Patent Application
20070037171
The ability to determine the presence of an analyte in a sample is of significant benefit. For example, many metals and metal ions, such as lead, mercury, cadmium, chromium, and arsenic, pose significant health risks when present in drinking water supplies. To prevent the contamination of drinking and other water supplies, it is common to test industrial waste-streams before their release to the water treatment plant. Biological fluids, such as blood and those originating from body tissues, also may be tested for a variety of analytes to determine if the body has been exposed to harmful agents or if a disease state exists. For example, the need to detect trace amounts of anthrax in a variety of samples has recently emerged.
Colorimetric methods are commonly used for the detection of metals and ions in soil, water, waste-streams, biological samples, body fluids, and the like. In relation to instrument based methods of analysis, such as atomic absorption spectroscopy, calorimetric methods tend to be rapid and require little in the way of equipment or user sophistication. For example, colorimetric tests are available to aquarists that turn darker shades of pink when added to aqueous samples containing increasing concentrations of the nitrate (NO3−)ion. In this manner, colorimetric tests show that the analyte of interest, such as nitrate, is present in the sample and also may provide an indicator of the amount of analyte in the sample through the specific hue of color generated. While conventional colorimetric tests are extremely useful, they only exist for a limited set of analytes, and often cannot detect very small or trace amounts of the analyte.
As can be seen from the above description, there is an ongoing need for calorimetric sensor systems that can identify trace amounts of a broader scope of analytes and that increase the reliability of the analysis.
A sensor system for detecting an analyte includes a linker comprising an aptamer that folds in response to the analyte and second particles coupled to a second oligonucleotide that is complementary to at least a portion of the aptamer. The linker may include an extension where a first oligonucleotide coupled to first particles is complementary to at least a portion of the extension.
A method of detecting an analyte includes combining an aggregate with a sample to detect a color change responsive to the analyte. The aggregate may include a linker and second particles. The aggregate also may include first particles and the linker may include an extension.
A kit for detecting an analyte includes a first container containing a system for forming aggregates that includes second particles and a linker including an aptamer, which folds in response to the analyte. The second particles are coupled to second oligonucleotides that are complementary to at least a portion of the aptamer.
A method for determining the sensitivity and selectivity of an aptamer to an analyte includes combining an aggregate with the analyte, detecting a color change responsive to the analyte, and determining if the DNA strand folded to provide the color change. The aggregate includes second particles and a linker including a DNA strand. The aggregate also may include first particles. The linker may include an extension.
In order to provide a clear and consistent understanding of the specification and claims, the following definitions are provided.
The term “sample” is defined as a composition that will be subjected to analysis that is suspected of containing the analyte of interest. Typically, a sample for analysis is in a liquid form, and preferably the sample is an aqueous mixture. A sample may be from any source, such as an industrial sample from a waste-stream or a biological sample, such as blood, urine, or saliva. A sample may be a derivative of an industrial or biological sample, such as an extract, a dilution, a filtrate, or a reconstituted precipitate.
The term “analyte” is defined as one or more substance potentially present in the sample. The analysis determines the presence, quantity, or concentration of the analyte present in the sample.
The term “calorimetric” is defined as an analysis where the reagent or reagents constituting the sensor system produce a color change in the presence or absence of an analyte.
The term “light-up” refers to a colorimetric sensor system that undergoes a desired color change in response to an analyte present in a sample.
The term “light-down” refers to a calorimetric sensor system that does not undergo a color change when an analyte is present in a sample, but does under a desired color change occurs in the absence of the analyte.
The term “sensitivity” refers to the smallest increase in an analyte concentration that is detectable by the sensor system (resolution) or to the lowest concentration limit at which a sensor system can differentiate a signal responsive to the analyte from a background signal (detection limit). Thus, the more sensitive a sensor system is to an analyte, the better the system is at detecting lower concentrations of the analyte.
The term “selectivity” refers to the ability of the sensor system to detect a desired analyte in the presence of other species.
