Patent Application
20080075717
Besides the above arrangements, the invention also comprises other arrangements that will emerge from the following description, which refers to examples of use of the antigens and of the antibodies according to the present invention, and also to table I summarizing the sequences of the application, in which the sequences corresponding to the extracellular domains are indicated in bold, the sequences corresponding to the linking fragment are boxed in, and the amino acids derived from the transmembrane domains are underlined, and to the attached drawings in which:
—, 2.1:
and 1.1: —66 —;
MSDWTGGALLWNLHGQAL
LWNLHGQALLYLQQNWWT
MSDWTGGALLYLQQNWWT
MSDWTGGALLWNLHGQAL
YLQQNWWT
MSDWTGGALLWNLHGQAL
L
YLQQNWWT
ASSFTASVSTTWRIEDPPFNSL
TWRIEDPPFNSLVDAVLQLSPL
IVDAVLQLSPLILGTLNLTTM
ILGTLNLTTMGGSILQTNFKSLS
GGSILQTNFKSLSSTEFIPNLV
MSNTLLSAW
ASSFTASVSTTWRIEDPPFNSL
VDAVLQLSPL
TWRIEDPPFNSLVDAVLQLSPL
ILGTLNLTTM
VDAVLQLSPLILGTLNLT
GGSILQTNFKSLSSTEFIPNL
ILGTNLTGGSILQTNFKSLSST
VMSNTLLSAW
TWRIEDPPFNSLVDAVLQLSPL
LQQN
1) Animals
Four week-old female BALB/c mice (Iffa-Credo) are fed at will and immunized at the age of 7 to 10 weeks.
2) Antigens
Peptides derived from the extracellular domains of LMP1 and LMP2A were solid-phased synthesized manually, according to the method originally described by Merrifield et al. (J. Am. Chem. Soc., 1964, 85: 2149-) (1964)), using the Fmoc/tert-Butyl chemistry strategy on a 0.1 mmol scale. The various protected amino acids (Fmoc-L-aa; Novabiochem) are sequentially attached to Rink amide resin (Applied Biosystem) after activation for 3 min with HATU (O-(7-azabenzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate), according to the method of Miranda and Alewood (P.N.A.S., 1999, 96: 1881-1186) in the presence of a 5-fold excess of DIEA (diisopropylethylamine). In situ neutralization during the coupling gives better degrees of acylation and in a minimum amount of time. The coupling efficiency is controlled by means of a TNBS (trinitrobenzenesulfonic acid) test. If the test is positive, a second coupling is carried out, followed by an acetylation for 5 min with a 3:0.3:96.7 mixture of Ac2-DIEA-CH2Cl2, and then by 3 washes for one minute with CH2Cl2 (chloroform) and then with NMP (N-methylpyrrolidone). The Fmoc protective groups are cleaved before each coupling, with a solution of NMP containing 20% piperidine. At the end of synthesis, the resin is washed with diethyl ether and dried. The peptide is cleaved from the resin and deprotected using a TFA (trifluoroacetic acid)-H20-EDT-Pr3SiH mixture (92.5:2.5:2.5:2.5; 15 ml) for 2 hours at ambient temperature, precipitated from cold diethyl ether, centrifuged, washed in cold diethyl ether, recentrifuged, dissolved in water and, finally, lyophilized to give a crude peptide extract. The crude peptide is purified by HPLC on a semi-preparative reverse-phase column (C18 column). The purity of the peptides is always greater than 95% and their identity is confirmed by mass spectrometry (positive MALDI-TOF-MS) and analytical HPLC. The peptide sequences synthesized (SEQ ID Nos 10 to 16) corresponding to the domains of LMP1 (Swiss Protein Databank number P03230) and LMP2A (Swiss Protein Database number P13285) are given in table I in the one-letter-code form.
