Patent Application
20100092521
1. Field of Invention
The disclosure relates generally to the fields of immunology and fish production.
2. Related Art
Infectious pancreatic necrosis virus is the causative agent of infectious pancreatic necrosis disease (IPN) that infects salmonids and remains a serious problem in the aquaculture industry (1). IPN is especially contagious and destructive to juvenile trout and salmon. Highly virulent strains may cause greater than 70% mortality in hatchery stocks over a period of two months (21). This disease is especially destructive in salmonid eggs and fingerlings (25). Survivors of infection can remain lifelong asymptomatic carriers and serve as reservoirs of infection, shedding virus in their feces and reproductive products. Losses due to IPNV on salmon smoltification have been estimated at 5% (16). Economic losses due to IPNV in aquaculture were estimated to he over 560 million in 1996 (4), (17). This has been reduced as vaccines for salmonids became available based on killed virus or recombinantly produced viral peptides (13, 17). However, these vaccines are not completely effective and can only be used in fairly large fish due to the reliance on injection for vaccination.
IPNV is a double-stranded RNA virus of the Birnaviridae family (5) and is the type species of the Aquabirnavirus genus (6). Birnaviruses have a non-enveloped, single-shelled particle structure comprised of a single protein capsid layer with T=13 icosahedral symmetry (2). All birnavirus genomes have two dsRNA segments. The IPNV genome's two dsRNA segments are designated segments A and B. Segment B (2777 nucleotides) encodes a minor internal polypeptide VP1 (94 kDa), which is the virion- associated RNA-dependent RNA polymerase (RdRp) (7), (11). Segment A (3097 nucleotides) encodes a 106-kDa precursor polyprotein composed of pVP2-VP4-VP3, in that order, and a 15-kDa non-structural VP5 protein, found only in infected cells (14). VP2 and VP3 are the major capsid proteins, but VP2 is the major host-protective antigen of IPNV (9), (12).
There are commercial multivalent vaccines based on inactivated whole virus available as well as those produced with another approach, expressing VP2-derived conserved antigenic epitopes in bacteria for production of a subunit vaccine. In the laboratory, these current vaccines provide impressive protection against bath challenge with IPNV, but the behavior in the field is not predicted by the laboratory studies. This could be due to the lack of a well-defined challenge system with mortality as its endpoint. Results based on viral clearance exist but may not be as rigorous as a standardized challenge model (1). Another possible explanation could be that the salmon smolts or larger trout being vaccinated are already infected with the virus, as each year between 30-40% of the salmon hatcheries experience an outbreak of IPN (3) and IPN is endemic in many trout rearing areas. The need for better field efficacy could be achieved with improved vaccines that could be economically delivered to young salmonids such that subsequent vaccinations would boost existing immunity instead of trying to combat an existing acute or chronic infection.
The disclosure relates to production and care of fish, including immunization of fish against viral pathogens.
Here, we report cloning of the IPNV-VP2 gene into a yeast expression vector, pESC-ura. Expression of the VP2 protein resulted in formation of approximately 20 nanometer sub-viral particles (SVPs) in yeast, as detected by electron microscopy. Purified recombinant VP2 SVPs (rVP2-SVPs) were used to vaccinate fish by both injection and oral routes and their antigenicity in rainbow trout evaluated by immunoassay. An IPNV challenge trial was also carried out and the effect of vaccination on viral load evaluated.
An ideal vaccine for IPNV must induce long lasting protection at an early age, prevent carrier formation, and be effective against a large number IPNV serotypes. Injection cannot be used for small fish, therefore either oral delivery or immersion are more preferred routes for early vaccination. These attributes of an ideal IPNV vaccine must be met either by a recombinant subunit vaccine or by an inactivated viral vaccine, as a live attenuated vaccine could potentially lead to carrier formation. The yeast expression system has potential value for oral vaccine development, since yeast is already a component of feeds and is generally regarded as safe. This contrasts with bacterial expression in Escherichia coli, which generates pyrogens that would need to be removed before use of any crude preparation as an oral vaccine (22). The use of yeast is also attractive because production is economical and, through well-developed genetic systems, can he engineered to provide an abundant supply of the protein or proteins of interest. In fact, Pitcovski et al. (19) reported the development and large-scale use of yeast- derived recombinant VP2 vaccine for the prevention of infectious bursal disease (caused by another birnavirus) of chickens.
