ARTIFICIAL RNAS FOR MODULATING RNA FRAGMENTS

Information

  • Patent Application
  • 20230323354
  • Publication Number
    20230323354
  • Date Filed
    June 28, 2021
    4 years ago
  • Date Published
    October 12, 2023
    2 years ago
  • Inventors
    • DÍEZ ANTÓN; Juana María
    • DOTU RODRÍGUEZ; Ivan Javier
    • TALLÓ PARRA; Marc
  • Original Assignees
Abstract
The present invention relates to an artificial RNA having at least one hybridization region against one or more target disruption structures of one or more RNA fragments, wherein such an artificial RNA suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments, thereby modulating the functionality of the one or more RNA fragments.
Description
FIELD OF THE INVENTION

The present invention relates to the field of biotechnology. In particular, the present invention relates to artificial RNAs as defined in the present invention. More particularly, the present invention relates to artificial RNAs suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments, thereby modulating the one or more RNA fragments.


BACKGROUND OF THE INVENTION

A vast amount of research and development is underway to extend the range of medicines in general, such as antivirals to treat pathogens currently without commercial treatments or to treat cancer. Also, with the tendency of viruses and tumoral cells to mutate and become drug resistant, the need of the hour is to develop and refresh the pipeline of antitumorals and/or antivirals with new therapies. The opportunities available for this market, according to a recent market report (https://www.mordorintelligence.com/industry-reports/global-antiviral-drugs-market-industry), are (i) an increasing need for broad-spectrum antiviral drugs and (ii) access to antiviral drugs in the pharmerging markets.


Current approved and effective antiviral treatments include molecules that specifically interact with viral proteins essential for the viral life cycle. Developing these therapeutic molecules is costly and highly time consuming. Moreover, every molecule functions solely for a specific virus. Multiple efforts have been made to develop RNA-based antiviral treatments to target the viral RNA genome [Brice A Sullenger and Smita Nair. From the RNA world to the clinic. Science 352 (6292), 1417-1420]. These include the design of 19 nucleotide-long micro RNAs (miRNAs) that specifically interact with viral RNA genomes, leading to their subsequent degradation by the cellular RISC system. Although successful in cell culture, a major drawback for their clinical use is the rapid emergence and selection of mutations in the RNA genome that inhibit the interaction with the miRNAs. Another drawback of miRNAs as antiviral molecules is their stability, as they are naturally degraded by the cellular decay machinery.


Because of the cost and time required to develop new therapeutic agents against viral proteins, RNA-based therapeutics has generated a lot of attention in the last years. RNA-based therapies have been able to address targets untreatable with antibody and small-molecule approaches [Ling-Ling Chen. The biogenesis and emerging roles of circular RNAs. Nature Reviews Molecular Cell Biology 17, 205-211 (2016), doi:10.1038/nrm.2015.32]. Consequently, multiple companies have been created to develop RNA-based therapies to treat multiple diseases. For instance, the company Moderna is developing an mRNA-based vaccine against infection caused by SARS-CoV-2 (Covid-19). These companies focus on the use of antisense, siRNAs, aptamers and microRNA mimics/anti-microRNAs. However, these molecules (i) are rapidly degraded and (ii) share with protein- and antibodies-based therapies the emergence of drug resistance by the high tendency of viruses to mutate.


The present inventors have particularly focused their approach on stable artificial RNAs, such as circular RNAs. Circular RNAs (circRNAs) are back-splicing products of precursor mRNAs that appear naturally in the cell (see review [Ling-Ling Chen. The biogenesis and emerging roles of circular RNAs. Nature Reviews Molecular Cell Biology 17, 205-211 (2016), doi:10.1038/nrm.2015.32]). Previously thought to be irrelevant byproducts, are now proven to perform several functions, such as miRNA sponges and RBP (RNA binding proteins) sponges. Circular RNA has no ends. This is very important, since most mRNA degradation pathways in the cell require 5′or 3′ ends for the cellular exonucleases to carry out their degradation function. Consequently, circRNAs are extremely stable molecules. The potential of circRNAs as novel therapeutic platforms have not been fully exploited.


WO2017/222911 discloses the use of circular RNAs generated with exogenous introns to stimulate immune response or circular RNAs generated with endogenous introns to prevent immune recognition of foreign RNA.


WO0061595 discloses a covalently-closed multiple antisense (CMAS)-oligo, which is constructed to form a closed type by ligation using complementary primer, and a ribbon-type antisense (RiAS)-oligo, which is composed of two loops containing multiple antisense sequences and a stem connecting the two loops that is constructed to by ligation using complementary sequences at both 5 prime ends.


WO 2013/162350 A2 relates to the use of circular RNAs composed of 2 purine rich domains that can target viral pyrimidine rich regions in order to form triple helices that can block viral replication.


CN 108165549 A relates to the use of circular RNAs as micro-RNA sponges. It presents an artificial formulation of the well-known function of endogenous circRNAs, where multiple partial complementarity regions target mature micro-RNAs that activate AGO2 pathway upon hybridization.


In addition, there is an increasing need for better understanding molecular mechanisms underlying many pathologies, such as cancer, viral infections, autoimmune diseases, neurological diseases, genetic disorders, etc. In most of these pathologies, RNAs play a role in the underlying mechanisms. Hence, there is a need for tools which would allow the study of the specific functions of the RNAs involved in the molecular mechanisms involving pathologies.


The present invention addresses the above problems, and is directed to tools which allow the modulation of the functionality of RNA fragments, such as, e.g., viral genome, which allow multiple applications. For instance, with the tools of the present invention (artificial RNAs) it is possible to study the structure-function relationship of a certain RNA fragment, or certain regions within a certain RNA fragment. In addition, with the RNAs of the present invention, it is possible to prevent and/or treat diseases where RNA fragments are involved, such as viral infections, cancer, immune diseases, genetic disorders, etc. For instance, with the artificial RNA of the present invention it is possible to study RBPs (ribosome binding proteins) that bind to double stranded RNA motifs.


SUMMARY OF THE INVENTION

In a first aspect, the present invention provides an artificial circular RNA suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments,

  • (a) wherein the artificial circular RNA comprises between 150 and 800 nucleotides, preferably between 200 and 600 nucleotides;
  • (b) wherein the artificial circular RNA comprises two or more hybridization regions which:
    • (i) completely hybridize with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments; and
    • (ii) have a total of between 7 and 100 nucleotides, preferably between 10 and 50 nucleotides;
  • (c) wherein the one or more target disruption structures:
    • (i) comprises at least a hairpin loop preceded or followed by a region of unpaired nucleotides; and
    • (ii) comprises at least one target hybridization region which comprises a single-stranded region of at least 2 nucleotides, preferably 3 nucleotides or more preceded or followed by a double-stranded region of at least 5 nucleotides, preferably 10 nucleotides or more, wherein the at least one target hybridization region completely hybridizes with each of the two or more hybridization regions of the artificial circular RNA; and
  • (d) wherein the two or more hybridization regions comprised in the artificial circular RNA are further characterized because, when hybridizing with the target hybridization region, the energy of hybridization, as measured by RNAcofold, between the hybridization region and the at least one target hybridization region is more negative than the energy of the target disruption region, thereby disrupting the target disruption structure.


Preferably, the artificial circular RNA according to the first aspect or any of its embodiments comprises between 6 and 20 hybridization regions. Preferably, the least two, and preferably all, of the hybridization regions are capable of completely hybridizing with the same target hybridization region. Preferably, the least two, and preferably all, of the hybridization regions have different nucleotide sequences.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the 2 or more hybridization regions are:

  • a) separated by non-hybridization regions of sizes up to 20 nucleotides; or
  • b) are not separated by non-hybridization regions; or
  • c) are overlapping.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the one or more RNA fragments is selected from mRNA, tRNA, rRNA, non-coding RNA and viral genomic RNA.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the one or more RNA fragments is viral genomic RNA.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the one or more RNA fragments is positive-sense single-stranded viral genomic RNA.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the viral genomic RNA is selected from Influenza virus, HAV, Poliovirus, Coxsackie B virus, Coronavirus and Rhinovirus (common cold).


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the viral genomic RNA is selected from Hepatitis C virus, Dengue, Zika, Chikungunya, West Nile and Yellow Fever virus.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the viral genomic RNA is from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures are selected from the group consisting of:

  • (a) Internal Ribosome Entry (IRES) Domain IV and Domain V, capsid-coding region hairpin element (cHP) or SL427 from Hepatitis C Virus,
  • (b) short Stem Loop (sHP) or capsid-coding region hairpin element (cHP) from Dengue virus,
  • (c) 5′ untranslated region (5′UTR), Repetitive Sequence Element (RSE) or Recoding Element from Chikungunya,
  • (d) Stem loop III (SLIII) from West Nile, and/or
  • (e) SL-2, Replication site, Target A, Target C, Target D from Coronavirus, preferably from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprises or consists of the target disruption structures selected from the list consisting of SEQ ID NOs.:76, 77, 78 and/or 79 from Hepatitis C virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs: 25, 26, 27 and 28.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprises or consists of the target disruption structures selected from the list consisting of SEQ ID NO.:29 and/or 30 from Dengue virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 29 and 30.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprises or consists of the target disruption structures selected from the list consisting of SEQ ID NOs.: 80, 81 and/or 82 from Chikungunya, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 33, 35, and 31.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprise or consist of the target disruption structure of SEQ ID NO.: 83 from West Nile and the target hybridization regions is SEQ ID NO.: 37.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprise or consists of the target disruption structures selected from the list consisting of SEQ ID NOs.: 84, 58, 85, 86, and/or 87 from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 62, 58, 59, 60, and 61.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprise or consists of the target disruption structures selected from the list consisting of SEQ ID NOs.: 30 and/or 79 from Dengue Virus and Hepatitis C Virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 30 and 28.


Preferably, in the artificial circular RNA according to the first aspect or any of its embodiments, the at least one or more target disruption structures comprise or consists of the target disruption structures selected from the list consisting of SEQ ID NOs SEQ ID NOs.: 30 and/or 83 from Dengue Virus and West Nile Virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 30 and 37.


Preferably, the sequence of the artificial circular RNA according to the first aspect or any of its embodiments comprises, or preferably, consists of, the following nucleotides defined in: SEQ ID NO: 2, 3, 4, 5, 6 (for Hepatitis C virus); 8, 9, 10 (for Dengue virus); 12, 13, 14, 15, 39 (for Chikungunya virus); 16 and 17 (broad spectrum activity for both Hepatitis C virus and Dengue Virus); 24 and 19 (for West Nile Virus); 21, 22 and 23 (broad spectrum activity for both Dengue and West Nile Viruses); 32 (broad spectrum activity for both Hepatitis C virus and Dengue Virus); 36, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 65, 66, 67, 68, 69, 70, 71, 72 (for Severe acute respiratory syndrome coronavirus 2).


Preferably, the one or more target hybridization region of the artificial circular RNA which completely hybridize with the two or more hybridization regions is comprised in the artificial RNA defined in SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11, SEQ ID NO.: 34 and/or SEQ ID NO.: 20.


In a second aspect, the present invention relates to a composition comprising the artificial RNA of the invention.


In a third aspect, the present invention relates to a kit comprising the artificial RNA and/or the composition of the present invention.


In a fourth aspect, the present invention relates to the artificial RNA and/or the composition of the present invention for use as a medicament, preferably for use in a method of preventing and/or treating a viral infection. Preferably, the viral infection is caused by Hepatitis C virus, Hepatitis A virus, Poliovirus, Influenza virus, Coxsackie B virus, rhinovirus (common cold), Dengue, Zika, Chikungunya, West Nile, Yellow Fever virus or coronavirus, such as SARS and/or MERS, preferably SARS-CoV-2.


In a sixth aspect, the present invention provides a method of screening for artificial circular RNA comprising two or more hybridization regions capable of disrupting by hybridization one or more target disruption structures of one or more RNA fragments, wherein the target disruption structures are defined as:

  • i. a first region with at least a hairpin loop preceded or followed by a second region of unpaired nucleotides; and
  • ii. as comprising at least one target hybridization region which comprises a single-stranded region of at least 2 nucleotides, preferably 3 nucleotides or more preceded or followed by a double-stranded region of at least 5 nucleotides, preferably 10 nucleotides or more, and wherein the method comprises the steps of:
    • a) identifying the two or more hybridization regions of the artificial circular RNA as those regions that have a total of between 7 and 100 nucleotides in length, preferably between 10 and 50 nucleotides that, when hybridizing with the at least one target hybridization region, the energy of the hybridization between the two or more hybridization regions and the at least one target hybridization region is more negative than the energy of the target disruption structure, thereby disrupting the one or more target disruption structure; wherein the the two or more hybridization regions comprised in the artificial circular RNA, are identified by RNA inverse folding tools, such as NUPACK, RNAifold, or MoiRNAiFold;
    • b) designing an artificial circular RNA comprising the two or more hybridization regions capable of disrupting the one or more target disruption structures as identified in step a), wherein said artificial circular RNA is between 150 and 800 nucleotides in length, preferably between 200 and 600 nucleotides; and
    • c) optionally selecting the artificial circular RNA capable of disrupting by hybridization the one or more target disruption structures as designed in step b), and optionally packaging it into a product.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 represents schematically the intracellular production of antiviral circRNA. This figure describes how a circular RNA can be produced within the target cell. First, the figure shows a plasmid containing a CMV promoter, two complementary and repetitive regions surrounding the candidate circular RNA and flanking splicing acceptor and donor sites. This plasmid is transfected into the target cell. The cell then transcribes the linear RNA as shown, and the area between the splice donor and acceptor sites gets circularized through backsplicing.



FIG. 2. Synthesis and circularization of RNA. Workflow composed of four major steps: (A) production of T7 promoter-flanked templates by PCR. (B) RNA preparation by in vitro transcription. (C) Generation of specific termini for ligation. In vitro transcribed RNAs have to be dephosphorylated prior in vitro circularization. (D) Ligation with T4 RNA Ligase 1 or circRNA Ligase. Circular or linear oligomers can be formed as side products.



FIG. 3 represents schematically the mode of action.This figure shows the mode of action of a circular RNA as it hinders viral cycle. Viruses contain RNA structures in their genome that are vital for their life cycles. The circular RNA targets those structures by binding to them in a way that a conformational change occurs that hinders vital steps of the virus life cycle.



FIG. 4 represents schematically an example of a relevant mode of action. This figure shows an example of how hybridization of the circular RNA can alter viral cycle. First, RNA binding proteins (RBPs) are necessary for many steps in the viral life cycle. These RBPs generally bind specific regions of the viral genome, where both sequence and structure (or structural context) are necessary. Similar to the figure, an example is the binding of PTB in the last domain of the IRES element of many picornaviruses, which binds to a box of single stranded pyrimidines immediately 3′ of a stable haripin. As in the right drawing, when a circular RNA binds a certain structured region of the IRES and the single stranded region preceding this structured region, it changes the RNA structure in such a way that the box of pyrimidines is not in the same estructural context anymore, and therefore the RBP cannot bind to it.



FIG. 5 represents an example of a circRNA that targets 3 different regions of the viral genome (or 3 different viral genomes) with 2 hybridization sequences per target region. Regions with the same color represent that they target the same viral region.



FIG. 6 represents schematically the RNA secondary structure of the beginning and end of the HCV genome. Highlighted are the regions to which our circular RNAs are designed to target to.



FIG. 7 represents schematically the results of 4 of the designed RNAs against HCV genome. The ids of the circRNAs correspond to the target regions shown in the previous figure. As it can be seen, infection is lowered up to 20% with respect to the control.



FIG. 8 represents schematically the RNA secondary structure of the DENV genome. Highlighted are the regions to which our circular RNAs are designed to target to.



FIG. 9 represents schematically the results of 3 of the designed RNAs against DENV genome. The ids of the circRNAs correspond to the target regions shown in the previous figure. As it can be seen, infection is lowered up to 40% with respect to the control.



FIG. 10 represents the results of the 4 designed RNAs against CHIKV genome. As it can be seen, infection is lowered up to 50% with respect to the control.



FIG. 11 represents the results of a broadspectrum circRNA designed against both DENV and HCV genomes when used to treat DENV infection. HCV_CDS2 is one of the circRNAs in example 1 and used here as negative control. DENV1_chp is one of the circRNAs in example 2 and used here as positive control.



FIG. 12 represents the results of a broadspectrum circRNA designed against both DENV and HCV genomes when used to treat HCV infection. HCV_CDS2 is one of the circRNAs in example 1 and used here as positive control. DENV1_chp is one of the circRNAs in example 2 and used here as negative control.



FIG. 13 represents the results of a second broadspectrum circRNA designed against both DENV and HCV genomes when used to treat DENV infection. HCV_CDS2 is one of the circRNAs in example 1 and used here as negative control. DENV1_chp is one of the circRNAs in example 2 and used here as positive control.



FIG. 14 represents the results of a second broadspectrum circRNA designed against both DENV and HCV genomes when used to treat HCV infection. HCV_CDS2 is one of the circRNAs in example 1 and used here as positive control. DENV1_chp is one of the circRNAs in example 2 and used here as negative control.



FIG. 15 represents the results of the two designed RNAs against West Nile virus (WNV) genome, circ wnv_slll 1 and circ wnv_slll 2. As it can be seen, infection is lowered with respect to the control.



FIG. 16 represents the results of three broadspectrum circRNAs designed against both WNV and DENV (dchp_wsll_A, dchp_wsll_B and dchp_wsll_C) when used to treat WNV infection. Positive and negative controls from examples 2 and 5 were used. As it can be seen, all circRNA showed inhibition.



FIG. 17 represents the results of three broadspectrum circRNAs designed against both WNV and DENV (dchp_wsll_A, dchp_wsll_B and dchp_wsll_C) when used to treat DENV infection. Positive and negative controls from examples 2 and 5 were used. As it can be seen, all circRNA showed inhibition.



FIG. 18 represents the capacity of the designed RNA against HCV in inhibiting chronically infected cells with HCV. CircRNAs inhibit infectivity in HCV chronically infected cells. Huh7/Scr cells were infected with HCV and 48hpi transfected with circ_hcv_cds2. Two days later luciferase values were measured. Effects on infectivity are determined by changes in luciferase expression levels.



FIG. 19 represents the result of the designed RNA against a region required for HCV RNA replication and its ability to inhibit HCV replication. Circ_hcv_cds2, which targets a region required for HCV RNA replication, inhibits HCV RNA replication. Circ_hcv_cds2 inhibited luciferase levels 48 hours post infection when HCV RNA is translated and replicated but not at 4 hours post infection when HCV RNA is solely translated. Effects on infectivity are determined by changes in luciferase expression levels. Statistical significance was calculated using a T-test (*represents p-value < 0.05).



FIG. 20 represents the result of the designed RNA against a region required for DENV RNA replication and its ability to inhibit DENV replication. Circ_dv_3utr and circ_dv_cHP_v1, designed to target structures within the DENV RNA genome directing RNA replication, inhibit DENV RNA replication. The circ_dv_3utr and circ_dv_cHP_v1 inhibit luciferase expression levels at 48 hours when the RNA genome is translated and replicated but not at 8 hours when is solely translated. All Results were obtained from at least three biological replicates. Statistical significance was calculated using a T-test (*represents p-value < 0.05).



FIG. 21. Artificial circRNA structure and mode of action. 1) CircRNAs contain several different hybridization (brown regions H) and separation sequences (light grey regions S). Hybridization sequences target the viral RNA genome (dark grey regions) and separation sequences allow for structural flexibility and physical separation among the hybridization ones. Note that all H and S sequences are different among themselves. 2) Hybridization regions are designed to target and disrupt a particular viral RNA genome structure, leading to a decrease in infectivity. The hybridization starts in a single stranded region, an external or hairpin loop or a pseudoknot and finish within a helix, so that the helix is disrupted.



FIG. 22. WNV structures used for the design of circWNV. Representation of the 5′-UTR (above) and 3′-UTR (below) from WNV genome. In red the hybridization regions used for the design of the circWNV. UTR: untranslated region [Adapted from Fernandez-Sanlés et al., 2017, Front. Microbiol. 8, 1-16].



FIG. 23. Schematic CHIKV structures used for the design of circCHIKV. Representation of the predicted 5′-UTR (A), RSE (B) and Recording Element (C). In A and B all the structure is targeted by the circRNA in C, the hybridization region is depicted in red. UTR: untranslated region; RSE: repetitive sequence elements. [Adapted from Kendra et al., 2018, Virology 339, 200-212; and from Khan et al., 2002, J. Gen. Virol. 83, 3075-3084].



FIG. 24. Designed broad-spectrum circRNAs impair both DENV and HCV infectivity. Cells were transfected with the circRNA dv_chp_v1, the circRNA hcv_cds2 or the broad-spectrum circRNA (circ dchp_hcv_cds2_2) containing hybridization sequences from circRNA dv_chp_v1 and circRNA hcv_cds2. Next, cells were infected either with DENV or HCV harbouring the luciferase reporter gene and 48h later the infectivity was measured. All results were obtained from at least three biological replicates. Effects on infectivity are determined by changes in luciferase expression levels. Statistical significance was calculated using a T-test (*represents p-value < 0.05).



FIG. 25. Depicts the protocol to obtain circular RNAs in vitro.



FIG. 26. Shows the results of both a circular RNA against DNV and WNV and a circular RNA against HCV generated in vitro.



FIG. 27. Shows types of target disruption structures (inner line) and target hybridization regions (outer line).



FIG. 28. Exemplifies the relationship between target disruption structure, target hybridization region and hybridization region, and it shows the mechanism of disruption by hybridization.



FIG. 29. Comparison of cleavage efficiency of different Hammerhead ribozymes.



FIG. 30. Gel with different magnesium conditions.



FIG. 31. Gel showing different IVT times.



FIG. 32. Gel showing the RNAse R effect without gel purification.



FIG. 33. Shows the efficacy results of the circRNAs designed against SARS-Cov2.



FIG. 34. Shows the efficacy of an in vitro generated circRNA against SARS-Cov2.





DETAILED DESCRIPTION OF THE INVENTION
Definitions

In describing the present disclosure, the following terms will be used and are defined as indicated below.


The forms “a”, “an” and “the” include plural referents unless the context states otherwise.


The term “about” when referred to a given amount or quantity is meant to include deviations of plus or minus five percent.


The term “artificial circular RNAs” or “circular RNAs” or “circRNAs” is used herein to refer to non-coding RNAs forming covalently closed continuous loops which have the 3′ and 5′ ends joint together, thus they are missing the 5′-cap and in consequence the polyadenylated tail. Therefore, they are resistant to exonuclease-mediated degradation and to debranching enzymes, which confers them higher stability with respect to other RNAs.


The term “complementary” and “complementarity” are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). 100% (or total) complementary refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region. Less than perfect (or partial) complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can hydrogen bond with each other and can be expressed as a percentage.


The term “hybridization” is used to refer to the structure formed by 2 independent strands of RNA that form a double stranded structure via base pairings from one strand to the other. These base pairs are considered to be G-C, A-U and G-U. (A - Adenine, C -Cytosin, G-Guanine, U - Uracil). As in the case of the complementarity, the hybridization can be total or partial.


The term “transfection or “transfect” is used to refer to the uptake of circular RNA by a cell. A cell has been “transfected” when the circular RNA has been introduced inside the cell membrane.


“Stem-loop intramolecular base pairing” (“stem-loops”) is a pattern that can occur in single-stranded DNA or, more commonly, in RNA. The structure is also known as a “hairpin” or “hairpin loop”. It occurs when two regions of the same strand, usually complementary in nucleotide sequence when read in opposite directions, base-pair to form a double helix that ends in an unpaired loop. The resulting structure is a key building block of many RNA secondary structures. The base-pairing of the helix need not be complete, there could be stretches of single stranded nucleotides, which are called “bulges” or “internal loops”. As an important secondary structure of RNA, it can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.


“Internal-loops” (also termed “interior loops”), in RNA, are found where the double stranded RNA separates due to no Watson-Crick base pairing between the nucleotides. Internal-loops can be classified as either symmetrical or asymmetrical, with some asymmetrical internal-loops, also known as bulges. Internal-loops differ from stem-loops as they occur in the middle of a stretch of double stranded RNA.


“External-loops” are stretches of single-stranded nucleotides that separate hairpin loops or multi-loops.


“Multi-loops” are branching off of a double-stranded region into several hairpin loops.


In the context of the present invention a “target disruption structure” is a stem loop (or hairpin loop), preferably preceded or followed by a stretch of unpaired nucleotides, (external loop, bulge or internal loop or multiloop, see FIG. 27).


In the context of the present invention, a “target hybridization region” is a region within a target disruption structure composed of a single stranded region preceded or followed by a double-stranded region. The target hybridization region is thus a region that, upon hybridization of another RNA strand, yields the disruption of the structure to which it belongs to.


“Disruption by hybridization”: given a target disruption structure, a target hybridization region and an artificial RNA that completely hybridizes with the target hybridization region, disruption by hybridization occurs when the energy of the hybridization is more favourable than the energy of the target disruption structure (more negative). Upon such hybridization, the structure of the target disruption structure changes, at least, completely for the overlap between the target disruption structure and the target hybridization region. Such energy calculations can be obtained in silico using well established software like RNAcofold (Lorenz, Ronny and Bernhart, Stephan H. and Höner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L., ViennaRNA Package 2.0, Algorithms for Molecular Biology, 6:1 26, 2011, doi:10.1186/1748-7188-6-26; Reuter, J. S., & Mathews, D. H. (2010). RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics. 11,129; Mathews, D. H., et al., “Predicting oligonucleotide affinity to nucleic acid targets”, RNA, 1999 5: 1458-1469), RNAstructure (https://rna.urmc.rochester.edu/RNAstructure.html), Mfold (http://unafold.rna.albany.edu/?q=mfold, M. Zuker, “Mfold web server for nucleic acid folding and hybridization prediction”, Nucleic Acids Res. 31 (13), 3406-3415, 2003) or Vienna package (http://rna.tbi.univie.ac.at/; Lorenz, Ronny and Bernhart, Stephan H. and Höner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L., ViennaRNA Package 2.0, Algorithms for Molecular Biology, 6:1 26, 2011, doi: 10.1186/1748-7188-6-26).


“Viral conserved structure” refers to viral genomic RNA structures which are conserved among members of the same species, genus, family, etc. Those structures are sometimes characterized in the literature and have been experimentally validated. In the absence of such experimental proof, there exists software that can predict such structures in silico. For instance, all viral genomes of the same family can be aligned, using for example ClustalW, and then using RNAz (RNAz 2.0: Improved noncoding RNA detection, Gruber AR, Findeiβ S, Washietl S, Hofacker IL, Stadler PF. Pac Symp Biocomput. 15:69-79, 2010; Nucleic Acids Res. 1994 Nov 11; 22(22): 4673-4680, doi: 10.1093/nar/22.22.4673, PMCID: PMC308517, PMID: 7984417; CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, J D Thompson, D G Higgins, and T J Gibson). RNAz predicts structured regions that are more thermodynamically stable than expected by comparison to random sequences of the same length and sequence composition (z-score), and additionally assesses regions by the support of compensatory and consistent mutations in the sequence alignment. Such conserved structures are believed to be so due to its functional relevance in the life-cycle of the virus. Within example 14, we show how some these viral conserved structures have been found.


The term 5′UTR refers to the region upstream of the coding region, immediately before the start codon.


The term “IRES” is defined as an internal ribosome entry site and is an RNA element that allows for translation initiation in a cap-independent manner, as part of the greater process of protein synthesis. In eukaryotic translation, initiation typically occurs at the 5′ end of mRNA molecules, since 5′ cap recognition is required for the assembly of the initiation complex. The location for IRES elements is often in the 5′UTR, but can also occur elsewhere in mRNAs.


The term CDS refers to the coding region of a messenger RNA or a viral genome. This is the region that codes for the corresponding protein.


The term 3′UTR refers to the region of the viral genome downstream of the CDS, immediately after the stop codon.


The term “cHP” means “capsid-coding region hairpin element” which is a known region of several flavivirus genomes found within the CDS.


The term “RSE” means “conserved repeated sequence element” and it is a known structure found in the 3′UTR of several alphavirus genomes.


“SRVVLC”, structured region vital for the viral life cycle, are structured regions of the RNA viral genome which are vital in the viral replication, encapsidation and/or translation, i.e., if disrupted, the virus is less capable of performing essential functions of its life cycle and thus, the virus is less infective.


“Administering” an artificial RNA to a cell comprises transducing, transfecting, electroporating, translocating, fusing, phagocytosing, shooting or ballistic methods, etc., i.e., any means by which a nucleic acid can be transported across a cell membrane.


“Homology region” refers to regions in different virus strains/serotypes which share common structural and/or functional characteristics. Homologous structures do not imply sequence identity as a necessary condition. The skilled person is able to identify homologous regions in other viral strains/serotypes as the ones defined in the present application by conventional means.


The degree of identity between two sequences can be determined by conventional methods, for example, by means of standard sequence alignment algorithms known in the state of the art, such as, for example BLASTn (Altschul S.F. et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215(3):403-10).


During the description of the claims, the word “comprising”, and its variants does not intend to exclude other technical characteristics, additives, components or steps. In addition, the term “comprising” may also encompass the term “consisting of”.


Description of the Invention

In general, RNA fragments such as mRNA, tRNA, rRNA, non-coding RNA, viral RNA genomes, viral mRNAs, etc., contain highly structured regions (regions with secondary structure) which are either essential for their function or which, while not being essential, may play a more or less important role in the functionality of said RNA fragment. These highly structured regions comprise hairpin loops or at least portions of hairpin loops preceded or followed by a region of unpaired nucleotides. If the structure (such as the secondary structure) of these hairpin loops or portions of hairpin loops is altered, conformational changes within the RNA fragment take place. This would lead to changes in the functionality of the RNA fragment.


Biological RNA is single stranded and often forms complex and intricate base-pairing interactions due to its increased ability to form hydrogen bonds stemming from the extra hydroxyl group in the ribose sugar. The secondary structure of RNA consists of a single polynucleotide which is folded within the same molecule. Base pairing in RNA occurs when RNA folds between complementarity regions. Both single- and double-stranded regions are often found in RNA molecules. The antiparallel strands form a helical shape. The four basic elements in the secondary structure of RNA are helices, loops, bulges, and junctions. Stem-loop or hairpin loop is the most common element of RNA secondary structure. Stem-loop is formed when the RNA chains fold back on themselves to form a double helical tract called the stem, the unpaired nucleotides form a single stranded region called the loop.


The secondary structure of RNA can be predicted either computationally or with experimental methods. Computationally, RNA secondary structure can be predicted from one or several nucleic acid sequences using tools publically available to the skilled person, e.g., Vienna package, as described above.


As outlined above, RNA structure such as RNA secondary structure is important in many biological processes, including translation regulation in messenger RNA, replication of single-stranded RNA viruses, and the function of structural RNAs and RNA/protein complexes. In fact, for many RNA molecules, the secondary structure is highly important to the correct function of the RNA — often more so than the actual sequence.


Hence, changes in the secondary structure of the RNA fragments will inevitably lead to changes in the functionality of the RNA fragments.


The artificial RNAs of the present invention, preferably circRNAs, are able to change the secondary structure of the RNA fragments they target. Accordingly, with the artificial RNAs of the present invention it is possible to modulate the functionality of the target RNA fragments. For instance, within viral genomes, there are highly structured regions which are vital for the viral life cycle (SRVVLC). If these regions are altered in their conformation or secondary structure (e.g., disrupted), the virus would be less capable (and, preferably incapable) of performing essential functions of its life cycle. Accordingly, altering the conformation or secondary structure of these regions vital for the viral life cycle would lead the virus less infective, ideally totally ineffective. The same principle can be applied to other RNA fragments. For instance, a change in the conformation of a tRNA molecule can lead to a decrease (or increase) in the efficiency of translation of that specific tRNA. For instance, a change in the secondary structure of an mRNA molecule can lead to a decrease (or to an increase) in the binding affinity of that mRNA molecule and a certain protein or even the ribosome and thus affect its translation rate. Changes in the structure of an IRES element, both viral and cellular, can affect translation initiation. Changes in the structure of the UTRs of an mRNA can obscure miRNA binding sites, thus affecting translation regulation of such mRNA. Changes in the structure of intronic regions can affect splicing, etc.


In particular, the artificial RNAs of the present invention, preferably circRNAs, are able to hybridize with specific regions within the target RNA fragment. In doing so, the artificial RNAs of the present invention, preferably circRNAs, are able to disrupt these specific target regions within the target RNA fragment. These “specific regions within the target RNA fragment” are the so-called “target disruption structures”.


The target disruption structures comprise at least a hairpin loop preceded or followed by a region of unpaired nucleotides, and also comprise the so-called “target hybridization region(s)”. The target hybridization regions are regions within the target disruption structures which comprise a single-stranded region of at least 2 nucleotides, preceded or followed by a double-stranded region.


The artificial RNAs of the present invention, preferably circRNAs, hybridize with the target hybridization regions through the so-called “hybridization regions”. In other words, the artificial RNAs of the present invention, preferably circRNAs, comprise at least one hybridization region, which is a region of the artificial RNA which is able to completely hybridize with one or more target hybridization regions comprised in the target disruption regions of the target RNA fragment.


Hybridization (or hybridisation) is a phenomenon in which two RNA molecules anneal to each other via base pairing interactions. In the context of this invention only canonical base pairings are considered (C-G,A-U and G-U). By “complete hybridization” it is understood that all of the nucleotides of the hybridization region of the artificial RNA anneal with all of the nucleotides of the target hybridization region.


When the hybridization region completely hybridizes with the target hybridization region, the energy of the hybridization between the hybridization region and the target hybridization region is more negative than the energy of the target disruption region. When this happens, the target disruption structure is disrupted, i.e., the secondary structure of the target RNA fragment is altered. Hence, the functionality of the target RNA fragment is also altered: the functionality of the RNA fragment has been modulated by the artificial RNA of the present invention. This can be reproduced, and thus candidates for hybridization region that completely hybridize with the target hybridization region can be easily found, by using RNA design tools such as NUPACK or RNAiFold once the target hybridization region is known as explained below.


In a first aspect, the present invention relates to artificial RNAs, preferably circRNAs, suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments.


By “disrupting by hybridization one or more target disruption structures of one or more RNA fragments” it is understood, in the context of the present invention, that the secondary structure of the one or more target disruption structures of one or more RNA fragments is altered when a hybridization region of the artificial RNA of the present invention completely hybridizes with the corresponding target hybridization region of the target disruption structure.


The artificial RNA of the invention, preferably circRNA, can be of any length as long as it comprises at least one hybridization region as described in the present invention and is suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments. Preferably, the RNA of the present invention, preferably circRNA, comprises between 100 and 1000 nucleotides, more preferably between 150 and 800 nucleotides, and even more preferably between 200 and 600 nucleotides.


As described above, the artificial RNA of the present invention, which is preferably a circular RNA, comprises at least one hybridization region. The at least one hybridization region is a region of the artificial RNA (i.e., a sequence of nucleotides) which completely hybridizes with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments. The number of nucleotides of the hybridization region is not limited as long as it is able to completely hybridize with at least one target hybridization region, although preferably it has the same length as the target hybridization region, comprised in the one or more target disruption structures and, in doing so, disrupts (i.e., alters the secondary structure) of the one or more target disruption structures.


In a preferred embodiment, the at least one hybridization region has a total of between 7 and 100 nucleotides, more preferably between 10 and 50 nucleotides, even more preferably between 15 and 35 nucleotides, such as between 15 and 25 nucleotides.


As described above, the hybridization region completely hybridizes with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments. The target disruption structures are regions of the RNA fragments which comprise at least a portion of a hairpin loop preceded or followed by a region of unpaired nucleotides. The target disruption structures comprise at least one target hybridization region. The target hybridization regions are regions (i.e., a sequence of nucleotides) which comprises a single-stranded region of at least 2 nucleotides preceded or followed by a double-stranded region. The length of the target hybridization region is not limited as long as it comprises a single-stranded region of at least 2 nucleotides preceded or followed by a double-stranded region and is able to completely hybridize with the at least one hybridization region of the artificial RNA. Preferably, the single-stranded region of the target hybridization region comprises 3 nucleotides or more, such as 3, 4, 5, 10, 15 nucleotides or more. Preferably the double-stranded region of the target hybridization region comprises 5 nucleotides or more, such as 5, 7, 10, 15, 20, 25 nucleotides or more.


Importantly, the hybridization region of the artificial RNA of the present invention, which is preferably a circular RNA, completely hybridizes with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments. Hence, the at least one hybridization region of the artificial RNA of the present invention has exaclty the same number of nucleotides than the at least one target hybridization region with which it hybridizes. Consequently, the at least one hybridization region of the artificial RNA of the present invention has a first region of a certain number of nucleotides which completely hybridizes with the single-stranded region of the target hybridization region, and a second region of a certain number of nucleotides which completely hybridizes with the double-stranded region of the target hybridization region.


In other words, in a first step, the single-stranded region of the target hybridization region anneals with certain nucleotides of the hybridization region of the artificial RNA, which is preferably a circular RNA. In a second step, the double-stranded region of the target hybridization region, which precedes or follows the single-stranded region, is disrupted, and new interactions are formed between one strand of the double-stranded region of the target hybridization region and certain nucleotides of the hybridization region of the artificial RNA, which anneal to each other. The disruption of the double-stranded region of the target hybridization region occurs when the energy of the hybridization between the at least one hybridization region and the at least one target hybridization region is more negative (more favourable) than the energy of the target disruption region. The energy of hybridization and the capacity of disrupting the one or more target disruption structures can be measured, for example, with RNAcofold; the identification of potential candidates of the hybridization regions of the artificial RNA of the present invention characterized by having an energy of the hybridization between the at least one hybridization region and the at least one target hybridization region more negative (more favourable) than the energy of the target disruption region, can be easily identified by RNA inverse folding tools, such as NUPACK, RNAifold, or MoiRNAiFold as illustrated in example 4.


As a result, at least the double-stranded region of the target hybridization region is disrupted and, hence, the target disruption structure is also disrupted. Hence, the structure of the target disruption structure changes, at least, completely for the overlap between the target disruption structure and the target hybridization region. Therefore, the secondary structure of the target RNA fragment is changed and, thus, its functionality is also altered.


The hybridization between the hybridization region of the artificial RNA and the target hybridization region of the target disruption structures of the RNA fragment can be followed in vitro or in vivo. The change in secondary structure of the RNA fragment can also be checked employing techniques well-known in the art such as SHAPE (Poulsen, Line Dahl et al. “SHAPE Selection (SHAPES) enrich for RNA structure signal in SHAPE sequencing-based probing data.” RNA (New York, N.Y.) vol. 21,5 (2015): 1042-52. doi:10.1261/rna.047068.114) or PARIS (Lu Z, Gong J, Zhang QC. PARIS: Psoralen Analysis of RNA Interactions and Structures with High Throughput and Resolution. Methods Mol Biol. 2018;1649:59-84. doi: 10.1007/978-1-4939-7213-5_4).