The term “hybridization” refers to the ability of a first polynucleotide to form at least one hydrogen bond with at least one second nucleotide under low stringency conditions.
The term “aptamer” refers to a strand of nucleic acids that undergoes a conformational change in response to an analyte.
The term “conformational change” refers to the process by which an aptamer adopts a tertiary structure from another state. For simplicity, the term “fold” may be substituted for conformational change.
The invention can be better understood with reference to the following drawings and description. The components in the figures are not necessarily to scale and are not intended to accurately represent molecules or their interactions, emphasis instead being placed upon illustrating the principles of the invention.
Aptamers may be easier to isolate than nucleic acid based catalysts. The simpler structure of aptamers in relation to nucleic acid enzymes also may allow for the design of analyte sensor systems for which nucleic acid enzymes are not available. The present invention makes use of the discovery that by selecting the hybridization strength between the folded and unfolded conformations of an aptamer and an oligonucleotide functionalized particle, the particle may be released in response to an analyte. In this manner, a light-up calorimetric sensor is provided that undergoes a desired color change in response to a selected analyte at room temperature, thus overcoming a disadvantage of the sensor system disclosed in U.S. Ser. No. 10/144,679.
In one aspect, the analyte 105 may be any ion that causes an aptamer 124 to fold. In another aspect, the analyte 105 may be any metal ion that causes an aptamer 124 to fold. Preferable monovalent ions having a +1 formal oxidation state (I) include NH4+, K(I), Li(I), Tl(I), and Ag(I). Preferable divalent metal ions having a +2 formal oxidation state (II) include Mg(II), Ca(II), Mn(II), Co(II), Ni(II), Zn(II), Cd(II), Cu(II), Pb(II), Hg(II), Pt(II), Ra(II), Sr(II), Ni(II), and Ba(II). Preferable trivalent and higher metal ions having +3 (III), +4 (IV), +5 (V), or +6 (VI) formal oxidation states include Co(III), Cr(III), Ce(IV), As(V), U(VI), Cr(VI), and lanthanide ions. More preferred analyte ions include monovalent metal ions and metal ions that are toxic to living organisms, such as Ag(I), Pb(II), Hg(II), U(VI), and Cr(VI).
In another aspect, the analyte 105 may be any biomolecule that causes the aptamer 124 to fold. Preferable biomolecules include large biomolecules, such as proteins (e.g. proteins related to HIV, hCG-hormone, insulin), antibodies, growth factors, enzymes, virus (e.g. HIV, small pox), viral derived components (e.g. HIV-derived molecules), bacteria (e.g. anthrax), bacteria derived molecules and components (e.g. anthrax derived molecules), or cells. Preferable biomolecules also may include small biomolecules, such as amino acids (e.g. arginine), nucleotides (e.g. ATP, GTP), neurotransmitters (e.g. dopamine), cofactors (e.g. biotin), peptides, or amino-glycosides.
In another aspect, the analyte 105 may be any organic molecule that causes the aptamer 124 to fold. Preferable organic molecules include drugs, such as antibiotics and theophylline, or controlled substances, such as cocaine, dyes, oligosaccharides, polysaccharides, glucose, nitrogen fertilizers, pesticides, dioxins, phenols, 2,4-dichlorophenoxyacetic acid, nerve gases, trinitrotoluene (TNT), or dinitrotoluene (DNT).
Once the analyte 105 is selected, the one or more aptamer 124 is selected that folds in response to the analyte 105. The aptamer selection 120 may be performed by in vitro selection, directed evolution, or other method known to those of ordinary skill in the art. The aptamer selection 120 may provide one or more aptamers that demonstrate enhanced folding in the presence of the selected analyte 105 (thereby providing sensor sensitivity). The selection 120 also may exclude aptamers that fold in the presence of selected analytes, but that do not fold in the presence of non-selected analytes and/or other species present in the sample 102 (thereby providing sensor selectivity).