Materials and Methods
Cloning of the VP2 and VP3 Genes of IPNV
The West Buxton (WB) strain of IPNV, obtained from American Type Culture Collection (ATCC VR-877), was used for this study. This virulent strain of IPNV is prevalent in Maine and Canada, where the major North American salmon aquaculture industry exists. The WB strain of IPNV was purified as previously described (26). The virus was propagated in Chinook salmon embryo (CHSE-214) cell cultures (ATCC CRL-1681), maintained at 15 degrees Celsius in Eagle's minimal essential medium (EMEM) and supplemented with 10% fetal bovine serum (FBS), 100 units per milliliter penicillin, 100 micrograms per milliliter streptomycin and 1 microgram per milliliter fungizone. Total viral RNA was isolated from purified virus by digesting with proteinase K (200 micrograms per milliliter final concentration) followed by phenol: chloroform extraction (23). The IPNV-VP2 and VP3 genes were amplified by reverse transcription-polymerase chain reaction (RT-PCR) and cloned into the pCR2.1 vector (Invitrogen, Carlsbad, Calif.) following previously published protocols (24). The primer pair used for VP2 cloning was WBABglF (5′-GAGATCTATGAACACAACAAAGGCAACCGC-3′; SEQ ID NO: 1), containing a 5′ Bg/II site, and WBAVP2R (5-AAGCTTAAGCCCATGTGTCCATGAC-3′; SEQ ID NO: 2), containing a 5′ HindIII site. The primer pair used to clone the VP3 gene was WBAVP3F (5′-GGATCCATGTCAGGGATGGACGAAGAACTG-3; SEQ ID NO: 3) and FA3′NCHindR (51-ATAAGCTTGGGGGCCCCCTGGGGGGCC-3′; SEQ ID NO: 4) with BamBI or HindIII sites at the 5′ ends respectively. The integrity of the clones was verified by sequencing the plasmid DNA in both directions using an automated DNA sequencer (Applied Biosystems).
To make a yeast expression vector containing the VP2 gene, the VP2-containing plasmid was double digested with Bg/II and HindIII. The VP2 fragment was gel purified, blunt-ended with Klenow enzyme, and inserted between the unique EcoRI and Bg/II sites of pESC-ura, which had been blunt-ended with Klenow, behind the GAL10 promoter (
Expression of VP2 in Yeast
Yeast (Saccharomyces cerivisiae strain YH501; Stratagene, La Jolla, Calif.) were transformed using the EZ Yeast Transformation Kit (Zymed, Sari Francisco, Calif.): Mutant colonies were selected for growth on autotrophic SG-ura medium containing galactose, yeast extract without amino acids, and amino acid dropout mixture (all amino acids plus adenine, no uracil). Mutants were grown at 30° C. for 4 days, collected by centrifugation, then crude protein extracts prepared using Y-PER yeast breaking buffer (Pierce Biotechnology, Rockford, Ill.). Lysates were electrophoresed on 12% SDS-polyacrylamide gels (BioRad, Richmond, Calif.) and transferred to nitrocellulose by electroblotting. The blots were probed with sheep-anti-IPNV polyclonal antibody (Microtek International, Inc, Saanichton, B.C., Canada) and detected with rabbit-anti-sheep polyclonal antibody conjugated to HRP (Bethyl Laboratories, Montgomery, Tex.). Detection was obtained using the colorimetric substrate tetramethyl benzidine (TMB) in a one step solution as described by the manufacturer (Pierce, Rockford, Ill.).