Consequently, the at least one hybridization region comprised in the artificial RNA of the present invention is further characterized because, when hybridizing with the target hybridization region, the energy of the hybridization between the at least one hybridization region and the at least one target hybridization region is more negative than the energy of the target disruption region, thereby disrupting the target disruption structure. As discussed above, the skilled person is able to predict the energy of the hybridization between the at least one hybridization region and the at least one target hybridization region and the energy of the target disruption region. Available tools for this prediction are, e.g., well established software like RNAcofold (Lorenz, Ronny and Bernhart, Stephan H. and Höner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L., ViennaRNA Package 2.0, Algorithms for Molecular Biology, 6:1 26, 2011, doi: 10.1186/1748-7188-6-26; Reuter, J. S., & Mathews, D. H. (2010). RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics. 11,129, Mathews, D. H. et al., “Predicting oligonucleotide affinity to nucleic acid targets”, RNA, 1999 5: 1458-1469), RNAstructure (https://rna.urmc.rochester.edu/RNAstructure.html), Mfold (http://unafold.rna.albany.edu/?q=mfold, M. Zuker, “Mfold web server for nucleic acid folding and hybridization prediction”, Nucleic Acids Res. 31 (13), 3406-3415, 2003) or Vienna package (http://rna.tbi.univie.ac.at/), as described in detail above.


Preferably, the energy of the hybridization between the at least one hybridization region and the at least one target hybridization region and the energy of the target disruption region is preferably calculated with RNAcofold software, with the settings as described in Mathews, D. H., et al., “Predicting oligonucleotide affinity to nucleic acid targets”, RNA, 1999 5: 1458-1469. It is however noted that such calculation shall be unnecessary when RNA inverse folding tools, such as NUPACK, RNAifold, or MoiRNAiFold, are used for the identification of potential candidates of the hybridization regions of the artificial RNA of the present invention characterized by having an energy of the hybridization between the at least one hybridization region and the at least one target hybridization region more negative (more favourable) than the energy of the target disruption region.


For a given RNA fragment, the skilled person is able to identify potential target disruption structures, since these are regions of RNA which comprise at least a portion of a hairpin loop preceded or followed by a region of unpaired nucleotides. There are many RNA structure prediction software available to the skilled person and that predict the secondary structure of a given RNA sequence. For instance, we refer to Mathews, D. H., et al. “RNA secondary structure prediction.” Current protocols in nucleic acid chemistry vol. Chapter 11 (2007): Unit 11.2. doi:10.1002/0471142700.nc1102s28.


In addition, the skilled person is able to identify one or more target hybridization regions within the target disruption structure, because the target hybridization region is comprised in the target disruption structure and comprises a single-stranded region of at least 2 nucleotides preceded or followed by a double-stranded region, as defined above.


Once a target hybridization region is identified, the skilled person, as indicated above, is able to design one or more hybridization regions which would completely hybridize with the target hybridization region. Similarly as above, the skilled person is aware of several software for the design of RNA sequences which would completely hybridize with a given RNA sequence, e.g., NUPACK (http://www.nupack.org/design/new, see also B. R. Wolfe, N. J. Porubsky, J. N. Zadeh, R. M. Dirks, and N. A. Pierce, “Constrained multistate sequence design for nucleic acid reaction pathway engineering”, JAm Chem Soc, 139:3134-3144, 2017; B. R. Wolfe and N. A. Pierce, “Sequence design for a test tube of interacting nucleic acid strands”, ACS Synth Biol, 4:1086-1100, 2015; J. N. Zadeh, B. R. Wolfe, and N. A. Pierce, “Nucleic acid sequence design via efficient ensemble defect optimization” J Comput Chem, 32:439-452, 2011; and R. M. Dirks, M. Lin, E. Winfree, and N. A. Pierce, “Paradigms for computational nucleic acid design” Nucl Acids Res, 32:1392-1403, 2004.) or RNAiFold (https://bioinformatics.bc.edu/clotelab/RNAiFold/, see also Juan Antonio Garcia-Martin, Peter Clote, Ivan Dotu, “RNAiFold: A constraint programming algorithm for RNA inverse folding and molecular design, J Bioinform Comput Biol 11(2): 1350001, 2013; and Garcia-Martin JA, Dotu I, Clote P., “RNAiFold 2.0 A web server and software to design custom and Rfam-based RNA molecules”, Nucleic Acids Research Web Server issue, 2015, doi: 10.1093/nar/gkv460, “RNAiFold 2.0 A web server and software to design custom and Rfam-based RNA molecules”). Moreover, it is possible to ascertain whether a certain target disruption structure can be disrupted by hybridization given a particular target hybridization region. This can be achieved using several RNA inverse folding or RNA design tools publicly available, such as NUPACK (http://www.nupack.org/design/new), RNAiFold (http://bioinformatics.bc.edu/clotelab/RNAiFold/) or its recent extension MoiRNAiFold (https://moiraibiodesign.com/design/).


For instance, in RNAiFold (and MoiRNAiFold), given any specific target disruption structure, such as the one shown in FIG. 28 (AAUAGAGUCCUGCCCAUUGGCGGG) and its target hybridization region (GAGUCCUGCC), one can use the following input file:









#RNAscdstr((((((((((&....))))))))))..........#RNAs


eqconNNNNNNNNNN&AAUAGAGUCCUGCCCAUUGGCGGG






Wherein the input of ((((((((((&....)))))))))).......... corresponds to the well established dot bracket notation (see, e.g. RNAlib-2.4.18: RNA Structure Notations (univie.ac.at), and wherein the input NNNNNNN&AAUAGAGUCCUGCCCAUUGGCGGG indicates that every “N” is a nucleotide (any nucleotide A,C,G or U) corresponding with “(” above and that has to hybridize with the corresponding “)” indicated above. That is, the RNAiFold (and MoiRNAiFold) should return a solution (or multiple ones) of potential hybridization regions that can indeed disrupt the target disruption structure AAUAGAGUCCUGCCCAUUGGCGGG upon complete hybridization to the target hybridization region GAGUCCUGCC .


In this case, a sample set of 10 solutions return by the RNA inverse folding tool was the following:










GGCGGGGCUC&AAUAGAGUCCUGCCCAUUGGCGGGGGUGGGGCUC&AAUA



GAGUCCUGCCCAUUGGCGGGGGCAGGGCUC&AAUAGAGUCCUGCCCAUUG


GCGGGGGUAGGGCUC&AAUAGAGUCCUGCCCAUUGGCGGGGGUGGGACUC


&AAUAGAGUCCUGCCCAUUGGCGGGGGCGGGACUC&AAUAGAGUCCUGCC


CAUUGGCGGGGGCAGGACUC&AAUAGAGUCCUGCCCAUUGGCGGGGGUAG GACUC&AAUAGAGUCCUGCCCAUUGGCGGGGGCGGGAUUC&AAUAGAGUC


CUGCCCAUUGGCGGGGGUGGGAUUC&AAUAGAGUCCUGCCCAUUGGCGGG






from which it follows first, that the target disruption structure can be disrupted via hybridization and second, that the hybridization regions (in bold) can be used to construct a circRNA (by separating these regions with random polynucleotide regions) that can disrupt by hybridization the target disruption structure.


Thus provided these input instructions, if the software tool returns a solution (or multiple ones) it means that the target disruption structure can indeed be disrupted by hybridization. From the set of solutions it follows the generation of the circRNA of this invention: by taking any number of these solutions (hybridization regions) and separating them by random nucleotides regions. Example 14 shows additional input files for several of the target disruption structures used as examples through this application.


In the context of this invention, hybridization region is a region within the artificial circular RNA capable of hybridizing with the target hybridization region in the RNA fragment of interest and disrupting by hybridization the target disruption structure (see FIG. 28 for a depiction of how all these concepts relate to each other). In a preferred embodiment, the energy of hybridization and the capacity of disrupting the one or more target disruption structures can be calculated with RNA inverse folding tools, such as NUPACK, RNAifold, MoiRNAiFold.


As indicated above, in a much preferred embodiment, the artificial RNA of the invention is a circular RNA. In this sense, the present inventors have found that the use of artificial RNA-based therapies as disclosed herein, preferably circular RNAs, has fundamental advantages over other RNA molecules:

  • Stability. On one hand, the circRNAs are extremely stable because of their unavailability to the cellular exonucleases. This stability would simplify their use in therapy, in contrast to the other current RNA-based therapies that require chemical modifications that are costly, unnatural, and could lead to toxicity concerns.
  • Resistance to the emergence and selection of escaping mutants. The designed artificial RNAs, such as circRNAs, preferably contain (i) longer sequences whose hybridization to target hybridization regions will not be affected by single mutations and (ii) multiple hybridization regions capable of completely hybridizing to multiple target hybridization regions in the viral RNA genome, hampering the emergence of resistant mutants by selection of single mutation.
  • Ability to address multiple targets. All current effective therapies involve molecules that target specific viral proteins and thus can cure only a single infection. By including in the designed artificial RNAs, such as circRNAs, hybridization regions able to hybridize with different target hybridization regions comprised in target disruption structures of different RNA fragments, such as different viral genomes, we will be able to target different RNA fragments, such as different viruses simultaneously. This broad-spectrum therapy is of great value (i) to simplify treatment of co-infections and (ii) to treat acute infections that share geographical locations and initial symptoms such as, for example, those caused by Dengue virus, Zika virus and Chikungynya virus, or those caused by SARS-CoV-2 and influenza. In acute infections early treatment is key to control the disease and epidemics. A broad-spectrum therapy will allow treating even before a final diagnosis is achieved. Moreover, during epidemics the use of such therapies as preventive treatments would be advisable.
  • Minimize the risk of drug resistance. Moreover, to minimize further the risk of drug resistance, hybridization regions in the designed artificial RNAs, such as circRNAs, (e.g., see FIG. 21) that target the same viral target disruption structure are all different as the artificial RNAs of the present invention, such as circRNAs, may advantageously comprise G-U pairing. In contrast to DNA where complementarity is required, G-U pairing is a valid hybridization pair in RNA.


In a further embodiment, the artificial RNA of the present invention, which is preferably a circular RNA, comprises at least one hybridization region, wherein the at least one hybridization region is capable of hybridizing target hybridization regions from different target disruption structures within the same RNA fragment, or even from different RNA fragments.


In a preferred embodiment, the artificial RNA of the present invention, which is preferably a circular RNA, comprises 2 or more hybridization regions, preferably between 6 and 20 hybridization regions. In a further preferred embodiment, at least two, and preferably all, of the hybridization regions are capable of completely hybridizing with the same target hybridization region. Hence, the artificial RNA according to this preferred embodiment would have more probabilities of disrupting the target disruption structure of the RNA fragment, and would then be more effective in modulating the functionality of the RNA fragment, especially RNA fragments which are prone to mutations (e.g., viruses and/or tumors). Hence, having multiple hybridization regions impacts mainly the mutant escaping capabilities of the virus/tumor.


In another more preferred embodiment, the RNA of the present invention, which is preferably a circular RNA, comprises at least two hybridization regions, wherein at least two, and preferably all, of the hybridization regions have different nucleotide sequences, i.e., are different from each other in terms of nucleotide sequence. Hence, in this preferred embodiment, the at least two hybridization regions, preferably all of the hybridization regions of the artificial RNA, are different from each other, and they all target (are capable of hybridizing) the same target hybridization region (“many-to-one” approach). This way, the artificial RNA according to this preferred embodiment would have more probabilities of disrupting the target disruption structure of the RNA fragment, and would then be more effective in modulating the functionality of the RNA fragment. Alternatively, the at least two hybridization regions, preferably all of the hybridization regions of the artificial RNA, which are different from each other, target (are capable of hybridizing) different target hybridization regions from different target disruption structures, either within the same RNA fragment or even from different RNA fragments.


In a further preferred embodiment, the two or more hybridization regions of the artificial RNA of the present invention are:

  • a) separated by non-hybridization regions of sizes up to 20 nucleotides; or
  • b) are not separated by non-hybridization regions; or
  • c) are overlapping.


Preferably, the one or more RNA fragments is selected from mRNA, tRNA, rRNA, non-coding RNA and viral genomic RNA. More preferably, the RNA fragment is viral genomic RNA. Even more preferably, the one or more RNA fragments is positive-sense single-stranded (ss) viral genomic RNA.


Viral RNA genomes and viral mRNAs contain highly structured regions (“target disruption structures”) comprising at least a portion of a hairpin loop preceded or followed by a region of unpaired nucleotides which are essential for their function. These highly structured regions are preferably structured regions vital for the viral life cycle (SRVVLC). If these regions are disrupted, the virus would be less capable (and, preferably incapable) of performing essential functions of its life cycle. Accordingly, disrupting these regions would render the virus less infective, ideally totally ineffective.


The present inventors have designed artificial RNAs, preferably circular RNAs, comprising at least one (and preferably more than one) hybridization region that hybridizes to at least one target hybridization region (such as one, or two, or more) within at least one target disruption structure (such as one, or two, or more) present in the viral genomic RNA and disrupts it, consequently reducing or even inhibiting viral infection. As described above, in a preferred embodiment, the artificial RNAs of the present invention comprise at least two (and preferably more) hybridization regions, which are different from each other, and which are able to completely hybridize with one target hybridization region within one target disruption structure present in the viral genomic RNA and disrupt it, consequently reducing or even inhibiting viral infection. In this way (“many-to-one” approach) the efficiency of the disruption is increased.


In one embodiment, the one or more target disruption structures is comprised in the IRES element of the viral genome. Preferably, the one or more target disruption structures comprised in the IRES element of the viral genome is a structured region vital for the viral life cycle (SRVVLC).


In another embodiment, the one or more target disruption structures is comprised in the 5′UTR and/or in the 3′UTR of the viral genome. Preferably, the one or more target disruption structures comprised in the 5′UTR and/or in the 3′UTR of the viral genome is a structured region vital for the viral life cycle (SRVVLC).


In a further embodiment, the one or more target disruption structures is comprised in the CDS of the viral genome. Preferably, the one or more target disruption structures comprised in the CDS of the viral genome is a structured region vital for the viral life cycle (SRVVLC).


In a further embodiment, the at least two hybridization region of the artificial RNA are capable of completely hybridizing with at least one target hybridization region comprised in at least one disruption structure present in any combination of two of the following locations: the IRES element, the region of the 5′UTR, the region of the CDS and/or the region of the 3′UTR of the viral genome.


In a further embodiment, the artificial RNA of the present invention, which is preferably a circular RNA, is able to disrupt by hybridization one or more target disruption structures comprised in at least two viral genomic RNAs. Preferably, the artificial RNA of the present invention is able to disrupt by hybridization one or more structured regions vital for the viral life cycle comprised in at least two viral genomic RNAs.


In a preferred embodiment, the disruption of the one or more structured regions vital for the viral life cycle renders the virus less active, more preferably the disruption of the one or more structured regions vital for the viral life cycle renders the virus completely inactive.


The viral genome as target RNA fragment (viral genomic RNA) is not limited. Any viral genome with target disruption structures (i.e., regions comprising at least a hairpin loop preceded or followed by a region of unpaired nucleotides) may be a suitable target RNA fragment for the artificial RNA of the present invention. Examples of viral genomes which may be target RNA fragments according to the present invention are the following: Hepatitis-C-Virus (HCV), Influenza virus, Hepatitis-A-Virus (HAV), Poliovirus, Coxsackie B virus, Coronavirus, Rhinovirus (common cold), Dengue virus, Zika virus, Chikungunya virus, West Nile virus and Yellow Fever virus.


In another preferred embodiment, the target disruption structures that the artificial RNA of the present invention, preferably in the artificial circular RNA of the present invention, is able to disrupt is a target disruption structure comprised in the 5′UTR of the viral genome. In a preferred embodiment, the target disruption structure of the 5′UTR region of the DENV (Dengue virus) genome is cHP (capsid coding hairpin region).


In another preferred embodiment, the target disruption structures that the artificial RNA of the present invention, preferably in the artificial circular RNA of the present invention, is able to disrupt is a target disruption structure comprised in the IRES element of the viral genome. In a preferred embodiment, the target disruption structure of the IRES element of the HCV (Hepatitis-C virus) viral genome is IRES1 and/or IRES2.


In another preferred embodiment, the target disruption structures that the artificial RNA of the present invention, preferably in the artificial circular RNA of the present invention, is able to disrupt is a target disruption structure comprised in the CDS of the viral genome. In a preferred embodiment, the target disruption structure of the CDS of the viral genome is CDS1 and/or CDS2. Preferably, the target disruption structure is selected from regions SL388, SL427, SL588 and/or SL750 of the genome of the HCV. In a preferred embodiment, the target disruption structure is region SL427 and/or region SL588 of the genome of the HCV (SL stands for Stem Loop).


In another preferred embodiment, the target disruption structures that the artificial RNA of the present invention, preferably in the artificial circular RNA of the present invention, is able to disrupt is a target disruption structure comprised in the 3′UTR of the viral genome. In a preferred embodiment, the target disruption structure of the 3′UTR region of the DENV genome is sHP (short Stem Loop or short Hairpin region). In a further preferred embodiment, the target disruption structure of the 3′UTR region of the WNV (West Nile virus) genome is SL_II.


In another preferred embodiment, in the circular RNA according to any of the preceding embodiments, the target disruption structures are found in a combination of two or more of the IRES element, the structured region of the 5′UTR, the structured region of the CDS or the structured region of the 3′UTR of the viral genome.


In another preferred embodiment, the target disruption structure of the CHIKV (Chikungunya virus) genome is the RSE region and/or the Recoding Element (RE).


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO.: 1. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 25 to 28, or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 28, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 28, or the homologe regions in another HCV strain/serotype.


In a preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes comprises the nucleotide sequence as defined in SEQ ID NO.: 25 to 27 (combination circ_hcv_ires1, circ HCV2 and circ_hcv_cds1, see Table 1 below) or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 27, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 27, or the homologe regions in another HCV strain/serotype.


The degree of identity between two sequences can be determined by conventional methods, for example, by means of standard sequence alignment algorithms known in the state of the art, such as, for example BLASTn (Altschul S.F. et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215(3):403-10).


“Homology region” refers to regions in different virus strains/serotypes which share common structural and/or functional characteristics. Homologous structures do not imply sequence identity as a necessary condition. The skilled person is able to identify homologe regions in other viral strains/serotypes as the ones defined in the present application by conventional means.





TABLE 1








CircRNAs designed against HCi98V


Name of the artificial circular RNA
Target disruption structure comprised in
Target hybridization region
SEQ ID NO.:
Hybridization regions of the artificial RNA




circ_hcv_ires1
IRES 1 SEQ ID NO.: 76
CUCCGCCAUGA AUCACUCCCCU GUGAGGAACUA SEQ ID NO.: 25
SEQ ID NO.:2
7


Circ HCV2
IRES 2 SEQ ID NO.: 77
UCUCGUAGACC GUGCACCAUGA GC SEQ ID NO.: 26
SEQ ID NO.:3
11


circ_hcv_cds1
CDS1 (target disruption structure: cHP) SEQ ID NO.: 78
CCAAAAGAAAC ACCAACCGUCG CCCAGA SEQ ID NO.: 27
SEQ ID NO.:4
8


circ_hcv_combo1
IRES- CDS
Combination circ_hcv_ires1, circ HCV2 and circ_hcv_cds1
SEQ ID NO.:5
3xtarget


circ_hcv_cds2
CDS2 SEQ ID NO.: 79
GGGGCCCCAGG SEQ ID NO.: 28
SEQ ID NO.:6 SEQ ID NO : 64
12


IRES: internal ribosomal entry site; CDS: coding sequence; cHP: capsid hairpin.






The different circRNAs designed against HCV are classified in the table with information of the target disruption structures which they disrupt by hybridization, the sequence of the target hybridization region which completely hybridizes with the hybridization region of the artificial RNA, the sequence of the whole circRNA and the number of hybridization regions present in each candidate (each artificial circular RNA).


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO.: 7. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 29 to 30 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 29 to 30, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 29 to 30, or the homologe regions in another DENV strain/serotype.





TABLE 2








CircRNAs designed against DENV


Name of the artificial circular RNA
Target disruption structure comprised in
Target hybridization region
SEQ ID NO.:
Hybridization regions of the artificial RNA




circ_dv_3utr
3′ UTR (target disruption structure: sHP) SEQ ID NO.: 29
AACAGCAUAU UGACGCUGGG AAAGACCAGA GA SEQ ID NO.: 29
SEQ ID NO.:8
7


circ_dv_cHP_v1
CDS (target disruption structure: cHP ) SEQ ID NO.: 30
ACGGAAAAAG GCGAAAAACA CGCCUUUCAA UAU SEQ ID NO.: 30
SEQ ID NO.:9
7


circ_dv_cHP_v2
CDS (target disruption structure: cHP ) SEQ ID NO.: 30
SEQ ID NO.: 30
SEQ ID NO.:10
7


UTR: untranslated region cHP: capsid region hairpin






The different circRNAs designed against DENV are classified in the table with information of the target disruption structures which they disrupt by hybridization, the sequence of the target hybridization region which completely hybridizes with the hybridization region of the artificial RNA, the sequence of the whole circRNA and the number of hybridization regions present in each candidate (each artificial circular RNA).


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in one or more of SEQ ID NO.: 1 and SEQ ID NO.: 7. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 30 and SEQ ID NO.: 28 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 30 and SEQ ID NO.: 28, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 30 and SEQ ID NO.: 28, or the homologe regions in another DENV/HCV strain/serotype.





TABLE 3








Broad-spectrum DENV-HCV circRNA


Name of the artificial circular RNA
Target disruption structure comprised in
Target hybridization region
SEQ ID NO.:
Hybridization regions of the artificial RNA




circ_dv_cHP_v 1_ circ_hcv_cds2_ 2
DENV: CDS (target disruption structure: cHP) HCV: CDS SEQ ID NOs.: 30 and 79.
ACGGAAAAAGGCGAAA AACACGCCUUUCAAUA U SEQ ID NO.: 30 GGGGCCCCAGG SEQ ID NO.: 28
SEQ ID NO: 32
4 x target


DENV cHP_HCV CDS2_T
DENV: CDS (target disruption structure: cHP) HCV: CDS2 SEQ ID NOs.: 30 and 79.
SEQ ID NO.: 30 SEQ ID NO.: 28
SEQ ID NO: 16
19


DENVlcHP_H CV CDS2_1
DENV: CDS (target disruption structure: cHP) HCV: CDS2 SEQ ID NOs.: 30 and 79.
SEQ ID NO.: 30 SEQ ID NO.: 28
SEQ ID NO: 17
4xtarget


cHP: capsid region hairpin CDS: coding sequence.






Information for circ_dv_cHP_v1-circ_hcv_cds2 of the two target disruption structures (DENV cHP and HCV CDS), the target hybridization regions, the sequence of the complete circRNA and the number of hybridization regions in each circRNA.


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO. 11. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 31, 33 and 35 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 31, 33 and 35, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 31, 33 and 35, or the homologe regions in another CHIKV strain/serotype.





TABLE 4








CircRNAs designed against CHIKV


Name of the artificial circular RNA
Target disruption structure comprised in
Target hybridization region
SEQ ID NO.:
Hybridization regions of the artificial RNA




chikv5utr
5′UTR SEQ ID NO: 80
ACACACGUAGC CUACCAGUUUC UUACUGCUCUA CU SEQ ID NO.: 33
SEQ ID NO.:12
6


chikv5utr
5′UTR SEQ ID NO: 80
SEQ ID NO.: 33
SEQ ID NO.: 13
7


chikvRSE
3′ UTR (target disruption structure: Repetitive Sequence Element (RSE)) SEQ ID NO: 81
AGCAAAUAAUC UAUAGAUCAAA GGGCUACGCAA SEQ ID NO.: 35
SEQ ID NO.: 14
6


Chikv_re
Recoding Element (CDS) SEQ ID NO: 82
GCUGCUGUAAA ACGUUGGCUUU UUUAGCCGUAA U SEQ ID NO.: 31
SEQ ID NO.:39
6


chikvRSE
3′ UTR (target disruption structure: RSE) SEQ ID NO: 81
SEQ ID NO.: 35
SEQ ID NO.: 15
6


UTR: untranslated region CDS: coding sequence.






The different circRNAs designed against CHIKV are classified in the table with information of the target disruption structure, the sequence of the target hybridization region, the sequence of the whole circRNA and the number of hybridization regions present in each candidate (in each artificial circRNA).


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO. 20. In particular, the target hybridization region comprises the nucleotide sequence as defined in SEQ ID NO.: 37 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 37, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 37, or the homologe regions in another WNV strain/serotype.





TABLE 5








CircRNAs designed against WNV


Name of the artificial circular RNA
Target disruption structure comprised in
Target hybridization region
SEQ ID NO.:
Hybridization regions of the artificial RNA




circ_wnv_s1II_1
3′ UTR (target disruption structure SL III) SEQ ID NO.: 83
UUUUGAGGAGA AAGUCAGGCCG GGAAGUU SEQ ID NO.: 37
SEQ ID NO.:24
7


circ_wnv_s1II_2
3′ UTR (target disruption structure SL III) SEQ ID NO.: 83
UUUUGAGGAGA AAGUCAGGCCG GGAAGUU SEQ ID NO.: 37
SEQ ID NO.: 19
7


UTR: untranslated region.






The different circRNAs designed against WNV are classified in the table with information of the target disruption structures, the sequence of the target hybridization region, the sequence of the complete circRNA and the number of hybridization regions present in each candidate (in each artificial circRNA). SLIII: Stem Loop III.


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO.: 20 and SEQ ID NO.: 7. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 30 and 37 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 30 and 37, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 30 and 37, or the homologe regions in another DENV/WNV strain/serotype.





TABLE 6








CircRNAs designed against WNV and DENV


Name of the artificial circular RNA
Target disruption structure comprised in
Target hybridization region
SEQ ID NO.:
Hybridization regions of the artificial RNA




dchp_ws1I_A
CDS and 3′ UTR (target disruption structures: cHP and SLII )
SEQ ID NO.: 30 and 37
SEQ ID NO.:21 SEQ ID NO: 63
6


dchp_ws1I_B
CDS and 3′ UTR (target disruption structures: cHP and SLI I)
SEQ ID NO.: 30 and 37
SEQ ID NO.:22
6


dchp_ws1I_C
CDS and 3′ UTR (target disruption structures: cHP and SLI I)
SEQ ID NO.: 30 and 37
SEQ ID NO.:23
6


SLI: Stem Loop I. cHP: capsid region hairpin






The different circRNAs designed against WNV and DENV are classified in the table with information of the target disruption structures, the sequence of the target hybridization region, the sequence of the complete circRNA and the number of hybridization regions present in each candidate (in each artificial circRNA).


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in one or more of SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11 and/or SEQ ID NO. 20. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 25 to 31, 33 and 35, 37 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 31, 33 and 35, 37, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 31, 33 and 35, 37.


In another preferred embodiment, the target disruption structures in the HCV viral genome are found in the IRES and/or CDS region and/or a combination of them. More preferably, the target disruption structure of the HCV genome is selected from the list of target disruption structures comprising or consisting of SEQ ID NOs.: 76, 77, 78 or 79 or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NOs.: 76, 77, 78, or 79, or any combination thereof.


In another preferred embodiment, the target disruption structures in the Dengue viral genome are found in the 3′UTR and/or is the cHP and/or a combination of them. More preferably, the target disruption structure of the DENV genome is selected from the list of target disruption structures comprising or consisting of SEQ ID NOs.: 29 or 30, or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NOs.: 29 or 30, or any combination thereof.


In another preferred embodiment, the target disruption structures in the Zika viral genome are found in the 5′UTR and/or are the RSE and/or a combination of them.


In another preferred embodiment, the target disruption structures in the Chikungunya viral genome is found in the 5′UTR and/or is the RSE and/or a combination of them. More preferably, the target disruption structure of the CHIKV genome is selected from the list of target disruption structures comprising or consisting of SEQ ID NOs.: 80, 81, or 82, or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NOs.: 80, 81, or 82, or any combination thereof.


In another preferred embodiment, the target disruption structure in the West Nile viral genome is the stem-loop III (SLIII). More preferably, the target disruption structure of the WNV genome comprises or consists of SEQ ID NO.: 83, or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NO.: 83.


In another preferred embodiment, the hybridization regions of the artificial RNA of the present invention, which is preferably a circular RNA, target (i.e., are able to completely hybridize with target hybridization regions present in) more than one the target disruption structures present in one viral genome.


In a particular embodiment, the artificial RNA of the present invention, preferably the artificial circular RNA of the present invention, has a broad spectrum activity against a RNA viral genome, preferably against HCV, Dengue, Zika, Chikungunya, West Nile and Yellow Fever viral genome. In the present invention “a broad spectrum activity” related to the artificial RNA, preferably the circular RNA of the present invention means that said artificial RNA is effective against a wide range of RNA viruses, preferably against HCV, Dengue, Zika, Chikungunya, West Nile and Yellow Fever.


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in SEQ ID NO. 34. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 58-62 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 58-62, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 58-62, or the homologe regions in another SARS-CoV-2 strain/serotype.


In another preferred embodiment, the target disruption structures in the SARS-CoV-2 viral genome is found in the Target A, B, C, D, 3′UTR, 5′UTR, and/or a combination of them. More preferably, the target disruption structure of the SARS-CoV-2 genome is selected from the list of target disruption structures comprising or consisting of SEQ ID NOs.: 84, 58, 85, 86, 87, or a nucleotide sequence with at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence as defined in SEQ ID NOs.: 84, 58, 85, 86 or 87, or any combination thereof.





TABLE 7








CircRNAs designed against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) isolate Wuhan-Hu-1 (complete genome: SEQ ID NO.: 34)


Name of the artificial circular RNA
Target disruption structure comprised in
Target hybridization region
SEQ ID NO.:
Hybridization regions of the artificial RNA




Artificial circular ARN 1; target disruption structure comprised in SARS-CoV-2 3′UTR replication site
3′UTR replication site SEQ ID NO.: 84
CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62
SEQ ID NO.:36
6


Artificial circular ARN 2; target disruption structure comprised in SARS-CoV-2 3′UTR
3′UTR replication site SEQ ID NO.: 84
CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62
SEQ ID NO.:38
6


Artificial circular RNA 3; target disruption structure comprised in SARS-CoV-2 3′UTR replication site
3′UTR replication site SEQ ID NO.: 84
CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62
SEQ ID NO.:40
6


Artificial circular RNA 4; target disruption structure comprised in SARS-CoV-2 3′UTR replication site
3′UTR replication site SEQ ID NO.: 84
CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62
SEQ ID NO.:41
6


Artificial circular RNA 5; target disruption structure comprised in SARS-CoV-2 3′UTR replication site
3′UTR replication site SEQ ID NO.: 84
CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62
SEQ ID NO.:42
6


Artificial circular RNA 6; target disruption structure comprised in SARS-CoV-2 3′UTR replication site
3′UTR replication site SEQ ID NO.: 84
CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62
SEQ ID NO.: 88
6


Artificial circular RNA 7; target disruption structure comprised in SARS-CoV-2 3′UTR replication site
3′UTR replication site SEQ ID NO.: 84
CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62
SEQ ID NO.: 89
6


Artificial circular RNA 8; target disruption structure comprised in SARS-CoV-2 3′UTR replication site
3′UTR replication site SEQ ID NO.: 84
CAGAAUGAAUU CUCGUAACUAC AUAGCACAAGU AG SEQ ID NO.: 62
SEQ ID NO.: 65
6


Artificial circular RNA 1; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II)
5′UTR (target disruption structure: S1II) SEQ ID NO.: 58
AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58
SEQ ID NO.:43
7


Artificial circular RNA 2; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II)
5′UTR (target disruption structure: S1II) SEQ ID NO.: 58
AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58
SEQ ID NO.:44
7


Artificial circular RNA 3; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II)
5′UTR (target disruption structure: S1II) SEQ ID NO.: 58
AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58
SEQ ID NO.:45
7


Artificial circular RNA 4; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II)
5′UTR (target disruption structure: S1II) SEQ ID NO.: 58
AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58
SEQ ID NO.: 66
7


Artificial circular RNA 5; target disruption structure comprised in SARS-CoV-2 5′UTR (S1II)
5′UTR (target disruption structure: S1II) SEQ ID NO.: 58
AACCAACUUUC GAUCUCUUGUA GAUCU SEQ ID NO.: 58
SEQ ID NO.: 67
7


Artificial circular RNA 1; target hybridization region: SARS-CoV-2 Target A
Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85
UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59
SEQ ID NO.:46
6


Artificial circular RNA 2; target hybridization region: SARS-CoV-2 Target A
Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85
UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59
SEQ ID NO.:47
6


Artificial circular RNA 3; target hybridization region: SARS-CoV-2 Target A
Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85
UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59
SEQ ID NO.:48
6


Artificial circular RNA 4; target hybridization region: SARS-CoV-2 Target A
Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85
UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59
SEQ ID NO.:49
6


Artificial circular RNA 5; target hybridization region: SARS-CoV-2 Target A
Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85
UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59
SEQ ID NO.:68
6


Artificial circular RNA 6; target hybridization region: SARS-CoV-2 Target A
Target hybridization region: SARS-CoV-2 Target A
UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59
SEQ ID NO.:69
6



SEQ ID NO.: 85





Artificial circular RNA 7; target hybridization region: SARS-CoV-2 Target A
Target hybridization region: SARS-CoV-2 Target A SEQ ID NO.: 85
UUUAAGUUUAG AAUAGACGGUG ACAUGGUACCA SEQ ID NO.: 59
SEQ ID NO.:70
6


Artificial circular RNA 1; target hybridization region: SARS-CoV-2 Target C
Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86
UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60
SEQ ID NO.:50
7


Artificial circular RNA 2; target hybridization region: SARS-CoV-2 Target C
Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86
UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60
SEQ ID NO.:51
7


Artificial circular RNA 3; target hybridization region: SARS-CoV-2 Target C
Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86
UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60
SEQ ID NO.:52
7


Artificial circular RNA 4; target hybridization region: SARS-CoV-2 Target C
Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86
UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60
SEQ ID NO.:53
7


Artificial circular RNA 5; target hybridization region: SARS-CoV-2 Target C
Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86
UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60
SEQ ID NO.:71
7


Artificial circular RNA 6; target hybridization region: SARS-CoV-2 Target C
Target hybridization region: SARS-CoV-2 Target C SEQ ID NO.: 86
UCACUAAGAAA UCUGCUGCUGA GGCUUCUA SEQ ID NO.: 60
SEQ ID NO.:72
7


Artificial circular RNA 1; target hybridization region: SARS-CoV-2 Target D
Target hybridization region: SARS-CoV-2 Target D SEQ ID NO.: 87
UCGUCUAUCUU CUGCAGGCUGC UUACGGUUU SEQ ID NO.: 61
SEQ ID NO.:54
6


Artificial circular RNA 2; target hybridization region: SARS-CoV-2 Target D
Target hybridization region: SARS-CoV-2 Target D SEQ ID NO.: 87
UCGUCUAUCUU CUGCAGGCUGC UUACGGUUU SEQ ID NO.: 61
SEQ ID NO.:55
6


Artificial circular RNA 3; target hybridization region: SARS-CoV-2 Target D
Target hybridization region: SARS-CoV-2 Target D SEQ ID NO.: 87
UCGUCUAUCUU CUGCAGGCUGC UUACGGUUU SEQ ID NO.: 61
SEQ ID NO.:56
6


Artificial circular RNA 4; target hybridization region: SARS-CoV-2 Target D
Target hybridization region: SARS-CoV-2 Target D SEQ ID NO.: 87
UCGUCUAUCUU CUGCAGGCUGC UUACGGUUU SEQ ID NO.: 61
SEQ ID NO.:57
6






The different circRNAs designed against SARS-CoV-2 are classified in the table with information of the target disruption structures, the sequence of the target hybridization region, the sequence of the complete circRNA and the number of hybridization regions present in each candidate (in each artificial circRNA).


In a further preferred embodiment, the one or more target hybridization regions to which the at least one hybridization region of the artificial RNA according to the present invention, preferably of the artificial circular RNA of the present invention, completely hybridizes is comprised in one or more of SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11 and/or SEQ ID NO. 20. In particular, the target hybridization region comprises the nucleotide sequence as defined in one or more of SEQ ID NO.: 25 to 31, 33, 35, 37 and 58-62 or a nucleotide sequence with at least 70% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 31, 33 and 35, 37, preferably with at least 80%, more preferably with at least 90%, even more preferably with at least 95% identity to the nucleotide sequence as defined in SEQ ID NO.: 25 to 31, 33, 35, 37, and 58-62.


All the possible combinations of the target disruption structures and/or the target hybridization regions from the same virus or from different viruses disclosed above are included herein as particular embodiments for the design of the circRNAs sequences of the present invention. It is noted that for each target disruption structures disclosed throughtout the present invention (IRES, CDS, etc), different corresponding hybridization regions can be used and/or combined as described herein in order to design the circRNAs.


In a second aspect, the present invention provides a composition comprising the artificial RNA of the present invention, in any of the embodiments, alone or in combination, disclosed herein.


Preferably, the composition is a pharmaceutical composition, and preferably comprises the artificial RNA of the present invention, in any of the embodiments, and one or more pharmaceutically acceptable carriers.


Where clinical applications are contemplated, pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.


Colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes, may be used as delivery vehicles for artificial RNAs, such as circular RNAs. Commercially available fat emulsions that are suitable for delivering the nucleic acids of the disclosure to tissues include Intralipid, Liposyn, Liposyn II, Liposyn III, Nutrilipid, and other similar lipid emulsions. A colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The preparation and use of such systems is well known in the art. Exemplary formulations are also disclosed in U.S. Pat. No. 5,981,505; U.S. Pat. No. 6,217,900; U.S. Pat. No. 6,383,512; U.S. Pat. No. 5,783,565; U.S. Pat. No. 7,202,227; U.S. Pat. No. 6,379,965; U.S. Pat. No. 6,127,170; U.S. Pat. No. 5,837,533; U.S. Pat. No. 6,747,014; and WO 03/093449. In particular, cationic liposome formulations comprising lipofectamine can be used for delivery. Lipofectamine may be formulated with a neutral co-lipid or helper lipid. See e.g., U.S. Pat. No. 7,479,573, Dalby et al. (2004) Science Direct, Methods 33:95-103, Hawley-Nelson et al. (1993) Focus 15 :73-79.


One will generally desire to employ appropriate salts and buffers to render delivery vehicles stable and allow for uptake by target cells. Buffers also will be employed when recombinant cells (e.g., transfected ex vivo with an artificial RNA, such as a circular RNA) are introduced into a patient. Aqueous compositions of the present disclosure comprise an effective amount of the delivery vehicle, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.


The phrases “pharmaceutically acceptable” or “pharmacologically acceptable” refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, “pharmaceutically acceptable carrier” includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art.


Except insofar as any conventional media or agent is incompatible with the active ingredients of the present disclosure, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions, provided they do not inactivate the nucleic acids of the compositions.


The pharmaceutical forms suitable for injectable use or catheter delivery include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that easy injectability exists. Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.


Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation include vacuum drying and freeze-drying techniques which yield a powder of the active ingredient(s) plus any additional desired ingredient from a previously sterile-filtered solution thereof.


The compositions of the present invention generally may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric acids, or from organic acids (e.g., acetic, oxalic, tartaric, mandelic, and the like). Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine and the like).


Upon formulation, solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure. By way of illustration, a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, “Remington’s Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biologies standards.


The pharmaceutical compositions of the present invention can also be housed in a syringe, an implantation device, or the like, depending upon the intended mode of delivery and use. Preferably, the compositions comprising artificial RNAs, such as artificial circular RNAs, prepared as described herein, are in unit dosage form, meaning an amount of a composition appropriate for a single dose, in a premeasured or pre-packaged form.