For example, an aptamer may be selected that specifically binds K(I), while not significantly binding Na(I), Li(I), Cs(I), Rb(I), or other competing metal ions. In one aspect, this may be achieved by isolating aptamers that bind K(I), then removing any aptamers that bind Na(I), Li(I), Cs(I), or Rb(I). In another aspect, aptamers that bind Na(I), Li(I), Cs(I), or Rb(I) are first discarded and then those that bind K(I) are isolated. In this manner, the selectivity of the aptamer may be increased.
The aptamer 124 includes a nucleic acid strand that folds in the presence of the analyte 105. In one aspect, the folding may be considered the conversion of a primary or duplex structure to a tertiary structure. The base sequence of the aptamer may be designed so that the aptamer may undergo at least partial hybridization with at least one oligonucleotide functionalized particle. In this aspect, at least a portion of the base sequence of the aptamer 124 may be complementary to at least one oligonucleotide of the oligonucleotide functionalized particle.
The aptamer 124 may be formed from deoxyribonucleotides, which may be natural, unnatural, or modified nucleic acids. Peptide nucleic acids (PNAs), which include a polyamide backbone and nucleoside bases (available from Biosearch, Inc., Bedford, Mass., for example), also may be useful.
Table I below lists analytes, the aptamer or aptamers that bind with and fold in response to that analyte, and the reference or references where the sequence of each aptamer is described. The analyte binding region of these, and other, aptamers may be adapted for use in a linker 128. For example, the non-analyte binding region of the cocaine aptamer, given as SEQ ID NO. 10 in Table I below, may be modified to provide the aptamer GGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC (SEQ ID NO. 56) and included in the linker 128.
After selecting an appropriate aptamer or aptamers in 120, a linker 128 is formed that includes the aptamer 124. In one aspect, the aptamer 124 may serve directly as the linker 128. In another aspect, the linker 128 may be formed by joining the aptamer 124 with one or more extensions 126.
The extension 126 may be any nucleic acid sequence that may be joined with the aptamer 124, that may undergo at least partial hybridization with one or more oligonucleotide functionalized particles, and that is compatible with the analysis 100. In this aspect, at least a portion of the base sequence of the extension 126 may be complementary to at least one oligonucleotide of one or more oligonucleotide functionalized particle. In one aspect, solid phase synthesis may be used to join the aptamer 124 with the extension 126 to form the linker 128. In another aspect, after the aptamer 124 portion of the linker 128 is synthesized, the synthesis is continued to form the extension 126. Similarly, the linker 128 may be extended with the aptamer 124 sequence.
Preferably, the extension 126 includes from 1 to 100 bases. In one aspect, at least 50, 70, or 90% of the bases present in the extension 126 are capable of hybridizing with a complementary portion of a first oligonucleotide functionalized particle, such as the TGAGTAGACACT-5′ (SEQ ID NO. 43) portion of particle 336 in
After selecting or synthesizing the linker 128, an aggregate 132 may be formed in 130. The aggregate 132 includes the linker 128 and oligonucleotide functionalized particles 136. Considering the physical size of its components, the aggregate 132 may be quite large.
The linker 128 hybridizes with the oligonucleotide functionalized particles 136 and includes the aptamer 124 and may include the extension 126. For example, if first and second oligonucleotide functionalized particles have base sequences of 3′-AAAAAAAAAAAATGAGTAGACACT (SEQ ID NO. 44) and 5′-CCCAGGTTCTCT (SEQ ID NO. 45), respectively, an appropriate sequence for the linker 128 that includes the aptamer 124 that folds in the presence of an adenosine analyte and the extension 126 may be 5′-ACTCATCTGTGAAGAGAACCTGGGG GAGTATTGCGGAGGAAGGT (SEQ ID NO. 46).