3) Immunization
a) Peptides Coupled to a Carrier Protein (KLH)
The LMP1-derived peptides containing only one exogenous cystein (SEQ ID Nos 10, 11, 12, 15, 16) were individually coupled to activated KLH (Imject maleimide-activated KLH®, Perbio) according to the supplier's protocol. Mice (4 animals per group) were injected subcutaneously in the flank, with an emulsion of peptide (50 μg in 0.1 ml H20) and of complete Freund's adjuvant (0.1 ml). On days 21, 42 and 62 following the first injection (D0), the animals are given a boost injection, by the same route, with the same amount of antigen but in incomplete Freund's adjuvant. Blood is taken by retro-orbital puncture before each injection, so as to determine the titer of serum antibodies specific for LMP1 and for LMP2A, by ELISA.
b) Peptides Coupled to a Lipid
The LMP1-derived peptides (SEQ ID Nos 10, 11, 13 and 14were individually coupled to one or more molecules of cholesterol or of palmitic acid, by means of a thioether (cholesterol) or thioester (palmitic acid) bond or bonds with the thiol function of their cysteine residue(s). The coupling of the peptide (5 mg/ml) via a thioether bond to activated cholesterol (bromoacetyl-cholesterol) is spontaneous in a medium of dimethylformamide (DMF)/phosphate buffer, pH 7.5 (95:5). The progression of the reaction is followed by acidification of the reaction medium and an analytical HPLC. The lipopeptide is purified by gel filtration in a 20% acetic acid medium. The palmitic acid is incorporated into the peptide chain by means of a thioester bond, during the peptide synthesis. The lipopeptide organizes itself spontaneously into vesicles (
4) ELISA
Blood samples are taken, by retro-orbital puncture, from the immunized mice, and the sera are then recovered and frozen at −20° C. in 20-μl fractions. The wells of a microtitration plate (Maxisorp®, Nunc) are coated with 100 μl of peptide (1 mg/ml) overnight at +4° C. Plates coated with non-relevant peptides of the same molecular mass are used as a control. The wells are then washed with PBS buffer containing 0.5% of Tween 20 (PBS-T) and then blocked 1 h in the presence of PBS buffer containing 2% of powdered skimmed milk (PBS-SM). After washes in the same buffer as above, 100 μl of serum diluted in PBS-T-SM buffer (PBS, 0.05% Tween 20, 2% powdered skimmed milk) are added to the wells and the plates are incubated for 2 hours at 37° C. After four washes with PBS-T buffer, 100 μl of goat anti-mouse total immunoglobulins or anti-mouse IgG1, -mouse G2a, -mouse G2b and -mouse G3, secondary antibody, conjugated to peroxydase (BIORAD), diluted to 1/10 000 in PBS-T buffer, are added to each well and the plates are incubated for 1 h at 37° C. After thorough washing with PBS-T buffer, 100 μl of substrate (OPD: o-phenylenediamine dihydrochloride, Sigma) diluted in 0.05 M citrate buffer, pH 5.5, containing H202, are added to each well and the plates are incubated for 30 min at ambient temperature, in the dark. The reaction is stopped by adding 4N sulfuric acid, and the absorption at 492 nm is measured using an automatic microplate reader (Dynatech).
5) Competition Assay
The antigen-antibody binding specificity is measured by means of a competition assay, according to the method described by Friguet et al., (J. Immunol. Methods, 1985, 77: 309-309). The principle of the method is as follows: the affinity constants are determined by linear regression from the curves of displacement of the binding of the antibody to the antigen in solid phase (at constant concentration) by varying concentrations of the same antigen in the liquid phase. The first step consists of absorption of the antibody by the antigen or by a non-relevant peptide, in solution, and the second step consists in assaying, by an indirect ELISA assay, free antibodies when the antigen and the antibody are in equilibrium.
More specifically:
step 1: various concentrations of the peptide antigen or of a non-relevant peptide (10−11 to 10−5 M) are incubated with a fixed concentration of antibodies (serum diluted to 1/50), in PBS-T-SM buffer (PBS, 2% powdered skimmed milk, 0.05% Tween 20), for 18 h at 4° C.;
step 2: 100 μl of the product of the reaction obtained in step 1 are sampled and added to the wells of a microtitration plate coated beforehand with the peptide antigen (100 μg/well in NaHCO3 buffer, pH 9.6) and the plate is incubated for 1 h at 20° C. After washes with PBS-T buffer (PBS, 0.05% Tween 20), the immunoglobulins bound to the peptide antigen are detected using a goat anti-mouse total immunoglobulins secondary antibody coupled to peroxydase. The visualization of the reaction and the reading of the plates are carried out as for the ELISA assay.