As for the administration, at least one therapeutically effective cycle of treatment with an artificial RNA, such as artificial circular RNAs, may be administered to a subject for treatment of a viral infection caused by, e.g., HCV, Dengue virus, Zika virus, Chikungunya virus, West Nile virus, Yellow Fever virus or coronavirus, such as SARS and/or MERS, preferably SARS-CoV-2.


By “therapeutically effective dose or amount” of a composition comprising an artificial RNA, such as artificial circular RNAs, is intended an amount that, when administered as described herein, brings about a positive therapeutic response, such as improved recovery from the treated condition, such as for example the viral infection, the cancer or the genetic disorder.


Multiple therapeutically effective doses of compositions comprising artificial RNAs of the present invention, such as artificial circular RNAs of the present invention, and/or one or more other therapeutic agents, will be administered. The compositions of the present invention are typically, although not necessarily, administered via injection (subcutaneously, intravenously, intra-arterially, or intramuscularly), by infusion, or locally. Additional modes of administration are also contemplated, such as intraperitoneal, intrathecal, intratumor, intralymphatic, intravascular, intralesion, transdermal, and so forth. In some embodiments, the pharmaceutical composition comprising the artificial RNA of the present invention,, such as artificial circular RNAs, is administered locally. The pharmaceutical compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, and other agents may be administered using the same or different routes of administration in accordance with any medically acceptable method known in the art.


The pharmaceutical compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, may also be administered prophylactically, e.g., to prevent the viral infection and/or cancer and/or genetic disorder.


The pharmaceutical compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, and/or other agents are in a sustained-release formulation, or a formulation that is administered using a sustained-release device. Such devices are well known in the art, and include, for example, miniature implantable pumps that can provide for delivery over time in a continuous, steady-state fashion at a variety of doses to achieve a sustained-release effect with a non-sustained-release pharmaceutical composition.


Those of ordinary skill in the art will appreciate which conditions compositions comprising artificial RNAs of the present invention can effectively treat and/or prevent. The actual dose to be administered will vary depending upon the age, weight, and general condition of the subject as well as the severity of the condition being treated, the judgment of the health care professional, and conjugate being administered.


Therapeutically effective amounts can be determined by those skilled in the art, and are adjusted to the particular requirements of each particular case. Compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, can be administered alone or in combination with one or more other therapeutic agents. The specific dosing schedule will be known by those of ordinary skill in the art or can be determined experimentally using routine methods. Exemplary dosing schedules include, without limitation, administration five times a day, four times a day, three times a day, twice daily, once daily, three times weekly, twice weekly, once weekly, twice monthly, once monthly, and any combination thereof. Preferred compositions are those requiring dosing no more than once a day.


Compositions comprising the artificial RNAs of the present invention, such as artificial circular RNAs, can be administered prior to, concurrent with, or subsequent to other agents. If provided at the same time as other agents, the artificial RNAs of the present invention can be provided in the same or in a different composition. Thus, artificial RNAs and one or more other agents can be presented to the individual by way of concurrent therapy.


By “concurrent therapy” is intended administration to a subject such that the therapeutic effect of the combination of the substances is caused in the subject undergoing therapy. For example, concurrent therapy may be achieved by administering a dose of a pharmaceutical composition comprising an artificial RNA according to the present invention, such as artificial circular RNAs, and a dose of a pharmaceutical composition comprising at least one other agent, which in combination comprise a therapeutically effective dose, according to a particular dosing regimen. Similarly, an artificial RNA of the present invention and one or more other therapeutic agents can be administered in at least one therapeutic dose. Administration of the separate pharmaceutical compositions can be performed simultaneously or at different times (i.e., sequentially, in either order, on the same day, or on different days), as long as the therapeutic effect of the combination of these substances is caused in the subject undergoing therapy.


In a third aspect, the present invention provides a kit comprising the artificial RNA of the present invention, in any of its embodiments, or comprising the composition of the present invention, and instructions for using the artificial RNA or composition.


Hence, any of the artificial RNAs and/or compositions described herein may be included in a kit. For example circular RNAs as disclosed herein may be included in a kit. The kit may also include one or more transfection reagents to facilitate delivery of the artificial RNAs to cells. Such kits may also include components that preserve the polynucleotides or that protect against their degradation. Such components may be RNAse-free or protect against RNAses.


Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution. The kit may comprise one or more containers holding the artificial RNAs and other agents. Suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes. Containers can be formed from a variety of materials, including glass or plastic. A container may have a sterile access port (for example, the container may be a vial having a stopper pierceable by a hypodermic injection needle).


The kit can further comprise a container comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer’s solution, or dextrose solution. It can also contain other materials useful to the end-user, including other pharmaceutically acceptable formulating solutions such as buffers, diluents, filters, needles, and syringes or other delivery devices. The delivery device may be pre-filled with the compositions.


The kit can also comprise a package insert containing written instructions for methods of treating the viral infections with the artificiañ RNAs of the present invention. The package insert can be an unapproved draft package insert or can be a package insert approved by the Food and Drug Administration (FDA) or other regulatory body.


As described above, preferably, the artificial RNA of the present invention, in any of its embodiments, which may be comprised in the composition or kit of the present invention, comprises the nucleotide sequence as defined in SEQ ID NO: 2, 3, 4, 5, 6 (for HCV); 8, 9, 10 (for Dengue virus); 12, 13, 14, 15, 39 (for Chikungunya virus); 16 and 17 (Broadspectrum activity for both HCV and Dengue Virus); 24 and 19 (for West Nile Virus); 21, 22 and 23 (Broad spectrum activity for both Dengue and West Nile Viruses); 32 (Broad spectrum activity for both HCV and Dengue Virus), 36, 38, 40, 41, 42, 88, 89, 65, 43, 44, 45, 66, 67, 46, 47, 48, 49, 68, 69, 70, 50, 51, 52, 53, 71, 72, 54, 55, 56, 57 (for SARS-CoV-2 virus). These are the target hybridization regions which completely hybridize with the hybridization regions comprised in the artificial RNAs described in the examples below.


Preferably, the the one or more target hybridization regions which completely hybridize with the at least one hybridization region comprised in the artificial RNA of the present invention, in any of its embodiments, which may also be comprised in the composition and/or kit of the present invention is comprised in SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11, SEQ ID NO.: 20 and/or SEQ ID NO.: 34.


In a fourth aspect, the present invention provides the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for use as a medicament. Preferably, the present invention provides the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for use in a method of preventing and/or treating a viral infection. Preferably, the artificial RNA of the present invention has a broad spectrum activity against two or more RNA viruses.


In a further embodiment, the present invention provides the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for use in a method of preventing and/or treating cancer.


In a further embodiment, the present invention provides the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for use in a method of preventing and/or treating genetic disorders.


In the context of the present invention, a genetic disorder refers to a health problem caused by one or more abnormalities in the genome. It can be caused by a mutation in a single gene (monogenic) or multiple genes (polygenic) or by a chromosomal abnormality. Examples of genetic disorders are the following: Familial hypercholesterolemia, Polycystic kidney disease, Neurofibromatosis type I, Hereditary spherocytosis, Marfan syndrome, Huntington’s disease, Sickle cell anaemia, Cystic fibrosis, Tay-Sachs disease, Phenylketonuria, Mucopolysaccharidoses, Lysosomal acid lipase deficiency, Glycogen storage diseases, Galactosemia, Duchenne muscular dystrophy or Hemophilia.


Hence, in the fourth aspect, the present invention provides the use of the artificial RNA of the present invention, in any of its embodiments, or the composition or the kit of the present invention for the manufacture of a medicament for preventing and/or treating a viral infection and/or cancer and/or a genetic disorder.


In a preferred embodiment, the viral infection is caused by HCV, Dengue, Zika, Chikungunya, West Nile, Yellow Fever virus or coronavirus, such as SARS and/or MERS, preferably SARS-CoV-2.


As it is well known in the art (see for example WO 2017/222911), any known method of nucleic acid delivery may be used for administration of the artificial RNAs as disclosed herein (e.g., immunogenic or non-immunogenic) to a subject. For example, an artificial RNA may be administered by transfection in vivo. Alternatively, the artificial RNA may be administered by transfection ex vivo, and subsequent transfer of a cell transfected with the artificial RNA to the subject.


An artificial RNA, such as a circular RNA, can be delivered with a nucleic acid carrier (e.g. cationic carrier) or a nanoparticle (e.g., lipid nanoparticle, polymeric nanoparticle, nanoparticle comprising a combination of polymers and peptides, or an electrostatic complex). The artificial RNA may be delivered to a subject using a recombinant virus, an exosome, liposome, or other lipid vesicle, or a cell engineered to secrete an artificial RNA, such as a circular RNA.


The artificial RNA, such as a circular RNA, can also be conjugated to a targeting ligand (e.g., small molecule, peptide or protein) for localized delivery to a particular site (e.g., cells, tissue, or organ) in the subject. The artificial RNA can be even linked to an internalization sequence, a protein transduction domain, or a cell penetrating peptide to facilitate entry into a cell.


In a fifth aspect, the present invention provides a method for producing the artificial RNA of the invention, preferably the artificial circular RNA of the present invention, wherein in the method comprises the step of:

  • a) synthesizing the artificial RNA of the invention;
  • b) screening the artificial RNA of step a) for artificial RNAs which are capable of disrupting the structure one or more target disruption structures of one or more RNA fragments, preferably which are able of disrupting the SRVVLC and/or rendering the virus less capable (ideally incapable) of performing essential functions of its life cycle, i.e., artificial RNAs which are capable of yielding conformational changes in the target RNA fragment, e.g., yielding conformational changes in the RNA of the virus which impede essential functions of the life cycle of the virus.


Production of CircRNAs

Artificial RNAs, such as circRNAs, are designed using an in-house software tool. This tool allows for several design constraints to be taken into account, for instance GC content range of the sequence. Once the artificial RNAs, such as circRNAs RNAs, are designed, they can be produced intracellularly or by in vitro transcription.


Intracellular Production of Artificial RNAs, Such as CircRNAs

The corresponding artificial RNAs sequence, such as circRNAs sequence, in DNA form is commercially obtained and cloned to be later transformed into cells using the following steps.


First, the designed artificial RNA sequence is cloned into a plasmid (por example a pcDNA3-CIRS7 plasmid) between two sequences that mediate splicing and circularization, SA (splicing acceptor) and SD (splicing donor) (clone gently provided by Dr. Thomas B. Hansen from the University of Aarhus (Denmark) (Patent application: WO 2014/082644 A1). This plasmid contains a gene conferring resistance to the antibiotic ampicillin. The derived plasmid is then transformed into XL1-Blue competent cells (Sigma). The transformed cells are grown in LB media with ampicillin (LB—Amp) for selection. One of the selected colonies is then grown in LB—Amp liquid medium for 36h for amplification. After this time, the culture is centrifuged to obtain the bacteria cells and the plasmid purified using NucleoSpin® Plasmid kit (Macherey-Nagel).


When these derived plasmids are introduced into human cells, the transcription promoter CMV is recognized by the cellular transcription machinery and a mRNA is expressed using the host transcription machinery. For the production of circRNAs, the resultant RNA is circularized by the host splicing machinery generating the designed circRNAs (see FIG. 1).


In Vitro Production of Artificial CircRNAs

The production of circRNAs can be also achieved in vitro by obtaining the corresponding linear RNA, through chemical synthesis or in vitro transcription, and then circularize it with RNA ligases (see FIG. 2).


A more efficient approach is to produce the circRNAs in vitro from T7 promoter-flanked templates. This plasmid contains self-cleavage ribozymes that after the in vitro transcription will be cleaved generating the ends that will allow the circularization and generation of circRNAs. For each candidate, the T7 promoter plasmid was linearized using Hindlll (FastDigest) during 30 min at 37° C. The purified linearized molecule was in vitro transcribed and purified from a polyacrylamide gel. Afterwards, the RNAs will be circularized using RtcB (NEB) and the circularized molecules were selected after RNAse R (Lucigen) treatment during 30′ at 37° C. (See FIG. 25).


More specifically, circRNAs were produced from a T7-derived plasmid containing the circRNA of interest surrounded in both ends by ribozymes which are RNA molecules with self-cleavage capacity. We used at the 5′ the eggplant latent viroid (ELVd) and at the 3′, the coral one, as the pair of hammerheads. As we saw lower cleavage efficiency in the 5′ hammerhead, we tested several ribozymes both natural and artificial in order to decide which pair of hammerheads were more efficient. As seen in the FIG. 29, all hammerheads tested except number 3 and 7 produced the desired cleaved RNA molecule with different cleavage efficiencies being hammerheads 5-6-9 the best ones. After extracting the bands of the corresponding cleaved RNA molecule from the gel, we saw similar amounts in the three hammerheads, however, we decided to use the artificial ribozyme 3 (ART-RBZ3) as the hammerhead was behaving the same way as in the predictions in silico.


We, then, tested whether we could increase the ratio of partially cleaved/completely cleaved using different concentrations of magnesium in buffers but we did not observe any difference (FIG. 30).


Once the hammerheads were established and to continue with the production of our desired circRNA, we cloned the circRNA sequence into the plasmid and we linearized 10 micrograms using Hind III (Fast Digest) following manufacturer’s instructions. The linearized DNA was phenol-chloroform purified and further in vitro transcribed. Moreover, we tested the optimal amount of linearized plasmid to use as a template and the reaction time. We saw that using either 10 micrograms or 1 microgram of linearized DNA, we obtained the same quantity of cleaved RNA molecule using T7 RNA polymerase (Takara) either incubating 6h (as recommended by the manufacturer’s) or 3h (FIG. 31). Thus, we decided to do the IVT using 1 microgram of template and 3h of reaction.


The IVT was stopped and ran in a urea gel for 4 hours and the desired band (complete cleavage) was cut and RNA was further isolated from there. This last step generates a low yield of the recovered RNA and requires plenty of time to generate sufficient linear molecule to further continue with the protocol. To improve this, we purified the IVT by Chloroform/Isoamyl alcohol extraction instead of running a gel with better results in terms of recovery.


Next, we proceed with the circularization of 10 micrograms of purified linear RNA using RtcB (New England Biolabs) during 1 hour at 37° C. To eliminate non-circular RNA forms, the resulting RNA was RNAse R (Lucigen) treated and purified following manufacturer’s instructions. In order to validate the RNAse R treatment, we ran a urea gel and selected the circRNA band. As said before, the urea gel purification caused a significant loss of RNA material. Therefore, we decided to avoid the gel purification, increasing the RNAse R conditions (FIG. 32) and purifying as done before in the protocol obtaining higher amounts of circRNA. This change in the protocol (see FIG. 25) is key to achieve significant amounts of circRNA at reasonable cost and time. Finally, the presence of circRNA was verified with a TBE-Urea gel only using 1% of the material.


Mode of Action

The artificial RNAs, such as circRNAs, are designed so that they hybridize with selected regions (target hybridization regions) present in target disruption structures of one or more RNA fragments, such as an RNA viral genome. These target disruption structures are relevant to the functionality of the RNA fragments, as described above. For instance, if the RNA fragment is RNA viral genome, the target disruption structures may be relevant for multiple functions of the viral RNA and infectivity such as translation, replication, localization or/and encapsidation. These signals can be found in the 5′ and 3′untranslated regions and in the coding sequence region (CDS) of the viral RNA genomes. In one embodiment, these target disruption structures can be located within the IRES element (Internal Ribosomal Entry Site), which is responsible for sequestering the host ribosomes to initiate translation of the viral proteins for some viral RNA genomes.


The mechanism of action is NOT just the hybridization between the hybridization regions of the artificial RNA and the target hybridization regions of the target disruption structures, in contrast to the state of the art, but the structural changes triggered upon this hybridization will alter the secondary structure of the RNA fragment, ultimately affecting its function. For instance, viral RNA genomes and viral mRNAs contain highly structured regions essential for their function. Binding of the designed artificial RNAs to target disruption structures in the viral RNA genome will lead to the unfolding of the structure (changes in the secondary structure) and consequently to the reduction or even inhibition of the infectivity (see, e.g., FIG. 3).


For instance, the disruption of the target disruption structures in the RNA viral genome can disturb the accessibility of RNA binding proteins (RBP) to their target viral RNA sequences. Note that this strategy differs from that whose aim is hybridizing the exact binding site of an RBP (see, e.g., FIG. 4).


Sometimes, RBPs bind single stranded RNA regions that require to be found in a specific structural context, for instance, immediately 3′ of a stem loop (see, e.g., FIG. 4, left side). In our case, hybridizing with a different target hybridization region might disrupt this stem loop (which is part of a target disruption structure) and, although the binding site remains accessible, the structural change renders RBP binding ineffective (see, e.g., FIG. 4, right side).


Structure

The structure of the designed artificial RNAs, such as circRNAs, is very flexible. Generally, it contains at least one, preferably several hybridization regions that hybridize with at least one, preferably several target hybridization regions present in at least one, preferably several target disruption structures of one or more RNA fragments, preferably in the viral genome. These preferably several hybridization regions in the artificial RNA are preferably separated by sequences that are quasi-random, in the sense that they do not perform any functions other than separate the preferably several hybridization regions, and to allow for the observance of the design constraints (low secondary structure, specific GC content, etc.). For instance, an example of an artificial RNA, which is a circRNA, that targets 3 different target disruption structures of the viral genome with 2 hybridization regions per target disruption structure is depicted in FIG. 5. Regions with the same color represent the fact that they target the same viral target disruption structure.


However, as explained above, these preferably several hybridization regions of the artificial RNA, such as circRNA, that target the same target hybridization region within a certain target disruption structure are preferably designed to be different from each other. This is possible since RNA allows for three different base-pairing types: G-C, A-U and G-U. This fact also entails that, e.g., viral escape (through mutations) from the artificial RNAs is more difficult since it will need to escape all the different hybridization regions at the same time. Note that the hybridization requirement is different from the anti-sense or complementarity requirement.


It is also possible to design the hybridization regions of a single artificial RNA in order to target different regions of different RNA fragments, such as different regions of different RNA viruses to obtain broad-spectrum artificial RNAs.


In a sixth aspect, the present invention provides a method of screening for artificial circular RNA comprising two or more hybridization regions capable of disrupting by hybridization one or more target disruption structures of one or more RNA fragments, wherein the target disruption structures are defined as comprising:

  • i. a first region with at least a hairpin loop preceded or followed by a second region of unpaired nucleotides; and
  • ii. at least one target hybridization region which comprises a single-stranded region of at least 2 nucleotides, preferably 3 nucleotides or more preceded or followed by a double-stranded region of at least 5 nucleotides, preferably 10 nucleotides or more, and wherein the method comprises the steps of:
    • a) identifying the two or more hybridization regions of the artificial circular RNA as those regions that have a total of between 7 and 100 nucleotides in length, preferably between 10 and 50 nucleotides that, when hybridizing with the at least one target hybridization region, the energy of the hybridization between the two or more hybridization regions and the at least one target hybridization region is more negative than the energy of the target disruption structure, thereby disrupting the one or more target disruption structure, wherein each of the the two or more hybridization regions comprised in the artificial circular RNA, are identified by RNA inverse folding tools, such as NUPACK, RNAifold, or MoiRNAiFold.,
    • b) designing an artificial circular RNA comprising the two or more hybridization regions capable of disrupting the one or more target disruption structures as identified in step a), wherein said artificial circular RNA is between 150 and 800 nucleotides in length, preferably between 200 and 600 nucleotides,
    • c) optionally selecting the artificial circular RNA capable of disrupting by hybridization the one or more target disruption structures as designed in step b), and optionally packaging it into a product.


As indicated above, in step a) of the method according to the sixth aspect or any of its embodiments, the identification of the two or more hybridization regions according to step a) is performed by RNA inverse folding tools such as NUPACK, RNAifold, MoiRNAiFold, wherein the method preferably comprises the steps of:

  • a) generating one or more nucleotide sequences of the possible two or more hybridization regions that completely hybridize with the at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments by providing the RNA inverse folding tools with at least both the target disruption structure/sequence and the target hybridization region,
  • b) obtaining as output only the one or more nucleotide sequences of those hybridization regions that, when hybridizing with the target hybridization region, the energy of the hybridization between the two or more hybridization region and the at least one target hybridization region is more negative than the energy of the target disruption region, thereby disrupting the target disruption structure.


In a preferred embodiment of the method according to the sixth aspect or any of its embodiments, the method comprises a pre-step that comprises identifying as a target disruption structure those structures of one or more RNA fragments that comprise:

  • a) a first region with at least a hairpin loop preceded or followed by a second region of unpaired nucleotides; and
  • b) at least one target hybridization region which comprises a single-stranded region of at least 2 nucleotides, preferably 3 nucleotides or more preceded or followed by a double-stranded region of at least 5 nucleotides, preferably 10 nucleotides or more.


In a preferred embodiment of the method according to the sixth aspect or any of its embodiments, the method comprises a further step d) of confirming in a biological setting the capacity of the designed artificial circular RNA as designed in step b) of disrupting by hybridization one or more target disruption structures of one or more RNA fragments.


In a preferred embodiment, the method according to the sixth aspect or any of its embodiments comprises the use of the target disruption structures and the target hybridization regions defined above in Tables 1 to 7.


The present invention is now further illustrated by reference to the following examples which do not intend to limit the scope of the present invention.


SEQUENCE LISTING

SEQ ID NO: 1









<211> 9678


<212> RNA


<213> Hepatitis C virus


<220>


<221> misc_ feature


<222> 24..56


<223> /note=“target region of the 5′UTR”


<220>


<221> misc_ feature


<222> 323..346


<223> /note=“target region of the 5′UTR”


<220>


<221> misc_ feature


<222> 372..399


<223> /note=“target region of the CDS”


<220>


<221> misc_ feature


<222> 459..474


<223> /note=“target region of the CDS”


<220>


<221> misc_ feature


<222> 651..668


<223> /note=“target region of the CDS”


<220>


<221> misc_ feature


<222> 9567..9600


<223> /note=“target region of the 3′UTR”


<400> 1
















accugccccu aauaggggcg acacuccgcc augaaucacu ccccugugag gaacuacugu  60


cuucacgcag aaagcgccua gccauggcgu uaguaugagu gucguacagc cuccaggccc  120


cccccucccg ggagagccau aguggucugc ggaaccggug aguacaccgg aauugccggg  180


aagacugggu ccuuucuugg auaaacccac ucuaugcccg gccauuuggg cgugcccccg  240


caagacugcu agccgaguag cguuggguug cgaaaggccu ugugguacug ccugauaggg  300


cgcuugcgag ugccccggga ggucucguag accgugcacc augagcacaa auccuaaacc  360


ucaaagaaaa accaaaagaa acaccaaccg ucgcccagaa gacguuaagu ucccgggcgg  420


cggccagauc guuggcggag uauacuuguu gccgcgcagg ggccccaggu ugggugugcg  480


cacgacaagg aaaacuucgg agcgguccca gccacguggg agacgccagc ccauccccaa  540


agaucggcgc uccacuggca aggccugggg aaaaccaggu cgccccuggc cccuauaugg  600


gaaugaggga cucggcuggg caggauggcu ccuguccccc cgaggcucuc gccccuccug  660


gggccccacu gacccccggc auaggucgcg caacgugggu aaagucaucg acacccuaac  720


guguggcuuu gccgaccuca ugggguacau ccccgucgua ggcgccccgc uuaguggcgc  780


cgccagagcu gucgcgcacg gcgugagagu ccuggaggac gggguuaauu augcaacagg  840


gaaccuaccc gguuuccccu uuucuaucuu cuugcuggcc cuguuguccu gcaucaccgu  900


uccggucucu gcugcccagg ugaagaauac caguagcagc uacaugguga ccaaugacug  960


cuccaaugac agcaucacuu ggcagcucga ggcugcgguu cuccacgucc ccgggugcgu  1020


cccgugcgag agagugggga auacgucacg guguugggug ccagucucgc caaacauggc  1080


ugugcggcag cccggugccc ucacgcaggg ucugcggacg cacaucgaua ugguugugau  1140


guccgccacc uucugcucug cucucuacgu gggggaccuc uguggcgggg ugaugcucgc  1200


ggcccaggug uucaucgucu cgccgcagua ccacugguuu gugcaagaau gcaauugcuc  1260


caucuacccu ggcaccauca cuggacaccg cauggcaugg gacaugauga ugaacugguc  1320


gcccacggcc accaugaucc uggcguacgu gaugcgcguc cccgagguca ucauagacau  1380


cguuagcggg gcucacuggg gcgucauguu cggcuuggcc uacuucucua ugcagggagc  1440


gugggcgaag gucauuguca uccuucugcu ggccgcuggg guggacgcgg gcaccaccac  1500


cguuggaggc gcuguugcac guuccaccaa cgugauugcc ggcguguuca gccauggccc  1560


ucagcagaac auucagcuca uuaacaccaa cggcaguugg cacaucaacc guacugccuu  1620


gaauugcaau gacuccuuga acaccggcuu ucucgcggcc uuguucuaca ccaaccgcuu  1680


uaacucguca ggguguccag ggcgccuguc cgccugccgc aacaucgagg cuuuccggau  1740


aggguggggc acccuacagu acgaggauaa ugucaccaau ccagaggaua ugaggccgua  1800


cugcuggcac uaccccccaa agccgugugg cguagucccc gcgaggucug uguguggccc  1860


aguguacugu uucaccccca gcccgguagu agugggcacg accgacagac guggagugcc  1920


caccuacaca uggggagaga augagacaga ugucuuccua cugaacagca cccgaccgcc  1980


gcagggcuca ugguucggcu gcacguggau gaacuccacu gguuucacca agacuugugg  2040


cgcgccaccu ugccgcacca gagcugacuu caacgccagc acggacuugu ugugcccuac  2100


ggauuguuuu aggaagcauc cugaugccac uuauauuaag ugugguucug ggcccuggcu  2160


cacaccaaag ugccuggucc acuacccuua cagacucugg cauuaccccu gcacagucaa  2220


uuuuaccauc uucaagauaa gaauguaugu aggggggguu gagcacaggc ucacggccgc  2280


augcaacuuc acucgugggg aucgcugcga cuuggaggac agggacagga gucagcuguc  2340


uccucuguug cacucuacca cggaaugggc cauccugccc ugcaccuacu cagacuuacc  2400


cgcuuuguca acuggucuuc uccaccuuca ccagaacauc guggacguac aauacaugua  2460


uggccucuca ccugcuauca caaaauacgu cguucgaugg gagugggugg uacucuuauu  2520


ccugcucuua gcggacgcca gagucugcgc cugcuugugg augcucaucu uguugggcca  2580


ggccgaagca gcauuggaga aguuggucgu cuugcacgcu gcgagugcgg cuaacugcca  2640


uggccuccua uauuuugcca ucuucuucgu ggcagcuugg cacaucaggg gucggguggu  2700


ccccuugacc accuauugcc ucacuggccu auggcccuuc ugccuacugc ucauggcacu  2760


gccccggcag gcuuaugccu augacgcacc ugugcacgga cagauaggcg uggguuuguu  2820


gauauugauc acccucuuca cacucacccc gggguauaag acccuccucg gccagugucu  2880


guggugguug ugcuaucucc ugacccuggg ggaagccaug auucaggagu ggguaccacc  2940


caugcaggug cgcggcggcc gcgauggcau cgcgugggcc gucacuauau ucugcccggg  3000


ugugguguuu gacauuacca aauggcuuuu ggcguugcuu gggccugcuu accucuuaag  3060


ggccgcuuug acacaugugc cguacuucgu cagagcucac gcucugauaa ggguaugcgc  3120


uuuggugaag cagcucgcgg gggguaggua uguucaggug gcgcuauugg cccuuggcag  3180


guggacuggc accuacaucu augaccaccu cacaccuaug ucggacuggg ccgcuagcgg  3240


ccugcgcgac uuagcggucg ccguggaacc caucaucuuc aguccgaugg agaagaaggu  3300


caucgucugg ggagcggaga cggcugcaug uggggacauu cuacauggac uucccguguc  3360


cgcccgacuc ggccaggaga uccuccucgg cccagcugau ggcuacaccu ccaaggggug  3420


gaagcuccuu gcucccauca cugcuuaugc ccagcaaaca cgaggccucc ugggcgccau  3480


aguggugagu augacggggc gugacaggac agaacaggcc ggggaagucc aaauccuguc  3540


cacagucucu caguccuucc ucggaacaac caucucgggg guuuugugga cuguuuacca  3600


cggagcuggc aacaagacuc uagccggcuu acgggguccg gucacgcaga uguacucgag  3660


ugcugagggg gacuugguag gcuggcccag ccccccuggg accaagucuu uggagccgug  3720


caagugugga gccgucgacc uauaucuggu cacgcggaac gcugauguca ucccggcucg  3780


gagacgcggg gacaagcggg gagcauugcu cuccccgaga cccauuucga ccuugaaggg  3840


guccucgggg gggccggugc ucugcccuag gggccacguc guugggcucu uccgagcagc  3900


ugugugcucu cggggcgugg ccaaauccau cgauuucauc cccguugaga cacucgacgu  3960


uguuacaagg ucucccacuu ucagugacaa cagcacgcca ccggcugugc cccagaccua  4020


ucaggucggg uacuugcaug cuccaacugg caguggaaag agcaccaagg ucccugucgc  4080


guaugccgcc cagggguaca aaguacuagu gcuuaacccc ucgguagcug ccacccuggg  4140


guuuggggcg uaccuaucca aggcacaugg caucaauccc aacauuagga cuggagucag  4200


gaccgugaug accggggagg ccaucacgua cuccacauau ggcaaauuuc ucgccgaugg  4260


gggcugcgcu agcggcgccu augacaucau cauaugcgau gaaugccacg cuguggaugc  4320


uaccuccauu cucggcaucg gaacgguccu ugaucaagca gagacagccg gggucagacu  4380


aacugugcug gcuacggcca caccccccgg gucagugaca accccccauc ccgauauaga  4440


agagguaggc cucgggcggg agggugagau ccccuucuau gggagggcga uuccccuauc  4500


cugcaucaag ggagggagac accugauuuu cugccacuca aagaaaaagu gugacgagcu  4560


cgcggcggcc cuucggggca ugggcuugaa ugccguggca uacuauagag gguuggacgu  4620


cuccauaaua ccagcucagg gagauguggu ggucgucgcc accgacgccc ucaugacggg  4680


guacacugga gacuuugacu ccgugaucga cugcaaugua gcggucaccc aagcugucga  4740


cuucagccug gaccccaccu ucacuauaac cacacagacu gucccacaag acgcugucuc  4800


acgcagucag cgccgcgggc gcacagguag aggaagacag ggcacuuaua gguauguuuc  4860


cacuggugaa cgagccucag gaauguuuga caguguagug cuuugugagu gcuacgacgc  4920


aggggcugcg ugguacgauc ucacaccagc ggagaccacc gucaggcuua gagcguauuu  4980


caacacgccc ggccuacccg ugugucaaga ccaucuugaa uuuugggagg caguuuucac  5040


cggccucaca cacauagacg cccacuuccu cucccaaaca aagcaagcgg gggagaacuu  5100


cgcguaccua guagccuacc aagcuacggu gugcgccaga gccaaggccc cucccccguc  5160


cugggacgcc auguggaagu gccuggcccg acucaagccu acgcuugcgg gccccacacc  5220


ucuccuguac cguuugggcc cuauuaccaa ugaggucacc cucacacacc cugggacgaa  5280


guacaucgcc acaugcaugc aagcugaccu ugaggucaug accagcacgu ggguccuagc  5340


uggaggaguc cuggcagccg ucgccgcaua uugccuggcg acuggaugcg uuuccaucau  5400


cggccgcuug cacgucaacc agcgagucgu cguugcgccg gauaaggagg uccuguauga  5460


ggcuuuugau gagauggagg aaugcgccuc uagggcggcu cucaucgaag aggggcagcg  5520


gauagccgag auguugaagu ccaagaucca aggcuugcug cagcaggccu cuaagcaggc  5580


ccaggacaua caacccgcua ugcaggcuuc auggcccaaa guggaacaau uuugggccag  5640


acacaugugg aacuucauua gcggcaucca auaccucgca ggauugucaa cacugccagg  5700


gaaccccgcg guggcuucca ugauggcauu cagugccgcc cucaccaguc cguugucgac  5760


caguaccacc auccuucuca acaucauggg aggcugguua gcgucccaga ucgcaccacc  5820


cgcgggggcc accggcuuug ucgucagugg ccuggugggg gcugccgugg gcagcauagg  5880


ccuggguaag gugcuggugg acauccuggc aggauauggu gcgggcauuu cgggggcccu  5940


cgucgcauuc aagaucaugu cuggcgagaa gcccucuaug gaagauguca ucaaucuacu  6000


gccugggauc cugucuccgg gagcccuggu gguggggguc aucugcgcgg ccauucugcg  6060


ccgccacgug ggaccggggg agggcgcggu ccaauggaug aacaggcuua uugccuuugc  6120


uuccagagga aaccacgucg ccccuacuca cuacgugacg gagucggaug cgucgcagcg  6180


ugugacccaa cuacuuggcu cucuuacuau aaccagccua cucagaagac uccacaauug  6240


gauaacugag gacugcccca ucccaugcuc cggauccugg cuccgcgacg ugugggacug  6300


gguuugcacc aucuugacag acuucaaaaa uuggcugacc ucuaaauugu uccccaagcu  6360


gcccggccuc cccuucaucu cuugucaaaa gggguacaag gguguguggg ccggcacugg  6420


caucaugacc acgcgcugcc cuugcggcgc caacaucucu ggcaaugucc gccugggcuc  6480


uaugaggauc acagggccua aaaccugcau gaacaccugg caggggaccu uuccuaucaa  6540


uugcuacacg gagggccagu gcgcgccgaa accccccacg aacuacaaga ccgccaucug  6600


gaggguggcg gccucggagu acgcggaggu gacgcagcau gggucguacu ccuauguaac  6660


aggacugacc acugacaauc ugaaaauucc uugccaacua ccuucuccag aguuuuucuc  6720


cuggguggac ggugugcaga uccauagguu ugcacccaca ccaaagccgu uuuuccggga  6780


ugaggucucg uucugcguug ggcuuaauuc cuaugcuguc gggucccagc uucccuguga  6840


accugagccc gacgcagacg uauugagguc caugcuaaca gauccgcccc acaucacggc  6900


ggagacugcg gcgcggcgcu uggcacgggg aucaccucca ucugaggcga gcuccucagu  6960


gagccagcua ucagcaccgu cgcugcgggc caccugcacc acccacagca acaccuauga  7020


cguggacaug gucgaugcca accugcucau ggagggcggu guggcucaga cagagccuga  7080


guccagggug cccguucugg acuuucucga gccaauggcc gaggaagaga gcgaccuuga  7140


gcccucaaua ccaucggagu gcaugcuccc caggagcggg uuuccacggg ccuuaccggc  7200


uugggcacgg ccugacuaca acccgccgcu cguggaaucg uggaggaggc cagauuacca  7260


accgcccacc guugcugguu gugcucuccc cccccccaag aaggccccga cgccuccccc  7320


aaggagacgc cggacagugg gucugagcga gagcaccaua ucagaagccc uccagcaacu  7380


ggccaucaag accuuuggcc agccccccuc gagcggugau gcaggcucgu ccacgggggc  7440


gggcgccgcc gaauccggcg guccgacguc cccuggugag ccggcccccu cagagacagg  7500


uuccgccucc ucuaugcccc cccucgaggg ggagccugga gauccggacc uggagucuga  7560


ucagguagag cuucaaccuc ccccccaggg ggggggggua gcucccgguu cgggcucggg  7620


gucuuggucu acuugcuccg aggaggacga uaccaccgug ugcugcucca ugucauacuc  7680


cuggaccggg gcucuaauaa cucccuguag ccccgaagag gaaaaguugc caaucaaccc  7740


uuugaguaac ucgcuguugc gauaccauaa caagguguac uguacaacau caaagagcgc  7800


cucacagagg gcuaaaaagg uaacuuuuga caggacgcaa gugcucgacg cccauuauga  7860


cucagucuua aaggacauca agcuagcggc uuccaagguc agcgcaaggc uccucaccuu  7920


ggaggaggcg ugccaguuga cuccacccca uucugcaaga uccaaguaug gauucggggc  7980


caaggagguc cgcagcuugu ccgggagggc cguuaaccac aucaaguccg uguggaagga  8040


ccuccuggaa gacccacaaa caccaauucc cacaaccauc auggccaaaa augagguguu  8100


cugcguggac cccgccaagg gggguaagaa accagcucgc cucaucguuu acccugaccu  8160


cggcguccgg gucugcgaga aaauggcccu cuaugacauu acacaaaagc uuccucaggc  8220


gguaauggga gcuuccuaug gcuuccagua cuccccugcc caacgggugg aguaucucuu  8280


gaaagcaugg gcggaaaaga aggaccccau ggguuuuucg uaugauaccc gaugcuucga  8340


cucaaccguc acugagagag acaucaggac cgaggagucc auauaccagg ccugcucccu  8400


gcccgaggag gcccgcacug ccauacacuc gcugacugag agacuuuacg uaggagggcc  8460


cauguucaac agcaaggguc aaaccugcgg uuacagacgu ugccgcgcca gcggggugcu  8520


aaccacuagc auggguaaca ccaucacaug cuaugugaaa gcccuagcgg ccugcaaggc  8580


ugcggggaua guugcgccca caaugcuggu augcggcgau gaccuaguag ucaucucaga  8640


aagccagggg acugaggagg acgagcggaa ccugagagcc uucacggagg ccaugaccag  8700


guacucugcc ccuccuggug auccccccag accggaauau gaccuggagc uaauaacauc  8760


cuguuccuca aaugugucug uggcguuggg cccgcggggc cgccgcagau acuaccugac  8820


cagagaccca accacuccac ucgcccgggc ugccugggaa acaguuagac acuccccuau  8880


caauucaugg cugggaaaca ucauccagua ugcuccaacc auauggguuc gcaugguccu  8940


aaugacacac uucuucucca uucucauggu ccaagacacc cuggaccaga accucaacuu  9000


ugagauguau ggaucaguau acuccgugaa uccuuuggac cuuccagcca uaauugagag  9060


guuacacggg cuugacgccu uuucuaugca cacauacucu caccacgaac ugacgcgggu  9120


ggcuucagcc cucagaaaac uuggggcgcc accccucagg guguggaaga gucgggcucg  9180


cgcagucagg gcgucccuca ucucccgugg agggaaagcg gccguuugcg gccgauaucu  9240


cuucaauugg gcggugaaga ccaagcucaa acucacucca uugccggagg cgcgccuacu  9300


ggacuuaucc aguugguuca ccgucggcgc cggcgggggc gacauuuuuc acagcguguc  9360


gcgcgcccga ccccgcucau uacucuucgg ccuacuccua cuuuucguag ggguaggccu  9420


cuuccuacuc cccgcucggu agagcggcac acacuaggua cacuccauag cuaacuguuc  9480


cuuuuuuuuu uuuuuuuuuu uuuuuuuuuu uuuuuuuuuu uuuucuuuuu uuuuuuuuuc  9540


ccucuuucuu cccuucucau cuuauucuac uuucuuucuu gguggcucca ucuuagcccu  9600


agucacggcu agcugugaaa gguccgugag ccgcaugacu gcagagagug ccguaacugg  9660


ucucucugca gaucaugu                          9678









SEQ ID NO: 2









<211> 294


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to IRES1 (hepatitis C virus)


    (circ_hcv_ires1)