For the adenosine analyte, the extension 126 portion of the linker 128 is the ACTCATCTGTGAAGAGA (SEQ ID NO. 47) portion of the sequence, which allows the extension 126 to hybridize with twelve bases of the first functionalized particle and five bases of the second functionalized particle. Similarly, the aptamer 124 portion of the linker 128 is the ACCTGGGGGAGTATTGCGGAGGAAGGT (SEQ ID NO. 18) portion of the sequence, which allows the ACCTGGG (SEQ ID NO: 48) portion of the aptamer 124 to hybridize with the TGGACCC (SEQ ID NO. 49) portion of the second functionalized particle.
Because the particles 136 demonstrate distance-dependent optical properties, the particles are one color when closely held in the aggregate 132 and undergo a color change as the distance between the particles increases. For example, when the particles 136 are gold nanoparticles, the aggregate 132 displays a blue color in aqueous solution that turns red as disaggregation proceeds.
Disaggregation occurs when the aptamer 124 portion of the linker 128 binds with and folds in response to the analyte 105. When the aptamer 124 folds, a portion of the hybridization with the second oligonucleotide functionalized particles is lost. This hybridization loss allows the second oligonucleotide functionalized particles to separate from the aggregate 132. Thus, as the particles 136 diffuse away from the aggregate 132, the solution changes from blue to red.
The particles 136 may be any species that demonstrate distance-dependent optical properties and are compatible with the operation of the sensor system. Suitable particles may include metals, such as gold, silver, copper, and platinum; semiconductors, such as CdSe, CdS, and CdS or CdSe coated with ZnS; and magnetic colloidal materials, such as those described in Josephson, Lee, et al., Angewandte Chemie, International Edition (2001), 40(17), 3204-3206. Specific useful particles may include ZnS, ZnO, TiO2 , Agl, AgBr, HgI2, PbS, PbSe, ZnTe, CdTe, In2S3, In2Se3, Cd3P2 , Cd3AS2, InAs, and GaAs.
In a preferred aspect, the particles are gold (Au) nanoparticles and have an average diameter from 5 to 70 nanometers (nm) or from 10 to 50 nm. In a more preferred aspect, gold nanoparticles having an average diameter of from 10 to 15 nm are functionalized to the oligonucleotides.
For a more detailed treatment of how to prepare oligonucleotide functionalized gold particles, See U.S. Pat. No. 6,361,944; Mirkin, et al., Nature (London) 1996, 382, 607-609; Storhoff, et al., J. Am. Chem. Soc. 1998, 20, 1959-1064; and Storhoff, et al., Chem. Rev. (Washington, D.C.) 1999, 99, 1849-1862. While gold nanoparticles are presently preferred, other species that undergo a distance-dependent color change, such as inorganic crystals, quantum dots, and the like also may be attached to oligonucleotides.
In 140 the aggregate 132 may be combined with the sample 102. In 150 the sample 102 is monitored for a color change. If a color change does not occur, then the analyte 105 is not present in the sample 102. If a color change does occur in 160, the analyte 105 is present in the sample 102. The color change signifies that the analyte 105 caused the aptamer 124 to fold, thus allowing the particles 136 to diffuse away from the aggregate 132 and into the solution of the sample 102. Thus, the analysis 100 provides a “light-up” sensor system because a color change occurs in the presence of the analyte 105.
The rate at which a substantially complete color change occurs in response to the analyte 105 may be considered the response time of the sensor system. In one aspect, the color change may be considered substantially complete when the absorption peak in the visible region increases by 20%. In another aspect, the color change may be considered substantially complete when the extinction coefficient at 522 nm over 700 nm increases by 100% for gold particles. Preferable response times for the sensor system are from 1 second to 60 minutes or from 2 seconds to 10 minutes. More preferable response times for the sensor system are from 5 seconds to 2 minutes or from 8 to 12 seconds. Preferable temperature ranges for operation of the sensor system are from 0° to 60° or from 15° to 40° C. More preferable ranges for operation of the sensor system are from 23° to 37° or from 25° to 30° C. In another aspect, when the analysis 100 is conducted from 23° to 37° C., a preferable response time may be less than 2 minutes or from 1 to 12 seconds.