6) Cell Culture
The human kidney embryonic cell line HEK-293 (ATCC CRL 1573) and the line transfected with the plasmid pSV-HA-LMP1, derived from the HEK-293 line, are cultured in 24-well plates in Dulbecco medium (GIBCO) supplemented with fetal calf serum (10%), glutamine (2 mM), nonessential amino acids (1%), sodium pyruvate (1 mM) and gentamycin (50 μg/ml). The plasmid pSV-HA-LMP1 derives from the plasmid pSV5 (STRATAGENE) through the cloning, under the control of the SV40 virus promoter, of an insert corresponding to the cDNA of LMP1 from the wild-type EBV strain B95.8. The other cells are cultured in RPMI medium supplemented as above. The EBV-infected marmoset B lymphocyte line B95.8 is used for the production of viral particles. The EBV-transformed B lymphocytes (B-EBVneo) and the LCLs (type III-latency EBV+ lymphoblastoidal cell lines) derived from human PMBCs by infection with a culture surnagent of the B95.8 line are obtained as described in Current Protocols in Immunology, 1991, Colingan J E, Kruisbeek A M, Margulies D H, Schevach E M, Strober W, Greene. The peripheral blood mononuclear cells (PBMCs) are purified by centrifugation of a blood sample on a Ficoll gradient. The human T lymphocytes Jurkat line and the EBV-negative Burkitt's lymphoma DG75 line are also used as controls.
7) Immunocytochemistry
The experiments are carried out on coverslips (cells in suspension) or in 24-well plates (adherent cells) using conventional immunocytochemistry techniques, employing a standard ABC protocol. More specifically, the adherence cells cultured in plates and the nonadherence cells cultured in suspension are washed with PBS, and then, only in the case of the cells in suspension, deposited onto a coverslip (100 μl at 106 cells/ml). The cells are then fixed (plates or coverslips) under nondenaturing conditions: incubation for 30 min in PBS buffer containing 4% formaldehyde, and then three washes for 1 min with PBS and, finally, blocking with 4% H202. In parallel, the cells are fixed under denaturing conditions: incubation for 30 min in PBS buffer containing 4% formaldehyde, and then denaturation by dehydration with increasing concentrations of ethanol (50°, 70°, 90°and 100°) and, finally, blocking with 4% H202.
The incubations with the primary and secondary antibodies are carried out either in PBS buffer containing 5% of powdered skimmed milk (cells fixed under nondenaturing conditions), with neither detergent nor any organic compound capable of inhibiting the binding of the antibody, or in PBS buffer containing 0.5% of Tween 20 or 0.05% of saponin (cells fixed under denaturing conditions). More specifically, the cells are first incubated for 45 min at ambient temperature, in the presence of a mouse immune serum specific for LMP1, prepared as described in example 1 and in example 2 (dilution to 1/1000th) and of a normal rabbit serum (dilution to 1/300th). The mouse antibodies are then labeled with a biotinylated rabbit antibody (SIGMA), according to the supplier's recommendations. After three washes with PBS, the biotine attached is detected using a peroxydase-coupled ABC enzymatic system (Axtravidin, SIGMA) and the reaction is then visualized with diaminobenzidine (SIGMA).
8) Analysis of proliferation and of the cell cycle An EBV-infected lymphoblastoidal cell culture (LCLs, 106 cells/ml) is distributed into a 6-well plate (106 cells/well) and the cells are then incubated for 4 days in RPMI medium containing non-decomplemented normal rabbit serum (dilution to 1/60th). Alternatively, the cells are incubated for 4 days with non-decomplemented normal rabbit serum at the same concentration and increasing concentrations of anti-LMP1 mouse immune serum (dilutions to 1/600th, 1/300th and 1/200th) prepared as described in examples 1.3 and 2.