Isolation of rVP2-SVPs and Transmission Electron Microscopy
SVPs were isolated from yeast cultures expressing recombinant VP2 according to a modified protoplasting protocol (18) to remove the yeast cell wall. The cells were lysed by three freeze thaw cycles then sonicated for five 60-second cycles with 20-second intervals. Lipids were removed by performing two successive Freon extractions. SVPs were then purified by passing them through a 26% sucrose cushion at 82,705×g (average) for 4 hours at 4° C. in a swinging bucket rotor (Beckman SW28), followed by CsCl-gradient centrifugation overnight at 115,584×g (average) at 4° C. in a swinging bucket rotor (Beckman SW41). The buoyant density of IPNV is 1.33 grams per cubic centimeter. Bands were withdrawn with a syringe and dialyzed overnight at 4° C. in TN buffer (50 millimolar Tris and 100 millimolar NaCl, pH 8.0) to remove CsCl. SVP's were prepared for negative staining transmission electron microscopy according to the previously published protocols (8). This method of producing SVPs is exemplary; other methods can he used to produce SVPs.
Immunization and Sampling of Rainbow Trout
Rainbow trout (Oncorhynchus mykiss; approximately 25 grams) originating from the Clear Springs Food, Inc. (Buhl, Id.) and known to be free of IPNV were used for the immunization experiment. The vaccination and animal work was done at Clear Springs Foods, Inc. while the analytical work was performed at Advanced BioNutrition, Inc. The fish were anesthetized and injected intraperitoneally (EP) with 100 microliters of vaccine (50 microliters of purified rVP2-SVPs containing 100 micrograms antigen and 50 microliters of Freund's Complete Adjuvant). There were three groups of fish: naive fish (n=9), fish injected with adjuvants only (sham-injected treatment; Freund's Complete Adjuvant, Sigma, St. Louis, Mo.; n=8), and a treatment group that was injected with IPNV rVP2-SVPs plus Freud's adjuvant (n=12). Vaccinations were done at days 1 and 32.
For oral vaccination, recombinant yeast expressing rVP2-SVPs (without prior purification) was mixed with feed. Yeast were ground in liquid nitrogen then incorporated into a fish feed (Clear Spring Foods, Inc., proprietary blend) that was first powdered using a coffee mill then supplemented with 10% wheat gluten as binder. Feed blends were mixed by hand with moisture added as required until a pliable dough was produced. This was then fed through a press to produce ribbons of feed that were chopped to approximately 0.5 cm in length. These were allowed to air dry at room temperature for several hours then spray coated with canola oil and frozen until use. The treatments for the oral vaccination include fish that were fed diet containing yeast expressing rVP2-SVPs (n=13) or diet containing non-recombinant yeast (control, n=10). At clay 60, blood was withdrawn from caudal vessels of control and vaccinated fish and allowed to clot overnight at 4 degrees Celsius. Blood samples were centrifuged in a tabletop centrifuge at 12,568×g (average) for 5 minutes, then serum was collected and stored at −75 degrees Celsius until analyzed.
Enzyme-Linked Immunosorbent Assay (ELISA)
Immuno Breakapart microplates (Nunc, Rochester, N.Y.) were coated with purified IPNV rVP2-SVPs at 150 micrograms per milliliter in a 50 millimolar carbonate coating buffer (pH 9.6) at 4° C. for 16 hours. Plates were washed 3 times in TBST (IX Iris Buffered Saline (TBS)+0.05% Tween 20) for 5 minutes each wash. The plates were blocked with Ix TBS containing 3% BSA at room temperature. Test sera were diluted 1:32 and 1:64 then 150 microliters was added per well and the plates were incubated for 1 hour at room temperature. Following incubation with test sera, the microplates were washed again 3 times with TBST for 5 minutes per wash. The secondary antibody (rabbit anti-rainbow trout IgG; Jackson ImmunoResearch Laboratories Inc, West Grove. Pa.) was diluted 1:1000 and added to all wells (150 microliters/well). The plates were incubated for 1 hour at room temperature and then washed 3 times in TBST, 5 minutes each wash. Horseradish peroxidase-conjugated goat anti-rabbit IgG (Biosource, Camarillo, Calif.) was added at a 1:1.000 dilution and detected by addition of the colorimetric substrate tetramethyl benzidine (TMB, Pierce, Rockford, Ill.). The absorbance was read at 450 nanometers using a SPECTRAFLUOR® Plus fluorescent plate reader (Tecan, Salzburg, Austria). Negative controls consisted of wells that were coated as above, but a 3% BSA solution was added instead of the fish serum at the capture step.