<220>


<221> misc_ feature


<222> 1..33


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 1..33


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 43..75


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 85..117


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 127..159


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 169..201


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 169..201


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 211..243


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 253..285


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<400> 2
















uaguuccuca cgggggagug guucguggug gagcggcgcc aaugguuuuu ugcgggggag  60


ugguucgugg cggggguaac cccuuaguuc uucauggggg ggugguucau gguggggaaa  120


cuaccguagu uuuucacagg ggggugguuc auggcggaga gaagcgcuua guuucuuaug  180


ggggagugau ucauggcgga guguggggca ugguuuuucg caggggagug auucguggug  240


gggagaguuu ugugguucuu uguagggggg ugauucgugg uggggacauc auug     294






SEQ ID NO: 3









<211> 373


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to IRES2 (hepatitis C virus)


<220>


<221> misc_ feature


<222> 11..34


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 44..67


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 77..100


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 110..123


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 133..166


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 176..199


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 209..232


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 242..265


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 275..298


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 308..331


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<220>


<221> misc_ feature


<222> 341..373


<223> /note=“hybridization site to IRES (hepatitis c virus)”


<400> 3
















ugccgaaaau gcuuauggug cacgguuugc gagagcaaga agagcuugug gugcaugguu  60


ugcggggaca guaaaggcuc auggugcaug gucuacgagg ugagauagcg uuuauggugu  120


acggucugug ggaaauuccg guguucgugg ugugcggucu gugggauauu agaucguuca  180


ugguguacgg uuugugggga uaauagcggc uuauggugca cggucuaugg gacgcgagaa  240


ggcucauggu gugugguuug ugaggcagug ugcgguucau ggugcacggu cugcgagaca  300


ccaggcggcu cguggugcac ggucuauggg gugucgucgu gcuuguggug ugcggucuau  360


gagggcggcu gaa                              373






SEQ ID NO: 4









<211> 346


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to CDS1 (hepatitis C virus)


    (circ_hcv_cds1 )


<220>


<221> misc_ feature


<222> 11..38


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 53..80


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 95..122


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 137..164


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 179..206


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 221..248


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 263..290


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 305..332


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<400> 4
















cugcacuggg uuugggcgac gguugguguu uuuuuuggac gagauuucuu gcucugggcg  60


acgguuggug uuucuuuugg guguuagugc guacucuggg cgaugguugg uguuucuuuu  120


gguaauuauu acuuucuuug ggcgaugguu gguguuuuuu uugguggggu gaaaagaguu  180


ugggcggugg uugguguuuc uuuuggcgug gugaguaaca uuuggguggc gguugguguu  240


uuuuuuggcu gcaacgcacc gguuugggcg acgguuggug uuucuuuugg gggucaaccg  300


ggaaucuggg uggcgguugg uguuuuuuuu ggugauggcc gaggua          346






SEQ ID NO: 5









<211> 355


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to IRES1, IRES2 and CDS1 (hepatitis


    C virus) (circ_hcv_combo1)


<220>


<221> misc_ feature


<222> 11..43


<223> /note=“hybridization site to IRES1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 54..77


<223> /note=“hybridization site to IRES2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 88..115


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 126..158


<223> /note=“hybridization site to IRES1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 169..192


<223> /note=“hybridization site to IRES2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 203..230


<223> /note=“hybridization site to CDS1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 241..273


<223> /note=“hybridization site to IRES1 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 284..307


<223> /note=“hybridization site to IRES2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 318..345


<223> /note=“hybridization site to IRES2 (hepatitis C virus)”


<400> 5
















gcgccaagua uaguuccuca caggggagug auuuauggug gagaccccua aacgcuugug  60


gugcacgguc uacgggguac cgagaaguuu gggcgguggu ugguguuuuu uuuggcgcuu  120


gugggugguu uuuugcaggg gagugauuua ugguggaggc aagaguuugc uuauggugua  180


cggucuguga gaugacauca gguuugggcg gcgguuggug uuuuuuuugg augaggaacc  240


uaguucuuca uaggggagug auuuguggug gagacagcga guuguuugug gugcacgguu  300


uacgagaaga augaagaucu ggguggcggu ugguguuucu uuugguagca caugu     355






SEQ ID NO: 6









<211> 288


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to CDS2 (hepatitis C virus)


    (circ_hcv_cds2)


<220>


<221> misc_ feature


<222> 4..14


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 28..38


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 52..62


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 76..86


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 100..110


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 124..134


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 148..158


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 172..182


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 196..206


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 220..230


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 244..254


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 266..278


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<400> 6
















cccccugggg cucugaugag gaaccucucu ggggucccca cagcgagucu ccuuggggcc  60


ccuagaauga aguucuuugg gguuucauag cacgguucuc cugggguuuu cauacgauug  120


ucucuugggg ucuugcgugu uuacccuuuu gggguccugc uaagggggcu uucuggggcc  180


uuucgaauaa gucuuuuugg ggccucguuu uaucacucuu cugggguucc cagccuuucc  240


cuucuugggg cuccuccgac caugccccuu gggguucuac ccuguaug         288






SEQ ID NO: 7









<211> 10722


<212> RNA


<213> Dengue virus


<220>


<221> misc_ feature


<222> 108..140


<223> /note=“target region of cHP”


<220>


<221> misc_ feature


<222> 10615..10646


<223> /note=“target region of 3UTR”


<400> 7
















aguuguuagu cuacguggac cgacaaagac agauucuuug agggagcuaa gcucaacgua  60


guucuaacag uuuuuuaauu agagagcaga ucucugauga auaaccaacg gaaaaaggcg  120


aaaaacacgc cuuucaauau gcugaaacgc gagagaaacc gcgugucgac ugugcaacag  180


cugacaaaga gauucucacu uggaaugcug cagggacgag gaccauuaaa acuguucaug  240


gcccuggugg cguuccuucg uuuccuaaca aucccaccaa cagcagggau auugaagaga  300


uggggaacaa uuaaaaaauc aaaagcuauu aauguuuuga gaggguucag gaaagagauu  360


ggaaggaugc ugaacaucuu gaauaggaga cgcagaucug caggcaugau cauuaugcug  420


auuccaacag ugauggcguu ccauuuaacc acacguaacg gagaaccaca caugaucguc  480


agcagacaag agaaagggaa aagucuucug uuuaaaacag aggauggcgu gaacaugugu  540


acccucaugg ccauggaccu uggugaauug ugugaagaca caaucacgua caaguguccc  600


cuucucaggc agaaugagcc agaagacaua gacuguuggu gcaacucuac guccacgugg  660


guaacuuaug ggacguguac caccauggga gaacauagaa gagaaaaaag aucaguggca  720


cucguuccac augugggaau gggacuggag acacgaacug aaacauggau gucaucagaa  780


ggggccugga aacaugucca gagaauugaa acuuggaucu ugagacaucc aggcuucacc  840


augauggcag caauccuggc auacaccaua ggaacgacac auuuccaaag agcccugauu  900


uucaucuuac ugacagcugu cacuccuuca augacaaugc guugcauagg aaugucaaau  960


agagacuuug uggaaggggu uucaggagga agcuggguug acauagucuu agaacaugga  1020


agcuguguga cgacgauggc aaaaaacaaa ccaacauugg auuuugaacu gauaaaaaca  1080


gaagccaaac agccugccac ccuaaggaag uacuguauag aggcaaagcu aaccaacaca  1140


acaacagaau cucgcugccc aacacaaggg gaacccagcc uaaaugaaga gcaggacaaa  1200


agguucgucu gcaaacacuc caugguagac agaggauggg gaaauggaug uggacuauuu  1260


ggaaagggag gcauugugac cugugcuaug uucagaugca aaaagaacau ggaaggaaaa  1320


guugugcaac cagaaaacuu ggaauacacc auugugauaa caccucacuc aggggaagag  1380


caugcagucg gaaaugacac aggaaaacau ggcaaggaaa ucaaaauaac accacagagu  1440


uccaucacag aagcagaauu gacagguuau ggcacuguca caauggagug cucuccaaga  1500


acgggccucg acuucaauga gaugguguug cugcagaugg aaaauaaagc uuggcuggug  1560


cacaggcaau gguuccuaga ccugccguua ccaugguugc ccggagcgga cacacaaggg  1620


ucaaauugga uacagaaaga gacauugguc acuuucaaaa auccccaugc gaagaaacag  1680


gauguuguug uuuuaggauc ccaagaaggg gccaugcaca cagcacuuac aggggccaca  1740


gaaauccaaa ugucaucagg aaacuuacuc uucacaggac aucucaagug caggcugaga  1800


auggacaagc uacagcucaa aggaauguca uacucuaugu gcacaggaaa guuuaaaguu  1860


gugaaggaaa uagcagaaac acaacaugga acaauaguua ucagagugca auaugaaggg  1920


gacggcucuc caugcaagau cccuuuugag auaauggauu uggaaaaaag acaugucuua  1980


ggucgccuga uuacagucaa cccaauugug acagaaaaag auagcccagu caacauagaa  2040


gcagaaccuc cauucggaga cagcuacauc aucauaggag uagagccggg acaacugaag  2100


cucaacuggu uuaagaaagg aaguucuauc ggccaaaugu uugagacaac aaugaggggg  2160


gcgaagagaa uggccauuuu aggugacaca gccugggauu uuggauccuu gggaggagug  2220


uuuacaucua uaggaaaggc ucuccaccaa gucuuuggag caaucuaugg agcugccuuc  2280


agugggguuu cauggacuau gaaaauccuc auaggaguca uuaucacaug gauaggaaug  2340


aauucacgca gcaccucacu gucugugaca cuaguauugg ugggaauugu gacacuguau  2400


uugggaguca uggugcaggc cgauaguggu ugcguuguga gcuggaaaaa caaagaacug  2460


aaauguggca gugggauuuu caucacagac aacgugcaca cauggacaga acaauacaag  2520


uuccaaccag aauccccuuc aaaacuagcu ucagcuaucc agaaagccca ugaagagggc  2580


auuuguggaa uccgcucagu aacaagacug gagaaucuga uguggaaaca aauaacacca  2640


gaauugaauc acauucuauc agaaaaugag gugaaguuaa cuauuaugac aggagacauc  2700


aaaggaauca ugcaggcagg aaaacgaucu cugcggccuc agcccacuga gcugaaguau  2760


ucauggaaaa cauggggcaa agcaaaaaug cucucuacag agucucauaa ccagaccuuu  2820


cucauugaug gccccgaaac agcagaaugc cccaacacaa auagagcuug gaauucguug  2880


gaaguugaag acuauggcuu uggaguauuc accaccaaua uauggcuaaa auugaaagaa  2940


aaacaggaug uauucugcga cucaaaacuc augucagcgg ccauaaaaga caacagagcc  3000


guccaugccg auauggguua uuggauagaa agugcacuca augacacaug gaagauagag  3060


aaagccucuu ucauugaagu uaaaaacugc cacuggccaa aaucacacac ccucuggagc  3120


aauggagugc uagaaaguga gaugauaauu ccaaagaauc ucgcuggacc agugucucaa  3180


cacaacuaua gaccaggcua ccauacacaa auaacaggac cauggcaucu agguaagcuu  3240


gagauggacu uugauuucug ugauggaaca acagugguag ugacugagga cugcggaaau  3300


agaggacccu cuuugagaac aaccacugcc ucuggaaaac ucauaacaga auggugcugc  3360


cgaucuugca cauuaccacc gcuaagauac agaggugagg augggugcug guacgggaug  3420


gaaaucagac cauugaagga gaaagaagag aauuugguca acuccuuggu cacagcugga  3480


caugggcagg ucgacaacuu uucacuagga gucuugggaa uggcauuguu ccuggaggaa  3540


augcuuagga cccgaguagg aacgaaacau gcaauacuac uaguugcagu uucuuuugug  3600


acauugauca cagggaacau guccuuuaga gaccugggaa gagugauggu uaugguaggc  3660


gccacuauga cggaugacau agguaugggc gugacuuauc uugcccuacu agcagccuuc  3720


aaagucagac caacuuuugc agcuggacua cucuugagaa agcugaccuc caaggaauug  3780


augaugacua cuauaggaau uguacuccuc ucccagagca ccauaccaga gaccauucuu  3840


gaguugacug augcguuagc cuuaggcaug augguccuca aaauggugag aaauauggaa  3900


aaguaucaau uggcagugac uaucauggcu aucuugugcg ucccaaacgc agugauauua  3960


caaaacgcau ggaaagugag uugcacaaua uuggcagugg uguccguuuc cccacugcuc  4020


uuaacauccu cacagcaaaa aacagauugg auaccauuag cauugacgau caaaggucuc  4080


aauccaacag cuauuuuucu aacaacccuc ucaagaacca gcaagaaaag gagcuggcca  4140


uuaaaugagg cuaucauggc agucgggaug gugagcauuu uagccaguuc ucuccuaaaa  4200


aaugauauuc ccaugacagg accauuagug gcuggagggc uccucacugu gugcuacgug  4260


cucacuggac gaucggccga uuuggaacug gagagagcag ccgaugucaa augggaagac  4320


caggcagaga uaucaggaag caguccaauc cugucaauaa caauaucaga agaugguagc  4380


augucgauaa aaaaugaaga ggaagaacaa acacugacca uacucauuag aacaggauug  4440


cuggugaucu caggacuuuu uccuguauca auaccaauca cggcagcagc augguaccug  4500


ugggaaguga agaaacaacg ggccggagua uugugggaug uuccuucacc cccacccaug  4560


ggaaaggcug aacuggaaga uggagccuau agaauuaagc aaaaagggau ucuuggauau  4620


ucccagaucg gagccggagu uuacaaagaa ggaacauucc auacaaugug gcaugucaca  4680


cguggcgcug uucuaaugca uaaaggaaag aggauugaac caucaugggc ggacgucaag  4740


aaagaccuaa uaucauaugg aggaggcugg aaguuagaag gagaauggaa ggaaggagaa  4800


gaaguccagg uauuggcacu ggagccugga aaaaauccaa gagccgucca aacgaaaccu  4860


ggucuuuuca aaaccaacgc cggaacaaua ggugcuguau cucuggacuu uucuccugga  4920


acgucaggau cuccaauuau cgacaaaaaa ggaaaaguug ugggucuuua ugguaauggu  4980


guuguuacaa ggaguggagc auaugugagu gcuauagccc agacugaaaa aagcauugaa  5040


gacaacccag agaucgaaga ugacauuuuc cgaaagagaa gacugaccau cauggaccuc  5100


cacccaggag cgggaaagac gaagagauac cuuccggcca uagucagaga agcuauaaaa  5160


cgggguuuga gaacauuaau cuuggccccc acuagaguug uggcagcuga aauggaggaa  5220


gcccuuagag gacuuccaau aagauaccag accccagcca ucagagcuga gcacaccggg  5280


cgggagauug uggaccuaau gugucaugcc acauuuacca ugaggcugcu aucaccaguu  5340


agagugccaa acuacaaccu gauuaucaug gacgaagccc auuucacaga cccagcaagu  5400


auagcagcua gaggauacau cucaacucga guggagaugg gugaggcagc ugggauuuuu  5460


augacagcca cucccccggg aagcagagac ccauuuccuc agagcaaugc accaaucaua  5520


gaugaagaaa gagaaauccc ugaacguucg uggaauuccg gacaugaaug ggucacggau  5580


uuuaaaggga agacuguuug guucguucca aguauaaaag caggaaauga uauagcagcu  5640


ugccugagga aaaauggaaa gaaagugaua caacucagua ggaagaccuu ugauucugag  5700


uaugucaaga cuagaaccaa ugauugggac uucgugguua caacugacau uucagaaaug  5760


ggugccaauu ucaaggcuga gaggguuaua gaccccagac gcugcaugaa accagucaua  5820


cuaacagaug gugaagagcg ggugauucug gcaggaccua ugccagugac ccacucuagu  5880


gcagcacaaa gaagagggag aauaggaaga aauccaaaaa augagaauga ccaguacaua  5940


uacauggggg aaccucugga aaaugaugaa gacugugcac acuggaaaga agcuaaaaug  6000


cuccuagaua acaucaacac gccagaagga aucauuccua gcauguucga accagagcgu  6060


gaaaaggugg augccauuga uggcgaauac cgcuugagag gagaagcaag gaaaaccuuu  6120


guagacuuaa ugagaagagg agaccuacca gucugguugg ccuacagagu ggcagcugaa  6180


ggcaucaacu acgcagacag aagguggugu uuugauggag ucaagaacaa ccaaauccua  6240


gaagaaaacg uggaaguuga aaucuggaca aaagaagggg aaaggaagaa auugaaaccc  6300


agaugguugg augcuaggau cuauucugac ccacuggcgc uaaaagaauu uaaggaauuu  6360


gcagccggaa gaaagucucu gacccugaac cuaaucacag aaauggguag gcucccaacc  6420


uucaugacuc agaaggcaag agacgcacug gacaacuuag cagugcugca cacggcugag  6480


gcagguggaa gggcguacaa ccaugcucuc agugaacugc cggagacccu ggagacauug  6540


cuuuuacuga cacuucuggc uacagucacg ggagggaucu uuuuauucuu gaugagcgga  6600


aggggcauag ggaagaugac ccugggaaug ugcugcauaa ucacggcuag cauccuccua  6660


ugguacgcac aaauacagcc acacuggaua gcagcuucaa uaauacugga guuuuuucuc  6720


uaguuuugcu uauuccagaa ccugaaaaac agagaacacc ccaagacaac caacugaccu  6780


acguugucau agccauccuc acaguggugg ccgcaaccau ggcaaacgag auggguuucc  6840


uagaaaaaac gaagaaagau cucggauugg gaagcauugc aacccagcaa cccgagagca  6900


acauccugga cauagaucua cguccugcau cagcauggac gcuguaugcc guggccacaa  6960


cauuuguuac accaauguug agacauagca uugaaaauuc cucagugaau gugucccuaa  7020


cagcuauagc caaccaagcc acaguguuaa ugggucucgg gaaaggaugg ccauugucaa  7080


agauggacau cggaguuccc cuucucgcca uuggaugcua cucacaaguc aaccccauaa  7140


cucucacagc agcucuuuuc uuauugguag cacauuaugc caucauaggg ccaggacucc  7200


aagcaaaagc aaccagagaa gcucagaaaa gagcagcggc gggcaucaug aaaaacccaa  7260


cugucgaugg aauaacagug auugaccuag auccaauacc uuaugaucca aaguuugaaa  7320


agcaguuggg acaaguaaug cuccuagucc ucugcgugac ucaaguauug augaugagga  7380


cuacaugggc ucugugugag gcuuuaaccu uagcuaccgg gcccaucucc acauuguggg  7440


aaggaaaucc agggagguuu uggaacacua ccauugcggu gucaauggcu aacauuuuua  7500


gagggaguua cuuggccgga gcuggacuuc ucuuuucuau uaugaagaac acaaccaaca  7560


caagaagggg aacuggcaac auaggagaga cgcuuggaga gaaauggaaa agccgauuga  7620


acgcauuggg aaaaagugaa uuccagaucu acaagaaaag uggaauccag gaaguggaua  7680


gaaccuuagc aaaagaaggc auuaaaagag gagaaacgga ccaucacgcu gugucgcgag  7740


gcucagcaaa acugagaugg uucguugaga gaaacauggu cacaccagaa gggaaaguag  7800


uggaccucgg uuguggcaga ggaggcuggu cauacuauug uggaggacua aagaauguaa  7860


gagaagucaa aggccuaaca aaaggaggac caggacacga agaacccauc cccaugucaa  7920


cauaugggug gaaucuagug cgucuucaaa guggaguuga cguuuucuuc aucccgccag  7980


aaaaguguga cacauuauug ugugacauag gggagucauc accaaauccc acaguggaag  8040


caggacgaac acucagaguc cuuaacuuag uagaaaauug guugaacaac aacacucaau  8100


uuugcauaaa gguucucaac ccauauaugc ccucagucau agaaaaaaug gaagcacuac  8160


aaaggaaaua uggaggagcc uuagugagga auccacucuc acgaaacucc acacaugaga  8220


uguacugggu auccaaugcu uccgggaaca uagugucauc agugaacaug auuucaagga  8280


uguugaucaa cagauuuaca augagauaca agaaagccac uuacgagccg gauguugacc  8340


ucggaagcgg aacccguaac aucgggauug aaagugagau accaaaccua gauauaauug  8400


ggaaaagaau agaaaaaaua aagcaagagc augaaacauc auggcacuau gaccaagacc  8460


acccauacaa aacgugggca uaccauggua gcuaugaaac aaaacagacu ggaucagcau  8520


cauccauggu caacggagug gucaggcugc ugacaaaacc uugggacguc guccccaugg  8580


ugacacagau ggcaaugaca gacacgacuc cauuuggaca acagcgcguu uuuaaagaga  8640


aaguggacac gagaacccaa gaaccgaaag aaggcacgaa gaaacuaaug aaaauaacag  8700


cagaguggcu uuggaaagaa uuagggaaga aaaagacacc caggaugugc accagagaag  8760


aauucacaag aaaggugaga agcaaugcag ccuugggggc cauauucacu gaugagaaca  8820


aguggaaguc ggcacgugag gcuguugaag auaguagguu uugggagcug guugacaagg  8880


aaaggaaucu ccaucuugaa ggaaagugug aaacaugugu guacaacaug augggaaaaa  8940


gagagaagaa gcuaggggaa uucggcaagg caaaaggcag cagagccaua ugguacaugu  9000


ggcuuggagc acgcuucuua gaguuugaag cccuaggauu cuuaaaugaa gaucacuggu  9060


ucuccagaga gaacucccug aguggagugg aaggagaagg gcugcacaag cuagguuaca  9120


uucuaagaga cgugagcaag aaagagggag gagcaaugua ugccgaugac accgcaggau  9180


gggauacaag aaucacacua gaagaccuaa aaaaugaaga aaugguaaca aaccacaugg  9240


aaggagaaca caagaaacua gccgaggcca uuuucaaacu aacguaccaa aacaaggugg  9300


ugcgugugca aagaccaaca ccaagaggca caguaaugga caucauaucg agaagagacc  9360


aaagagguag uggacaaguu ggcaccuaug gacucaauac uuucaccaau auggaagccc  9420


aacuaaucag acagauggag ggagaaggag ucuuuaaaag cauucagcac cuaacaauca  9480


cagaagaaau cgcugugcaa aacugguuag caagaguggg gcgcgaaagg uuaucaagaa  9540


uggccaucag uggagaugau uguguuguga aaccuuuaga ugacagguuc gcaagcgcuu  9600


uaacagcucu aaaugacaug ggaaagauua ggaaagacau acaacaaugg gaaccuucaa  9660


gaggauggaa ugauuggaca caagugcccu ucuguucaca ccauuuccau gaguuaauca  9720


ugaaagacgg ucgcguacuc guuguuccau guagaaacca agaugaacug auuggcagag  9780


cccgaaucuc ccaaggagca ggguggucuu ugcgggagac ggccuguuug gggaagucuu  9840


acgcccaaau guggagcuug auguacuucc acagacgcga ccucaggcug gcggcaaaug  9900


cuauuugcuc ggcaguacca ucacauuggg uuccaacaag ucgaacaacc ugguccauac  9960


augcuaaaca ugaauggaug acaacggaag acaugcugac agucuggaac agggugugga  10020


uucaagaaaa cccauggaug gaagacaaaa cuccagugga aucaugggag gaaaucccau  10080


acuuggggaa aagagaagac caauggugcg gcucauugau uggguuaaca agcagggcca  10140


ccugggcaaa gaacauccaa gcagcaauaa aucaaguuag aucccuuaua ggcaaugaag  10200


aauacacaga uuacaugcca uccaugaaaa gauucagaag agaagaggaa gaagcaggag  10260


uucuguggua gaaagcaaaa cuaacaugaa acaaggcuag aagucagguc ggauuaagcc  10320


auaguacgga aaaaacuaug cuaccuguga gccccgucca aggacguuaa aagaagucag  10380


gccaucauaa augccauagc uugaguaaac uaugcagccu guagcuccac cugagaaggu  10440


guaaaaaauc cgggaggcca caaaccaugg aagcuguacg cauggcguag uggacuagcg  10500


guuagaggag accccucccu uacaaaucgc agcaacaaug ggggcccaag gcgagaugaa  10560


gcuguagucu cgcuggaagg acuagagguu agaggagacc cccccgaaac aaaaaacagc  10620


auauugacgc ugggaaagac cagagauccu gcugucuccu cagcaucauu ccaggcacag  10680


aacgccagaa aauggaaugg ugcuguugaa ucaacagguu cu             10722






SEQ ID NO: 8









<211> 293


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to 3UTR (Dengue virus)


    (circ_dv_3utr)


<220>


<221> misc_ feature


<222> 7..38


<223> /note=“hybridization site to 3UTR (Dengue virus)”


<220>


<221> misc_ feature


<222> 48..79


<223> /note=“hybridization site to 3UTR (Dengue virus)”


<220>


<221> misc_ feature


<222> 89..120


<223> /note=“hybridization site to 3UTR (Dengue virus)”


<220>


<221> misc_ feature


<222> 130..161


<223> /note=“hybridization site to 3UTR (Dengue virus)”


<220>


<221> misc_ feature


<222> 171..202


<223> /note=“hybridization site to 3UTR (Dengue virus)”


<220>


<221> misc_ feature


<222> 212..243


<223> /note=“hybridization site to 3UTR (Dengue virus)”


<220>


<221> misc_ feature


<222> 253..284


<223> /note=“hybridization site to 3UTR (Dengue virus)”


<400> 8
















gcgccgucuu uggucuuuuu uggcgucagu auguuguuuu uuaaccaucu uugguuuuuc  60


cuggcgucag ugugcuguua uaguaugguc ucugguuuuu uuuagcguua gugugcuguu  120


aaagcuuucu cucuggucuu uuccaguguc aauaugcugu uuagugugcu ucuuugguuu  180


uucuuggugu uggugugcug uuucagcaag uucucugguc uuuucuggcg uugauguguu  240


guucgcuggc gaucuuuggu cuuucucggu gucgauaugu uguuaguggc cca     293






SEQ ID NO: 9









<211> 300


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to ChP (Dengue virus)


    (circ_dv_cHP_v1)


<220>


<221> misc_ feature


<222> 7..39


<223> /note=“hybridization site to ChP (Dengue virus)”


<220>


<221> misc_ feature


<222> 49..81


<223> /note=“hybridization site to ChP (Dengue virus)”


<220>


<221> misc_ feature


<222> 91..123


<223> /note=“hybridization site to ChP (Dengue virus)”


<220>


<221> misc_ feature


<222> 133..165


<223> /note=“hybridization site to ChP (Dengue virus)”


<220>


<221> misc_ feature


<222> 175..207


<223> /note=“hybridization site to ChP (Dengue virus)”


<220>


<221> misc_ feature


<222> 217..249


<223> /note=“hybridization site to ChP (Dengue virus)”


<220>


<221> misc_ feature


<222> 259..291


<223> /note=“hybridization site to ChP (Dengue virus)”


<400> 9
















gcgccgaugu uggggggugu guuuuuuguc uuuuuucguu gggguguaau guugagaggc  60


guguuuuuug cuuuuuuuug ugcaccuuau auauugggag guguguuuuu cgcuuuuuuc  120


cgucuggcug gcauauuggg gggcguguuu uucguuuuuu uucguuacaa gcuaauauug  180


aagggugugu uuuucgccuu uuuccguguu aaagauaugu ugaaaggcgu guuuuucguu  240


uuuuuccgua aguuuuaaau auuggagggc guguuuuucg cuuuuuucug uagaccggaa  300






SEQ ID NO: 10









<211> 294


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to ChP2 (Dengue virus)


    (circ_dv_cHP_v2)


<220>


<221> misc_ feature


<222> 7..39


<223> /note=“hybridization site to ChP2 (Dengue virus)”


<220>


<221> misc_ feature


<222> 55..87


<223> /note=“hybridization site to ChP2 (Dengue virus)”


<220>


<221> misc_ feature


<222> 103..135


<223> /note=“hybridization site to ChP2 (Dengue virus)”


<220>


<221> misc_ feature


<222> 151..183


<223> /note=“hybridization site to ChP2 (Dengue virus)”


<220>


<221> misc_ feature


<222> 199..231


<223> /note=“hybridization site to ChP2 (Dengue virus)”


<220>


<221> misc_ feature


<222> 247..279


<223> /note=“hybridization site to ChP2 (Dengue virus)”


<400> 10
















gcgccgaugu ugagaggugu guuuuuugcu uuuuuucguu uauuacucca acagauauug  60


agaggcgugu uuuucgcuuu uuuucguaga agguaauaga aaauauuggg gggcguguuu  120


uucgucuuuu uucgugacuc uuacgaguuu auguugaaag guguguuuuu cgcuuuuuuu  180


uguagggaac agucgcaaau auuggggggu guguuuuucg ccuuuuuucg uggcaccgua  240


auccgcaugu ugaaaggugu guuuuucguu uuuuuccguc aacucguucu uaua     294






SEQ ID NO: 11









<211> 11840


<212> RNA


<213> Chikungunya virus


<220>


<221> misc_ feature


<222> 14..48


<223> /note=“target region of 5UTR”


<220>


<221> misc_ feature


<222> 11367..11399


<223> /note=“target region of RSE”