The cell proliferation is analyzed by direct observation of the cultures (number of cells and cell morphology) under an optical microscope.
For the cell cycle analysis, 1 ml of cells are removed at D4, rinsed in PBS, fixed in PBS buffer containing 4% formaldehyde for 30 min at 4° C., washed twice in cold PBS buffer, and then centrifuged. The cell ??? obtained is resuspensed in 1 ml of PBS buffer containing 200 μg of propidium iodide and 100 μg of RNase A (/ml), and then incubated for 30 min at 37° C. The reactions are kept at 4° C. overnight and the DNA content of the cells is then analyzed by fluorometry (EPICS-XL cytometer, Coulter) so as to determine the percentage of cells in G0/G1 (2n), S (>2n and <4n) and G2/M (4n) phase, and undergoing apoptosis (<2n).
9) Immunoprecipitation
106 HEK-293 cells are transfected with the plasmid pSV-HA-LMP1 or with the control plasmid pSV5, using polyethyleneimine, under the conditions recommended by the supplier. 48 hours after transfection, the cells are rinsed twice with PBS buffer, and lysed for 15 min on ice, in 500 μl of PY buffer (20 mM Tris HCl, pH 7.4, 50 mM NaCl, 5 mM EDTA and 1% Triton X-100) supplemented with protease inhibitors (1 mM leupeptin, 1 mM sodium orthovanadate and 5 IU/μl of aprotinin), and the lysate is then, finally, clarified by centrifugation at 14 000 rpm. The lysate thus obtained is incubated for one hour at +4° C. with gentle agitation, with a murin monoclonal antibody that recognizes an intracellular region of LMP1 (CS1-4, Novocastra) or with 5 μl of anti-LMP1 mouse immune serum prepared as described in examples 1.3 and 2. 100 μl of a solution of protein A-sepharose (Amersham-Pharmacia) are then added and the mixture is gently agitated on a turntable, for one hour at +4° C. The sepharose beads are then washed four times with PY buffer, eluted with 30 μl of Laemmli buffer and then subjected to polyacrylamide gel electrophoresis in the presence of SDS (SDS-PAGE).
After the electrophoretic separation, the proteins present in the gel are then transferred onto membranes (Immobilon-P, Millipore) by electro-blotting. The membranes are saturated for 1 and a half hours with a solution of casein (0.2%) in PBS buffer-0.1% Tween 20, and are then incubated for one hour with the CS1-4 murin antibody. After successive washes, the membranes are incubated for 15 minutes with peroxydase-conjugated anti-mouse IgG immunoglobulins (Jackson Immunoresearch) and the LMP1 protein immunoprecipitated is visualized using the ECL kit (Amersham).
Antibodies directed against the extracellular domains of the EBV LMP1 protein were prepared by immunization of mice with the peptides SEQ ID Nos 10 and 11 coupled to KLH, or else with the peptide SEQ ID No. 13 coupled to cholesterol, as described in example 1. The kinetics of appearance of the serum antibodies directed against the extracellular domains of the LMP1 protein were analyzed by ELISA, as described in example 1.
The results illustrated in
MSDWTGGALLWNLHGQAL
LWNLHGQALLYLQQNWWT
MSDWTGGALLYLQQNWWT
MSDWTGGALLWNLHGQA
L
YLQQNWWT
LWNLHGQAL
LYLQQNWWT
The specificity and the affinity of the antibodies produced as described in examples 1 and 2 are measured using the competition assay, as described in example 1.
The results obtained with the antibodies directed against the antigen representing the concatenation of the extracellular domains ED1 and ED2, separated by a cysteine residue (antigen (ED1+ED2), SEQ ID NO. 10), are illustrated respectively in
The absence of competition with the peptide (ED1+ED3) demonstrates:
firstly, that the antibodies recognize the antigen (ED1+ED2) specifically (
secondly, since these antibodies, that are polyclonal in nature (immune serum), show no reactivity with the peptide ED1+ED3, which has the ED1 sequence in common with the antigen (ED1+ED2), these results also indicate that the antibodies are conformational antibodies, given that they specifically recognize a noncontiguous epitope corresponding to the extracellular domain 1 combined with the extracellular domain 2, which domains are far apart in the primary sequence of the proteins since they are separated by a transmembrane domain and an intracellular domain, but are close when the LMP1 protein is folded in its native form.