IPNV Challenge and Sample Collection
Three days after collecting the blood samples (i.e., at 63 days post-vaccination), IPNV challenge was performed by injecting each fish with approximately 250 microliters of 107 TCID50/mL of IPNV (Buhl strain, LaPatra unpublished). Naive fish injected with buffer served as negative control for the IPNV challenge. Ten days post-injection, animals were sacrificed, spleen samples collected in TR1 reagent, then stored at −75 degrees Celsius until RNA isolation was performed.
Isolation of Total RNA and cDNA Synthesis
Total RNA was isolated from spleen tissue of control and IPNV-injected rainbow trout using TR1 reagent following the manufacturer's protocols (Molecular Research Center, Cincinnati, Ohio). The RNA samples were treated with DNase I (Ambion, Enc, Austin, Tex.) then the RNA quality assessed by running the samples on a 1% formaldehyde agarose gel (23). The cDNA synthesis was carried out in a 40 microliter reaction volume containing 1 microgram total RNA, 1×RT-PCR buffer. 1 millimolar dNTPs, 0.75 micromolar oligo dT, 4 units of RNase inhibitor, and 5 units of MultiScribe reverse transcriptase (Applied Biosystems, Foster City, Calif.) at 42 degrees Celsius for 1 hour. The cDNA was diluted 1:10 using DNase and RNase free molecular biology grade water and 2 microliters of the diluted cDNA was taken for each reaction.
Determining IPNV Load by SYBR Green Real-Time RT-PCR
The primers for the SYBR Green real-time RT-PCR were designed based on the nucleotide sequence of segment A of the IPNV genome that encodes the protease protein (VP4) (GenBank Accession no. NC—001915, forward primer 1916F: 5′ AGGAGATGAC ATGTGCTACACCG 3′; SEQ ID NO: 5, and reverse primer 1999R: 5′CCAGCGAATA TTTTCTCCACCA 3′; SEQ ID NO: 6). The rainbow trout elongation factor 1-α (EF-1-α) gene was used as an internal control for normalizing the viral load from sample to sample. The primers for rainbow trout elongation factor 1-α (EF-1-α) were based on the published sequence of these genes (GenBank Accession no AF498320, forward primer 136F: 5′ TGATCTACAAGTGCGGAGGCA 3′; SEQ ID NO: 7, and reverse primer 236R: 5′ CAGCACCCAGGCATACTTGAA 3′; SEQ ID NO: 8). The primers were designed using the Primer Express Software version 1.0 (Perkin Elmer-Applied Biosystem). The real-time RT-PCR amplifications were performed in a BioRad iCycler iQ (BioRad Laboratories, Inc., Richmond, Calif.).
The SYBR Green real-time RT-PCR mixture contained 12.5 microliters of 2× SYBR. Green Supermix (iQ SYBR Green Supermix), 300 nanomolar each of forward and reverse primers and 2 microliters of the 1:10 diluted cDNA in a 25 microliters reaction volume. The amplifications were carried out in a 96-well microplate with 3 replicates per sample. The thermal profile for SYBR Green real-time RT-PCR was 95 degrees Celsius for 10 minutes, followed by 40 cycles of 95 degrees Celsius for 10 seconds and 60 degrees Celsius for 1 minute.
After a SYBR Green PCR run, data acquisition and subsequent data analyses were performed using the iCycler iQ Real-Time PCR Detection System (BioRad iQ Software Version 1.3). The relative IPNV load in a sample was determined by subtracting the mean Ct values for EF-1α from the mean Ct values of the IPNV amplicon. The differences in the Ct value of the viral genes and the corresponding internal controls were expressed as ΔCt. The ΔC values were plotted using GraphPad Version 4 (Graphpad Software, Inc., San Diego, Calif.). The difference in the ΔCt for one vaccine group compared to the ΔCt of the corresponding control was expressed as a ΔΔCt and 2 represents the difference in viral load between the two treatments.
