sigma) and incubated at 25° C. for 20 minutes. Optical densities (OD) were measured by a plate reader at 450 nm.
Results are depicted in
Data provided in Examples 13 and 14 herein suggest that, not only can similar humanized scFv constructs from other hybridomas disclosed herein be designed based on the example of P8D10, but also that the sequences of the two humanized P8D10 variable domains (VH and VL) disclosed herein can be grafted back onto a human Ig scaffold, and thus generate a full length humanized mAb against CfaE. Thus, in a particular prophetic embodiment,
As previously reported, data provided herein for the mAb cross-reactivity patterns determined by ELISA showed individual adhesin specific, intra-subclass specific, inter-subclass specific and class-wide cross-reactivity. Specifically, among the 28 mAbs disclosed in this study, twenty-one of them cross-reacted to other class 5 adhesins, however, functional cross-reactivity was only observed in nine mAbs. Since some mAbs may cross-react with epitopes not directly involved in hemagglutination, we expected that only a subset would show heterologous HAI activity. Indeed, among mAbs with both cross-reactivity in ELISA and homologous HAI activity, the breadth of the heterologous HAI activity of each mAb was more limited than the repertoire of cross-reactivity shown by the ELISA. One example was anti-CfaE mAbs P3B2, which was cross-reactive to all other five tested class 5 adhesins, but showed heterologous HAI activity only to CS17 and CS1-ETEC. The results suggested the hemagglutination inhibition assay was more discriminating than ELISA in distinguishing subtle differences of epitopes in the class 5 adhesins recognized by the mAbs.
In addition, we previously reported that all five adhesin domain specific anti-CfaE mAbs with epitopes including the R67 and R181 residues had strong homologous HAI activity, confirming that these two residues in CfaE are essential for hemagglutination. Two adhesin domain specific anti-CsbD mAbs P2H6 and P1F7 with epitopes in the vicinity of R67 and R181, showed strong homologous HAI responses, suggesting that the upper pole region of CsbD serves as the receptor binding site, and that this may be a universal feature for all class 5 adhesins. However, one exception was anti-CsbD P7F9 mAb since it had epitope in the upper pole including R181, but had low homologous HAI activity. One possibility is that the affinity of P7F9 may be too low to elicit any HAI activity, as the affinity of mAbs to antigens such as the hemagglutinin of influenza virus (26) and the surface protein gp120 of human immunodeficiency virus (27) has been shown to be positively correlated with their functionality. The combination of low homologous HAI activity and class-wide cross-reactivity pattern in the ELISA of P7F9 may be explained by the significant primary sequence variations downstream of the R181 in the alignment of class 5 adhesins (24). P7F9 may have to spare its homologous HAI activity for the cross-reactivity.
In addition, we previously considered the receptor binding domain resides in the adhesin domain; not only were 13 out 19 adhesin-domain specific mAbs identified with strong homologous HAI activity, but also two anti-CfaE pilin-domain specific mAbs P3B2 and P1F9 had high homologous HAI activity. This observation could possibly be explained by the dynamic binding property of CfaE modulated by the interface interaction of the two domains. We previously showed that increased shear stress could activate CfaE into the high affinity binding state to the host cells (31), and partial disruption of the interface between the adhesin and pilin domains of CfaE led the activation and significant structural shift in the pilin domain (32). The mAbs specific to the pilin domain of CfaE could bind and lock the native conformation of the pilin domain, prevent structural changes under shear stress generated by the rocking in the HAI assay, and hold CfaE in the low affinity binding state, resulting in hemagglutination inhibition.
In particular, the anti-CfaE pilin-domain specific mAb P3B2 was previously shown to have HAI activity to the homologous CFA/I strain, and heterologous CS17 and CS1 strains. This mAb could have epitopes including residues in the donor strand, which is in the pilin domain and conserved across class 5 (24). This hypothesis is supported by the observation that the P3B2 mAb was reactive to a peptide within the donor strand in the peptide ELISA assay (data not shown), and the previous study suggesting that a monoclonal antibody against the N-terminal 25 residues of CFA/I subunits, which serve as the donor strand in the pilin domain, had HAI activity to CFA/I, CS1 or CS4-ETEC, and blocked those ETEC binding to the Caco-2 cells (7).
Notwithstanding the foregoing, our results with a limited number of mAbs suggests that a multivalent ETEC prophylactic or vaccine may be most effective with more than one active component due to lack of strong cross-reactive functional epitopes within class 5 adhesins. Accordingly, it is contemplated herein that future experiments may focus on creating more effective anti-adhesin mAbs as immunoprophylactic products against ETEC infection. In a particular embodiment, it is contemplated herein that such prophetic anti-adhesin mAbs would be directed to particular immunodominant epitopes on ETEC antigens. These epitopes include R67, S86, R181 in CfaE, and T84, S88, H144, R181, Y182 in CsbD, and R69, R184 in CotD disclosed herein.
In additional future studies, assays may be performed to identify additional immunodominant epitopes with competitive ELISA and potent functional epitopes with competitive HAI assay using specific mAbs and sera from human volunteers immunized with CfaE in clinical trials, e.g., clinicaltrials.gov ID NCT01644565 and NCT01922856.