<400> 11
















auggcugcgu gagacacacg uagccuacca guuucuuacu gcucuacucu gcaaagcaag  60


agauuaauaa cccaucaugg auccugugua cguggacaua gacgcugaca gcgccuuuuu  120


gaaggcccug caacgugcgu accccauguu ugagguggaa ccaaggcagg ucacaccgaa  180


ugaccaugcu aaugcuagag cguucucgca ucuagcuaua aaacuaauag agcaggaaau  240


ugaccccgac ucaaccaucc uggauaucgg cagugcgcca gcaaggagga ugaugucgga  300


caggaaguac cacugcgucu gcccgaugcg cagugcggaa gaucccgaga gacucgccaa  360


uuaugcgaga aagcuagcau cugccgcagg aaaaguccug gacagaaaca ucucuggaaa  420


gaucggggac uuacaagcag uaauggccgu gccagacacg gagacgccaa cauucugcuu  480


acacacagac gucucaugua gacagagagc agacgucgcu auauaccaag acgucuaugc  540


uguacacgca cccacgucgc uauaccacca ggcgauuaaa gggguccgag uggcguacug  600


gguuggguuc gacacaaccc cguucaugua caaugccaug gcgggugccu accccucaua  660


cucgacaaac ugggcagaug agcagguacu gaaggcuaag aacauaggau uauguucaac  720


agaccugacg gaagguagac gaggcaaguu gucuauuaug agagggaaaa agcuaaaacc  780


gugcgaccgu gugcuguucu caguaggguc aacgcucuac ccggaaagcc gcaagcuacu  840


uaagagcugg caccugccau cgguguucca uuuaaagggc aaacucagcu ucacaugccg  900


cugugauaca gugguuucgu gugagggcua cgucguuaag agaauaacga ugagcccagg  960


ccuuuaugga aaaaccacag gguaugcggu aacccaccac gcagacggau uccugaugug  1020


caagacuacc gacacgguug acggcgaaag arugucauuc ucggugugca cauacgugcc  1080


ggcgaccauu ugugaucaaa ugaccggcau ccuugcuaca gaagucacgc cggaggaugc  1140


acagaagcug uugguggggc ugaaccagag aauagugguu aacggcagaa cgcaacggaa  1200


uacgaacacc augaaaaauu aucugcuucc cguggucgcc caagccuuca guaagugggc  1260


aaaggagugc cggaaagaca uggaagauga aaaacuccug ggggucagag aaagaacacu  1320


gaccugcugc ugucuauggg cauucaagaa gcagaaaaca cacacggucu acaagaggcc  1380


ugauacccag ucaauucaga agguucaggc cgaguuugac agcuuugugg uaccgagucu  1440


guggucgucc ggguugucaa ucccuuugag gacuagaauc aaaugguugu uaagcaaggu  1500


gccaaaaacc gaccugaucc cauacagcgg agacgcccga gaagcccggg acgcagaaaa  1560


agaagcagag gaagaacgag aagcagaacu gacucgcgaa gcccuaccac cucuacaggc  1620


agcacaggaa gauguucagg ucgaaaucga cguggaacag cuugaggaca gagcgggcgc  1680


aggaauaaua gagacuccga gaggagcuau caaaguuacu gcccaaccaa cagaccacgu  1740


cgugggagag uaccugguac ucuccccgca gaccguacua cguagccaga agcucagucu  1800


gauucacgcu uuggcggagc aagugaagac gugcacgcac aacggacgag cagggaggua  1860


ugcggucgaa gcguacgacg gccgaguccu agugcccuca ggcuaugcaa ucucgccuga  1920


agacuuccag agucuaagcg aaagcgcaac gaugguguau aacgaaagag aguucguaaa  1980


cagaaagcua caccauauug cgaugcacgg accagcccug aacaccgacg aagagucgua  2040


ugagcuggug agggcagaga ggacagaaca cgaguacguc uacgacgugg aucagagaag  2100


augcuguaag aaggaagaag ccgcaggacu gguacuggug ggcgacuuga cuaauccgcc  2160


cuaccacgaa uucgcauaug aagggcuaaa aauccgcccu gccugcccau acaaaauugc  2220


agucauagga gucuucggag uaccgggauc uggcaaguca gcuauuauca agaaccuagu  2280


uaccaggcag gaccugguga cuagcggaaa gaaagaaaac ugccaagaaa ucaccaccga  2340


cgugaugaga cagagagguc uagagauauc ugcacguacg guugacucgc ugcucuugaa  2400


uggaugcaac agaccagucg acguguugua cguagacgag gcguuugcgu gccacucugg  2460


aacgcuacuu gcuuugaucg ccuuggugag accaaggcag aaaguuguac uuugugguga  2520


cccgaagcag ugcggcuucu ucaauaugau gcagaugaaa gucaacuaua aucacaacau  2580


cugcacccaa guguaccaca aaaguaucuc caggcggugu acacugccug ugaccgccau  2640


ugugucaucg uugcauuacg aaggcaaaau gcgcacuacg aaugaguaca acaagccgau  2700


uguaguggac acuacaggcu caacaaaacc ugacccugga gaccucgugu uaacgugcuu  2760


cagagggugg guuaaacaac ugcaaauuga cuaucgugga uacgagguca ugacagcagc  2820


cgcaucccaa ggguuaacca gaaaaggagu uuacgcaguu agacaaaaag uuaaugaaaa  2880


cccgcucuau gcaucaacgu cagagcacgu caacguacuc cuaacgcgua cggaagguaa  2940


acugguaugg aagacacuuu ccggcgaccc guggauaaag acgcugcaga acccaccgaa  3000


aggaaacuuc aaagcaacua uuaaggagug ggagguggag caugcaucaa uaauggcggg  3060


caucugcagu caccaaauga ccuucgauac auuccaaaau aaagccaacg uuuguugggc  3120


uaagagcuug gucccuaucc ucgaaacagc ggggauaaaa cuaaaugaua ggcagugguc  3180


ucagauaauu caagccuuca aagaagacaa agcauacuca ccugaaguag cccugaauga  3240


aauauguacg cgcauguaug ggguggaucu agacagcggg cuauuuucua aaccguuggu  3300


gucuguguau uacgcggaua accacuggga uaauaggccu ggagggaaaa uguucggauu  3360


uaaccccgag gcagcaucca uucuagaaag aaaguaucca uucacaaaag ggaaguggaa  3420


caucaacaag cagaucugcg ugacuaccag gaggauagaa gacuuuaacc cuaccaccaa  3480


caucauaccg gccaacagga gacuaccaca cucauuagug gccgaacacc gcccaguaaa  3540


aggggaaaga auggaauggc ugguuaacaa gauaaacggc caccacgugc uccuggucag  3600


uggcuauaac cuugcacugc cuacuaagag agucacuugg guagcgccgu uagguguccg  3660


cggagcggac uacacauaca accuagaguu gggucugcca gcaacgcuug guagguauga  3720


ccuagugguc auaaacaucc acacaccuuu ucgcauacac cauuaccaac agugcgucga  3780


ccacgcaaug aaacugcaaa ugcucggggg ugacucauug agacugcuca aaccgggcgg  3840


cucucuauug aucagagcau augguuacgc agauagaacc agugaacgag ucaucugcgu  3900


auugggacgc aaguuuagau cgucuagagc guugaaacca ccauguguca ccagcaacac  3960


ugagauguuu uuccuauuca gcaacuuuga caauggcaga aggaauuuca caacucaugu  4020


caugaacaau caacugaaug cagccuucgu aggacagguc acccgagcag gaugugcacc  4080


gucguaccgg guaaaacgca uggacaucgc gaagaacgau gaagagugcg uagucaacgc  4140


cgcuaacccu cgcggguuac cgggugrcgg uguuugcaag gcaguauaca aaaaauggcc  4200


ggaguccuuu aagaacagug caacaccagu gggaaccgca aaaacaguua ugugcgguac  4260


guauccagua auccacgcug uuggaccaaa cuucucuaau uauucggagu cugaagggga  4320


ccgggaauug gcagcugccu aucgagaagu cgcaaaggaa guaacuaggc ugggaguaaa  4380


uaguguagcu auaccucucc ucuccacagg uguauacuca ggagggaaag acaggcugac  4440


ccagucacug aaccaccucu uuacagccau ggacucgacg gaugcagacg uggucaucua  4500


cugccgcgac aaagaauggg agaagaaaau aucugaggcc auacagaugc ggacccaagu  4560


agagcugcug gaugagcaca ucuccauaga cugcgauauu guucgcgugc acccugacag  4620


cagcuuggca ggcagaaaag gauacagcac cacggaaggc gcacuguacu cauaucuaga  4680


agggacccgu uuucaucaga cggcugugga uauggcggag auacauacua uguggccaaa  4740


gcaaacagag gccaaugagc aagucugccu auaugcccug ggggaaagua uugaaucgau  4800


caggcagaaa ugcccggugg augaugcaga cgcaucaucu ccccccaaaa cugucccgug  4860


ccuuugccgu uacgcuauga cuccagaacg cgucacccgg cuucgcauga accacgucac  4920


aagcauaauu guguguucuu cguuuccccu cccaaaguac aaaauagaag gagugcaaaa  4980


agucaaaugc ucuaagguaa ugcuauuuga ccacaacgug ccaucgcgcg uaaguccaag  5040


ggaauauaka ucuucccagg agucugcaca ggaggcgagu acaaucacgu cacugacgca  5100


uagucaauuc gaccuaagcg uugauggcga gauacugccc gucccgucag accuggaugc  5160


ugacgcccca gcccuagaac cagcacuaga cgacggggcg acacacacgc ugccauccac  5220


aaccggaaac cuugcggccg ugucugauug gguaaugagc accguaccug ucgcgccgcc  5280


cagaagaagg cgagggagaa accugacugu gacaugugac gagagagaag ggaauauaac  5340


acccauggcu agcguccgau ucuuuagggc agagcugugu ccggucguac aagaaacagc  5400


ggagacgcgu gacacagcaa ugucucuuca ggcaccaccg aguaccgcca cggaaccgaa  5460


ucauccgccg aucuccuucg gagcaucaag cgagacguuc cccauuacau uuggggacuu  5520


caacgaagga gaaaucgaaa gcuugucuuc ugagcuacua acuuucggag acuucuuacc  5580


aggagaagug gaugacuuga cagacagcga cugguccacg ugcucagaca cggacgacga  5640


guuaugacua gacagggcag guggguauau auucucgucg gacaccgguc caggucauuu  5700


acaacagaag ucaguacgcc agucagugcu gccggugaac acccuggagg aaguccacga  5760


ggagaagugu uacccaccua agcuggauga agcaaaggag caacuauuac uuaagaaacu  5820


ccaggagagu gcauccaugg ccaacagaag cagguaucag ucgcgcaaag uagaaaacau  5880


gaaagcagca aucauccaga gacuaaagag aggcuguaga cuauacuuaa ugucagagac  5940


cccaaaaguc ccuacuuacc ggacuacaua uccggcgccu guguacucgc cuccgaucaa  6000


cguccgauug uccaaucccg aguccgcagu ggcagcaugc aaugaguucu uagcuagaaa  6060


cuauccaacu gucucaucau accaaauuac cgacgaguau gaugcauauc uagacauggu  6120


ggacgggucg gagaguugcc uggaccgagc gacauucaau ccgucaaaac ucaggagcua  6180


cccgaaacag cacgcuuacc acgcgcccuc caucagaagc gcuguaccgu ccccauucca  6240


gaacacacua cagaauguac uggcagcagc cacgaaaaga aacugcaacg ucacacagau  6300


gagggaauua cccacuuugg acucagcagu auucaacgug gaguguuuca aaaaauucgc  6360


augcaaccaa gaauacuggg aagaauuugc ugccagcccu auuaggauaa caacugagaa  6420


uuuagcaacc uauguuacua aacuaaaagg gccaaaagca gcagcgcuau ucgcaaaaac  6480


ccauaaucua cugccacuac aggaaguacc aauggauagg uucacaguag auaugaaaag  6540


ggacguaaag gugacuccug guacaaagca uacagaggaa agaccuaagg ugcagguuau  6600


acaggcggcu gaacccuugg cgacagcaua ccuauguggg auucacagag agcugguuag  6660


gaggcugaac gccguccucc uacccaaugu acauacacua uuugacaugu cugccgagga  6720


uuucgaugcc aucauagccg cacacuuuaa gccaggagac acuguuuugg aaacggacau  6780


agccuccuuu gauaagagcc aagaugauuc acuugcgcuu acugcuuuga ugcuguuaga  6840


ggauuuaggg guggaucacu cccugcugga cuugauagag gcugcuuucg gagagauuuc  6900


cagcugucac cuaccgacag guacgcgcuu caaguucggc gccaugauga aaucagguau  6960


guuccuaacu cuguucguca acacauuguu aaacaucacc aucgccagcc gagugcugga  7020


agaucgucug acaaaauccg cgugcgcggc cuucaucggc gacgacaaca uaauacaugg  7080


agucgucucc gaugaauuga uggcagccag augugccacu uggaugaaca uggaagugaa  7140


gaucauagau gcaguuguau ccuugaaagc cccuuacuuu uguggagggu uuauacugca  7200


cgauacugug acaggaacag cuugcagagu ggcagacccg cuaaaaaggc uuuuuaaacu  7260


gggcaaaccg cuagcggcag gugacgaaca agaugaagau agaagacgag cgcuggcuga  7320


cgaagugauc agauggcaac gaacagggcu aauugaugag cuggagaaag cgguauacuc  7380


uagguacgaa gugcagggua uaucaguugu gguaaugucc auggccaccu uugcaagcuc  7440


cagauccaac uucgagaagc ucagaggacc cgucauaacu uuguacggcg guccuaaaua  7500


gguacgcacu acagcuaccu auuuugcaga agccgacagc aaguaucuaa acacuaauca  7560


gcuacaaugg aguucauccc aacccaaacu uuuuacaaua ggagguacca gccucgaccc  7620


uggacuccgc gcccuacuau ccaagucauc aggcccagac cgcgcccuca gaggcaagcu  7680


gggcaacuug cccagcugau cucagcaguu aauaaacuga caaugcgcgc gguaccccaa  7740


cagaagccac gcaggaaucg gaagaauaag aagcaaaagc aaaaacaaca ggcgccacaa  7800


aacaacacaa aucaaaagaa gcagccaccu aaaaagaaac cggcucaaaa gaaaaagaag  7860


ccgggccgca gagagaggau gugcaugaaa aucgaaaaug auuguauuuu cgaagucaag  7920


cacgaaggua agguaacagg uuacgcgugc cugguggggg acaaaguaau gaaaccagca  7980


cacguaaagg ggaccaucga uaacgcggac cuggccaaac uggccuuuaa gcggucaucu  8040


aaguaugacc uugaaugcgc gcagauaccc gugcacauga aguccgacgc uucgaaguuc  8100


acccaugaga aaccggaggg guacuacaac uggcaccacg gagcaguaca guacucagga  8160


ggccgguuca ccaucccuac aggugcuggc aaaccagggg acagcggcag accgaucuuc  8220


gacaacaagg gacgcguggu ggccauaguc uuaggaggag cuaaugaagg agcccguaca  8280


gcccucucgg uggugaccug gaauaaagac auugucacua aaaucacccc cgagggggcc  8340


gaagagugga gucuugccau cccaguuaug ugccuguugg caaacaccac guuccccugc  8400


ucccagcccc cuugcacgcc cugcugcuac gaaaaggaac cggaggaaac ccuacgcaug  8460


cuugaggaca acgucaugag accuggguac uaucagcugc uacaagcauc cuuaacaugu  8520


ucuccccacc gccagcgacg cagcaccaag gacaacuuca augucuauaa agccacaaga  8580


ccauacuuag cucacugucc cgacugugga gaagggcacu cgugccauag ucccguagca  8640


cuagaacgca ucagaaauga agcgacagac gggacgcuga aaauccaggu cuccuugcaa  8700


aucggaauaa agacggauga cagccacgau uggaccaagc ugcguuauau ggacaaccac  8760


augccagcag acgcagagag ggcggggcua uuuguaagaa caucagcacc guguacgauu  8820


acuggaacaa ugggacacuu cauccuggcc cgauguccaa aaggggaaac ucugacggug  8880


ggauucacug acaguaggaa gauuagucac ucauguacgc acccauuuca ccacgacccu  8940


ccugugauag gucgggaaaa auuccauucc cgaccgcagc acgguaaaga gcuaccuugc  9000


agcacguacg ugcagagcac cgccgcaacu accgaggaga uagagguaca caugccccca  9060


gacaccccug aucgcacauu aaugucacaa caguccggca acguaaagau cacagucaau  9120


ggccagacgg ugcgguacaa guguaauugc gguggcucaa augaaggacu aacaacuaca  9180


gacaaaguga uuaauaacug caagguugau caaugucaug ccgcggucac caaucacaaa  9240


aaguggcagu auaacucccc ucuggucccg cguaaugcug aacuugggga ccgaaaagga  9300


aaaauucaca ucccguuucc gcuggcaaau guaacaugca gggugccuaa agcaaggaac  9360


cccaccguga cguacgggaa aaaccaaguc aucaugcuac uguauccuga ccacccaaca  9420


cuccuguccu accggaauau gggagaagaa ccaaacuauc aagaagagug ggugaugcau  9480


aagaaggaag ucgugcuaac cgugccgacu gaagggcucg aggucacgug gggcaacaac  9540


gagccguaua aguauuggcc gcaguuaucu acaaacggua cagcccaugg ccacccgcau  9600


gagauaauuc uguauuauua ugagcuguac cccacuauga cuguaguagu ugugucagug  9660


gccacguuca uacuccuguc gauggugggu auggcagcgg ggaugugcau gugugcacga  9720


cgcagaugca ucacaccgua ugaacugaca ccaggagcua ccgucccuuu ccugcuuagc  9780


cuaauaugcu gcaucagaac agcuaaagcg gccacauacc aagaggcugc gauauaccug  9840


uggaacgagc agcaaccuuu guuuuggcua caagcccuua uuccgcuggc agcccugauu  9900


guucuaugca acugucugag acucuuacca ugcugcugua aaacguuggc uuuuuuagcc  9960


guaaugagcg ucggugccca cacugugagc gcguacgaac acguaacagu gaucccgaac  10020


acggugggag uaccguauaa gacucuaguc aauagaccug gcuacagccc caugguauug  10080


gagauggaac uacugucagu cacuuuggag ccaacacuau cgcuugauua caucacgugc  10140


gaguacaaaa ccgucauccc gucuccguac gugaagugcu gcgguacagc agagugcaag  10200


gacaaaaacc uaccugacua cagcuguaag gucuucaccg gcgucuaccc auuuaugugg  10260


ggcggcgccu acugcuucug cgacgcugaa aacacgcagu ugagcgaagc acacguggag  10320


aaguccgaau caugcaaaac agaauuugca ucagcauaca gggcucauac cgcaucugca  10380


ucagcuaagc uccgcguccu uuaccaagga aauaacauca cuguaacugc cuaugcaaac  10440


ggcgaccaug ccgucacagu uaaggacgcc aaauucauug uggggccaau gucuucagcc  10500


uggacaccuu ucgacaacaa aauuguggug uacaaaggug acgucuauaa cauggacuac  10560


ccgcccuuug gcgcaggaag accaggacaa uuuggcgaua uccaaagucg cacaccugag  10620


aguaaagacg ucuaugcuaa uacacaacug guacugcaga gaccggcugu ggguacggua  10680


cacgugccau acucucaggc accaucuggc uuuaaguauu ggcuaaaaga acgcggggcg  10740


ucgcugcagc acacagcacc auuuggcugc caaauagcaa caaacccggu aagagcggug  10800


aacugcgccg uagggaacau gcccaucucc aucgacauac cggaagcggc cuucacuagg  10860


gucgucgacg cgcccucuuu aacggacaug ucgugcgagg uaccagccug cacccauucc  10920


ucagacuuug ggggcgucgc cauuauuaaa uaugcagcca gcaagaaagg caagugugcg  10980


gugcauucga ugacuaacgc cgucacuauu cgggaagcug agauagaagu ugaagggaau  11040


ucucagcugc aaaucucuuu cucgacggcc uuagccagcg ccgaauuccg cguacaaguc  11100


uguucuacac aaguacacug ugcagccgag ugccaccccc cgaaggacca cauagucaac  11160


uacccggcgu cacauaccac ccucgggguc caggacaucu ccgcuacggc gaugucaugg  11220


gugcagaaga ucacgggagg ugugggacug guuguugcug uugccgcacu gauucuaauc  11280


guggugcuau gcgugucguu cagcaggcac uaacuugaca auuaaguaug aagguauaug  11340


uguccccuaa gagacacacu guacauagca aauaaucuau agaucaaagg gcuacgcaac  11400


cccugaauag uaacaaaaua caaaaucacu aaaaauuaua aaaacagaaa aauacauaaa  11460


uagguauacg uguccccuaa gagacacauu guauguaggu gauaaguaua gaucaaaggg  11520


ccgaauaacc ccugaauagu aacaaaauau gaaaaucaau aaaaaucaua aaauagaaaa  11580


accauaaaca gaaguaguuc aaagggcuau aaaaccccug aauaguaaca aaacauaaaa  11640


uuaauaaaaa ucaaaugaau accauaauug gcaaacggaa gagauguagg uacuuaagcu  11700


uccuaaaagc agccgaacuc acuuugagaa guaggcauag cauaccgaac ucuuccacga  11760


uucuccgaac ccacagggac guaggagaug uuauuuuguu uuuaauauuu caaaaaaaaa  11820


aaaaaaaaaa aaaaaaaaaa                         11840






SEQ ID NO: 12









<211> 294


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to 5UTR (Chikungunya virus)


    (chikv_5utr1 )


<220>


<221> misc_ feature


<222> 7..41


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 55..89


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 103..137


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 151..185


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 199..233


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 247..281


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<400> 12
















gcgccgagua gagcagugag gaacuggugg guugcgugug uuuugucacu acguaguaga  60


gugguaggaa auuggugggc ugcgugugug gcuuccagug ccaguagagc ggugagagau  120


ugguagguua uguguguguu cucgcccgaa aguagagugg ugagggguug guagguuacg  180


uguguucaaa uaugacggag uagaguagug gggggcuggu ggguugugug uguucggaga  240


ccagacagua gaguaguaag agguuggugg gcuacgugug ugccacacca cccg   294






SEQ ID NO: 13









<211> 314


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to 5UTR (Chikungunya virus)


    (chikv_5utr2)


<220>


<221> misc_ feature


<222> 7..41


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 51..85


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 95..129


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 139..173


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 183..217


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 227..261


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 271..305


<223> /note=“hybridization site to 5UTR (Chikungunya virus)”


<400> 13
















gcgccgagua gagugguggg ggguugguag guugcgugug ucuuagcgcc aguagagcag  60


uaagggacug guaggcugcg ugugugguac uuacaguaga gcggugagag acuggugggc  120


uaugugugug ccauccuuag uagaguggua gggaguuggu gggcugugug uguggggccu  180


auaguagagu agugggagau ugguagguua cguguguagc ugcacgagua gagcaguggg  240


aaguuggugg guugugugug ucuccgacga aguagaguag uaagaaauug guggguuaug  300


uguguaccug aguc                            314






SEQ ID NO: 14









<211> 288


<212> RNA


<213> Artificial sequence


<220>


<223> Circular Artificial sequence to RSE (Chikungunya virus)


    (chikv_RSE1)


<220>


<221> misc_ feature


<222> 7..39


<223> /note=“hybridization site to RSE (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 54..86


<223> /note=“hybridization site to RSE (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 101..133


<223> /note=“hybridization site to RSE (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 148..180


<223> /note=“hybridization site to RSE (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 195..227


<223> /note=“hybridization site to RSE (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 242..274


<223> /note=“hybridization site to RSE (Chikungunya virus)”


<400> 14
















gcgccguugc guggcucuuu ggucuauaga uuauuuguuu gcggguugcc cucuugcgug  60


guucuuuggu cuguggauug uuugcuugcc cgcgagcagg uuguguaguc cuuugaucug  120


uagguuguuu guuguucgua acacuucuug cguagcucuu ugaucuauag guuauuugcu  180


cuagguucga accguugcgu ggucuuuuga ucuauggguu guuuguucau caaaaccuuu  240


cuuguguggc cuuuuggucu guagauuguu uguuuccaac gacguacu        288






SEQ ID NO: 15









<211> 288


<212> RNA


<213> Artificial Sequence


<220>


<223> Circular Artificial sequence to RSE2 (Chikungunya virus)


    (chikvRSE)


<220>


<221> misc_ feature


<222> 7..39


<223> /note=“hybridization site to RSE2 (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 54..86


<223> /note=“hybridization site to RSE2 (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 101..133


<223> /note=“hybridization site to RSE2 (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 148..180


<223> /note=“hybridization site to RSE2 (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 195..227


<223> /note=“hybridization site to RSE2 (Chikungunya virus)”


<220>


<221> misc_ feature


<222> 242..274


<223> /note=“hybridization site to RSE2 (Chikungunya virus)”


<400> 15
















gcgccguugc guggcucuuu ggucuauggg uuguuugcuu gcggguugcc cucuugugua  60


gcuuuuugau cuguggguua uuugcuugcc cgcgagcagg uugcguaguu cuuugauuug  120


uagguuguuu gcuguucgua acacuucuug cguaguuuuu ugaucuaugg auuguuugcu  180


cuagguucga accguugcgu agcucuuugg uuuauagauu auuugcucau caaaaccuuu  240


cuuguguggu ccuuugaucu auagguuauu ugcuuccaac gacguacu         288









SEQ ID NO: 16









<211> 620


<212> RNA


<213> Artificial sequence


<220>


<223> Broadspectrum circular RNA to hepatitis C virus and Dengue virus


    (DENV1 cHP_ HCV CDS2_T)


<220>


<221> misc_ feature


<222> 16..48


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 58..90


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 100..132


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 142..174


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 184..216


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 226..258


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 268..300


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 330..340


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 354..364


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 378..388


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 402..412


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 426..436


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 450..460


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 474..484


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 498..508


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 522..532


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 546..556


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 570..580


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 594..604


<223> /note=“hybridization site to CDS2 (hepatitis C virus)”


<400> 16
















ggauccgcgg cgccgauguu ggggggugug uuuuuugucu uuuuucguug ggguguaaug  60


uugagaggcg uguuuuuugc uuuuuuuugu gcaccuuaua uauugggagg uguguuuuuc  120


gcuuuuuucc gucuggcugg cauauugggg ggcguguuuu ucguuuuuuu ucguuacaag  180


cuaauauuga aggguguguu uuucgccuuu uuccguguua aagauauguu gaaaggcgug  240


uuuuucguuu uuuuccguaa guuuuaaaua uuggagggcg uguuuuucgc uuuuuucugu  300


agaccggaac cgggaauuca cucgagcccc cuggggcucu gaugaggaac cucucugggg  360


uccccacagc gagucuccuu ggggccccua gaaugaaguu cuuugggguu ucauagcacg  420


guucuccugg gguuuucaua cgauugucuc uuggggucuu gcguguuuac ccuuuugggg  480


uccugcuaag ggggcuuucu ggggccuuuc gaauaagucu uuuuggggcc ucguuuuauc  540


acucuucugg gguucccagc cuuucccuuc uuggggcucc uccgaccaug ccccuugggg  600


uucuacccug uaugggaucc                           620






SEQ ID NO: 17









<211> 298


<212> RNA


<213> Artificial sequence


<220>


<223> Broadspectrum circular RNA to hepatitis C virus and Dengue virus


    (DENV1 cHP_ HCV CDS2_1)


<220>


<221> misc_ feature


<222> 7..22


<223> /note=“hybridization site to CDS2(2) (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 35..67


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 80..95


<223> /note=“hybridization site to CDS2(2) (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 108..140


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 153..168


<223> /note=“hybridization site to CDS2(2) (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 181..213


<223> /note=“hybridization site to chp (Dengue virus)”


<220>


<221> misc_ feature


<222> 226..241


<223> /note=“hybridization site to CDS2(2) (hepatitis C virus)”


<220>


<221> misc_ feature


<222> 254..286


<223> /note=“hybridization site to chp (Dengue virus)”


<400> 17
















gcgccgccug gcuugggguu uucccaggac ucuaauauug gaaggcgugu uuuuugucuu  60


uuuucguguc cugccuccuc uuagccuggg guuuuacgac cgcaccuaug uugagaggug  120


uguuuuuugc cuuuuuucgu uugauacccu cauuuaaucu ggggcucuag gugcagcaaa  180


auguuggagg gcguguuuuu cguuuuuuuc uguccugcac gaucucccga uuugggguuc  240


ucguugguga cguauauuga gggguguguu uuucgcuuuu uuucguauug gacgucgu  298






SEQ ID NO: 18









<211> 41


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial sequence for showing an squematic example of the mode


    of action according to figure 4 wherein the sequence has no


    particular value


<400> 18













aacgccaugc aagcgcgcag aucgagcugu gcgcuuuuuu u 41






SEQ ID NO: 19









<211> 299


<212> RNA


<213> Artificial sequence


<220>


<223> circ_wnv_slll_2


<400> 19
















ugcaguuaga uaaacuuucc gguuugauuu ucucuucaaa agacaguucu ucgaacuucc  60


cggcuugguu uucuuuucaa aaauggggcc ccucaacuuc cuggucuggu uuucuccuua  120


aaaggcuaua cgaucaacuu ucuggccuga cuuucuucuu aaaaagcuau caucgcaacu  180


ucucggcuug acuuucucuu uaaaacccuc gguaaccaac uuuucggccu gauuuucuuc  240


ucaaaaguuu uggcgacuaa cuucuugguu uggcuuucuc cucaaaaaau auaaacagc  299






SEQ ID NO: 20









<211> 11029


<212> RNA


<213> West Nile virus


<220>


<223> Genome West Nile virus


<400> 20
















aguaguucgc cugugugagc ugacaaacuu aguaguguuu gugaggauua acaacaauua  60


acacagugcg agcuguuucu uagcacgaag aucucgaugu cuaagaaacc aggagggccc  120


ggcaagagcc gggcugucaa uaugcuaaaa cgcggaaugc cccgcguguu guccuugauu  180


ggacugaaga gggcuauguu gagccugauc gacggcaagg ggccaauacg auuuguguug  240


gcucucuugg cguucuucag guucacagca auugcuccga cccgagcagu gcuggaucga  300


uggagaggug ugaacaaaca aacagcgaug aaacaccuuc ugaguuuuaa gaaggaacua  360


gggaccuuga ccagugcuau caaucggcgg agcucaaaac aaaagaaaag aggaggaaag  420


accggaauug cagucaugau uggccugauu gccagcguag gagcaguuac ccucucuaac  480


uuccaaggga aggugaugau gacgguaaau gcuacugacg ucacagaugu caucacgauu  540


ccaacagcug cuggaaagaa ccuaugcauu gucagagcaa uggauguggg auacaugugc  600


gaugauacua ucacuuauga augcccagug cugucggcug guaaugaucc agaagacauc  660


gacuguuggu gcacaaaguc agcagucuac gucagguaug gaagaugcac caagacacgc  720


cacucaagac gcagucggag gucacugaca gugcagacac acggagaaag cacucuagcg  780


aacaagaagg gggcuuggau ggacagcacc aaggccacaa gguauuuggu aaaaacagaa  840


ucauggaucu ugaggaaccc uggauaugcc cugguggcag ccgucauugg uuggaugcuu  900


gggagcaaca ccaugcagag aguuguguuu gucgugcuau ugcuuuuggu ggccccagcu  960


uacagcuuca acugccuugg aaugagcaac agagacuucu uggaaggagu gucuggagca  1020


acaugggugg auuugguucu cgaaggcgac agcugcguga cuaucauguc uaaggacaag  1080


ccuaccaucg augugaagau gaugaauaug gaggcggcca accuggcaga gguccgcagu  1140


uauugcuauu uggcuaccgu cagcgaucuc uccaccaaag cugcgugccc gaccauggga  1200


gaagcucaca augacaaacg ugcugaccca gcuuuugugu gcagacaagg agugguggac  1260


aggggcuggg gcaacggcug cggacuauuu ggcaaaggaa gcauugacac augcgccaaa  1320


uuugccugcu cuaccaaggc aauaggaaga accaucuuga aagagaauau caaguacgaa  1380


guggccauuu uuguccaugg accaacuacu guggagucgc acggaaacua cuccacacag  1440


guuggagcca cucaggcagg gagauucagc aucacuccug cggcgccuuc auacacacua  1500


aagcuuggag aauauggaga ggugacagug gacugugaac cacggucagg gauugacacc  1560


aaugcauacu acgugaugac uguuggaaca aagacguucu ugguccaucg ugagugguuc  1620


auggaccuca accucccuug gagcagugcu ggaaguacug uguggaggaa cagagagacg  1680


uuaauggagu uugaggaacc acacgccacg aagcagucug ugauagcauu gggcucacaa  1740


gagggagcuc ugcaucaagc uuuggcugga gccauuccug uggaauuuuc aagcaacacu  1800


gucaaguuga cgucggguca uuugaagugu agagugaaga uggaaaaauu gcaguugaag  1860


ggaacaaccu auggcgucug uucaaaggcu uucaaguuuc uugggacucc cgcagacaca  1920


ggucacggca cugugguguu ggaauugcag uacacuggca cggauggacc uugcaaaguu  1980


ccuaucucgu caguggcuuc auugaacgac cuaacgccag ugggcagauu ggucacuguc  2040


aacccuuuug uuucaguggc cacggccaac gcuaaggucc ugauugaauu ggaaccaccc  2100


uuuggagacu cauacauagu ggugggcaga ggagaacaac agaucaauca ccauuggcac  2160


aagucuggaa gcagcauugg caaagccuuu acaaccaccc ucaaaggagc gcagagacua  2220


gccgcucuag gagacacagc uugggacuuu ggaucaguug gagggguguu caccucaguu  2280


gggaaggcug uccaucaagu guucggagga gcauuccgcu cacuguucgg aggcaugucc  2340


uggauaacgc aaggauugcu gggggcucuc cuguugugga ugggcaucaa ugcucgugau  2400


agguccauag cucucacguu ucucgcaguu ggaggaguuc ugcucuuccu cuccgugaac  2460


gugcacgcug acacugggug ugccauagac aucagccggc aagagcugag auguggaagu  2520


ggaguguuca uacacaauga uguggaggcu uggauggacc gguacaagua uuacccugaa  2580


acgccacaag gccuagccaa gaucauucag aaagcucaua aggaaggagu gugcggucua  2640


cgaucaguuu ccagacugga gcaucaaaug ugggaagcag ugaaggacga gcugaacacu  2700


cuuuugaagg agaauggugu ggaccuuagu gucgugguug agaaacagga gggaauguac  2760


aagucagcac cuaaacgccu caccgccacc acggaaaaau uggaaauugg cuggaaggcc  2820


uggggaaaga guauuuuauu ugcaccagaa cucgccaaca acaccuuugu gguugauggu  2880


ccggagacca aggaaugucc gacucagaau cgcgcuugga auagcuuaga aguggaggau  2940


uuuggauuug gucucaccag cacucggaug uuccugaagg ucagagagag caacacaacu  3000


gaaugugacu cgaagaucau uggaacggcu gucaagaaca acuuggcgau ccacagugac  3060


cuguccuauu ggauugaaag caggcucaau gauacgugga agcuugaaag ggcaguucug  3120


ggugaaguca aaucauguac guggccugag acgcauaccu uguggggcga uggaauccuu  3180


gagagugacu ugauaauacc agucacacug gcgggaccac gaagcaauca caaucggaga  3240


ccuggguaca agacacaaaa ccagggccca ugggacgaag gccggguaga gauugacuuc  3300


gauuacugcc caggaacuac ggucacccug agugagagcu gcggacaccg uggaccugcc  3360


acucgcacca ccacagagag cggaaaguug auaacagauu ggugcugcag gagcugcacc  3420


uuaccaccac ugcgcuacca aacugacagc ggcuguuggu augguaugga gaucagacca  3480


cagagacaug augaaaagac ccucgugcag ucacaaguga augcuuauaa ugcugauaug  3540


auugacccuu uucaguuggg ccuucugguc guguucuugg ccacccagga gguccuucgc  3600


aagaggugga cagccaagau cagcaugcca gcuauacuga uugcucugcu aguccuggug  3660


uuugggggca uuacuuacac ugauguguua cgcuauguca ucuugguggg ggcagcuuuc  3720


gcagaaucua auucgggagg agacguggua cacuuggcgc ucauggcgac cuucaagaua  3780


caaccagugu uuaugguggc aucguuucuc aaagcgagau ggaccaacca ggagaacauu  3840


uuguugaugu uggcggcugu uuucuuucaa auggcuuauc acgaugcccg ccaaauucug  3900


cucugggaga ucccugaugu guugaauuca cuggcgguag cuuggaugau acugagagcc  3960


auaacauuca caacgacauc aaacgugguu guuccgcugc uagcccugcu aacacccggg  4020


cugagacgcu ugaaucugga uguguacagg auacugcugu ugauggucgg aauaggcagc  4080


uugaucaggg agaagaggag ugcagcugca aaaaagaaag gagcaagucu gcuaugcuug  4140


gcucuagccu caacaggacu uuucaacccc augauccuug cugcuggacu gauugcaugu  4200


gaucccaacc guaaacgcgg auggcccgca acugaaguga ugacagcugu cggccuaaug  4260


uuugccaucg ucggagggcu ggcagagcuu gacauugacu ccauggccau uccaaugacu  4320


aucgcggggc ucauguuugc ugcuuucgug auuucuggga aaucaacaga uauguggauu  4380


gagagaacgg cggacauuuc cugggaaagu gaugcagaaa uuacaggcuc gagcgaaaga  4440


guugaugugc ggcuugauga ugauggaaac uuccagcuca ugaaugaucc aggagcaccu  4500


uggaagauau ggaugcucag aauggucugu cucgcgauua gugcguacac ccccugggca  4560


aucuugcccu caguaguugg auuuuggaua acucuccaau acacaaagag aggaggcgug  4620


uugugggaca cucccucacc aaaggaguac aaaaaggggg acacgaccac cggcgucuac  4680


aggaucauga cucgugggcu gcucggcagu uaucaagcag gagcgggcgu gaugguugaa  4740


gguguuuucc acacccuuug gcauacaaca aaaggagccg cuuugaugag cggagagggc  4800


cgccuggacc cauacugggg cagugucaag gaggaucgac uuuguuacgg aggacccugg  4860


aaauugcagc acaaguggaa cgggcaggau gaggugcaga ugauuguggu ggaaccuggc  4920


aagaacguua agaacguccg gacgaaacca gggguguuca aaacaccuga aggagaaauc  4980


ggggccguga cuuuggacuu ccccacugga acaucaggcu caccaauagu ggacaaaaac  5040


ggugauguga uugggcuuua uggcaaugga gucauaaugc ccaacggcuc auacauaagc  5100


gcgauagugc agggugaaag gauggaugag ccaaucccag ccggauucga accugagaug  5160


cugaggaaaa aacagaucac uguacuggau cuccaucccg gcgccgguaa aacaaggagg  5220


auucugccac agaucaucaa agaggccaua aacagaagac ugagaacagc cgugcuagca  5280


ccaaccaggg uuguggcugc ugagauggcu gaagcacuga gaggacugcc cauccgguac  5340


cagacauccg cagugcccag agaacauaau ggaaaugaga uuguugaugu caugugucau  5400


gcuacccuca cccacaggcu gaugucuccu cacagggugc cgaacuacaa ccuguucgug  5460


auggaugagg cucauuucac cgacccagcu agcauugcag caagagguua cauuuccaca  5520


aaggucgagc uaggggaggc ggcggcaaua uucaugacag ccaccccacc aggcacuuca  5580


gauccauucc cagaguccaa uucaccaauu uccgacuuac agacugagau cccggaucga  5640


gcuuggaacu cuggauacga auggaucaca gaauacaccg ggaagacggu uugguuugug  5700


ccuaguguca agauggggaa ugagauugcc cuuugccuac aacgugcugg aaagaaagua  5760


guccaauuga acagaaaguc guacgagacg gaguacccaa aauguaagaa cgaugauugg  5820


gacuuuguua ucacaacaga cauaucugaa augggggcua acuucaaggc gagcagggug  5880


auugacagcc ggaagagugu gaaaccaacc aucauaacag aaggagaagg gagagugauc  5940


cugggagaac caucugcagu gacagcagcu agugccgccc agagacgugg acguaucggu  6000


agaaauccgu cgcaaguugg ugaugaguac uguuaugggg ggcacacgaa ugaagacgac  6060


ucgaacuucg cccauuggac ugaggcacga aucaugcugg acaacaucaa caugccaaac  6120


ggacugaucg cucaauucua ccaaccagag cgugagaagg uauauaccau ggauggggaa  6180


uaccggcuca gaggagaaga gagaaaaaac uuucuggaac uguugaggac ugcagaucug  6240


ccaguuuggc uggcuuacaa gguugcagcg gcuggagugu cauaccacga ccggaggugg  6300


ugcuuugaug guccuaggac aaacacaauu uuagaagaca acaacgaagu ggaagucauc  6360


acgaagcuug gugaaaggaa gauucugagg ccgcgcugga uugacgccag gguguacucg  6420


gaucaccagg cacuaaaggc guucaaggac uucgccucgg gaaaacguuc ucagauaggg  6480


cucauugagg uucugggaaa gaugccugag cacuucaugg ggaagacaug ggaagcacuu  6540


gacaccaugu acguuguggc cacugcagag aaaggaggaa gagcucacag aauggcccug  6600


gaggaacugc cagaugcucu ucagacaauu gccuugauug ccuuauugag ugugaugacc  6660


augggaguau ucuuccuccu caugcagcgg aagggcauug gaaagauagg uuugggaggc  6720


gcugucuugg gagucgcgac cuuuuucugu uggauggcug aaguuccagg aacgaagauc  6780


gccggaaugu ugcugcucuc ccuucucuug augauugugc uaauuccuga gccagagaag  6840


caacguucgc agacagacaa ccagcuagcc guguuccuga uuugugucau gacccuugug  6900


agcgcagugg cagccaacga gauggguugg cuagauaaga ccaagaguga cauaagcagu  6960


uuguuugggc aaagaauuga ggucaaggag aauuucagca ugggagaguu ccuucuggac  7020


uugaggccgg caacagccug gucacuguac gcugugacaa cagcgguccu cacuccacug  7080


cuaaagcauu ugaucacguc agauuacauc aacaccucau ugaccucaau aaacguucag  7140


gcaagugcac uauucacacu cgcgcgaggc uuccccuucg ucgauguugg agugucggcu  7200


cuccugcuag cagccggaug cuggggacaa gucacccuca ccguuacggu aacagcggca  7260


acacuccuuu uuugccacua ugccuacaug guucccgguu ggcaagcuga ggcaaugcgc  7320


ucagcccagc ggcggacagc ggccggaauc augaagaacg cuguagugga uggcaucgug  7380


gccacggacg ucccagaauu agagcgcacc acacccauca ugcagaagaa aguuggacag  7440


aucaugcuga ucuugguguc ucuagcugca guaguaguga acccgucugu gaagacagua  7500


cgagaagccg gaauuuugau cacggccgca gcggugacgc uuugggagaa uggagcaagc  7560


ucuguuugga acgcaacaac ugccaucgga cucugccaca ucaugcgugg ggguugguug  7620


ucaugucuau ccauaacaug gacacucaua aagaacaugg aaaaaccagg acuaaaaaga  7680


gguggggcaa aaggacgcac cuugggagag guuuggaaag aaagacucaa ccagaugaca  7740


aaagaagagu ucacuaggua ccgcaaagag gccaucaucg aagucgaucg cucagcggca  7800


aaacacgcca ggaaagaagg caaugucacu ggagggcauc cagucucuag gggcacagca  7860


aaacugagau ggcuggucga acggagguuu cucgaaccgg ucggaaaagu gauugaccuu  7920


ggauguggaa gaggcgguug guguuacuau auggcaaccc aaaaaagagu ccaagaaguc  7980


agaggguaca caaagggcgg ucccggacau gaagagcccc aacuagugca aaguuaugga  8040


uggaacauug ucaccaugaa gaguggagug gauguguucu acagaccuuc ugaguguugu  8100


gacacccucc uuugugacau cggagagucc ucgucaagug cugagguuga agagcauagg  8160


acgauucggg uccuugaaau gguugaggac uggcugcacc gagggccaag ggaauuuugc  8220


gugaaggugc ucugccccua caugccgaaa gucauagaga agauggagcu gcuccaacgc  8280


cgguaugggg ggggacuggu cagaaaccca cucucacgga auuccacgca cgagauguau  8340


ugggugaguc gagcuucagg caauguggua cauucaguga auaugaccag ccaggugcuc  8400


cuaggaagaa uggaaaaaag gaccuggaag ggaccccaau acgaggaaga uguaaacuug  8460


ggaaguggaa ccagggcggu gggaaaaccc cugcucaacu cagacaccag uaaaaucaag  8520


aacaggauug aacgacucag gcgugaguac aguucgacgu ggcaccacga ugagaaccac  8580


ccauauagaa ccuggaacua ucacggcagu uaugauguga agcccacagg cuccgccagu  8640


ucgcugguca auggaguggu caggcuccuc ucaaaaccau gggacaccau cacgaauguu  8700


accaccaugg ccaugacuga cacuacuccc uucgggcagc agcgaguguu caaagagaag  8760


guggacacga aagcuccuga accgccagaa ggagugaagu acgugcucaa cgagaccacc  8820


aacugguugu gggcguuuuu ggccagagaa aaacguccca gaaugugcuc ucgagaggaa  8880


uucauaagaa aggucaacag caaugcagcu uugggugcca uguuugaaga gcagaaucaa  8940


uggaggagcg ccagagaagc aguugaagau ccaaaauuuu gggagauggu ggaugaggag  9000


cgcgaggcac aucugcgggg ggaaugucac acuugcauuu acaacaugau gggaaagaga  9060


gagaaaaaac ccggagaguu cggaaaggcc aagggaagca gagccauuug guucaugugg  9120


cucggagcuc gcuuucugga guucgaggcu cuggguuuuc ucaaugaaga ccacuggcuu  9180


ggaagaaaga acucaggagg aggugucgag ggcuugggcc uccaaaaacu ggguuacauc  9240


cugcgugaag uuggcacccg gccugggggc aagaucuaug cugaugacac agcuggcugg  9300


gacacccgca ucacgagagc ugacuuggaa aaugaagcua aggugcuuga gcugcuugau  9360


ggggaacauc ggcgucuugc cagggccauc auugagcuca ccuaucguca caaaguugug  9420


aaagugaugc gcccggcugc ugauggaaga accgucaugg auguuaucuc cagagaagau  9480


cagaggggga guggacaagu ugucaccuac gcccuaaaca cuuucaccaa ccuggccguc  9540


cagcugguga ggaugaugga aggggaagga gugauuggcc cagaugaugu ggagaaacuc  9600


acaaaaggga aaggacccaa agucaggacc uggcuguuug agaaugggga agaaagacuc  9660


agccgcaugg cugucagugg agaugacugu gugguaaagc cccuggacga ucgcuuugcc  9720


accucgcucc acuuccucaa ugcuauguca aagguucgca aagacaucca agaguggaaa  9780


ccgucaacug gaugguauga uuggcagcag guuccauuuu gcucaaacca uuucacugaa  9840


uugaucauga aagauggaag aacacuggug guuccaugcc gaggacagga ugaauuggua  9900


ggcagagcuc gcauaucucc aggggccgga uggaacgucc gcgacacugc uugucuggcu  9960


aagucuuaug cccagaugug gcugcuucug uacuuccaca gaagagaccu gcggcucaug  10020


gccaacgcca uuugcuccgc ugucccugug aauugggucc cuaccggaag aaccacgugg  10080


uccauccaug caggaggaga guggaugaca acagaggaca uguuggaggu cuggaaccgu  10140


guuuggauag aggagaauga auggauggaa gacaaaaccc caguggagaa auggagugac  10200


gucccauauu caggaaaacg agaggacauc ugguguggca gccugauugg cacaagagcc  10260


cgagccacgu gggcagaaaa cauccaggug gcuaucaacc aagucagagc aaucaucgga  10320


gaugagaagu auguggauua caugaguuca cuaaagagau augaagacac aacuuugguu  10380


gaggacacag uacuguagau auuuaaucaa uuguaaauag acaauauaag uaugcauaaa  10440


aguguaguuu uauaguagua uuuaguggug uuaguguaaa uaguuaagaa aauuuugagg  10500


agaaagucag gccgggaagu ucccgccacc ggaaguugag uagacggugc ugccugcgac  10560


ucaaccccag gaggacuggg ugaacaaagc cgcgaaguga uccauguaag cccucagaac  10620


cguuucggaa ggaggacccc acauguugua acuucaaagc ccaaugucag accacgcuac  10680


ggcgugcuac ucugcggaga gugcagucug cgauagugcc ccaggaggac uggguuaaca  10740


aaggcaaacc aacgccccac gcggcccuag ccccgguaau gguguuaacc agggcgaaag  10800


gacuagaggu uagaggagac cccgcgguuu aaagugcacg gcccagccug gcugaagcug  10860


uaggucaggg gaaggacuag agguuagugg agaccccgug ccacaaaaca ccacaacaaa  10920


acagcauauu gacaccuggg auagacuagg agaucuucug cucugcacaa ccagccacac  10980


ggcacagugc gccgacaaug guggcuggug gugcgagaac acaggaucu        11029






SEQ ID NO: 21









<211> 270


<212> RNA


<213> Artificial Sequence


<220>


<223> dchp_wsll_A


<400> 21
















ugcaguuaga uaauauuggg agguguguuu uuugccuuuu uccguagauc cucgcgaaac  60


uucuuggccu gguuuucuuu ucaaaagagu ccuuacguau auuggagggu guguuuuucg  120


cuuuuuuccg ucucggaaac gauaacuucc uggcuugauu uuuucuucaa aagcugcguu  180


aucuauauug agaggcgugu uuuucgucuu uuuccguucc aaccuggaga acuuuuuggc  240


cugauuuucu cuucaaaacc aggccguacc                   270






SEQ ID NO: 22









<211> 270


<212> RNA


<213> Artificial Sequence


<220>


<223> dchp_wsll_B


<400> 22
















ugcaguuaga uaauauugga aggcguguuu uuugcuuuuu uccguagauc cuaacggaac  60


uuccuggccu gauuuucuuc uuaaaagagu ccuuacguau auugaaaggu guguuuuucg  120


ccuuuuuccg ucucggaaac gauaacuuuc cggccugguu uuuuccuuaa aagcugcguu  180


aucuauauug aggggugugu uuuuugucuu uuuccguucc aaccuggaga acuuccuggu  240


uuggcuuuuu ucuugaaacc aggccguacc                   270






SEQ ID NO: 23









<211> 270


<212> RNA


<213> Artificial Sequence


<220>


<223> dchp_wsll_C


<400> 23
















ugcaguuaga uaauauuggg agguguguuu uuugccuuuu uccguagauc cucgcgaaac  60


uucuuggccu gguuuucuuu ucaaaagagu ccuuacguau auuggagggu guguuuuucg  120


cuuuuuuccg ucucggaaac gauaacuucc uggcuugauu uuuucuucaa aagcugcguu  180


aucuauauug agaggcgugu uuuucgucuu uuuccguucc aaccuggaga acuucccggc  240


cugacuuuuu ccuuaaaacc aggccguacc                   270









SEQ ID NO: 24









<211> 299


<212> RNA


<213> Artificial Sequence


<220>


<223> circ_wnv_slll_1


<400> 24
















ugcaguuaga uaaacuuucu gguuugguuu ucuccucaaa agacaguucu ucgaacuucc  60


cgguuugauu uucucuuuaa aaauggggcc ccucaacuuc uuggucugac uuucucuuca  120


aaaggcuaua cgaucaacuu cucggccuga uuuucuuuuc aaaaagcuau caucgcaacu  180


uccuggucug guuuucuucu caaaacccuc gguaaccaac uuuccggcuu gacuuucuuc  240


uuaaaacguu uugcgacaaa cuuuucggcu uggcuuucuc cuuaaaauau guaaacagc  299






SEQ ID NO: 25









<211> 33


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence IRES Circ HCV1


<400> 25
















cuccgccaug aaucacuccc cugugaggaa cua                   33






SEQ ID NO: 26









<211> 24


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence IRES Circ HCV2


<400> 26
















ucucguagac cgugcaccau gagc                    24






SEQ ID NO: 27









<211> 28


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence cHP (CDS1) circ_hcv_cds1