Results and Discussion
The IPNV segment A has previously been cloned and expressed in hamster fibroblast cells, BHK-21, under the Semliki forest virus promoter and in insect cells under the polyhedrin promoter (polh) and were shown to produce virus-like particles (VLPs) that contain both VP2 and VP3 and are of similar size to the native virus but lack associated nucleic acid (15), (24). However, when we cloned the IPNV segment A in yeast, the polyprotein was expressed but no particles were observed under TEM (data not shown). This might he due to the lack of post-translational processing of the polypeptide in yeast. Therefore, we coexpressed VP2 and VP3 genes under different promoters into the pESC-ura vector so that the post-translational processing of the polyprotein would not be required. For clarity in the following discussion, the authors use the term virus-like particle (VLP) to describe viral-derived particles of similar size to the native virus that lack nucleic acid. For particles that are viral-derived and lack nucleic acid but do not have the same size or shape as the native virus the authors use the term sub-viral particle (SVP) to differentiate the two sets of viral-derived particles.
Cloning of VP2 and VP3 Genes
The predicted mature VP2 and VP3 genes were cloned separately behind GAL10 and GAL1 promoters in pESC-ura. Recombinant yeast containing VP2 or both VP2 and VP3 genes were grown under galactose induction then analyzed by western blot analysis to determine if VP2 and VP3 were expressed (
Preparation of SVPs and/or VLPs Plus Subsequent Electron Microscopy
Using the methods described above, VLP or SVP preparations were prepared on the clones containing both VP2 & VP3 genes. Several areas of high density were observed in the CsCl gradients. The high molecular weight materials pelleted in the ultracentrifuge, and a band of moderate density was observed in the gradient. The moderate density band corresponded to a approximately 20 nm particle that contained only VP2 reacting materials (
Immunization of Rainbow Trout
Rainbow trout that were free of IPNV were used for a vaccination experiment testing both intraperitoneal injection (IP) with adjuvant and by oral delivery in feed. The rVP2-SVPs were delivered either as purified SVPs (for IP injection) or as crude yeast lysate incorporated into feeds (for oral delivery) to test the antigenicity of these IPNV subunit vaccines in particle form in rainbow trout. The experimental design is outlined in Table 1. To test the ability of rVP2-SVPs to induce anti-IPNV antibody production, the most direct method is to use purified antigen and deliver by injection. Purified rVP2-SVPs were delivered by IP injection with Freud's adjuvant as described in Tables 1 and 2. A booster of the same composition was delivered after 32 days and fish bled at 63 days. All of the injected fish had significantly higher titers of anti-IPNV antibodies than either the naive or sham-injected controls (
Oral vaccination would provide a number of advantages over injection such as ease of use, ability to vaccinate smaller fish, lower cost of vaccine, and easy ability to make multivalent vaccines (through delivery of different clones in the feeds). In order to test the ability of rVP2-SVPs to induce an immune response, recombinant yeast expressing VLPs were incorporated into fish feed and fed to one treatment group for seven days. At day 32 another seven day feeding of the recombinant yeast containing feed was done as a booster (Table 1). At 63 days the fish were bled and the anti-IPNV titers compared to that found in naive fish and fish fed a control feed supplemented with wild-type yeast in place of the recombinant yeast (
While these data do not demonstrate the effectiveness of these vaccination strategies on prevention of disease, they are an indication that oral vaccination could potentially provide an alternative to IP injection vaccination for the treatment of IPN. A challenge trial would provide definitive evidence that this approach could prevent disease.
The results presented herein pertain to rainbow trout. However, the methods and compositions are not so limited in their applicability. One expects such compositions and methods to be effective in other types of fish as well, including not only salmonids. Furthermore, the efficacy of the compositions described herein for enhancing immunity and preventing disease are not limited to the methods of administration that are explicitly described herein. Other methods of administering immunogenic compositions to fish are expected to yield similar efficacy.