The degree the color changes in response to the analyte 105 may be quantified by colorimetric quantification methods known to those of ordinary skill in the art in 170. Various color comparator wheels, such as those available from Hach Colo., Loveland, Colo. or LaMotte Colo., Chestertown, Md. may be adapted for use with the present invention. Standards containing known amounts of the selected analyte may be analyzed in addition to the sample to increase the accuracy of the comparison. If higher precision is desired, various types of spectrophotometers may be used to plot a Beer's curve in the desired concentration range. The color of the sample may then be compared with the curve and the concentration of the analyte present in the sample determined. Suitable spectrophotometers include the Hewlett-Packard 8453 and the Bausch & Lomb Spec-20.
In yet another aspect, the method 100 may be modified to determine the sensitivity and selectivity of an aptamer to the analyte 105. In this aspect, one or more DNA strand suspected of being an aptamer responsive to the analyte 105 is selected in 120. The DNA strand may or may not be modified with the extension 126 in 125. In 130, an aggregate is formed from the DNA strands and appropriate particles. In 140, the aggregates are combined with the analyte 105. If the aggregate undergoes a color change, then the DNA strand is an appropriate aptamer sequence for the target 105. In this manner, multiple aptamers selected in 120 may be tested for use in a colorimetric sensor system.
The aptamer 224 includes C and D portions. In one aspect, the hybridization stability of the combined B portion of the extension 226 and the C portion of the aptamer 224 with the second particle 237 may be less than that for A and the first particle 236. In a preferred aspect, the melting temperature of this C+B/second particle hybridization is higher than the temperature at which the sensor system is to be used. In another preferred aspect, the melting temperature of a B portion hybridized to the oligonucleotide sequence of the second particle 237 is less than the temperature at which the sensor system is to be used. In another preferred aspect, the stability of a C+D+ analyte complex should be greater than the hybridization stability of C with the second particle 237. In another aspect, the sequences of B and C are as short as is compatible with the operation of the sensor system.
While one base sequence for the linker and the particles are shown, the bases may be changed on the opposing strands to maintain the pairings. For example, any cytosine in the A or B portions of the linker 228 may be changed to thymine, as long as the paired base of the particle oligonucleotide is changed from guanine to adenine.
In the presence of the adenosine analyte 305, the aptamer portion 324 of the linker 328 folds, thus eliminating at least a portion of the hybridization between the aptamer portion 324 of the linker 328 and the 5′-AdeAu particle 337. This loss of hybridization between the aptamer 324 and the 5′-AdeAu particle 337 releases the 5′-AdeAu particle to the solution.
As the 5′-AdeAu particles 337 are released, the blue aggregate 332 begins to disaggregate to form partial aggregate 390. This partial disaggregation adds red color to the blue solution as the particles 337 diffuse away from the aggregate 332, thus giving a purple solution. If enough of the adenosine analyte 305 is present in the sample, the reaction will continue until the aggregate 332 is completely disaggregated, to give 395. Complete disaggregation results in a red solution due to the greater distance between the particles 336, 337.
The alignment of the particles 336, 337 (tail-to-tail, head-to-tail, or head-to-head) with respect to each other may influence how tightly the aggregate units 331 bind.
At present, the tail-to-tail hybridization arrangement of
While not shown, the methodology of
The ionic strength of the sample may influence how tightly the moieties that form the aggregate bind together. Higher salt concentrations favor aggregation, thus slowing sensor response, while lower salt concentrations may lack the ionic strength necessary to maintain the aggregates. In one aspect, the sample may include or be modified with a reagent to include a monovalent metal ion concentration of 30 mM and greater. The ionic strength of the sample may be modified with Na+ ions, for example. In a preferred aspect, the monovalent metal ion concentration of the sample, which contains the aggregate, is from 150 to 400 mM. At present, especially preferred monovalent metal ion concentrations are about 300 mM for adenosine and potassium analytes and about 150 mM for cocaine as an analyte. pH also may influence the aggregate binding, possibly attributable to the protonation of the polynucleotide base pairs at lower pH. In one aspect, a pH from 5 to 9 is preferred, with an approximately neutral pH being more preferred.