<400> 27
















ccaaaagaaa caccaaccgu cgcccaga                   28






SEQ ID NO: 28









<211> 16


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence CDS2 circ_hcv_cds2


<400> 28
















ggggccccag g                   16






SEQ ID NO: 29









<211> 32


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence sHP (3′ UTR) circ_dv_3utr


<400> 29
















aacagcauau ugacgcuggg aaagaccaga ga                   32






SEQ ID NO: 30









<211> 33


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence cHP½ circ_dv_cHP_v½


<400> 30
















acggaaaaag gcgaaaaaca cgccuuucaa uau                   33






SEQ ID NO: 31









<211> 34


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence Chikv_re


<400> 31
















gcugcuguaa aacguuggcu uuuuuagccg uaau                   34






SEQ ID NO: 32









<211> 294


<212> RNA


<213> Artificial Sequence


<220>


<223> Broad Spectrum Circular Artificial sequence to DENV cHP and HCV


    CDS (circ_dv_cHP_v1_circ_hcv_cds2_2)


<400> 32
















gcgccgaugu ugaaaggugu guuuuucguu uuuuucuguc aaguguagga ucuucugggg  60


ucucgggccc cacgaccaau guuggggggc guguuuuucg cuuuuuucug ucaaaauaau  120


guugaccugg gguucuuuac ugaacucauu auguugggag gcguguuuuu ugucuuuuuu  180


uguuuuaucu acacccgucu gggguuuugu cggcgccacg acauguuggg ggguguguuu  240


uuugccuuuu uccgucucag ugcggcgccc uugggguucc cuuucgcauc acgu    294






SEQ ID NO: 33









<211> 35


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence 5 UTR chikv5utr


<400> 33
















acacacguag ccuaccaguu ucuuacugcu cuacu                   35






SEQ ID NO: 34









<211> 29903


<212> RNA


<213> Coronaviridae


<220>


<223> NC_045512.2 Severe acute respiratory syndrome coronavirus 2


    (SARS-CoV-2) isolate Wuhan-Hu-1, complete genome


<400> 34
















auuaaagguu uauaccuucc cagguaacaa accaaccaac uuucgaucuc uuguagaucu  60


guucucuaaa cgaacuuuaa aaucugugug gcugucacuc ggcugcaugc uuagugcacu  120


cacgcaguau aauuaauaac uaauuacugu cguugacagg acacgaguaa cucgucuauc  180


uucugcaggc ugcuuacggu uucguccgug uugcagccga ucaucagcac aucuagguuu  240


cguccgggug ugaccgaaag guaagaugga gagccuuguc ccugguuuca acgagaaaac  300


acacguccaa cucaguuugc cuguuuuaca gguucgcgac gugcucguac guggcuuugg  360


agacuccgug gaggaggucu uaucagaggc acgucaacau cuuaaagaug gcacuugugg  420


cuuaguagaa guugaaaaag gcguuuugcc ucaacuugaa cagcccuaug uguucaucaa  480


acguucggau gcucgaacug caccucaugg ucauguuaug guugagcugg uagcagaacu  540


cgaaggcauu caguacgguc guagugguga gacacuuggu guccuugucc cucauguggg  600


cgaaauacca guggcuuacc gcaagguucu ucuucguaag aacgguaaua aaggagcugg  660


uggccauagu uacggcgccg aucuaaaguc auuugacuua ggcgacgagc uuggcacuga  720


uccuuaugaa gauuuucaag aaaacuggaa cacuaaacau agcaguggug uuacccguga  780


acucaugcgu gagcuuaacg gaggggcaua cacucgcuau gucgauaaca acuucugugg  840


cccugauggc uacccucuug agugcauuaa agaccuucua gcacgugcug guaaagcuuc  900


augcacuuug uccgaacaac uggacuuuau ugacacuaag agggguguau acugcugccg  960


ugaacaugag caugaaauug cuugguacac ggaacguucu gaaaagagcu augaauugca  1020


gacaccuuuu gaaauuaaau uggcaaagaa auuugacacc uucaaugggg aauguccaaa  1080


uuuuguauuu cccuuaaauu ccauaaucaa gacuauucaa ccaaggguug aaaagaaaaa  1140


gcuugauggc uuuaugggua gaauucgauc ugucuaucca guugcgucac caaaugaaug  1200


caaccaaaug ugccuuucaa cucucaugaa gugugaucau uguggugaaa cuucauggca  1260


gacgggcgau uuuguuaaag ccacuugcga auuuuguggc acugagaauu ugacuaaaga  1320


aggugccacu acuugugguu acuuacccca aaaugcuguu guuaaaauuu auuguccagc  1380


augucacaau ucagaaguag gaccugagca uagucuugcc gaauaccaua augaaucugg  1440


cuugaaaacc auucuucgua aggguggucg cacuauugcc uuuggaggcu guguguucuc  1500


uuauguuggu ugccauaaca agugugccua uuggguucca cgugcuagcg cuaacauagg  1560


uuguaaccau acagguguug uuggagaagg uuccgaaggu cuuaaugaca accuucuuga  1620


aauacuccaa aaagagaaag ucaacaucaa uauuguuggu gacuuuaaac uuaaugaaga  1680


gaucgccauu auuuuggcau cuuuuucugc uuccacaagu gcuuuugugg aaacugugaa  1740


agguuuggau uauaaagcau ucaaacaaau uguugaaucc ugugguaauu uuaaaguuac  1800


aaaaggaaaa gcuaaaaaag gugccuggaa uauuggugaa cagaaaucaa uacugagucc  1860


ucuuuaugca uuugcaucag aggcugcucg uguuguacga ucaauuuucu cccgcacucu  1920


ugaaacugcu caaaauucug ugcguguuuu acagaaggcc gcuauaacaa uacuagaugg  1980


aauuucacag uauucacuga gacucauuga ugcuaugaug uucacaucug auuuggcuac  2040


uaacaaucua guuguaaugg ccuacauuac aggugguguu guucaguuga cuucgcagug  2100


gcuaacuaac aucuuuggca cuguuuauga aaaacucaaa cccguccuug auuggcuuga  2160


agagaaguuu aaggaaggug uagaguuucu uagagacggu ugggaaauug uuaaauuuau  2220


cucaaccugu gcuugugaaa uugucggugg acaaauuguc accugugcaa aggaaauuaa  2280


ggagaguguu cagacauucu uuaagcuugu aaauaaauuu uuggcuuugu gugcugacuc  2340


uaucauuauu gguggagcua aacuuaaagc cuugaauuua ggugaaacau uugucacgca  2400


cucaaaggga uuguacagaa aguguguuaa auccagagaa gaaacuggcc uacucaugcc  2460


ucuaaaagcc ccaaaagaaa uuaucuucuu agagggagaa acacuuccca cagaaguguu  2520


aacagaggaa guugucuuga aaacugguga uuuacaacca uuagaacaac cuacuaguga  2580


agcuguugaa gcuccauugg uugguacacc aguuuguauu aacgggcuua uguugcucga  2640


aaucaaagac acagaaaagu acugugcccu ugcaccuaau augaugguaa caaacaauac  2700


cuucacacuc aaaggcggug caccaacaaa gguuacuuuu ggugaugaca cugugauaga  2760


agugcaaggu uacaagagug ugaauaucac uuuugaacuu gaugaaagga uugauaaagu  2820


acuuaaugag aagugcucug ccuauacagu ugaacucggu acagaaguaa augaguucgc  2880


cuguguugug gcagaugcug ucauaaaaac uuugcaacca guaucugaau uacuuacacc  2940


acugggcauu gauuuagaug aguggaguau ggcuacauac uacuuauuug augagucugg  3000


ugaguuuaaa uuggcuucac auauguauug uucuuucuac ccuccagaug aggaugaaga  3060


agaaggugau ugugaagaag aagaguuuga gccaucaacu caauaugagu augguacuga  3120


agaugauuac caagguaaac cuuuggaauu uggugccacu ucugcugcuc uucaaccuga  3180


agaagagcaa gaagaagauu gguuagauga ugauagucaa caaacuguug gucaacaaga  3240


cggcagugag gacaaucaga caacuacuau ucaaacaauu guugagguuc aaccucaauu  3300


agagauggaa cuuacaccag uuguucagac uauugaagug aauaguuuua gugguuauuu  3360


aaaacuuacu gacaauguau acauuaaaaa ugcagacauu guggaagaag cuaaaaaggu  3420


aaaaccaaca gugguuguua augcagccaa uguuuaccuu aaacauggag gagguguugc  3480


aggagccuua aauaaggcua cuaacaaugc caugcaaguu gaaucugaug auuacauagc  3540


uacuaaugga ccacuuaaag ugggugguag uuguguuuua agcggacaca aucuugcuaa  3600


acacugucuu cauguugucg gcccaaaugu uaacaaaggu gaagacauuc aacuucuuaa  3660


gagugcuuau gaaaauuuua aucagcacga aguucuacuu gcaccauuau uaucagcugg  3720


uauuuuuggu gcugacccua uacauucuuu aagaguuugu guagauacug uucgcacaaa  3780


ugucuacuua gcugucuuug auaaaaaucu cuaugacaaa cuuguuucaa gcuuuuugga  3840


aaugaagagu gaaaagcaag uugaacaaaa gaucgcugag auuccuaaag aggaaguuaa  3900


gccauuuaua acugaaagua aaccuucagu ugaacagaga aaacaagaug auaagaaaau  3960


caaagcuugu guugaagaag uuacaacaac ucuggaagaa acuaaguucc ucacagaaaa  4020


cuuguuacuu uauauugaca uuaauggcaa ucuucaucca gauucugcca cucuuguuag  4080


ugacauugac aucacuuucu uaaagaaaga ugcuccauau auagugggug auguuguuca  4140


agaggguguu uuaacugcug ugguuauacc uacuaaaaag gcugguggca cuacugaaau  4200


gcuagcgaaa gcuuugagaa aagugccaac agacaauuau auaaccacuu acccggguca  4260


ggguuuaaau gguuacacug uagaggaggc aaagacagug cuuaaaaagu guaaaagugc  4320


cuuuuacauu cuaccaucua uuaucucuaa ugagaagcaa gaaauucuug gaacuguuuc  4380


uuggaauuug cgagaaaugc uugcacaugc agaagaaaca cgcaaauuaa ugccugucug  4440


uguggaaacu aaagccauag uuucaacuau acagcguaaa uauaagggua uuaaaauaca  4500


agagggugug guugauuaug gugcuagauu uuacuuuuac accaguaaaa caacuguagc  4560


gucacuuauc aacacacuua acgaucuaaa ugaaacucuu guuacaaugc cacuuggcua  4620


uguaacacau ggcuuaaauu uggaagaagc ugcucgguau augagaucuc ucaaagugcc  4680


agcuacaguu ucuguuucuu caccugaugc uguuacagcg uauaaugguu aucuuacuuc  4740


uucuucuaaa acaccugaag aacauuuuau ugaaaccauc ucacuugcug guuccuauaa  4800


agauuggucc uauucuggac aaucuacaca acuagguaua gaauuucuua agagagguga  4860


uaaaagugua uauuacacua guaauccuac cacauuccac cuagauggug aaguuaucac  4920


cuuugacaau cuuaagacac uucuuucuuu gagagaagug aggacuauua agguguuuac  4980


aacaguagac aacauuaacc uccacacgca aguuguggac augucaauga cauauggaca  5040


acaguuuggu ccaacuuauu uggauggagc ugauguuacu aaaauaaaac cucauaauuc  5100


acaugaaggu aaaacauuuu auguuuuacc uaaugaugac acucuacgug uugaggcuuu  5160


ugaguacuac cacacaacug auccuaguuu ucuggguagg uacaugucag cauuaaauca  5220


cacuaaaaag uggaaauacc cacaaguuaa ugguuuaacu ucuauuaaau gggcagauaa  5280


caacuguuau cuugccacug cauuguuaac acuccaacaa auagaguuga aguuuaaucc  5340


accugcucua caagaugcuu auuacagagc aagggcuggu gaagcugcua acuuuugugc  5400


acuuaucuua gccuacugua auaagacagu aggugaguua ggugauguua gagaaacaau  5460


gaguuacuug uuucaacaug ccaauuuaga uucuugcaaa agagucuuga acguggugug  5520


uaaaacuugu ggacaacagc agacaacccu uaagggugua gaagcuguua uguacauggg  5580


cacacuuucu uaugaacaau uuaagaaagg uguucagaua ccuuguacgu gugguaaaca  5640


agcuacaaaa uaucuaguac aacaggaguc accuuuuguu augaugucag caccaccugc  5700


ucaguaugaa cuuaagcaug guacauuuac uugugcuagu gaguacacug guaauuacca  5760


guguggucac uauaaacaua uaacuucuaa agaaacuuug uauugcauag acggugcuuu  5820


acuuacaaag uccucagaau acaaaggucc uauuacggau guuuucuaca aagaaaacag  5880


uuacacaaca accauaaaac caguuacuua uaaauuggau gguguuguuu guacagaaau  5940


ugacccuaag uuggacaauu auuauaagaa agacaauucu uauuucacag agcaaccaau  6000


ugaucuugua ccaaaccaac cauauccaaa cgcaagcuuc gauaauuuua aguuuguaug  6060


ugauaauauc aaauuugcug augauuuaaa ccaguuaacu gguuauaaga aaccugcuuc  6120


aagagagcuu aaaguuacau uuuucccuga cuuaaauggu gauguggugg cuauugauua  6180


uaaacacuac acacccucuu uuaagaaagg agcuaaauug uuacauaaac cuauuguuug  6240


gcauguuaac aaugcaacua auaaagccac guauaaacca aauaccuggu guauacguug  6300


ucuuuggagc acaaaaccag uugaaacauc aaauucguuu gauguacuga agucagagga  6360


cgcgcaggga auggauaauc uugccugcga agaucuaaaa ccagucucug aagaaguagu  6420


ggaaaauccu accauacaga aagacguucu ugaguguaau gugaaaacua ccgaaguugu  6480


aggagacauu auacuuaaac cagcaaauaa uaguuuaaaa auuacagaag agguuggcca  6540


cacagaucua auggcugcuu auguagacaa uucuagucuu acuauuaaga aaccuaauga  6600


auuaucuaga guauuagguu ugaaaacccu ugcuacucau gguuuagcug cuguuaauag  6660


ugucccuugg gauacuauag cuaauuaugc uaagccuuuu cuuaacaaag uuguuaguac  6720


aacuacuaac auaguuacac gguguuuaaa ccguguuugu acuaauuaua ugccuuauuu  6780


cuuuacuuua uugcuacaau uguguacuuu uacuagaagu acaaauucua gaauuaaagc  6840


aucuaugccg acuacuauag caaagaauac uguuaagagu gucgguaaau uuugucuaga  6900


ggcuucauuu aauuauuuga agucaccuaa uuuuucuaaa cugauaaaua uuauaauuug  6960


guuuuuacua uuaaguguuu gccuagguuc uuuaaucuac ucaaccgcug cuuuaggugu  7020


uuuaaugucu aauuuaggca ugccuucuua cuguacuggu uacagagaag gcuauuugaa  7080


cucuacuaau gucacuauug caaccuacug uacugguucu auaccuugua guguuugucu  7140


uagugguuua gauucuuuag acaccuaucc uucuuuagaa acuauacaaa uuaccauuuc  7200


aucuuuuaaa ugggauuuaa cugcuuuugg cuuaguugca gagugguuuu uggcauauau  7260


ucuuuucacu agguuuuucu auguacuugg auuggcugca aucaugcaau uguuuuucag  7320


cuauuuugca guacauuuua uuaguaauuc uuggcuuaug ugguuaauaa uuaaucuugu  7380


acaaauggcc ccgauuucag cuaugguuag aauguacauc uucuuugcau cauuuuauua  7440


uguauggaaa aguuaugugc auguuguaga cgguuguaau ucaucaacuu guaugaugug  7500


uuacaaacgu aauagagcaa caagagucga auguacaacu auuguuaaug guguuagaag  7560


guccuuuuau gucuaugcua auggagguaa aggcuuuugc aaacuacaca auuggaauug  7620


uguuaauugu gauacauucu gugcugguag uacauuuauu agugaugaag uugcgagaga  7680


cuugucacua caguuuaaaa gaccaauaaa uccuacugac cagucuucuu acaucguuga  7740


uaguguuaca gugaagaaug guuccaucca ucuuuacuuu gauaaagcug gucaaaagac  7800


uuaugaaaga cauucucucu cucauuuugu uaacuuagac aaccugagag cuaauaacac  7860


uaaagguuca uugccuauua auguuauagu uuuugauggu aaaucaaaau gugaagaauc  7920


aucugcaaaa ucagcgucug uuuacuacag ucagcuuaug ugucaaccua uacuguuacu  7980


agaucaggca uuagugucug auguugguga uagugcggaa guugcaguua aaauguuuga  8040


ugcuuacguu aauacguuuu caucaacuuu uaacguacca auggaaaaac ucaaaacacu  8100


aguugcaacu gcagaagcug aacuugcaaa gaaugugucc uuagacaaug ucuuaucuac  8160


uuuuauuuca gcagcucggc aaggguuugu ugauucagau guagaaacua aagauguugu  8220


ugaaugucuu aaauugucac aucaaucuga cauagaaguu acuggcgaua guuguaauaa  8280


cuauaugcuc accuauaaca aaguugaaaa caugacaccc cgugaccuug gugcuuguau  8340


ugacuguagu gcgcgucaua uuaaugcgca gguagcaaaa agucacaaca uugcuuugau  8400


auggaacguu aaagauuuca ugucauuguc ugaacaacua cgaaaacaaa uacguagugc  8460


ugcuaaaaag aauaacuuac cuuuuaaguu gacaugugca acuacuagac aaguuguuaa  8520


uguuguaaca acaaagauag cacuuaaggg ugguaaaauu guuaauaauu gguugaagca  8580


guuaauuaaa guuacacuug uguuccuuuu uguugcugcu auuuucuauu uaauaacacc  8640


uguucauguc augucuaaac auacugacuu uucaagugaa aucauaggau acaaggcuau  8700


ugaugguggu gucacucgug acauagcauc uacagauacu uguuuugcua acaaacaugc  8760


ugauuuugac acaugguuua gccagcgugg ugguaguuau acuaaugaca aagcuugccc  8820


auugauugcu gcagucauaa caagagaagu ggguuuuguc gugccugguu ugccuggcac  8880


gauauuacgc acaacuaaug gugacuuuuu gcauuucuua ccuagaguuu uuagugcagu  8940


ugguaacauc uguuacacac caucaaaacu uauagaguac acugacuuug caacaucagc  9000


uuguguuuug gcugcugaau guacaauuuu uaaagaugcu ucugguaagc caguaccaua  9060


uuguuaugau accaauguac uagaagguuc uguugcuuau gaaaguuuac gcccugacac  9120


acguuaugug cucauggaug gcucuauuau ucaauuuccu aacaccuacc uugaagguuc  9180


uguuagagug guaacaacuu uugauucuga guacuguagg cacggcacuu gugaaagauc  9240


agaagcuggu guuuguguau cuacuagugg uagaugggua cuuaacaaug auuauuacag  9300


aucuuuacca ggaguuuucu gugguguaga ugcuguaaau uuacuuacua auauguuuac  9360


accacuaauu caaccuauug gugcuuugga cauaucagca ucuauaguag cuggugguau  9420


uguagcuauc guaguaacau gccuugccua cuauuuuaug agguuuagaa gagcuuuugg  9480


ugaauacagu cauguaguug ccuuuaauac uuuacuauuc cuuaugucau ucacuguacu  9540


cuguuuaaca ccaguuuacu cauucuuacc ugguguuuau ucuguuauuu acuuguacuu  9600


gacauuuuau cuuacuaaug auguuucuuu uuuagcacau auucagugga ugguuauguu  9660


cacaccuuua guaccuuucu ggauaacaau ugcuuauauc auuuguauuu ccacaaagca  9720


uuucuauugg uucuuuagua auuaccuaaa gagacgugua gucuuuaaug guguuuccuu  9780


uaguacuuuu gaagaagcug cgcugugcac cuuuuuguua aauaaagaaa uguaucuaaa  9840


guugcguagu gaugugcuau uaccucuuac gcaauauaau agauacuuag cucuuuauaa  9900


uaaguacaag uauuuuagug gagcaaugga uacaacuagc uacagagaag cugcuuguug  9960


ucaucucgca aaggcucuca augacuucag uaacucaggu ucugauguuc uuuaccaacc  10020


accacaaacc ucuaucaccu cagcuguuuu gcagaguggu uuuagaaaaa uggcauuccc  10080


aucugguaaa guugaggguu guaugguaca aguaacuugu gguacaacua cacuuaacgg  10140


ucuuuggcuu gaugacguag uuuacugucc aagacaugug aucugcaccu cugaagacau  10200


gcuuaacccu aauuaugaag auuuacucau ucguaagucu aaucauaauu ucuugguaca  10260


ggcugguaau guucaacuca ggguuauugg acauucuaug caaaauugug uacuuaagcu  10320


uaagguugau acagccaauc cuaagacacc uaaguauaag uuuguucgca uucaaccagg  10380


acagacuuuu ucaguguuag cuuguuacaa ugguucacca ucugguguuu accaaugugc  10440


uaugaggccc aauuucacua uuaaggguuc auuccuuaau gguucaugug guaguguugg  10500


uuuuaacaua gauuaugacu gugucucuuu uuguuacaug caccauaugg aauuaccaac  10560


uggaguucau gcuggcacag acuuagaagg uaacuuuuau ggaccuuuug uugacaggca  10620


aacagcacaa gcagcuggua cggacacaac uauuacaguu aauguuuuag cuugguugua  10680


cgcugcuguu auaaauggag acaggugguu ucucaaucga uuuaccacaa cucuuaauga  10740


cuuuaaccuu guggcuauga aguacaauua ugaaccucua acacaagacc auguugacau  10800


acuaggaccu cuuucugcuc aaacuggaau ugccguuuua gauaugugug cuucauuaaa  10860


agaauuacug caaaauggua ugaauggacg uaccauauug gguagugcuu uauuagaaga  10920


ugaauuuaca ccuuuugaug uuguuagaca augcucaggu guuacuuucc aaagugcagu  10980


gaaaagaaca aucaagggua cacaccacug guuguuacuc acaauuuuga cuucacuuuu  11040


aguuuuaguc cagaguacuc aauggucuuu guucuuuuuu uuguaugaaa augccuuuuu  11100


accuuuugcu auggguauua uugcuauguc ugcuuuugca augauguuug ucaaacauaa  11160


gcaugcauuu cucuguuugu uuuuguuacc uucucuugcc acuguagcuu auuuuaauau  11220


ggucuauaug ccugcuaguu gggugaugcg uauuaugaca ugguuggaua ugguugauac  11280


uaguuugucu gguuuuaagc uaaaagacug uguuauguau gcaucagcug uaguguuacu  11340


aauccuuaug acagcaagaa cuguguauga ugauggugcu aggagagugu ggacacuuau  11400


gaaugucuug acacucguuu auaaaguuua uuaugguaau gcuuuagauc aagccauuuc  11460


caugugggcu cuuauaaucu cuguuacuuc uaacuacuca gguguaguua caacugucau  11520


guuuuuggcc agagguauug uuuuuaugug uguugaguau ugcccuauuu ucuucauaac  11580


ugguaauaca cuucagugua uaaugcuagu uuauuguuuc uuaggcuauu uuuguacuug  11640


uuacuuuggc cucuuuuguu uacucaaccg cuacuuuaga cugacucuug guguuuauga  11700


uuacuuaguu ucuacacagg aguuuagaua uaugaauuca cagggacuac ucccacccaa  11760


gaauagcaua gaugccuuca aacucaacau uaaauuguug gguguuggug gcaaaccuug  11820


uaucaaagua gccacuguac agucuaaaau gucagaugua aagugcacau caguagucuu  11880


acucucaguu uugcaacaac ucagaguaga aucaucaucu aaauuguggg cucaaugugu  11940


ccaguuacac aaugacauuc ucuuagcuaa agauacuacu gaagccuuug aaaaaauggu  12000


uucacuacuu ucuguuuugc uuuccaugca gggugcugua gacauaaaca agcuuuguga  12060


agaaaugcug gacaacaggg caaccuuaca agcuauagcc ucagaguuua guucccuucc  12120


aucauaugca gcuuuugcua cugcucaaga agcuuaugag caggcuguug cuaaugguga  12180


uucugaaguu guucuuaaaa aguugaagaa gucuuugaau guggcuaaau cugaauuuga  12240


ccgugaugca gccaugcaac guaaguugga aaagauggcu gaucaagcua ugacccaaau  12300


guauaaacag gcuagaucug aggacaagag ggcaaaaguu acuagugcua ugcagacaau  12360


gcuuuucacu augcuuagaa aguuggauaa ugaugcacuc aacaacauua ucaacaaugc  12420


aagagauggu uguguucccu ugaacauaau accucuuaca acagcagcca aacuaauggu  12480


ugucauacca gacuauaaca cauauaaaaa uacgugugau gguacaacau uuacuuaugc  12540


aucagcauug ugggaaaucc aacagguugu agaugcagau aguaaaauug uucaacuuag  12600


ugaaauuagu auggacaauu caccuaauuu agcauggccu cuuauuguaa cagcuuuaag  12660


ggccaauucu gcugucaaau uacagaauaa ugagcuuagu ccuguugcac uacgacagau  12720


gucuugugcu gccgguacua cacaaacugc uugcacugau gacaaugcgu uagcuuacua  12780


caacacaaca aagggaggua gguuuguacu ugcacuguua uccgauuuac aggauuugaa  12840


augggcuaga uucccuaaga gugauggaac ugguacuauc uauacagaac uggaaccacc  12900


uuguagguuu guuacagaca caccuaaagg uccuaaagug aaguauuuau acuuuauuaa  12960


aggauuaaac aaccuaaaua gagguauggu acuugguagu uuagcugcca caguacgucu  13020


acaagcuggu aaugcaacag aagugccugc caauucaacu guauuaucuu ucugugcuuu  13080


ugcuguagau gcugcuaaag cuuacaaaga uuaucuagcu agugggggac aaccaaucac  13140


uaauuguguu aagauguugu guacacacac ugguacuggu caggcaauaa caguuacacc  13200


ggaagccaau auggaucaag aauccuuugg uggugcaucg uguugucugu acugccguug  13260


ccacauagau cauccaaauc cuaaaggauu uugugacuua aaagguaagu auguacaaau  13320


accuacaacu ugugcuaaug acccuguggg uuuuacacuu aaaaacacag ucuguaccgu  13380


cugcgguaug uggaaagguu auggcuguag uugugaucaa cuccgcgaac ccaugcuuca  13440


gucagcugau gcacaaucgu uuuuaaacgg guuugcggug uaagugcagc ccgucuuaca  13500


ccgugcggca caggcacuag uacugauguc guauacaggg cuuuugacau cuacaaugau  13560


aaaguagcug guuuugcuaa auuccuaaaa acuaauuguu gucgcuucca agaaaaggac  13620


gaagaugaca auuuaauuga uucuuacuuu guaguuaaga gacacacuuu cucuaacuac  13680


caacaugaag aaacaauuua uaauuuacuu aaggauuguc cagcuguugc uaaacaugac  13740


uucuuuaagu uuagaauaga cggugacaug guaccacaua uaucacguca acgucuuacu  13800


aaauacacaa uggcagaccu cgucuaugcu uuaaggcauu uugaugaagg uaauugugac  13860


acauuaaaag aaauacuugu cacauacaau uguugugaug augauuauuu caauaaaaag  13920


gacugguaug auuuuguaga aaacccagau auauuacgcg uauacgccaa cuuaggugaa  13980


cguguacgcc aagcuuuguu aaaaacagua caauucugug augccaugcg aaaugcuggu  14040


auuguuggug uacugacauu agauaaucaa gaucucaaug guaacuggua ugauuucggu  14100


gauuucauac aaaccacgcc agguagugga guuccuguug uagauucuua uuauucauug  14160


uuaaugccua uauuaaccuu gaccagggcu uuaacugcag agucacaugu ugacacugac  14220


uuaacaaagc cuuacauuaa gugggauuug uuaaaauaug acuucacgga agagagguua  14280


aaacucuuug accguuauuu uaaauauugg gaucagacau accacccaaa uuguguuaac  14340


uguuuggaug acagaugcau ucugcauugu gcaaacuuua auguuuuauu cucuacagug  14400


uucccaccua caaguuuugg accacuagug agaaaaauau uuguugaugg uguuccauuu  14460


guaguuucaa cuggauacca cuucagagag cuagguguug uacauaauca ggauguaaac  14520


uuacauagcu cuagacuuag uuuuaaggaa uuacuugugu augcugcuga cccugcuaug  14580


cacgcugcuu cugguaaucu auuacuagau aaacgcacua cgugcuuuuc aguagcugca  14640


cuuacuaaca auguugcuuu ucaaacuguc aaacccggua auuuuaacaa agacuucuau  14700


gacuuugcug ugucuaaggg uuucuuuaag gaaggaaguu cuguugaauu aaaacacuuc  14760


uucuuugcuc aggaugguaa ugcugcuauc agcgauuaug acuacuaucg uuauaaucua  14820


ccaacaaugu gugauaucag acaacuacua uuuguaguug aaguuguuga uaaguacuuu  14880


gauuguuacg augguggcug uauuaaugcu aaccaaguca ucgucaacaa ccuagacaaa  14940


ucagcugguu uuccauuuaa uaaauggggu aaggcuagac uuuauuauga uucaaugagu  15000


uaugaggauc aagaugcacu uuucgcauau acaaaacgua augucauccc uacuauaacu  15060


caaaugaauc uuaaguaugc cauuagugca aagaauagag cucgcaccgu agcugguguc  15120


ucuaucugua guacuaugac caauagacag uuucaucaaa aauuauugaa aucaauagcc  15180


gccacuagag gagcuacugu aguaauugga acaagcaaau ucuauggugg uuggcacaac  15240


auguuaaaaa cuguuuauag ugauguagaa aacccucacc uuauggguug ggauuauccu  15300


aaaugugaua gagccaugcc uaacaugcuu agaauuaugg ccucacuugu ucuugcucgc  15360


aaacauacaa cguguuguag cuugucacac cguuucuaua gauuagcuaa ugagugugcu  15420


caaguauuga gugaaauggu cauguguggc gguucacuau auguuaaacc agguggaacc  15480


ucaucaggag augccacaac ugcuuaugcu aauaguguuu uuaacauuug ucaagcuguc  15540


acggccaaug uuaaugcacu uuuaucuacu gaugguaaca aaauugccga uaaguauguc  15600


cgcaauuuac aacacagacu uuaugagugu cucuauagaa auagagaugu ugacacagac  15660


uuugugaaug aguuuuacgc auauuugcgu aaacauuucu caaugaugau acucucugac  15720


gaugcuguug uguguuucaa uagcacuuau gcaucucaag gucuaguggc uagcauaaag  15780


aacuuuaagu caguucuuua uuaucaaaac aauguuuuua ugucugaagc aaaauguugg  15840


acugagacug accuuacuaa aggaccucau gaauuuugcu cucaacauac aaugcuaguu  15900


aaacagggug augauuaugu guaccuuccu uacccagauc caucaagaau ccuaggggcc  15960


ggcuguuuug uagaugauau cguaaaaaca gaugguacac uuaugauuga acgguucgug  16020


ucuuuagcua uagaugcuua cccacuuacu aaacauccua aucaggagua ugcugauguc  16080


uuucauuugu acuuacaaua cauaagaaag cuacaugaug aguuaacagg acacauguua  16140


gacauguauu cuguuaugcu uacuaaugau aacacuucaa gguauuggga accugaguuu  16200


uaugaggcua uguacacacc gcauacaguc uuacaggcug uuggggcuug uguucuuugc  16260


aauucacaga cuucauuaag auguggugcu ugcauacgua gaccauucuu auguuguaaa  16320


ugcuguuacg accaugucau aucaacauca cauaaauuag ucuugucugu uaauccguau  16380


guuugcaaug cuccagguug ugaugucaca gaugugacuc aacuuuacuu aggagguaug  16440


agcuauuauu guaaaucaca uaaaccaccc auuaguuuuc cauugugugc uaauggacaa  16500


guuuuugguu uauauaaaaa uacauguguu gguagcgaua auguuacuga cuuuaaugca  16560


auugcaacau gugacuggac aaaugcuggu gauuacauuu uagcuaacac cuguacugaa  16620


agacucaagc uuuuugcagc agaaacgcuc aaagcuacug aggagacauu uaaacugucu  16680


uaugguauug cuacuguacg ugaagugcug ucugacagag aauuacaucu uucaugggaa  16740


guugguaaac cuagaccacc acuuaaccga aauuaugucu uuacugguua ucguguaacu  16800


aaaaacagua aaguacaaau aggagaguac accuuugaaa aaggugacua uggugaugcu  16860


guuguuuacc gagguacaac aacuuacaaa uuaaauguug gugauuauuu ugugcugaca  16920


ucacauacag uaaugccauu aagugcaccu acacuagugc cacaagagca cuauguuaga  16980


auuacuggcu uauacccaac acucaauauc ucagaugagu uuucuagcaa uguugcaaau  17040


uaucaaaagg uugguaugca aaaguauucu acacuccagg gaccaccugg uacugguaag  17100


agucauuuug cuauuggccu agcucucuac uacccuucug cucgcauagu guauacagcu  17160


ugcucucaug ccgcuguuga ugcacuaugu gagaaggcau uaaaauauuu gccuauagau  17220


aaauguagua gaauuauacc ugcacgugcu cguguagagu guuuugauaa auucaaagug  17280


aauucaacau uagaacagua ugucuuuugu acuguaaaug cauugccuga gacgacagca  17340


gauauaguug ucuuugauga aauuucaaug gccacaaauu augauuugag uguugucaau  17400


gccagauuac gugcuaagca cuauguguac auuggcgacc cugcucaauu accugcacca  17460


cgcacauugc uaacuaaggg cacacuagaa ccagaauauu ucaauucagu guguagacuu  17520


augaaaacua uagguccaga cauguuccuc ggaacuuguc ggcguugucc ugcugaaauu  17580


guugacacug ugagugcuuu gguuuaugau aauaagcuua aagcacauaa agacaaauca  17640


gcucaaugcu uuaaaauguu uuauaagggu guuaucacgc augauguuuc aucugcaauu  17700


aacaggccac aaauaggcgu gguaagagaa uuccuuacac guaacccugc uuggagaaaa  17760


gcugucuuua uuucaccuua uaauucacag aaugcuguag ccucaaagau uuugggacua  17820


ccaacucaaa cuguugauuc aucacagggc ucagaauaug acuaugucau auucacucaa  17880


accacugaaa cagcucacuc uuguaaugua aacagauuua auguugcuau uaccagagca  17940


aaaguaggca uacuuugcau aaugucugau agagaccuuu augacaaguu gcaauuuaca  18000


agucuugaaa uuccacguag gaauguggca acuuuacaag cugaaaaugu aacaggacuc  18060


uuuaaagauu guaguaaggu aaucacuggg uuacauccua cacaggcacc uacacaccuc  18120


aguguugaca cuaaauucaa aacugaaggu uuauguguug acauaccugg cauaccuaag  18180


gacaugaccu auagaagacu caucucuaug auggguuuua aaaugaauua ucaaguuaau  18240


gguuacccua acauguuuau cacccgcgaa gaagcuauaa gacauguacg ugcauggauu  18300


ggcuucgaug ucgaggggug ucaugcuacu agagaagcug uugguaccaa uuuaccuuua  18360


cagcuagguu uuucuacagg uguuaaccua guugcuguac cuacagguua uguugauaca  18420


ccuaauaaua cagauuuuuc cagaguuagu gcuaaaccac cgccuggaga ucaauuuaaa  18480


caccucauac cacuuaugua caaaggacuu ccuuggaaug uagugcguau aaagauugua  18540


caaauguuaa gugacacacu uaaaaaucuc ucugacagag ucguauuugu cuuaugggca  18600


cauggcuuug aguugacauc uaugaaguau uuugugaaaa uaggaccuga gcgcaccugu  18660


ugucuaugug auagacgugc cacaugcuuu uccacugcuu cagacacuua ugccuguugg  18720


caucauucua uuggauuuga uuacgucuau aauccguuua ugauugaugu ucaacaaugg  18780


gguuuuacag guaaccuaca aagcaaccau gaucuguauu gucaagucca ugguaaugca  18840


cauguagcua guugugaugc aaucaugacu aggugucuag cuguccacga gugcuuuguu  18900


aagcguguug acuggacuau ugaauauccu auaauuggug augaacugaa gauuaaugcg  18960


gcuuguagaa agguucaaca caugguuguu aaagcugcau uauuagcaga caaauuccca  19020


guucuucacg acauugguaa cccuaaagcu auuaagugug uaccucaagc ugauguagaa  19080


uggaaguucu augaugcaca gccuuguagu gacaaagcuu auaaaauaga agaauuauuc  19140


uauucuuaug ccacacauuc ugacaaauuc acagauggug uaugccuauu uuggaauugc  19200


aaugucgaua gauauccugc uaauuccauu guuuguagau uugacacuag agugcuaucu  19260


aaccuuaacu ugccugguug ugaugguggc aguuuguaug uaaauaaaca ugcauuccac  19320


acaccagcuu uugauaaaag ugcuuuuguu aauuuaaaac aauuaccauu uuucuauuac  19380


ucugacaguc caugugaguc ucauggaaaa caaguagugu cagauauaga uuauguacca  19440


cuaaagucug cuacguguau aacacguugc aauuuaggug gugcugucug uagacaucau  19500


gcuaaugagu acagauugua ucucgaugcu uauaacauga ugaucucagc uggcuuuagc  19560


uuguggguuu acaaacaauu ugauacuuau aaccucugga acacuuuuac aagacuucag  19620


aguuuagaaa auguggcuuu uaauguugua aauaagggac acuuugaugg acaacagggu  19680


gaaguaccag uuucuaucau uaauaacacu guuuacacaa aaguugaugg uguugaugua  19740