The affinity constants determined by linear regression from the curve of
The reactivity of the mouse immune sera prepared as described in examples 1.3 and 2, with respect to the native or denatured LMP1 antigen, is tested by immunocytochemistry, as described in example 1.7. Alternatively, the reactivity of the sera is tested by Western blotting (denaturing conditions), according to standard protocols known in themselves or by immunoprecipitation (native conditions), as described in example 1.9.
The results illustrated in
The cytotoxicity of the antibodies is tested on B lymphoblastoidal lines having suffered latent infection with EBV (B-LCLs), incubated with complement, alone (control) or in the presence of anti-LMP1 mouse immune serum, as described in example 1.8.
The results show that the anti-LMP1 immune sera have ADCC-type cytotoxicity, with respect to the cells having suffered latent infection with EBV:
direct observation of the B-LCLs shows that, at 24 h, 50% of the cells incubated in the presence of complement and of the lowest dilution of immune serum were lysed; at later times, lysis of all the cells is observed;
the cell cycle analysis (
Antibodies directed against the extracellular domains of the LMP2A proteins were prepared by immunization of batches of 4 BALB/c mice or of batches of 3 LOU/M rats with the peptides SEQ ID Nos 15, 16 and 17 coupled to activated KLH as described in example 1. The response in terms of antibodies directed against the extracellular domains of the LMP2A protein was analyzed by ELISA, as described in example 1.
The results given in table III show that the antigens according to the invention exhibit a high immunogenic potency (symbolized by + signs), comparable to that of the antigens derived from the extracellular loops of LMP1 (example 2). The best humoral response was developed against the peptide SEQ ID No. 16 (table III). The peptides SEQ ID Nos 18 and 19 were not synthesized.
PNL
SAW
The specificity and the affinity of the anti-LMP2A antibodies produced as described in example 6 were measured using the competition assay described in example 1.
The mean affinity of the antibodies produced in BALB/c mice and LOU/M rats immunized with the peptide SEQ ID No. 16 is illustrated in
The anti-LMP2 rat immune sera will be used in the studies of in vivo serotherapy of EBV-positive human tumors induced in SCID mice.
1) Materials and Methods
a) Construction and Production of an Expression Vector for LMP2A (pREP4-LMP2)
The LMP2A cDNA was amplified by RT-PCR from mRNA extracted from EBV-positive lymphoblastic cells (LCLs). The pair of primers used for the PCR (SEQ ID No. 27: 5‘AGAATTCATGGGGTCCCTAGAA3’ and SEQ ID No. 28: 5‘AGGTACCTTATAGAGTGTTGCGA3’) contain, in bold, the EcoR1 and KpnI restriction sites for insertion into the TOPO plasmid, and, underlined, the sequences complementary to the LMP2A (strain B95.8) cDNA.
Competent JM 109 bacteria (Invitrogen) were transformed, by thermal shock, with the plasmid TOPO-LMP2A, and were then amplified for one hour at 37° C. and selected overnight at 37° C. on Luria Broth Base agar medium (LB, Invitrogen) supplemented with ampicillin (Appligene) and with X-Gal (Eurogentec). Positive clones possessing the LMP2 cDNA insert (1 500 bp) were isolated by enzymatic digestion and agarose gel electrophoresis of plasmid DNA minipreparations. These positive clones were then amplified overnight at 37° C. in 30 ml of liquid LB supplemented with ampicillin, overnight at 37° C., and the plasmid TOPO-LMP2 was then extracted using the Nucleobond AX kit, according to the supplier's protocol (Machery Nagel). The plasmid DNA thus obtained was quantified by specrophotometry at 260 nm and verified by enzymatic digestion and 1.5% agarose gel electrophoresis in the presence of ethidium bromide.