It is also contemplated herein that a combination of structural, peptide-based and site-directed mutagenesis approaches may be employed for further epitope mapping. This is based on the observations summarized below.
Anti-CfaE mAbs P5C7, P6H4, P8D10, P3B2, P1F9 and P2E11: Anti-CfaE Mabs P5C7, P6H4, P8D10, P3B2, P1F9, and P2E11 displayed strong or moderate homologous functional activity (hemagglutination inhibition). The epitope of P5C7 included CfaE residues R67, S86 and R181, and P5C7 showed heterologous functional activity to one CS17 strain. The epitope of P6H4 and P8D10 included CfaE residues R67 and R181. P3B2 is a pilin-domain specific Mab. P3B2 had cross-reactivity to all six ETEC adhesins tested, and it showed heterologous functional activity to two CS17 strains and one CS1 strain. P1F9 and P2E11 are two pilin-domain specific Mabs and had homologous functional activities. Thus, experiments may be performed to gather detailed epitope information for these six Mabs. Based on these data, possible future experiments include making CfaE mutants CfaE/S85A, CfaE/S86A, CfaE/T91A, CfaE/N127A, CFaE/S138A, CfaE/H140A and CfaE/R145A, and using the mutants in ELISA assays to reconfirm that S86 in CfaE is one of the epitope residues for anti-CfaE mAbs P10A7 and P5C7, e.g., it is a residue responsible for receptor binding in a hemagglutination assay, and to identify additional epitope residues of these six Mabs.
Anti-CsbD Mabs P7C2, P9A5, P2H6, P6G1, P2A9,P1F7, P9E11 and P7F9: The seven anti-CsbD Mabs P7C2, P9A5,P2H6, P6G1, P2A9, P1F7 and P9E11 had strong homologous functional activity, and P7C2, P9A5, P2H6, P6G1 and P2A9 had heterologous functional activity to a CS1 strain. P9E11 had cross-reactivity to five ETEC adhesins. P7F9 had cross-reactivity to six ETEC adhesins. The epitope of P2H6 included CsbD residue T84. The epitope of P1F7 included CsbD residue H144. The epitope of P7F9 included CsbD residues S88, R181 and Y182. Possible future experiments include making CsbD mutants CsbD/T84A, CsbD/L85A, CsbD/S88A, CsbD/H144A, CsbD/R181A and CsbD/Y182A and using the mutants in ELISA assays to identify additional epitope residues of these eight Mabs.
Anti-CotD Mabs P7F6, P3F4 and P6B8: All three anti-CotD Mabs P7F6, P3F4 and P6B8 had strong homologous functional activity. The epitope of P6B8 included CotD residues R69 and R184. P3F4 had heterologous functional activity to a CS17 strain. Experiments may be performed to gather detailed epitope information for these three Mabs.
Epitope mapping techniques that may be peformed in future include methodologies described in the above examples, and other conventional methods familiar to one of skill in the art, including, e.g., structural approaches such as X-ray crystallography, nuclear magnetic resonance (NMR), hydrogen-deuterium exchange coupled to mass spectrometry; peptide-based approaches (ELISA or phase display); and site-directed mutagenesis (a.k.a. alanine scanning or shotgun mutagenesis). For example, current hotspot residues in the epitope as described in Table 4 above were identified through site-directed mutagenesis. Specifically, two different possible approaches are contemplated and outlined below.
For certain anti-adhesin Mabs (such as anti-CfaE P8D10, P10A7; anti-CotD P6B8), a few key residues contributing to the antigen-antibody interactions are already disclosed herein. Crystallographic structures for dsc19CfaE (PDB ID: 2HB0; Li et al., 2007 J. Biol. Chem. 282, 23970-23980) and CsbD and CotD (unpublished data) may be used to investigate other undisclosed residues in the epitope binding to the Mabs. For example, initially, the location of the known hotspot residues on the adhesin structures may be pinpointed. See, e.g.,
Site-directed mutagenesis data provided herein did not identify hotspot residues for other anti-adhesin Mabs such as anti-CfaE P3B2; anti-CsbD P7C2, P9A5, P9E11; and anti-CotD P7F6, P3F4, due to the limited number of adhesin mutants. It is contemplated herein that future studies include constructing an overlapping peptide library for each adhesin. In a peptide ELISA assay, increased reactivity of Mabs to a peptide or a group of peptides suggests the specific peptide(s) contain residues in the epitope. These peptides may be mapped onto adhesin structures in order to define surface areas with most increased reactivity. Surface exposed residues in the specific areas then may be analyzed and evaluated as potential hotspot amino acids. Experimental verification such as making recombinant adhesin mutants, and comparing Mab reactivity to the mutants and the native adhesins, will likely confirm the qualification of the hotspot residues. The analysis of surface exposed residues and experimental verification processes may be iterated a few times until five to eight key residues in the epitope for each Mab are identified.
The present application claims the benefit of U.S. Provisional Pat. Application No. 63/004,002 filed Apr. 2, 2020, the entire disclosure of which is incorporated by reference herein.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/025254 | 3/31/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63004002 | Apr 2020 | US |