gaauuguuug aaaauaaaac aacauuaccu guuaauguag cauuugagcu uugggcuaag  19800


cgcaacauua aaccaguacc agaggugaaa auacucaaua auuugggugu ggacauugcu  19860


gcuaauacug ugaucuggga cuacaaaaga gaugcuccag cacauauauc uacuauuggu  19920


guuuguucua ugacugacau agccaagaaa ccaacugaaa cgauuugugc accacucacu  19980


gucuuuuuug augguagagu ugauggucaa guagacuuau uuagaaaugc ccguaauggu  20040


guucuuauua cagaagguag uguuaaaggu uuacaaccau cuguaggucc caaacaagcu  20100


agucuuaaug gagucacauu aauuggagaa gccguaaaaa cacaguucaa uuauuauaag  20160


aaaguugaug guguugucca acaauuaccu gaaacuuacu uuacucagag uagaaauuua  20220


caagaauuua aacccaggag ucaaauggaa auugauuucu uagaauuagc uauggaugaa  20280


uucauugaac gguauaaauu agaaggcuau gccuucgaac auaucguuua uggagauuuu  20340


agucauaguc aguuaggugg uuuacaucua cugauuggac uagcuaaacg uuuuaaggaa  20400


ucaccuuuug aauuagaaga uuuuauuccu auggacagua caguuaaaaa cuauuucaua  20460


acagaugcgc aaacagguuc aucuaagugu guguguucug uuauugauuu auuacuugau  20520


gauuuuguug aaauaauaaa aucccaagau uuaucuguag uuucuaaggu ugucaaagug  20580


acuauugacu auacagaaau uucauuuaug cuuuggugua aagauggcca uguagaaaca  20640


uuuuacccaa aauuacaauc uagucaagcg uggcaaccgg guguugcuau gccuaaucuu  20700


uacaaaaugc aaagaaugcu auuagaaaag ugugaccuuc aaaauuaugg ugauagugca  20760


acauuaccua aaggcauaau gaugaauguc gcaaaauaua cucaacugug ucaauauuua  20820


aacacauuaa cauuagcugu acccuauaau augagaguua uacauuuugg ugcugguucu  20880


gauaaaggag uugcaccagg uacagcuguu uuaagacagu gguugccuac ggguacgcug  20940


cuugucgauu cagaucuuaa ugacuuuguc ucugaugcag auucaacuuu gauuggugau  21000


ugugcaacug uacauacagc uaauaaaugg gaucucauua uuagugauau guacgacccu  21060


aagacuaaaa auguuacaaa agaaaaugac ucuaaagagg guuuuuucac uuacauuugu  21120


ggguuuauac aacaaaagcu agcucuugga gguuccgugg cuauaaagau aacagaacau  21180


ucuuggaaug cugaucuuua uaagcucaug ggacacuucg caugguggac agccuuuguu  21240


acuaauguga augcgucauc aucugaagca uuuuuaauug gauguaauua ucuuggcaaa  21300


ccacgcgaac aaauagaugg uuaugucaug caugcaaauu acauauuuug gaggaauaca  21360


aauccaauuc aguugucuuc cuauucuuua uuugacauga guaaauuucc ccuuaaauua  21420


agggguacug cuguuauguc uuuaaaagaa ggucaaauca augauaugau uuuaucucuu  21480


cuuaguaaag guagacuuau aauuagagaa aacaacagag uuguuauuuc uagugauguu  21540


cuuguuaaca acuaaacgaa caauguuugu uuuucuuguu uuauugccac uagucucuag  21600


ucaguguguu aaucuuacaa ccagaacuca auuacccccu gcauacacua auucuuucac  21660


acgugguguu uauuacccug acaaaguuuu cagauccuca guuuuacauu caacucagga  21720


cuuguucuua ccuuucuuuu ccaauguuac uugguuccau gcuauacaug ucucugggac  21780


caaugguacu aagagguuug auaacccugu ccuaccauuu aaugauggug uuuauuuugc  21840


uuccacugag aagucuaaca uaauaagagg cuggauuuuu gguacuacuu uagauucgaa  21900


gacccagucc cuacuuauug uuaauaacgc uacuaauguu guuauuaaag ucugugaauu  21960


ucaauuuugu aaugauccau uuuugggugu uuauuaccac aaaaacaaca aaaguuggau  22020


ggaaagugag uucagaguuu auucuagugc gaauaauugc acuuuugaau augucucuca  22080


gccuuuucuu auggaccuug aaggaaaaca ggguaauuuc aaaaaucuua gggaauuugu  22140


guuuaagaau auugaugguu auuuuaaaau auauucuaag cacacgccua uuaauuuagu  22200


gcgugaucuc ccucaggguu uuucggcuuu agaaccauug guagauuugc caauagguau  22260


uaacaucacu agguuucaaa cuuuacuugc uuuacauaga aguuauuuga cuccugguga  22320


uucuucuuca gguuggacag cuggugcugc agcuuauuau guggguuauc uucaaccuag  22380


gacuuuucua uuaaaauaua augaaaaugg aaccauuaca gaugcuguag acugugcacu  22440


ugacccucuc ucagaaacaa aguguacguu gaaauccuuc acuguagaaa aaggaaucua  22500


ucaaacuucu aacuuuagag uccaaccaac agaaucuauu guuagauuuc cuaauauuac  22560


aaacuugugc ccuuuuggug aaguuuuuaa cgccaccaga uuugcaucug uuuaugcuug  22620


gaacaggaag agaaucagca acuguguugc ugauuauucu guccuauaua auuccgcauc  22680


auuuuccacu uuuaaguguu auggaguguc uccuacuaaa uuaaaugauc ucugcuuuac  22740


uaaugucuau gcagauucau uuguaauuag aggugaugaa gucagacaaa ucgcuccagg  22800


gcaaacugga aagauugcug auuauaauua uaaauuacca gaugauuuua caggcugcgu  22860


uauagcuugg aauucuaaca aucuugauuc uaagguuggu gguaauuaua auuaccugua  22920


uagauuguuu aggaagucua aucucaaacc uuuugagaga gauauuucaa cugaaaucua  22980


ucaggccggu agcacaccuu guaauggugu ugaagguuuu aauuguuacu uuccuuuaca  23040


aucauauggu uuccaaccca cuaauggugu ugguuaccaa ccauacagag uaguaguacu  23100


uucuuuugaa cuucuacaug caccagcaac uguuugugga ccuaaaaagu cuacuaauuu  23160


gguuaaaaac aaauguguca auuucaacuu caaugguuua acaggcacag guguucuuac  23220


ugagucuaac aaaaaguuuc ugccuuucca acaauuuggc agagacauug cugacacuac  23280


ugaugcuguc cgugauccac agacacuuga gauucuugac auuacaccau guucuuuugg  23340


uggugucagu guuauaacac caggaacaaa uacuucuaac cagguugcug uucuuuauca  23400


ggauguuaac ugcacagaag ucccuguugc uauucaugca gaucaacuua cuccuacuug  23460


gcguguuuau ucuacagguu cuaauguuuu ucaaacacgu gcaggcuguu uaauaggggc  23520


ugaacauguc aacaacucau augaguguga cauacccauu ggugcaggua uaugcgcuag  23580


uuaucagacu cagacuaauu cuccucggcg ggcacguagu guagcuaguc aauccaucau  23640


ugccuacacu augucacuug gugcagaaaa uucaguugcu uacucuaaua acucuauugc  23700


cauacccaca aauuuuacua uuaguguuac cacagaaauu cuaccagugu cuaugaccaa  23760


gacaucagua gauuguacaa uguacauuug uggugauuca acugaaugca gcaaucuuuu  23820


guugcaauau ggcaguuuuu guacacaauu aaaccgugcu uuaacuggaa uagcuguuga  23880


acaagacaaa aacacccaag aaguuuuugc acaagucaaa caaauuuaca aaacaccacc  23940


aauuaaagau uuuggugguu uuaauuuuuc acaaauauua ccagauccau caaaaccaag  24000


caagagguca uuuauugaag aucuacuuuu caacaaagug acacuugcag augcuggcuu  24060


caucaaacaa uauggugauu gccuugguga uauugcugcu agagaccuca uuugugcaca  24120


aaaguuuaac ggccuuacug uuuugccacc uuugcucaca gaugaaauga uugcucaaua  24180


cacuucugca cuguuagcgg guacaaucac uucugguugg accuuuggug caggugcugc  24240


auuacaaaua ccauuugcua ugcaaauggc uuauagguuu aaugguauug gaguuacaca  24300


gaauguucuc uaugagaacc aaaaauugau ugccaaccaa uuuaauagug cuauuggcaa  24360


aauucaagac ucacuuucuu ccacagcaag ugcacuugga aaacuucaag auguggucaa  24420


ccaaaaugca caagcuuuaa acacgcuugu uaaacaacuu agcuccaauu uuggugcaau  24480


uucaaguguu uuaaaugaua uccuuucacg ucuugacaaa guugaggcug aagugcaaau  24540


ugauagguug aucacaggca gacuucaaag uuugcagaca uaugugacuc aacaauuaau  24600


uagagcugca gaaaucagag cuucugcuaa ucuugcugcu acuaaaaugu cagagugugu  24660


acuuggacaa ucaaaaagag uugauuuuug uggaaagggc uaucaucuua uguccuuccc  24720


ucagucagca ccucauggug uagucuucuu gcaugugacu uaugucccug cacaagaaaa  24780


gaacuucaca acugcuccug ccauuuguca ugauggaaaa gcacacuuuc cucgugaagg  24840


ugucuuuguu ucaaauggca cacacugguu uguaacacaa aggaauuuuu augaaccaca  24900


aaucauuacu acagacaaca cauuuguguc ugguaacugu gauguuguaa uaggaauugu  24960


caacaacaca guuuaugauc cuuugcaacc ugaauuagac ucauucaagg aggaguuaga  25020


uaaauauuuu aagaaucaua caucaccaga uguugauuua ggugacaucu cuggcauuaa  25080


ugcuucaguu guaaacauuc aaaaagaaau ugaccgccuc aaugagguug ccaagaauuu  25140


aaaugaaucu cucaucgauc uccaagaacu uggaaaguau gagcaguaua uaaaauggcc  25200


augguacauu uggcuagguu uuauagcugg cuugauugcc auaguaaugg ugacaauuau  25260


gcuuugcugu augaccaguu gcuguaguug ucucaagggc uguuguucuu guggauccug  25320


cugcaaauuu gaugaagacg acucugagcc agugcucaaa ggagucaaau uacauuacac  25380


auaaacgaac uuauggauuu guuuaugaga aucuucacaa uuggaacugu aacuuugaag  25440


caaggugaaa ucaaggaugc uacuccuuca gauuuuguuc gcgcuacugc aacgauaccg  25500


auacaagccu cacucccuuu cggauggcuu auuguuggcg uugcacuucu ugcuguuuuu  25560


cagagcgcuu ccaaaaucau aacccucaaa aagagauggc aacuagcacu cuccaagggu  25620


guucacuuug uuugcaacuu gcuguuguug uuuguaacag uuuacucaca ccuuuugcuc  25680


guugcugcug gccuugaagc cccuuuucuc uaucuuuaug cuuuagucua cuucuugcag  25740


aguauaaacu uuguaagaau aauaaugagg cuuuggcuuu gcuggaaaug ccguuccaaa  25800


aacccauuac uuuaugaugc caacuauuuu cuuugcuggc auacuaauug uuacgacuau  25860


uguauaccuu acaauagugu aacuucuuca auugucauua cuucagguga uggcacaaca  25920


aguccuauuu cugaacauga cuaccagauu ggugguuaua cugaaaaaug ggaaucugga  25980


guaaaagacu guguuguauu acacaguuac uucacuucag acuauuacca gcuguacuca  26040


acucaauuga guacagacac ugguguugaa cauguuaccu ucuucaucua caauaaaauu  26100


guugaugagc cugaagaaca uguccaaauu cacacaaucg acgguucauc cggaguuguu  26160


aauccaguaa uggaaccaau uuaugaugaa ccgacgacga cuacuagcgu gccuuuguaa  26220


gcacaagcug augaguacga acuuauguac ucauucguuu cggaagagac agguacguua  26280


auaguuaaua gcguacuucu uuuucuugcu uucgugguau ucuugcuagu uacacuagcc  26340


auccuuacug cgcuucgauu gugugcguac ugcugcaaua uuguuaacgu gagucuugua  26400


aaaccuucuu uuuacguuua cucucguguu aaaaaucuga auucuucuag aguuccugau  26460


cuucuggucu aaacgaacua aauauuauau uaguuuuucu guuuggaacu uuaauuuuag  26520


ccauggcaga uuccaacggu acuauuaccg uugaagagcu uaaaaagcuc cuugaacaau  26580


ggaaccuagu aauagguuuc cuauuccuua cauggauuug ucuucuacaa uuugccuaug  26640


ccaacaggaa uagguuuuug uauauaauua aguuaauuuu ccucuggcug uuauggccag  26700


uaacuuuagc uuguuuugug cuugcugcug uuuacagaau aaauuggauc accgguggaa  26760


uugcuaucgc aauggcuugu cuuguaggcu ugauguggcu cagcuacuuc auugcuucuu  26820


ucagacuguu ugcgcguacg cguuccaugu ggucauucaa uccagaaacu aacauucuuc  26880


ucaacgugcc acuccauggc acuauucuga ccagaccgcu ucuagaaagu gaacucguaa  26940


ucggagcugu gauccuucgu ggacaucuuc guauugcugg acaccaucua ggacgcugug  27000


acaucaagga ccugccuaaa gaaaucacug uugcuacauc acgaacgcuu ucuuauuaca  27060


aauugggagc uucgcagcgu guagcaggug acucagguuu ugcugcauac agucgcuaca  27120


ggauuggcaa cuauaaauua aacacagacc auuccaguag cagugacaau auugcuuugc  27180


uuguacagua agugacaaca gauguuucau cucguugacu uucagguuac uauagcagag  27240


auauuacuaa uuauuaugag gacuuuuaaa guuuccauuu ggaaucuuga uuacaucaua  27300


aaccucauaa uuaaaaauuu aucuaaguca cuaacugaga auaaauauuc ucaauuagau  27360


gaagagcaac caauggagau ugauuaaacg aacaugaaaa uuauucuuuu cuuggcacug  27420


auaacacucg cuacuuguga gcuuuaucac uaccaagagu guguuagagg uacaacagua  27480


cuuuuaaaag aaccuugcuc uucuggaaca uacgagggca auucaccauu ucauccucua  27540


gcugauaaca aauuugcacu gacuugcuuu agcacucaau uugcuuuugc uuguccugac  27600


ggcguaaaac acgucuauca guuacgugcc agaucaguuu caccuaaacu guucaucaga  27660


caagaggaag uucaagaacu uuacucucca auuuuucuua uuguugcggc aauaguguuu  27720


auaacacuuu gcuucacacu caaaagaaag acagaaugau ugaacuuuca uuaauugacu  27780


ucuauuugug cuuuuuagcc uuucugcuau uccuuguuuu aauuaugcuu auuaucuuuu  27840


gguucucacu ugaacugcaa gaucauaaug aaacuuguca cgccuaaacg aacaugaaau  27900


uucuuguuuu cuuaggaauc aucacaacug uagcugcauu ucaccaagaa uguaguuuac  27960


agucauguac ucaacaucaa ccauauguag uugaugaccc guguccuauu cacuucuauu  28020


cuaaauggua uauuagagua ggagcuagaa aaucagcacc uuuaauugaa uugugcgugg  28080


augaggcugg uucuaaauca cccauucagu acaucgauau cgguaauuau acaguuuccu  28140


guuuaccuuu uacaauuaau ugccaggaac cuaaauuggg uagucuugua gugcguuguu  28200


cguucuauga agacuuuuua gaguaucaug acguucgugu uguuuuagau uucaucuaaa  28260


cgaacaaacu aaaaugucug auaauggacc ccaaaaucag cgaaaugcac cccgcauuac  28320


guuuggugga cccucagauu caacuggcag uaaccagaau ggagaacgca guggggcgcg  28380


aucaaaacaa cgucggcccc aagguuuacc caauaauacu gcgucuuggu ucaccgcucu  28440


cacucaacau ggcaaggaag accuuaaauu cccucgagga caaggcguuc caauuaacac  28500


caauagcagu ccagaugacc aaauuggcua cuaccgaaga gcuaccagac gaauucgugg  28560


uggugacggu aaaaugaaag aucucagucc aagaugguau uucuacuacc uaggaacugg  28620


gccagaagcu ggacuucccu auggugcuaa caaagacggc aucauauggg uugcaacuga  28680


gggagccuug aauacaccaa aagaucacau uggcacccgc aauccugcua acaaugcugc  28740


aaucgugcua caacuuccuc aaggaacaac auugccaaaa ggcuucuacg cagaagggag  28800


cagaggcggc agucaagccu cuucucguuc cucaucacgu agucgcaaca guucaagaaa  28860


uucaacucca ggcagcagua ggggaacuuc uccugcuaga auggcuggca auggcgguga  28920


ugcugcucuu gcuuugcugc ugcuugacag auugaaccag cuugagagca aaaugucugg  28980


uaaaggccaa caacaacaag gccaaacugu cacuaagaaa ucugcugcug aggcuucuaa  29040


gaagccucgg caaaaacgua cugccacuaa agcauacaau guaacacaag cuuucggcag  2910


acguggucca gaacaaaccc aaggaaauuu uggggaccag gaacuaauca gacaaggaac  29160


ugauuacaaa cauuggccgc aaauugcaca auuugccccc agcgcuucag cguucuucgg  29220


aaugucgcgc auuggcaugg aagucacacc uucgggaacg ugguugaccu acacaggugc  29280


caucaaauug gaugacaaag auccaaauuu caaagaucaa gucauuuugc ugaauaagca  29340


uauugacgca uacaaaacau ucccaccaac agagccuaaa aaggacaaaa agaagaaggc  29400


ugaugaaacu caagccuuac cgcagagaca gaagaaacag caaacuguga cucuucuucc  29460


ugcugcagau uuggaugauu ucuccaaaca auugcaacaa uccaugagca gugcugacuc  29520


aacucaggcc uaaacucaug cagaccacac aaggcagaug ggcuauauaa acguuuucgc  29580


uuuuccguuu acgauauaua gucuacucuu gugcagaaug aauucucgua acuacauagc  29640


acaaguagau guaguuaacu uuaaucucac auagcaaucu uuaaucagug uguaacauua  29700


gggaggacuu gaaagagcca ccacauuuuc accgaggcca cgcggaguac gaucgagugu  29760


acagugaaca augcuaggga gagcugccua uauggaagag cccuaaugug uaaaauuaau  29820


uuuaguagug cuauccccau gugauuuuaa uagcuucuua ggagaaugac aaaaaaaaaa  29880


aaaaaaaaaa aaaaaaaaaa aaa                        29903






SEQ ID NO: 35









<211> 33


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence RSE Circ chikvRSE


<400> 35
















agcaaauaau cuauagauca aagggcuacg caa               33






SEQ ID NO: 36









<211> 294


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular ARN 1; target disruption structure comprised


    in SARS-CoV-2 3′UTR replication site


<400> 36
















ugcaguuaga uacugcuugu guuauguggu ugugaggguu uauuuugaga uccugcuggu  60


uacuugugcu guguaguuau gagaguuugu uuuggauacc uuuagccugc uuguguugug  120


ugguugcgag gauuuauucu gcucggaaac gauuuguuug uguuauguag uuguggggau  180


ucauucuggc ugcuuccucu uuauuugugu uguguaguua cgggaguucg uuuuguccca  240


cauagaguug cuugugcuau gugguuacgg ggauuuauuu ugccagggcc aaac     294






SEQ ID NO: 37









<211> 29


<212> RNA


<213> Artificial Sequence


<220>


<223> Target sequence SL III 3′ UTR circ_wnv_slll_½


<400> 37
















uuuugaggag aaagucaggc cgggaaguu                   29









SEQ ID NO: 38









<211> 294


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular ARN 2; target disruption structure comprised


    in SARS-CoV-2 3′UTR replication site


<400> 38
















ugcaguuaga uacugcuugu guuauguggu ugugaggguu uauuuugaga uccugcuggu  60


uacuugugcu guguaguuau gagaguuugu uuuggauacc uuuagccugc uuguguugug  120


ugguugcgag gauuuauucu gcucggaaac gauuuguuug uguuauguag uuguggggau  180


ucauucuggc ugcuuccucu uuguuugugu uguguaguua cggggguucg uuuuguccca  240


cauagaguua cuugugcuau guaguuauga ggauucauuu ugccagggcc aaac     294






SEQ ID NO: 39









<211> 294


<212> RNA


<213> Artificial Sequence


<220>


<223> Circ Chikv_re


<400> 39
















gcgccgauua uggcuaaaag agucaacguu uuguaguagc ugcggguugc ccucauuacg  60


guuaagaggg uuaauguuuu auagcagcug cccgcgagca ggauuauggu uggaaagguu  120


aacguuuugc agcagcguuc guaacacuuc auuauggcua aggaagccaa cguuuugugg  180


uagccuaggu ucgaaccgau uauggcuaga ggggucagcg uuuuauggua gccaucaaaa  240


ccuuucauua cggcugagag agccaauguu uuacaguagc uccaacgacg uacu     294






SEQ ID NO: 40









<211> 294


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 3; target disruption structure comprised


    in SARS-CoV-2 3′UTR replication site


<400> 40
















ugcaguuaga uacugcuugu guuauguggu ugugaggguu uauuuugaga uccugcuggu  60


uguuugugcu auguaguuac gaggguucau uuuggauacc uuuagccugc uuguguugug  120


ugguugcgag gauuuauucu gcucggaaac gauuuguuug uguuauguag uuguggggau  180


ucauucuggc ugcuuccucu cugcuugugc uguguaguua ugagaguuug uuuuguccca  240


cauagaguua uuuguguugu guaguugugg gaguuuguuu ugccagggcc aaac      294






SEQ ID NO: 41









<211> 294


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 4; target disruption structure comprised


    in SARS-CoV-2 3′UTR replication site


<400> 41
















ugcaguuaga uauuguuugu gcuauguggu uguggggauu cauucugaug ucguauuguu  60


ugcuuguguu gugugguuac gggaauuugu uuugaacucu uaguuguugu uugugcugug  120


uaguuguggg gguuuguucu gauguucuga ucuuuguuug uguuauguag uuacgaggau  180


uuauucuggu gcaacaaguu cuauuugugu uaugugguug cggggguucg uuuugcccgg  240


ccuucgcuua cuuguguugu guaguuguga ggauucguuu uggaugcauc gaac      294






SEQ ID NO: 42









<211> 294


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 5; target disruption structure comprised


    in SARS-CoV-2 3′UTR replication site


<400> 42
















ugcaguuaga uacuauuugu gcuauguagu ugcggggguu uguuuugugg cuuucuuacc  60


uguuuguguu augugguugu gaggauuugu uuuggccgac ucguuccugc uugugcugug  120


uaguuguggg aguucauuuu guucagaguu agccuacuug uguuauguag uuaugagagu  180


ucguuuugga gagacgcaca cuguuugugu ugugugguua uggggauucg uuuugugggu  240


ccggcuccug uuugugcugu gugguuauga gaauuuguuc ugaagauuua uucc    294









SEQ ID NO: 43









<211> 292


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 1; target disruption structure comprised


    in SARS-CoV-2 5′UTR (SIII)


<400> 43
















ugcaguuaga uaagaucugc aggggguuga ggguugguug auccaggcug cuagaucuau  60


aagggguugg gaguugguuc uuuagcuauc ccagauuugu gagggguugg ggguugguua  120


ggcuuacagu uaagaucuau gggagguugg agguugguua ccgccgaguu auagauuuau  180


aggggaucgg aaguugguua aagcuagggc gaagaucugc gggggguugg aaguugguua  240


uacaacgaau uaagauuuau ggggggucgg ggguugguuu aguaguugga ug      292






SEQ ID NO: 44









<211> 292


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 2; target disruption structure comprised


    in SARS-CoV-2 5′UTR (SIII)


<400> 44
















ugcaguuaga uaggaucuau aagggguugg aaguugguua uguggucgcg cgaggucugu  60


aagagauuga aaguugguug ucacugacgu aaagauuuac gagagaucga ggguugguug  120


aaugucgguc ugggguuugu gggggguugg agguugguua uugguauaac ggaggucuau  180


gagagguuga ggguugguuc gcgauagaca ccgggucugc aggaggucgg aaguugguua  240


guugaacaga cuggguuuau ggggggucga gaguugguua uuuguuccga gg      292






SEQ ID NO: 45









<211> 292


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 3; target disruption structure comprised


    in SARS-CoV-2 5′UTR (SIII)


<400> 45
















ugcaguuaga uaagguuugc gagggauugg aaguugguug aaauguggaa ggggauuugc  60


gagagguuga aaguugguuu uuauuaaagg uaggaucuac aagggauuga agguugguua  120


cccaguagcu caggguuuac aggaggucgg agguugguuu uucuggauag aaaggucuau  180


aagagguuga ggguugguuu ggagauugua acggauuuau gagagaucga gaguugguua  240


aaaacaagga acggauuuac aagggguugg ggguugguua uacuuagcgg ug      292






SEQ ID NO: 46









<211> 282


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 1; target hybridization region:


    SARS-CoV-2 Target A


<400> 46
















ugcaguuaga uauggugcug ugucgucguc uauucuaagu uugggagauc cugcuggugg  60


uauuauguua cugucuguuc uaaauuugag gauaccuuua gcuggugucg uguuauuguc  120


uguuuuggac uuaggcucgg aaacgauugg uacuguguca cugucuguuu uaggcuugaa  180


gcugcuuccu cuugguguua ugucaucguc uauuuugaac uuggguccca cauagagugg  240


uaccaugucg uugucuguuc uggauuuaaa ccagggccaa ac           282









SEQ ID NO: 47









<211> 282


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 2; target hybridization region:


    SARS-CoV-2 Target A


<400> 47
















ugcaguuaga uaugguacug ugucacuguc uguucugaac uugagcguuc acgucucugg  60


ugcuauguug ucgucuauuc uaaacuuaag aacuagguau aguggugucg uguuaucguc  120


uauuuugggc uugggggcuc cccuuggugg uaccauguca ccgucuauuc ugaauuuaaa  180


ucucccauag ugugguaucg uguugccguc uauuuuagac uuggaccacc gucuguuugg  240


uacuauguug cugucuguuu ugaacuugag aucagauuaa gg             282






SEQ ID NO: 48









<211> 282


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 3; target hybridization region:


    SARS-CoV-2 Target A


<400> 48
















ugcaguuaga uaugguaccg ugucgucguc uauuuuggau uuaaaagauc cugcuggugg  60


uauuaugucg uuguuuguuc ugaguuuaaa gauaccuuua gcugguacca uguuaccguc  120


uguucuaagu uuaaacucgg aaacgauugg uauuguguug ucguuuguuc uagauuuaaa  180


gcugcuuccu cuugguaucg ugucgccguc uauucugagc uuaaauccca cauagagugg  240


uacuauguug uugucuauuu ugaguuuaaa ccagggccaa ac             282






SEQ ID NO: 49









<211> 282


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 4; target hybridization region:


    SARS-CoV-2 Target A


<400> 49
















ugcaguuaga uaugguaccg ugucgccguu uguucugagc uuaaaguucu ugcgcucugg  60


uaucauguug cuguuuauuc uaggcuuaaa ucggccgucu ggugguauug ugucguuguc  120


uguucugagu uuaaaucucu uucccggugg uacuguguug ucgucuauuc uggguuuaaa  180


acucgacccc ggugguacca ugucaccguc uguuuuagac uuaaaguuac aagucgcugg  240


uauuauguug cugucuauuc uagauuuaaa auucccccag cc             282






SEQ ID NO: 50









<211> 299


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 1; target hybridization region:


    SARS-CoV-2 Target C


<400> 50
















ugcaguuaga uauagaggcc uugguggcag guuucuuggu gaagugagua uaguagaggu  60


cuuaguagca gguuuuuuag ugauguaacc uauguagaag ccucagcagc agauuucuug  120


gugggggguc aaggguaggg gucuuggugg uagauuuuuu gguggcacuu gaggaguagg  180


aguuucggcg guggauuucu uagugggcua ggaaauuugg gagcuuuggu gguagguuuu  240


uuggugaggu gggaggguug ggggcuucgg uagcggauuu uuuaguggaa cugaaagcg  299






SEQ ID NO: 51









<211> 292


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 2; target hybridization region:


    SARS-CoV-2 Target C


<400> 51
















ugcaguuaga uauaggaguu ucggcggcgg guuuuuuggu gaaaguugaa uuuagaaguu  60


ucgguggcgg guuucuuagu gagaaauuca gauagaaguu uuggcagugg auuucuuggu  120


gaggaauggg uuuggaagcc uugguagugg auuuuuuagu ggccacccuu gguagaagcu  180


uuggugguag auuuuuuggu ggguaacuua auugggaguu uugguggcag guuuuuuagu  240


gauaggagac cguagggguu ucagcaguag auuucuuagu gggagacaga cu      292






SEQ ID NO: 52









<211> 292


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 3; target hybridization region:


    SARS-CoV-2 Target C


<400> 52
















ugcaguuaga uauaggaguc ucggcagcgg auuuuuuagu ggacaugacu uuuagaggcc  60


uugguagcgg auuucuuagu ggucuacagc gaugggaguu uuggcggugg guuuuuuggu  120


gaccucuaau guuggaggcu ucagcagcag guuuuuuagu gauaagagua gguaggggcc  180


uuaguagcag auuucuuggu gggauucgaa uuuagagguu uuaguaguag guuucuuagu  240


gaagggcuuu auuggggguu uuagcggcag auuuuuuggu ggauucgauc ug      292






SEQ ID NO: 53









<211> 292


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 4; target hybridization region:


    SARS-CoV-2 Target C


<400> 53
















ugcaguuaga uauggaaguu uuggcagugg guuucuuagu ggugggacuu gauagaaguc  60


uuagugguag guuucuuggu ggggcggagu guuggaggcu uugguagcgg guuuuuuagu  120


ggggcuaucu cgugggaguc uugguaguag auuucuuggu gaaggaugcg gguggaaguc  180


uuagcggcgg auuuuuuggu ggccaguuag uauggggguu uugguagcag guuuuuuggu  240


gauaguagac ucuggaggcu ucgguagcag auuuuuuagu gaguuauaaa gg      292






SEQ ID NO: 54









<211> 270


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 1; target hybridization region:


    SARS-CoV-2 Target D


<400> 54
















ugcaguuaga uaaaaccgua agcagccugu agaagguaga cgaguccaga cguacaaacc  60


guaggcagcu ugcagaagau agacgaagaa cgaguacuaa accgugggca guuugcgggg  120


gauagacgaa gcuuggagac uaaaccguaa guagucugug ggggauggac gaauuucugg  180


caauaaaccg uagguaguuu gcagagggua gacgagcucg uagcuagaaa ccgugaguag  240


ccuguagagg auggacgacu gagaccucaa                    270









SEQ ID NO: 55









<211> 270


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 2; target hybridization region:


    SARS-CoV-2 Target D


<400> 55
















ugcaguuaga uaaaaccgua ggcagccugu aggagguaga cgaguuuucu cacggaaacc  60


guggguagcu uguaggagau agacgaguug aggaccagaa accguaagug guuugcagga  120


gauggacgag uuugggcagu uaaaccguga gcagucugca ggggguagac gaauguucgg  180


agcaaaaccg ugaguaguuu guagaaggug gacgagagga gaguaggaaa ccguaagcag  240


ucuguagggg auggacgauu uauaaucagu                   270






SEQ ID NO: 56









<211> 270


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 3; target hybridization region:


    SARS-CoV-2 Target D


<400> 56
















ugcaguuaga uaaagccgug agcggcuugu ggaagauaga ugaaaggauu ggaaaagacc  60


guaagcagcu uguagaagau gggugacaag uaauggaaaa auuguaagug gucugcggaa  120


ggugggugga uaaggaacuu gagaucguag guaguuugua gaggguaggu gggacuaugg  180


ggaugaacug ugggcggucu gcaggaggug gacgagagag guacauaaga ccguaaguag  240


uuuguggggg augggcgaug uauugcacac                    270






SEQ ID NO: 57









<211> 270


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA 4; target hybridization region:


    SARS-CoV-2 Target D


<400> 57
















ugcaguuaga uaaagccgug agcggcuugu ggaagauaga ugaaaggauu ggaaaagacc  60


guaagcagcu uguagaagau gggugacaag uaauggaaaa auuguaagug gucugcggaa  120


ggugggugga uaaggaacuu gagaucguag guaguuugua gaggguaggu gggacuaugg  180


ggaugaacug ugggcggucu gcaggaggug gacgagagag guacauaaag ccguaaguag  240


cuuguagggg auagauggug uauugcacac                    270






SEQ ID NO: 58









<211> 27


<212> RNA


<213> Artificial Sequence


<220>


<223> SARS-CoV-2 target hybridization region - comprised in


    5′UTR SLII


<400> 58
















aaccaacuuu cgaucucuug uagaucu                    27






SEQ ID NO: 59









<211> 33


<212> RNA


<213> Artificial Sequence


<220>


<223> SARS-CoV-2 target hybridization region - Target A


<400> 59
















uuuaaguuua gaauagacgg ugacauggua cca                   33






SEQ ID NO: 60









<211> 30


<212> RNA


<213> Artificial Sequence


<220>


<223> SARS-CoV-2 target hybridization region - Target C


<400> 60
















ucacuaagaa aucugcugcu gaggcuucua                   30






SEQ ID NO: 61









<211> 31


<212> RNA


<213> Artificial Sequence


<220>


<223> SARS-CoV-2 target hybridization region - Target D


<400> 61
















ucgucuaucu ucugcaggcu gcuuacgguu u                   31






SEQ ID NO: 62









<211> 35


<212> RNA


<213> Artificial Sequence


<220>


<223> SARS-CoV-2 target hybridization region - comprised in


    3UTR Replication Site


<400> 62
















cagaaugaau ucucguaacu acauagcaca aguag                   35









SEQ ID NO: 63









<211> 289


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA against WNV and DENV (circWD1-in vitro)


<400> 63
















ugcaguuaga uaugcaguua gauaauauug ggaggugugu uuuuugccuu uuuccguaga  60


uccucgcgaa acuucuuggc cugguuuucu uuucaaaaga guccuuacgu auauuggagg  120


guguguuuuu cgcuuuuuuc cgucucggaa acgauaacuu ccuggcuuga uuuuuucuuc  180


aaaagcugcg uuaucuauau ugagaggcgu guuuuucguc uuuuuccguu ccaaccugga  240


gaacuuuuug gccugauuuu cucuucaaaa ccaggccgua ccgacaguc         289






SEQ ID NO: 64









<211> 307


<212> RNA


<213> Artificial Sequence


<220>


<223> Artificial circular RNA against HCV (circHCV-in vitro)