The plasmid TOPO-LMP2 (20 μg) was digested with HindIII and NotI (Roche Diagnostic) and the LMP2A insert (1 500 pb) was then isolated by agarose gel electrophoresis and purified using the Nucleospin Extract kit (Machery Nagel). 45 ng of insert were added to 100 ng of pREP4 linearized by digestion with HindIII and NotI, and the mixture was then ligated with 2 IU of T4 phage ligase (Promega) overnight at 4° C. Competent bacteria were then transformed with the ligation product. Positive clones (pREP4-LMP2A) were isolated and amplified as above for the plasmid TOPO-LMP2A.
b) Stable Transfection of Cell Lines with the Expression Vector pREP4-LMP2A
The reactivity of the anti-LMP2A antibodies produced, with respect to the native LMP2A protein, was tested using a cell line stably transfected with the plasmid pREP4-LMP2A, obtained in the following way:
HEK 293 cells were seeded into 6-well plates, in 2 ml of DMEM medium supplemented with 10% FCS (DMEM-10% FCS) and then cultured until a cell culture in the exponential phase was obtained. The cells were then rinsed and incubated in 1 ml of Optimem (GIBCO), to which a mixture of plasmid pREP4 or pREP4-LMP2A (1 to 2 ug of total DNA) and of PEI (polyethyleneimine, 4 μl/ug of DNA, Euromedex) was added as transfecting agent. After incubation for 5 hours, the transfection medium was replaced with 2 ml of DMEM-10% FCS medium. Cells stably expressing LMP2A were selected by culturing in the presence of 100 μg/ml of hygromycin for 4 to 5 weeks.
The expression vector used (pREP4) can persist stably in episomal form in the transfected cells, by virtue of its Ori P origin of replication. It replicates synchronously with division and is therefore, theoretically, entirely transmitted to all the daughter cells. A new cell line expressing LMP2A (HEK-LMP2A) is obtained, which can be compared with the HEK line of origin in immunocytochemistry assays.
c) Anti-LMP2 Immunocytochemistry on HEK and HEK-LMP2A Cells
The HEK 293 or HEK-LMP2 cells are suspended (100 000 ml) by digestion with a trypsin solution for 15 min at 37° C., and then washing in PBS buffer. The cells are deposited onto a histological slide, completely dried, and then rehydrated and fixed under nondenaturing conditions: incubation in PBS buffer containing 4% paraformaldehyde, for 20 min at ambient temperature. After washing with PBS, the cells are treated with 3% aqueous hydrogen peroxide for 10 min and saturated with blocking buffer (PBS-5% powdered skimmed milk). The cells are then incubated with the anti-LMP2 rat immune serum prepared as described in example 6 ( 1/500) saturated with normal goat serum ( 1/50). The rat IgGs are detected using the Extra5 detection-amplification kit (Sigma) and the presence of exogenous peroxydase is visualized by means of diaminobenzidine for 5 to 10 min, depending on the intensity of the coloration.
2) Results
The antitumor serotherapy experiments using the anti-LMP2A antibodies were carried out in a human tumor model in SCID (Severe Combined Immunodeficiency) mice. The antitumor immunization experiments were carried out in BALB/c mice, with peptide antigens and transfected murin tumor cells.
1) Serotherapy
a) Induction of Tumors Expressing LMP1 and LMP2A in SCID Mice
EBV+ human cell lines of monocyte origin (E1) and T lymphocyte origin (NC5), that develop a latency II EBV phenotype (Masy E, et al., J. Virol., 2002, 76: 6460-72;
The cells (E1 or NC5) gave palpable tumors from the beginning of the second week following injection in most of the mice, which had to be sacrificed before the end of the third week of the experiment.
Of the two cell types tested, the NC5 cells are the most aggressive (table IV). Some SCID mice did not exhibit any tumors more than 45 days after the injection, which justifies a certain survival percentage in table IV.
b) Verification of the Expression of LMP1 and LMP2A at the Surface of the E1 and NC5 Cells
The presence of LMP1 and LMP2A at the surface of the E1 and NC5 cells was controlled by immunocytochemistry, using anti-LMP2A rat immune serum, anti-LMP1 mouse immune serum and normal serum (NRas), according to the protocols described in examples 1.7 and 8.