IPNV Challenge/Viral Load
There is no good challenge system for IPNV with mortality as the endpoint (1). Using IPNV viral load, as determined by real-time RT PCR, could provide a convenient method to track the progress of the disease. In this study, the trout were vaccinated with either rVP2-SVPs delivered in feed or by injection of purified rVP2-SVPs derived from the West Buxton strain of IPNV. After 63 days post-vaccination, fish were injected with the Buhl strain of IPNV that had been isolated from rainbow trout in Idaho (La Patra, unpublished data). This was a different IPNV strain (Buhl) than that from which the rVP2-SVPs vaccine was derived (West Buxton strain). Therefore, the challenge was with a heterologous strain and may help evaluate the specificity of this approach. IP vaccinated rainbow trout had significantly less virus (p=0.0280) (22 fold) than sham-injected control fish (Table 3,
These data indicate that rVP2-SVPs produced in yeast could provide a novel means for amplification of a protective immune response in rainbow trout, and by extension to salmonid species like salmon, either by injection or by delivery in feeds. Expression of a rVP2-SVP particle in yeast provides an interesting opportunity for its use as a vaccine for trout and salmon. The ability of these particles to induce the production of IPNV-specific antibodies was demonstrated by both oral and injection routes. The potential for use of the oral route as a vaccine needs further investigation to optimize the immune response and determine if the observed decrease in viral load directly correlates with prevention of IPN. This study sets the foundation for further studies to test in juvenile salmonids the utility of this approach to prevent early onset of IPN.
The disclosure of every patent, patent application, and publication cited herein is hereby incorporated herein by reference in its entirety.
While this subject matter has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations can be devised by others skilled in the art without departing from the true spirit and scope of the subject matter described herein. The appended claims include all such embodiments and equivalent variations.
Literature Referred to Herein is as Follows:
(1) Biering, E., S. Villoing, I. Sommerset, K. E. Christie. 2005. Update on viral vaccines for fish In: P. J. Midtlyng (ed.), Progress in Fish Vaccinology. Dev. Biol. Basel 121:97-113.
(2) Botteher, B., N. A. Kiselev, V. Y. Stel'Mashchuk, N. A. Perevozchikova, A. V. Borisov, and R. A. Crowther. 1997. Three-dimensional structure of infectious bursal disease virus determined by electron cryomicroscoopy. J Virol 71(1): 325-330.
(3) Brun, E. 2003. Epidemiology. In: O. Evensen, E. Rimstad, R. Stagg, E. Brun, P. Midtlyng, B. Skjelstad. L. H. Johansen, and I. Jensen (eds.), IPN in salmonids: a review. FHL & VESO, Trondheim, Norway, pp. 51-67.
(4) Christie, K. E. 1997. Immunization with viral antigens: infectious pancreatic necrosis. Dev. Biol. Stand. 90: 191-199.
(5) Delmas, B., Kibenge, F. S. B., Leong, J. A., Mundt, E., Vakharia, V. N., Wu, J. L., 2005. Birnaviridae, p. 561-569. In C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, and A. L. Ball (ed.), Virus Taxonomy. Academic Press, London, U.K.
(6) Dobos, P., 1995. The molecular biology of infectious pancreatic necrosis virus (IPNV). Ann. Rev. Fish Dis. 5, 24-54.
(7) Duncan, R., Mason, C. L, Nagy, E., Leong, J. A., Dobos, P., 1991. Sequence analysis of infectious pancreatic necrosis virus genome segment B and its encoded VP1 protein: a putative RNA-dependent RNA polymerase lacking the Gly-Asp-Asp motif. Virology 181(2), 541-552.
(8) Dykstra M J. (1.992) Specimen preparation for transmission electron microscopy. In Dykstra M J, ed. Biological Electron Microscopy. New York, London, Plenum Press, 5-78.
(9) Frost P., L. S. Havarstein, B. Lygren, S. Stahl, C. Endresen, K. E. Christie. 1995. Napping of neutralization epitopes on infectious pancreatic necrosis viruses. J. Gen. Virol. 76 (Pt 5): 1165-1172.
(10) Galloux, M., C. Chevalier, C. Henry, J.-C. Huet, B. Da Costa, B. Delmas 2004. Peptides resulting from the pVP2 C-terminal processing are present in infectious pancreatic necrosis virus particles. J. Gen. Virol. 85(Pt 8): 2231-2236.