Thus, the performance of the sensor may be improved by adjusting the ionic strength and pH of the sample prior to combining it with the aggregate. Depending on the sample, it may be preferable to add the sample or analyte to a solution containing the aggregate (where the ionic strength and pH may be controlled) or the reverse.
The sensor system, including the aptamer, extension, and oligonucleotide functionalized particles may be provided in the form of a kit. In one aspect, the kit includes the aptamer and the extension joined to form the linker. In yet another aspect, the kit includes the extension, but excludes the aptamer, which is then provided by the user or provided separately. In this aspect, the kit also may include the reagents required to link the supplied extension with an aptamer. In this aspect, the kit also may be used to determine the specificity and/or selectivity of various aptamers to a selected analyte. Thus, the kit may be used to select an appropriate aptamer in addition to detecting the analyte. In yet another aspect, the kit includes an exterior package that encloses a linker and oligonucleotide functionalized particles.
One or more of these kit components may be separated into individual containers, or they may be provided in their aggregated state. If separated, the aggregate may be formed before introducing the sample. Additional buffers and/or pH modifiers may be provided in the kit to adjust the ionic strength and/or pH of the sample.
The containers may take the form of bottles, tubs, sachets, envelopes, tubes, ampoules, and the like, which may be formed in part or in whole from plastic, glass, paper, foil, MYLAR®, wax, and the like. The containers may be equipped with fully or partially detachable lids that may initially be part of the containers or may be affixed to the containers by mechanical, adhesive, or other means. The containers also may be equipped with stoppers, allowing access to the contents by syringe needle. In one aspect, the exterior package may be made of paper or plastic, while the containers are glass ampoules.
The exterior package may include instructions regarding the use of the components. Color comparators; standard analyte solutions, such as a 10 μm solution of the analyte; and visualization aids, such as thin layer chromatography (TLC) plates, test tubes, and cuvettes, also may be included. Containers having two or more compartments separated by a membrane that may be removed to allow mixing may be included. The exterior package also may include filters and dilution reagents that allow preparation of the sample for analysis.
In another aspect, in addition to the sensor system of the present invention, the kit also may include multiple sensor systems to further increase the reliability of analyte determination and reduce the probability of user error. In one aspect, multiple light-up sensor systems in accord with the present invention may be included. In another aspect, a “light-down” sensor system may be included with the light-up sensor system of the present invention. Suitable light-down sensors for inclusion in the presently claimed kit may rely on DNAzyme/Substrate/particle aggregates that are not formed in the presence of the selected analyte. A more detailed description of suitable light-down sensor systems for inclusion in the presently claimed kit may be found, for example, in U.S. patent application Ser. No. 10/756,825, filed Jan. 13, 2004, entitled “Biosensors Based on Directed Assembly of Particles,” which is hereby incorporated by reference.
The preceding description is not intended to limit the scope of the invention to the described embodiments, but rather to enable a person of ordinary skill in the art to make and use the invention. Similarly, the examples below are not to be construed as limiting the scope of the appended claims or their equivalents, and are provided solely for illustration. It is to be understood that numerous variations can be made to the procedures below, which lie within the scope of the appended claims and their equivalents.
All DNA samples were purchased from Integrated DNA Technology Inc., Coralville, Iowa. The DNA samples that formed the extensions were purified by gel electrophoresis, while the thiol-modified DNA samples for forming the oligonucleotide functionalized particles were purified by standard desalting. Adenosine, cytidine, uridine, guanosine and cocaine were purchased from Aldrich. Gold nanoparticles having an average diameter of 13 nm were prepared and functionalized with 12-mer thiol-modified DNA following literature procedures, such as those disclosed in Storhoff, J., et al., “One-pot calorimetric differentiation of polynucleotides with single base imperfections using gold particle probes,” JACS 120: 1959-1964 (1998), for example. The average diameter of the gold nanoparticles was verified by transmission electronic microscope (JEOL 2010).