The intensity of the LMP1 labeling is much greater than that for LMP2A on the two cell types (
c) Anti-LMP2 Antitumor Serotherapy
The studies of serotherapy for tumors induced in SCID mice were carried out on E1 cells with the rat anti-LMP2A antibodies having an affinity of 7×10−11 M−1, described in examples 6 and 7 and in
Four groups of 10 SCID mice were given an interscapular subcutaneous injection of 3 million E1 cells in a volume of 100 μl of 0.9% NaCl, on the same day, from the same preparation of E1 cells. On D+2 and D+5 after injection, the three groups of 10 mice were given two intraperitoneal (i.p.) injections of 40 μl of rat anti-LMP2 antibodies diluted in 100 μl of 0.9% NaCl, while the control group was given 100 μl of normal rat serum.
The survival curve for the SCID mice injected with 3 million E1 cells, and then treated with anti-LMP2A serum or a normal serum, is given in
These results demonstrate that the anti-LMP2 extracellular loop antibodies are capable of preventing the appearance and the development of human tumors induced by E1 cells in SCID mice.
2) Preventive Anticancer Immunization
These experiments comprise: (i) immunization of BALB/c mice (immunocompetent) with the LMP1 antigen so as to obtain conformational antibodies against LMP1 extracellular loops, and (ii) inoculation of the tumorigenic cells of murin origin.
a) Production of a Tumorigenic Line Expressing LMP1
Firstly, a tumorigenic murin line stably expressing LMP1 was constructed in a manner similar to the line expressing LMP2A described in example 8.
Construction of the Plasmid pREP4-LMP1
The LMP1 cDNA was isolated by digestion of the plasmid pSVHA-LMP1 using the HindIII and NotI restriction enzymes, and then cloned into the same sites in the plasmid pREP4, as described in example 8.
Production of a Stable Line Expressing LMP1
The Sp2o cell line, which has a BALB/c genetic background, makes it possible to obtain tumors in BALB/c mice. A stable line expressing LMP1 was selected from semi-adherent Sp2o cells transfected with the recombinant vector pREP4-LMP1, and then the expression of LMP1 in the transfected line was analyzed, as described in example 8. After four weeks of growth in the selected medium, all the cells are evenly labeled with the antibody against LMP1 extracellular loops (
b) Preventive Immunization
Forty one BALB/c mice (7 weeks old) are immunized according to a standard protocol described above in example 1. The mice are given an injection, either of KLH (n=21), or of the peptide that mimics the LMP1 extracellular loops (SEQ ID NO. 10) coupled to KLH (n=20). Five days before the injection of Sp2o-pREP-4-LMP1 cells, the mice of each batch are given a booster injection, respectively with KLH or KLH coupled to the peptide SEQ ID No. 10.
The mice of the control group (KLH: n=21) are given an interscapular subcutaneous injection of 1 million Sp2o-pREP4-LMP1 cells. The mice immunized against the peptide that mimics the LMP1 extracellular loops are separated into two batches of 10 mice, and each is given, on the same day and from the same preparation of Sp2o-pREP4-LMP1 cells, an interscapular subcutaneous injection of 1 or 3 million cells in a volume of 100 μl of 0.9% NaCl.
On the other hand, none of the mice given 1 million Sp2o-pREP4-LMP1 cells (KLH-LMP1 (1 M),
In conclusion, all these results show that it is possible to obtain a very good humoral response against type III membrane proteins of parasitic, viral or bacterial origins as defined in
As emerges from the above, the invention is in no way limited to its methods of implementation, execution and application which have just been described more explicitly; on the contrary, it encompasses all the variants thereof which may occur to those skilled in the art, without departing from the context or the scope of the present invention.
| Number | Date | Country | Kind |
|---|---|---|---|
| 03/00943 | Jan 2003 | FR | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/FR04/00190 | 1/28/2004 | WO | 00 | 8/9/2006 |