(11) Gorbalenya. A. E., F. M. Pringle, J. L. Zeddam, B. T. Luke, C. E. Cameron, J. Kalmakoff, T. N. Hanzlik, K. H. Gordon, and V. K. Ward. 2002. The palm subdomain-based active site is internally permuted in viral RNA-dependent RNA polymerases of an ancient lineage. J. Mol. Biol. 324 (1): 47-62.
(12) Heppell J., E. Tarrab, J. Lecomte, Berthiaume, and M. Arella. 1995. Strain variability and localization of important epitopes on the major structural protein (VP2) of infectious pancreatic necrosis virus. Virology 214 (1): 40-49.
(13) Labus, M. B., S. Breeman, A. E. Ellis, D. A. Smail, M. Kervick and W. T. Melvin. 2001. Antigenic comparison of a truncated form of VP2 of infectious pancreatic necrosis (IPN) virus expressed in four different cell types. Fish & Shellfish Immunology 11(3): 203-216.
(14) Magyar, G. and P. Dobos. 1994. Evidence to the detection of the infectious pancreatic necrosis virus polyprotein and the 17 kDa polypeptide in infected cells and the NS protease in purified virus. Virology 204(2): 580-589.
(15) McKenna, B. M., R, M. Fitzpatrick, K. V. Phenix, D. Todd, L. M. Vaughan and G. J. Atkins. 2001. Formation of infectious pancreatic necrosis virus-like particles following expression of segment A by recombinant semliki forest virus. Marine Biotechnology 3(2): 103-110.
(16) Melby, P. Caswell-Reno, and K. Falk. 1994. Antigenic analysis of Norwegian aquatic birnavirus isolates uwin monoclonal antibodies J. Fish Dis. 17: 85-91.
(17) Midtlyng, P. 2003. Vaccination. In: Evensen O, Rimstad E, Stagg R, Brun E, Midtlyng P., Skjelstad B. Johansen L H, Jensen I (eds.), IPN in salmonids: a review. FHL & VESO, Trondheim, Norway, pp. 85-95.
(18) Pannunzio, V. G., Burgos, H. I., Alonso, M., Ramos, E. H., Mattoon, J. R., Stella, C A. 2004. Yeast Plasmids with the Least Trouble. Promega Notes #87: 27-28.
(19) Pitcovski, J., B. Gutter, et al. (2003). “Development and large-scale use of recombinant VP2 vaccine for the prevention of infectious bursal disease of chickens.” Vaccine 21(32): 4736-43.
(20) Pous, J., C. Chevalier, M. Ouldali, J. Navaza, B. Delmas and J. Lepault. 2005. Structure of birnavirus-like particles determined by combined electron cryomicroscopy and X-ray crystallography. J. Gen. Virol. 86(Pt 8): 2339-2346.
(21) Roberts, R. J. and M. D. Pearson 2005. Infectious pancreatic necrosis in Atlantic salmon, Salmo salar L. J. Fish Diseases 28(7): 383-390.
(22) Romanos, M. A., C. A. Scoer, and J. J. Clare. 1992. Foreign gene expression in yeast: a review. Yeast 8(6): 423-488.
(23) Sambrook, J., E. F. Fritsch and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
(24) Shivappa, R. B., P. E. McAllister, G. H. Edwards, N. Santi, O. Evensen, and V. N. Vakharia. 2005. Development of a subunit vaccine for infectious pancreatic necrosis virus using a baculovirus insect/larvae system. In: P. J. Midtlyng (ed.) Progress in Fish Vaccinology. Dev. Biol. Basel 121: 165-174.
(25) WolfK., S. Snieszko, C. Dunbar, E. Pyle. 1960. Virus nature of infectious pancreatic necrosis in trout. Proc. Soc. Exp. Biol. Med. 104: 105-108.
(26) Yao, K. and V. N. Vakharia. 1998. Generation of infectious pancreatic necrosis virus from cloned cDNA. J. Virol. 72(11): 8913-8920.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US07/87942 | 12/18/2007 | WO | 00 | 12/10/2009 |
| Number | Date | Country | |
|---|---|---|---|
| 60875901 | Dec 2006 | US |