Preparation of a Colorimetric Adenosine Sensor
Five-hundred microliters of 5′-AdeAu (extinction at 522 nm equals 2.2) and 500 μL of 3′-A12AdeAu (extinction at 522 nm equals 2.2) were mixed in the presence of 300 mM NaCl, 25 mM Tris acetate buffer, pH 8.2, and 100 nM of the adenosine aptamer/extension (Adenosine Linker). The sample was warmed to 65° C. for one minute and then allowed to cool slowly to 4° C. The nanoparticles changed color from red to dark purple during this process. The sample was centrifuged and the precipitates were collected and then dispersed in 2000 μL of the same buffer (300 mM NaCl, 25 mM Tris acetate, pH 8.2). The suspension was used for detection of adenosine.
Colorimetric Detection of Adenosine
One-hundred microliters of the sensor suspension from Example 1 was added to a small volume of concentrated adenosine solution. For example, 2 μL of 50 mM adenosine was added to give a final concentration of 1 mM. The color change was monitored with a UV-vis spectrometer or by the naked eye.
Monitoring the Performance of the Adenosine Sensor
The color change of the sample from Example 2 was monitored by UV-vis extinction spectroscopy.
Selectivity and Sensitivity of the Adenosine Sensor
To a quarts UV-vis spectrophotometer cell (Hellma, Germany) was added 100 μL of the adenosine sensor system prepared in Example 1. A small volume (1-5 μL) of solutions including adenosine, uridine, cytidine or guanosine was added to the spectrophotometer cell to bring the analyte concentration to the desired level in the cell.
The dispersion kinetics for each cell was monitored as a function of time using a Hewlett-Packard 8453 spectrophotometer.
In addition to the instrumental method of
Preparation of a Colorimetric Potassium Ion Sensor
Colorimetric Detection of Potassium
Metal ion solutions of Li+, Na+, K+, Rb+, or Cs+ ions were made by dissolving LiCl, NaCl, KCl, RbCl or CsCl salt, respectively, in deionized water to obtain an ion concentration of 3 M. From these metal ion stock solutions were prepared solutions containing 25 mM of Tris acetate buffer, pH 8.2, and 300 mM of Li+, Na+, K+, Rb+, or Cs+ ions. To each of these five solutions was added 1 μL of the K(I) sensor system from Example 5 for each 99 μL of the metal ion containing solution. Therefore, each solution contained ˜ 300 mM of Li+, Na+, K+, Rb+, or Cs+ metal ions and an additional 3 mM of Na+ ions as background. Each sample was heated to 65° C. and then cooled slowly to 4° C. in 1 hour. The color change was monitored with a UV-vis spectrometer or by the naked eye.
Preparation of a Colorimetric Cocaine Sensor
Colorimetric Detection of Cocaine
One-hundred microliters of the above prepared cocaine sensor suspension were combined with a small volume of concentrated cocaine solution. For example, 1 μL of 100 mM cocaine was added to the suspension to give a final concentration of 1 mM. The color change was monitored with a UV-vis spectrometer or by the naked eye.
Selectivity and Sensitivity of the Cocaine Sensor
To a quarts UV-vis spectrophotometer cell (Hellma, Germany) was added 100 μL of the cocaine sensor system prepared in Example 7. A small volume (0.5-2 μL) of solutions including cocaine, adenosine, or sucrose was added to the spectrophotometer cell to bring the analyte concentration to the desired level in the cell.
The dispersion kinetics for each cell was monitored as a function of time using a Hewlett-Packard 8453 spectrophotometer.
In addition to the instrumental method of
As any person of ordinary skill in the art will recognize from the provided description, figures, and examples, that modifications and changes can be made to the preferred embodiments of the invention without departing from the scope of the invention defined by the following claims and their equivalents.
This subject matter of this application may have been funded in part under the following research grants and contracts: National Science Foundation Contract Numbers CTS-0120978 and DMR-0117792. The U.S. Government may have rights in this invention.