<400> 64
















ugcaguuaga uacccccugg ggcucugaug aggaaccucu cugggguccc cacagcgagu  60


cuccuugggg ccccuagaau gaaguucuuu gggguuucau agcacgguuc uccugggguu  120


uucauacgau ugucucuugg ggucuugcgu guuuacccuu uugggguccu gcuaaggggg  180


cuuucugggg ccuuucgaau aagucuuuuu ggggccucgu uuuaucacuc uucugggguu  240


cccagccuuu cccuucuugg ggcuccuccg accaugcccc uugggguucu acccuguaug  300


gacaguc                                  307






>SEQ ID 65









CCCGGTTCCGCACTACTTGTGCTGTGTAGTTACGAGGATTCGTTCTGACC


GTGTCTTCGCTATTTGTGCTATGTAGTTATGGGAGTTTATTCTGCTGCTC


GTGGACCTACTTGTGTTATGTAGTTGTGGGAGTTCGTTCTGGGGCAGTTC


GCTCTATTTGTGCTGTGTGGTTGCGGGGGTTCATTTTGATCCCGATAAGC


CTACTTGTGTTGTGTAGTTATGAGGGTTTGTTTTGACCATACGACAGCTA


CTTGTGCTATGTGGTTGTGAGGATTCATTCTGGACAGTC






>SEQ ID 66









CCCGGTTCCGCAAGATTTGTAGGAGGTCGAAAGTTGGTTTACAACGCTAC


TGGGGTCTACAGGAGGTTGAAGGTTGGTTGTCATAATGCAGTGGATCTAC


AGGGGGTCGAGAGTTGGTTGCCGCCATTCACAGGGTCTGCAGGGGGTCGG


AAGTTGGTTAGCAGATGTTTGAAGGTCTACGAGAGATTGGGGGTTGGTTA


GGCTCGGAAGAAAGATTTATAGGGGGTTGGAGGTTGGTTCCAGTCAGTTT


ACGGATCTACAAGGGGTTGGGAGTTGGTTGACAGTC






>SEQ ID 67









CCCGGTTCCGCAAGATTTGTAGGAGGTCGAAAGTTGGTTTACAACGCTAC


TGGGGTCTACAGGAGGTTGAAGGTTGGTTGTCATAATGCAGTGGATCTAC


AGGGGGTCGAGAGTTGGTTGCCGCCATTCACAGGGTCTGCGAGAGGTCGG


AAGTTGGTTAGCAGATGTTTGAAGGTCTACGAGAGATTGGGGGTTGGTTA


GGCTCGGAAGAAAGATTTATAGGGGGTTGGAGGTTGGTTCCAGTCAGTTT


ACGGATCTACAAGGGGTTGGGAGTTGGTTGACAGTC






>SEQ ID 68









CCCGGTTCCGCATGGTATTGTGTTACCGTCTATTTTAAGCTTAAGGCCCC


CAAACTAGTTGGTGCCGTGTTGCCGTCTGTTCTAAGCTTAAGCTCGATCC


CGTGTTTGGTGCTATGTCACCGTCTATTCTAGACTTAGGCCGTCACTATC


ATTTGGTGTTGTGTTATTGTCTATTTTGGACTTGAACATGATTACACAAC


TGGTATCGTGTTGTCGTCTGTTTTAGACTTAGGTCGCTTTTCTTTCCTGG


TACCATGTCGCCGTCTGTTTTGGGCTTGAGGACAGTC






>SEQ ID 69









CCCGGTTCCGCATGGTATTATGTTGCCGTCTATTCTGGACTTAAACATTC


CGTCATAGCTGGTGTCGTGTTATCGTCTATTCTAAACTTGAGGTCACAGT


CGAACCTGGTGCTATGTCGTTGTCTGTTCTGGGTTTAAGCTACTTTTTCA


TGATGGTACTGTGTTACTGTCTGTTCTAGACTTGGGCGAGCAGAGATCTT


TGGTACTATGTCACCGTCTATTTTAAGCTTGGGATTAAAGCACCTGGTGG


TACCGTGTCGCTGTCTATTTTGGGCTTAGAGACAGTC






>SEQ ID 70









CCCGGTTCCGCATGGTATTATGTTATTGTTTGTTCTGGGCTTAAAGAAGT


ACCATTAGGTGGTATCGTGTTGTTGTTTATTCTAGATTTAAAGACCTGGG


GGCATCTGGTACTGTGTTGTCGTCTATTTTAGACTTAAAGTGGGCGATCG


AGTTGGTACCATGTCATCGTTTATTTTAGGCTTAAACACAGATTCGCCTC


TGGTACTATGTCGCCGTTTATTTTGGGTTTAAATATGCGTGGAGCAATGG


TATCATGTTACCGTCTATTTTGAACTTAAAGACAGTC






>SEQ ID 71









CCCGGTTCCGCATAGGGGCCTTGGCAGTAGGTTTTTTAGTGGAGTAGCCA


TTTAGGGGTTTCAGTGGTAGATTTCTTAGTGGAACCATATTGTAGGAGTC


TCGGTAGTGGATTTCTTGGTGAATCGCTTGGCTGGAAGCCTTAGTAGCAG


GTTTTTTGGTGGCAGCTAAGCATAGAGGCCTCGGTAGTAGATTTTTTAGT


GATCGTAGAGGATAGGGGCTTTGGCAGCAGATTTTTTGGTGGGAGATTGC


CTTAGGAGCCTCGGCAGCAGGTTTCTTGGTGAGACAGTC






>SEQ ID 72









CCCGGTTCCGCATAGGAGCCTTAGCGGTAGGTTTCTTAGTGAACTATTAT


TTTAGAAGCTTTAGTAGCGGATTTTTTGGTGGTTTTTATAACTGGAGGTT


TCAGTGGCAGGTTTTTTAGTGGAGGAGTGAGCTGGAAGTCTCGGTAGCAG


GTTTTTTGGTGATGGCATTGACTGGAAGTCTTGGCGGTAGATTTCTTGGT


GAGTCTCACCGATGGAAGTTTCAGCGGCGGGTTTCTTGGTGGTGAATGAA


CTTAGGGGCTTCAGCGGCGGATTTCTTAGTGGGACAGTC






SEQ ID NO.:73









5′-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3′






SEQ ID NO.:74









5′-GACCCCAAAATCAGCGAAAT-3′






SEQ ID NO.:75









5′-TCTGGTTACTGCCAGTTGAATCTG-3






Target 1: IRES 1 (Domain II)

SEQ ID NO.: 76,










CUCCGCCAUGAAUCACUCCCCUGUGAGGAACUACUGUCUUCACGCAGAAA



GCGCCUAGCCAUGGCGUUAGUAUGAGUGUCGUACAGCCUCCAGGCCC






Target 2: IRES 2 (Domain IV)

SEQ ID NO. : 77










UCUCGUAGACCGUGCACCAUGAGCACAAAUCCU







Target 3: CDS1 (cHP)

SEQ ID NO. : 78;










CCAAAAGAAACACCAACCGUCGCCCAGAAGACGUUAAGUUCCCGGGCGGC



GG






Target 4: CDS2 (SL427)

SEQ ID NO.: 79;









GAUCGUUGGCGGAGUAUACUUGUUGCCGCGCAGGGGCCCCAGGUUGGGUG


UGCGCACGACAAGGAAAACUUCGGAGCGGUC






CHIKV
Target 1: 5′UTR

SEQ ID NO.: 80,









AUGGCUGCGUGAGACACACGUAGCCUACCAGUUUCUUACUGCUCUACUCU


GCAAAGCAAGAGAUUAAUAA






Target 2: Repetitive Sequence Element:

SEQ ID NO.: 81,










AGCAAAUAAUCUAUAGAUCAAAGGGCUACGCAACCCCUGAA







Target 3: Recoding Element:

SEQ ID NO.: 82,










UGUCUGAGACUCUUACCAUGCUGCUGUAAAACGUUGGCUUUUUUAGCCGU AAUGAGCGUCGGUGCCCAC







WNV
Target 1: SLII

SEQ ID NO.: 83,










UUUUGAGGAGAAAGUCAGGCCGGGAAGUUCCCGCCACCGGAAGUUGAGUA



GACGGUGCUGCCUGCGA






SARS-CoV-2
Target 1: Replication Site Fully Conserved in Pangolin and RatG13

SEQ ID NO.: 84,










CAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUU







Target 3: Target A

SEQ ID NO.: 85,









CUUUAAGUUUAGAAUAGACGGUGACAUGGUACCACAUAUAUCACGUCAAC


GUCUUA






Target 4: Target C

SEQ ID NO.: 86










UCACUAAGAAAUCUGCUGCUGAGGCUUCUAAGAAGCCCUCGGCAAA







Target 5: Target D

SEQ ID NO.: 87,










UCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCGAU







>SEQ ID 88









CCCGGTTCCGCACTACTTGTGTTATGTAGTTACGAGGATTCGTTTTGCTC


TTTTCTCCCTTATTTGTGTTGTGTAGTTATGGGAGTTTGTTCTGGCGTGG


TACGTCTTACTTGTGTTGTGTGGTTATGAGAGTTCATTCTGTATCACCAC


TAGCTGCTTGTGCTGTGTAGTTATGAGGATTTATTCTGGAATACCGTTCC


CTGTTTGTGCTGTGTGGTTATGGGAGTTCGTTCTGTGAGGTGTTCCACTG


CTTGTGCTATGTGGTTACGAGAATTTGTTTTGGACAGTC






>SEQ ID 89









CCCGGTTCCGCACTACTTGTGCTGTGTAGTTACGAGGATTCGTTCTGACC


GTGTCTTCGCTATTTGTGCTATGTAGTTATGGGAGTTTATTCTGCAACCA


GTGGACCTACTTGTGTTATGTAGTTGTGGGAGTTCGTTCTGGGGCAGTTC


GCTCTATTTGTGCTGTGTGGTTGCGGGGGTTCATTTTGATCCCGATAAGC


CTACTTGTGTTGTGTAGTTATGAGGGTTTGTTTTGACCATACGACAGCTA


CTTGTGCTATGTGGTTGTGAGGATTCATTCTGGACAGTC






EXAMPLES
Example 1

We have designed and tested four circRNAs (circ_hcv_ires1 (SEQ ID NO.: 2), circ_hcv_cds1 (SEQ ID NO.: 4), circ_hcv_cds2 (SEQ ID NO.: 6) y circ_hcv_combo1 (SEQ ID NO.: 5) against two different regions of HCV genome (see SEQ ID NO.: 1) as previously disclosed in the section Production of circRNAs. Circ_hcv_ires1 contains 7 hybridization sites of length 33 nucleotides that target a sequence in the IRES element. Circ_hcv_cds1 contains 8 hybridization sites of length 28 nucleotides that target a sequence in the coding region. Circ_hcv_cds2 contains 12 hybridization sites that target a sequence in the coding region. Circ_hcv_combo1 contains 3 hybridization sites per target region (IRES1 (SEQ ID NO.: 25), IRES2 (SEQ ID NO.: 26) and cHP (CDS1) (SEQ ID NO.: 27)). The target regions in the HCV genome are depicted in FIG. 6 and SEQ ID NO.: 1. Both IRES1 (domain IV) and IRES2 (domain V) target disruption structures were considered SRVVLC in C Romero-López et al. 2007 (Cell Mol Life Sci . 2007 Nov;64(22):2994-3006. doi: 10.1007/s00018-007-7345-y) https://pubmed.ncbi.nlm.nih.gov/17938858/. Both CDS1 (cHP) and CDS2 (SL427) target disruption structures were considered SRVVLC in Pirakitikulr et al. 2016 (Molecular Cell 62, 111-120 Apr. 7, 2016 a2016 Elsevier Inc. http://dx.doi.org/10.1016/j.molcel.2016.01.024).


Cell Cultures and Transfection

We transfected each circRNA in Huh7 cells and 24h post-transfection we infected the cells with an HCV derivative that expresses luciferase. After 48 hours post-infection, we measured the luciferase levels and compared the values to a control (mock transfected). We carried out five biological replicates for each condition. All circRNAs tested inhibit HCV infection by a significant amount. As shown in FIG. 7 all circRNAs designed are capable of lowering the infection with different efficiencies that range between 30% and 70% with respect to the control.


Example 2

We have designed and tested three circRNAs (circ_dv_3utr (SEQ ID NO.: 8), circ_dv_cHP_v1 (SEQ ID NO.: 9) and circ_dv_cHP_v2 (SEQ ID NO.: 10)) against two different regions of DENV (Dengue) genome (SEQ ID NO.: 7) as previously disclosed in the section Production of circRNAs. Plasmid to generate DENV (pFK-DVs-R2A) carrying the Renilla luciferase reporter gene has been previously described (Scaturro, P. et al. Characterization of the mode of action of a potent dengue virus capsid inhibitor. J. Virol. 88, 11540-55 (2014)). All three circRNAs contain 7 hybridization regions that target the corresponding regions in the DENV genome (See FIG. 8 and SEQ ID NO.: 7). The target disruption structure corresponding to circ_dv_3utr (sHP) was considered SRVVLC in Huber et al. 2019 (Nature Communications volume 10, Article number: 1408 (2019)), and the target disruption structure cHP was considered SRVVLC in Fernández-Sanlés et al. 2017 (Front Microbiol. 2017; 8: 546,doi:10.3389/fmicb.2017.00546).


Cell Cultures and Transfection

The human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1 105 HEK293 cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the cirRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with Dengue Virus for 4 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).


Results are shown in FIG. 9 and depict the significant inhibition of DENV infection with respect to the control (empty plasmid).


Example 3

We have designed and tested five circRNAs (chikv_5utr1 (SEQ ID NO.: 12), chikv_5utr2 (SEQ ID NO.: 13), chikv_RSE1 (SEQ ID NO.: 14), chikv_RSE2 (SEQ ID NO.: 15) and chikv_RE (SEQ ID NO.: 39) against three different regions of CHIKV (Chikungunya) genome (SEQ ID NO.: 11) as previously disclosed in the section Production of circRNAs. The plasmid to generate CHIKV carrying the reporter gene of Gaussian luciferase (kindly provided by Dr. Merits, University of Tartu, Estonia) is based directly on the viral sequence isolated from a human patient from La Reunion (isolate LR2006_OPY1 (DQ443544). All five circRNAs contain 6 hybridization regions that target the corresponding regions in the CHIKV genome (SEQ ID NO.: 11). Both the target disruption structure en the 5′ UTR of CHIKV and the target disruption structure “Repetitive Sequence Structure” were considered SRVVLC in Hossain Khan et al., 2002 (Journal of General Virology (2002), 83, 3075-3084). The Recoding Element, third target disruption structure for CHIKV, was considered SRVVLC in A. Kendra et al., 2018 (J. Biol. Chem. (2018) 293(45) 17536 -17545).


Cell Cultures and Transfection

The human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1 105 HEK293 cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the cirRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with Chikungunya Virus for 1 h at 37° C. Finally, the virus containing media was replaced with fresh media. Sixteen hours post infection, Luciferase activity was assayed. The supernatant of the cells was collected and inactivated with UV for 10 minutes. 4 µl of the supernatant were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).


Results are shown in FIG. 10 and depict the significant inhibition of CHIKV infection with respect to the control (empty plasmid).


Example 4

We have designed and tested three circRNA (DENV1 cHP_ HCV CDS2_1 (SEQ ID NO.: 17), DENV cHP_ HCV CDS2_2 (circ_dv_cHP_v1_circ_hcv_cds2_2, SEQ ID NO.: 32), and (DENV1 cHP_ HCV CDS2_T (SEQ ID NO.: 16) against one region of DENV (Dengue) genome (SEQ ID NO.: 7) and one region of HCV genome (SEQ ID NO.: 1) as previously disclosed in the section Production of circRNAs. Plasmid to generate HCV (pFK-Luc-Jc1) carrying the Firefly luciferase reporter gene has been previously described (Wakita T et al., Production of infectious hepatitis C virus in tissue culture from a cloned viral genome, Nat Med, 2005;11:791-796). Plasmid to generate DENV (pFK-DVs-R2A) carrying the Renilla luciferase reporter gene has been previously described (Scaturro, P. et al., Characterization of the mode of action of a potent dengue virus capsid inhibitor, J. Virol. 88, 11540-55 (2014)).


The first 2 circRNAs contain 6 hybridization regions that target the corresponding regions in the DENV genome and the HCV genome, and the last one contains 7 against DENV and 12 against HCV.


Cell Cultures and Transfection

The human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1 105 HEK293 cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the cirRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with Dengue Virus for 4 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).


The human hepatocarcinoma cell line Huh7/Scr was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 2.5 104 Huh7/Scr cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the cirRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions.


After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with the different viruses for 4 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Passive lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 50 µl of the lysates were mixed with 25 µl of Luciferase Assay Reagent (Promega) and incubated 5 minutes at room temperature. Afterwards the luciferase activity was measured in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).


Results for each circRNA against both DENV and HCV along with the corresponding positive and negative controls from examples 1 and 2 are shown in FIGS. 11, 12, 1314 and 24. Inhibition is shown for all circRNAs in both viral infections, demonstrating the broadspectrum capabilities of the design circRNAs.


Example 5

We have designed and tested two circRNAs (circ_wnv_slll_1 (SEQ ID NO.: 24), circ_wnv_slll_2 (SEQ ID NO.: 19)) against one region of WNV (West Nile Virus) genome (SEQ ID NO.: 20) as previously disclosed in the section Production of circRNAs. Plasmid to generate WNV carrying the Nanoluc luciferase reporter gene was kindly provided by Dr. Merits, University of Tartu, Estonia. Both circRNAs contain 7 hybridization regions that target the corresponding region in the WNV genome. The target disruption structure SLII was considered SRVVLC in Fernández-Sanlés et al., 2017 (Front Microbiol. 2017; 8: 546 doi: 10.3389/fmicb.2017.00546).


Cell Cultures and Transfection

The human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1 105 HEK293 cells/well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the circRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with WNV for 4 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).


Results are shown in FIG. 15 and depict the significant inhibition of WNV infection with respect to the control (empty plasmid).


Example 6

We have designed and tested three circRNA (dchp_wslll_A (SEQ ID NO.: 21), dchp_wslll_B (SEQ ID NO.: 22) and dchp_wslll_C (SEQ ID NO.: 23) against one region of DENV (Dengue) genome (SEQ ID NO: 7) and one region of WNV genome (SEQ ID NO.: 20) as previously disclosed in the section Production of circRNAs. Plasmid to generate DENV (pFK-DVs-R2A) carrying the Renilla luciferase reporter gene has been previously described (Scaturro, P. et al., Characterization of the mode of action of a potent dengue virus capsid inhibitor, J. Virol. 88, 11540-55 (2014)). Plasmid to generate WNV carrying the Nanoluc luciferase reporter gene was kindly provided by Dr. Merits, University of Tartu, Estonia. The circRNAs contain 6 hybridization regions that target the corresponding regions in the DENV genome and the WNV genome.


Cell Cultures and Transfection

The human embryonic kidney cell line HEK293 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1x105 HEK293 cells/well and were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the circRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with Dengue Virus or West Nile Virus for 4h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).


Results for each circRNA against both DENV and WNV along with the corresponding positive and negative controls from examples 2 and 5 are shown in FIGS. 16 and 17. Inhibition is shown for the circRNAs in both viral infections, demonstrating the broadspectrum capabilities of the designed circRNAs.


Example 7

We tested whether circ_hcv_cds2 (SEQ ID NO.: 6) may inhibit infections already established. For this, Huh7/Scr cells were infected with HCVJc1-luc and 48 hours later transfected with circ_hcv_cds2 (SEQ ID NO.: 6). Luciferase values were measured 24 hours post-transfection. Importantly, circ_hcv_cds2 inhibited infectivity with similar efficiency as when cells were expressing the circ_hcv_cds2 before infection (FIG. 18).


Example 8

Next, we examine whether the circ_hcv_cds2 (SEQ ID NO.: 6) is indeed inhibiting the function described for the target sequence, viral RNA replication. For this, we used HCV RNA replicons that harbour a luciferase reporter gene but not the viral structural genes required for encapsidation. Thus, these replicons allow efficient translation and replication of the viral RNA genome but not virion production. Huh7/Scr cells were transfected with circ_hcv_cds2 (SEQ ID NO.: 6) or the corresponding empty plasmid and the next day, transfected with the HCV replicon. Luciferase values were measured at 4 hours and 48 hours post-HCV replicon transfection. These times were selected because already established kinetics prove that luciferase production derived at 4 hours is solely from HCV RNA translation and at 48 hours from both translation and replication. Indeed, a decrease in viral infectivity was observed at 48 but not at 4 hours post-transfection (FIG. 19) indicating that circ_hcv_cds2 impairs viral RNA replication.


Example 9

Circ_dv_3utr (SEQ ID NO.: 8) and circ_dv_cHP_v1 (SEQ ID NO.: 9), designed to target structures within the DENV RNA genome directing RNA replication, were tested to see if they inhibit DENV RNA replication following the same procedure as in Example 8. The results show that circ_dv_3utr and circ_dv_cHP_v1 inhibit luciferase expression levels at 48 hours when the RNA genome is translated and replicated but not at 8 hours when is solely translated (FIG. 20).


Example 10

The human embryonic kidney cell line HEK293 and the Hepatocarcinoma cell line Huh7 were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 1x105 HEK293 cells/well or 4x104 Huh7/cells and were seeded in 24-well plates the day before transfection. 100 nanograms of circular RNAs against WNV-DENV (circWD1-in vitro SEQ ID NO.: 63) or circular RNA against HCV (circHCV-in vitro SEQ ID NO.: 64) were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. HEK293 cells were inoculated with Dengue Virus or West Nile Virus for 4 h at 37° C. In parallel, Huh7 cells were inoculated with Hepatitis C virus for 4h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, Luciferase activity was assayed. Cells were washed with 1X PBS, lysed in 150 µl of Renilla lysis buffer (HEK293) or 150 µl of Passive lysis buffer and frozen. Upon thawing, lysates were resuspended by pipetting. In the case of DENV and WNV, 4 µl of the lysates were mixed with 20 µl of Renila Luciferase Assay Buffer and 1/200 of substrate from the Renilla Luciferase assay system (Promega) and measured immediately in a luminometer for 2 s. In the case of HCV, 50 µl of the lysates were mixed with 25 µl of Luciferase Assay Reagent (LARII) for 5 minutes and measured immediately in a luminometer for 2 s. Mean relative light units (RLU) were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid) in FIG. 26.


Example 11

We have designed and tested twelve circRNA (circ_SARS_tA_4 (SEQ ID NO.: 49), circ_SARS_tA_5 (SEQ ID NO.: 68), circ_SARS_tA_6 (SEQ ID NO.: 69), circ_SARS_tA_7 (SEQ ID NO.: 70), circ_SARS_tC_3 (SEQ ID NO.: 52), circ_SARS_tC_5 (SEQ ID NO.: 71), circ_SARS_tC_6 (SEQ ID NO.: 72), circ_SARS_3utr_6 (SEQ ID NO.:63), circ_SARS_3utr_7 (SEQ ID NO.: 89), circ_SARS_3utr_8 (SEQ ID NO.:65), circ_SARS_5utr_4 (SEQ ID NO.: 66), circ_SARS_5utr_5 (SEQ ID NO.: 67) against four regions of SARS-CoV-2 genome (SEQ ID NO: 58; SEQ ID NO: 59; SEQ ID NO: 60; SEQ ID NO: 62) as previously disclosed in the section Production of circRNAs. SARS-CoV-2 strain hCoV-19/Spain/VH000001133/2020 (EPI_ISL_418860) was kindly provided by Miguel Chillon, Universitat Autonoma de Barcelona. The designed circRNAs contain between 6 and 7 hybridization regions that target the corresponding regions in the SARS-CoV-2 genome. The target disruption structure Replication Site was considered SRVVLC in J. Goebel et al., 2004 (American Society for Microbiology. Journal of VirologyVolume 78, Issue 14, Pages 7846-7851https://doi.org/10.1128/JVI.78.14.7846-7851.2004). The target disruption structure SL-2 was considered SRVVLC in Chen et al., 2010 (Virology 401 (2010) 29-41 doi: 10.1016/j.virol.2010.02.007). The rest of the target disruption structures (A,C and D) were considered to be viral conserved structures, following the RNAz approach mentioned above, in Rangan et al., 2020 (doi: https://doi.org/10.1101/2020.03.27.012906).


Example 12. Cell Cultures and Transfection

The green monkey kidney epithelial cell line VERO E6 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 6x104 VERO E6 cells per well were seeded in 24-well plates the day before transfection. 2 micrograms of each plasmid containing the circRNAs or the empty plasmid were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with SARS-CoV-2 for 1 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, supernatant was collected and inactivated and viral RNA was extracted using Quick-RNA Viral Kit (Zymo Research, Irvine, USA). SARS-CoV-2 RNA levels were measured by qPCR using qScript XLT One-Step RT-qPCR ToughMix, ROX (Quanta Biosciences, Berverly, USA), using the specific probe 2019-nCoV_N1-P, 5′-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3′ (SEQ ID NO.:73); as well as primers 2019-nCoV_N1-F, 5′-GACCCCAAAATCAGCGAAAT-3′ (SEQ ID NO.: 74); and 2019-nCoV_N1-R, 5′-TCTGGTTACTGCCAGTTGAATCTG-3′ (SEQ ID NO.: 75) (Biomers, Ulm, Germany). Mean relative RNA levels were plotted as percentage relative to control infections (cells transfected with the circoVIR plasmid).


Results for each circRNA against SARS-CoV-2 are shown in FIG. 33. Inhibition is shown for the circRNAs in SARS-CoV-2 viral infection, demonstrating the antiviral effect of the designed circRNAs.


Example 13

The green monkey kidney epithelial cell line VERO E6 was maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine serum (FBS) and 10% non-essential amino acids. Cells were grown in an incubator with 5% CO2 at 37° C. 6x104 VERO E6 cells per well were seeded in 24-well plates the day before transfection. 100 nanograms of circular RNAs against SARS-CoV-2 (circSARS-in vitro SEQ ID NO.: 70) or circular RNA against WNV-DENV (circWD1-in vitro SEQ ID NO.: 21) were transfected using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. After overnight incubation, DMEM medium was removed and cells were washed with 1X PBS. Cells were inoculated with SARS-CoV-2 for 1 h at 37° C. Finally, the virus containing media was replaced with fresh media. Forty-eight hours post infection, supernatant was collected and inactivated and viral RNA was extracted using Quick-RNA Viral Kit (Zymo Research, Irvine, USA). SARS-CoV-2 RNA levels were measured by qPCR using qScript XLT One-Step RT-qPCR ToughMix, ROX (Quanta Biosciences, Berverly, USA), using the specific probe 2019-nCoV_N1-P, 5′-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3′ (SEQ ID NO.:73); as well as primers 2019-nCoV_N1-F, 5′-GACCCCAAAATCAGCGAAAT-3′ (SEQ ID NO.: 74); and 2019-nCoV_N1-R, 5′-TCTGGTTACTGCCAGTTGAATCTG-3′ (SEQ ID NO.: 75) (Biomers, Ulm, Germany). Mean relative RNA levels were plotted as percentage relative to control infections (cells transfected with an irrelevant circRNA) in FIG. 34.


Example 14

In this example we present some of the input files for RNAiFold to both check whether a target disruption structure is indeed possible to disrupt by hybridization (from which immediately follows the design of the circRNA with the hybridization region/s to disrupt it).


For HCV target disruption structure cHP and corresponding target hybridization region (SEQ ID NO 27, highlighted in bold):









#RNAscdstr((((((((((((((((((((((((((((&)))))))))))


))))))))))))))))),,,,,,,,,,,,,,,,,,,,,,,,#RNAseqco


nNNNNNNNNNNNNNNNNNNNNNNNNNNNN&CCAAAAGAAACACCAACCGU


CGCCCAGAAGACGUUAAGUUCCCGGGCGGCGG






The input “((((((((((((((((((((((((((((&)))))))))))))))))))))))))))),,,,,,,,,,,,,,,,,,,,,,,,” means that the software should look for a nucleotide sequence that is k nucleotides in length, wherein the nucleotides located at positions corresponding to a open bracket “(” should be base paired to the nucleotides located at positions corresponding to a closed bracket “)” in the Minimum Free Energy structure. The comas “,” mean that the nucleotides in the corresponding positions can be base paired or not in the Minimum Free Energy Structure. The & symbol separates both strands. Note that the base paired nucleotides on the second strand (target disruption structure) correspond to the target hybridization region.


Further, the input:









“NNNNNNNNNNNNNNNNNNNNNNNNNNNN&CCAAAAGAAACACCAACCGU”


CGCCCAGAAGACGUUAAGUUCCCGGGCGGCGG            "






means fixes the nucleotides that are available for selection, where N means any nucleotide (A,C,G or U). In this case, the nucleotides corresponding to the target disruption structure are fixed and all the nucleotides corresponding to the hybridization region are unfixed (N- any nucleotide). The results are shown herein below:









UCUGGGCGACGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UUUGGGCGACGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UCUGGGUGACGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UUUGGGUGACGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UCUGGGCGGCGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UUUGGGCGGCGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UCUGGGUGGCGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UUUGGGUGGCGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UCUGGGCGAUGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG













UUUGGGCGAUGGUUGGUGUUUCUUUUGG&CCAAAAGAAACACCAACCGUC


GCCCAGAAGACGUUAAGUUCCCGGGCGGCGG






For CHIKV target disruption structure RSE and corresponding target hybridization region (SEQ ID NO 35):









#RNAscdstr(((((((((((((((((((((((((((((((((&))))))


))))))))))))))))))))))))))).#RNAseqconNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNN&AGCAAAUAAUCUAUAGAUCAAAGGGCUA CGCAACCCCUGAA






The results are shown herein below:









UUGCGUGGCCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGUGUGGCCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGCGUAGCCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGUGUAGCCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGCGUGGUCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGUGUGGUCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGCGUAGUCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGUGUAGUCCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGCGUAGCUCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA













UUGUGUAGCUCUUUGGUCUGUAGGUUGUUUGCU&AGCAAAUAAUCUAUAG


AUCAAAGGGCUACGCAACCCCUGAA






For WNV target disruption structure SLII and corresponding target hybridization region (SEQ ID NO 37):










#RNAscdstr((((((((((((((((((((((((((((&))))))))))) ))))))))))))))))),,,,,,,,,,,,,,,,,,,,,,,,#RNAseqco n
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN&UUUUGAGGAGAAAGU CAGGCCGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGC GA







The results are shown herein below:










GAUUUUCUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















AAUUUUCUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















GAUUUUUUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















AAUUUUUUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















GAUUUUCUGGCUUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















AAUUUUCUGGCUUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















GAUUUUUUGGCUUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















AAUUUUUUGGCUUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















GACUUUCUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA















AACUUUCUGGCCUGGCUUUUUCCUCAAGA&UUUUGAGGAGAAAGUCAGGC CGGGAAGUUCCCGCCACCGGAAGUUGAGUAGACGGUGCUGCCUGCGA







For SARS-Cov2 target disruption structure Replication Site and corresponding target hybridization region (SEQ ID NO 62):










#RNAscdstr(((((((((((((((((((((((((((((((((((&)))) ))))))))))))))))))))))))))))))).............#RNAse qconNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN&CAGAAUGAAUUC UCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUU







The results are shown herein below:










CUACUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















UUACUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















CUGCUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















UUGCUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















CUAUUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















UUAUUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















CUGUUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















UUGUUUGUGCUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















CUGCUUGUGUUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU















UUGCUUGUGUUAUGUAGUUACGGGAGUUCGUUCUG&CAGAAUGAAUUCUC GUAACUACAUAGCACAAGUAGAUGUAGUUAACUU







In all cases, including those not depicted above, RNAiFold return multiple solutions, i.e., sequences corresponding to potential hybridization regions that shall disrupt by hybridization the corresponding target disruption structures.


Lasltly, we present herein the well-established dot bracket notation used in the present invention to obtain the target hybridization region (highlighted herein in bold) for each virus:


HCV
Target 1: IRES 1 (Domain II)

SEQ ID NO.: 76, FIG. 1a in Romero et al. 2007 (Cell Mol Life Sci. 2007 Nov;64(22):2994-3006. doi: 10.1007/s00018-007-7345-y.):










CUCCGCCAUGAAUCACUCCCCUGUGAGGAACUACUGUCUUCACGCAGAAA



GCGCCUAGCCAUGGCGUUAGUAUGAGUGUCGUACAGCCUCCAGGCCC...


................((((.((((.....(((((..(((.((...((((


((.......))))))....)).)))..).))))))))))))...






Target 2: IRES 2 (Domain IV)

SEQ ID NO. : 77, FIG. 1a in Romero et al. (Cell Mol Life Sci. 2007 Nov;64(22):2994-3006. doi: 10.1007/s00018-007-7345-y.):










UCUCGUAGACCGUGCACCAUGAGCACAAAUCCU...........((((..



.....)))).......






Target 3: CDS1 (cHP)

SEQ ID NO. : 78; FIG. S1 B in Pirakitikulr et al.2016 (Pirakitikulr et al., 2016, Molecular Cell 62, 111-120 Apr. 7, 2016 Elsevier Inc):









   CCAAAAGAAACACCAACCGUCGCCCAGAAGACGUUAAGUUCCCGGGC


GGCGG   ................(((((((((.(..(((.....)))..


))))))))))






Target 4: CDS2 (SL427)

SEQ ID NO.: 79; FIG. 2a in Pirakitikulr et al.2016 (Pirakitikulr et al., 2016, Molecular Cell 62, 111-120 Apr. 7, 2016 Elsevier Inc).









GAUCGUUGGCGGAGUAUACUUGUUGCCGCGCAGGGGCCCCAGGUUGGGUG


UGCGCACGACAAGGAAAACUUCGGAGCGGUC(((((((..((((((...(


((((((..(((((...((((......)))).))))).)))))))....))


)))).)))))))






DNV
Target 1 : sHP

SEQ ID NO.: 29; FIG. 1c in Huber et al., 2019 (Huber et al. Nature Communications volume 10, Article number: 1408, 2019)










AACAGCAUAUUGACGCUGGGAAAGACCAGAGA...............(((



(......))))...






Target 2: cHP

SEQ ID NO.: 30; FIG. 2B in Sanlés et al. 2017 (Sanlés et al. 2017. Front Microbiol.; 8: 546.):










ACGGAAAAAGGCGAAAAACACGCCUUUCAAUAU......(((((.(....



....))))))......






CHIKV
Target 1: 5′UTR

SEQ ID NO.: 80, FIG. 3A in Khan et al. 2002 (Khan et al. Journal Of General Virology Volume 83, Issue 12):









AUGGCUGCGUGAGACACACGUAGCCUACCAGUUUCUUACUGCUCUACUCU


GCAAAGCAAGAGAUUAAUAA..(((((((((.....)))))))))....(


(((((((.((((........))..)).)))))))).....






Target 2: Repetitive Sequence Element

SEQ ID NO.: 81, FIG. 4B in Khan et al. 2002 (Khan et al. Journal Of General Virology Volume 83, Issue 12):










AGCAAAUAAUCUAUAGAUCAAAGGGCUACGCAACCCCUGAA.........



........(((..(((........))).))).






Target 3: Recoding Element

SEQ ID NO.: 82, FIG. 4D in Kendra et al. 2018 (Kendra et al. 2018 Protein Synthesis And Degradation| Volume 293, Issue 45, P17536-17545, Nov. 09, 2018):










UGUCUGAGACUCUUACCAUGCUGCUGUAAAACGUUGGCUUUUUUAGCCGU AAUGAGCGUCGGUGCCCAC.((((((..(((((((..(((....)))...



....((((.....)))))))).)))..)))).))....






WNV
Target 1: SLII

SEQ ID NO.: 83, FIG. 3 in Sanlés et al. 2017 (Sanlés et al. 2017. Front Microbiol.; 8: 546.):










UUUUGAGGAGAAAGUCAGGCCGGGAAGUUCCCGCCACCGGAAGUUGAGUA



GACGGUGCUGCCUGCGA.............(.((((((((((...)))))


.(((((.............)))))..))))))..






SARS-CoV-2
Target 1: Replication Site Fully Conserved in Pangolin and RatG13

SEQ ID NO.: 84, FIG. 1 in Goebel et al. 2004 (Goebel et al.. Journal Of Virology, July 2004, p. 7846-7851):










CAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUU..



.............(((((((((.((....))..)))))))))....






Target 2: SL-2

SEQ ID NO.: 58, FIG. 3b in Cheng Chen et al. 2010 (Cheng chen et al. Virology, Volume 401, Issue 1, 25 May 2010, Pages 29-41)










AACCAACUUUCGAUCUCUUGUAGAUCU ...........(((((.....)



)))).






Target 3: Target A

SEQ ID NO.: 85, FIG. 2 in Rangan et al. 2020 (Rangan et al. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.27.012906):









CUUUAAGUUUAGAAUAGACGGUGACAUGGUACCACAUAUAUCACGUCAAC


GUCUUA...............(((((.((((.(((((.......))))).


)))).)))))..






Target 4: Target C

SEQ ID NO.: 86, FIG. 2 in Rangan et al. 2020 (Rangan et al. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.27.012906):










UCACUAAGAAAUCUGCUGCUGAGGCUUCUAAGAAGCCCUCGGCAAA....



...........((((((((((...)))).))))))))..






Target 5: Target D

SEQ ID NO.: 87, FIG. 2 in Rangan et al. 2020 (Rangan et al. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.27.012906):










UCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCGAU.



................(((((.((((......)))))..)))))...






Further Items of the Invention

The present invention also comprises the following items:


1. An artificial circular RNA between 200 and 600 nucleotides having 6 to 20 hybridization regions of sizes between 10 and 50 nucleotides against one or more structured regions of one or more RNA viral genomes, wherein such hybridization regions have sequences that are different among each other, wherein the one or more structured regions are structured regions vital for the viral life cycle (SRVVLC) preceded by a single stranded region, and wherein the artificial circular RNA is capable of disrupting the structure of the one or more SRVVLC, rendering the virus less infective.


2. The artificial circular RNA of item 1, wherein the hybridization regions are:

  • a) separated by non-hybridization regions of sizes up to 20 nucleotides; or
  • b) are not separated by non-hybridization regions; or
  • c) are overlapping.


3. The artificial circular RNA according to any of the preceding items, wherein the target of the hybridization regions is a SRVVLC of the IRES element of the viral genome.


4. The artificial circular RNA according to any of the items 1 o 2, wherein the target of the hybridization regions is a SRVVLC of the 5′UTR of the viral genome.


5. The artificial circular RNA according to any of the items 1 or 2, wherein the target of the hybridization regions is a SRVVLC of the CDS of the viral genome.


6. The artificial circular RNA according to items 1 or 2, wherein the target of the hybridization regions is a SRVVLC of the 3′UTR of the viral genome.


7. The artificial circular RNA, according to any of items 1 to 6, wherein the target of the hybridization regions is a combination of two or more of the IRES element, the region of the 5′UTR, the region of the CDS or the region of the 3′UTR of the viral genome.


8. The artificial circular RNA according to item 3 or 7, wherein said viral genome is selected from HCV, HAV, Poliovirus, Coxsackie B virus and rhinovirus (common cold).


9. The artificial circular RNA according to any of items 4 to 7, wherein said viral genome is selected from HCV, Dengue, Zika, Chikungunya, West Nile and Yellow Fever virus.


10. The artificial circular RNA according to any of items 1 to 9, wherein said circular RNA has a broad spectrum activity against two or more RNA viral genome.


11. A composition comprising the artificial circular RNA according to any of the previous items.


12. A kit comprising the artificial circular RNA according to any of items 1 to 10 or the composition according to item 11, and instructions for using said circular RNA or composition.


13. The artificial circular RNA according to any of items 1 to 10, or the composition according to item 11 or the kit according to items 12, wherein said circular RNA comprises the sequence selected from SEQ ID NO: 2, 4, 5, 6 (for HCV); 8, 9, 10 (for Dengue virus); 12, 13, 14, 15, 39 (for Chikungunya virus); 16 and 17 (Broadspectrum activity for both HCV and Dengue Virus); 24 and 19 (for West Nile Virus); 21, 22 and 23 (Broad spectrum activity for both Dengue and West Nile Viruses); 32 (Broad spectrum activity for both HCV and Dengue Virus), whrerin the one or more targets of the 6 to 20 hybridization regions is comprised in SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11 and/or SEQ ID NO.: 20.


14. The artificial circular RNA according to any of items 1 to 10 or 13, or the composition according to item 11 or 13 or the kit according to item 12 or 13 for use in preventing and/or treating a viral infection.


15. The artificial circular RNA or the composition or the kit for use according to item 14, wherein said viral infection is caused by HCV, HAV, Poliovirus, Coxsackie B virus, rhinovirus (common cold), Dengue, Zika, Chikungunya, West Nile or Yellow Fever virus.

Claims
  • 1. An artificial circular RNA suitable for disrupting by hybridization one or more target disruption structures of one or more RNA fragments, (a) wherein the artificial circular RNA comprises between 150 and 800 nucleotides, preferably between 200 and 600 nucleotides;(b) wherein the artificial circular RNA comprises two or more hybridization regions which: (i) completely hybridize with at least one target hybridization region comprised in the one or more target disruption structures of the one or more RNA fragments; and(ii) have a total of between 7 and 100 nucleotides, preferably between 10 and 50 nucleotides;(c) wherein the one or more target disruption structures: (i) comprises at least a hairpin loop preceded or followed by a region of unpaired nucleotides; and(ii) comprises at least one target hybridization region which comprises a single-stranded region of at least 2 nucleotides, preferably 3 nucleotides or more preceded or followed by a double-stranded region of at least 5 nucleotides, preferably 10 nucleotides or more, wherein the at least one target hybridization region completely hybridizes with each of the two or more hybridization regions of the artificial circular RNA; and(d) wherein the two or more hybridization regions comprised in the artificial circular RNA are further characterized because, when hybridizing with the target hybridization region, the energy of hybridization, as measured by RNAcofold, between the hybridization region and the at least one target hybridization region is more negative than the energy of the target disruption region, thereby disrupting the target disruption structure.
  • 2. The artificial circular RNA of claim 1 wherein the artificial circular RNA comprises between 6 and 20 hybridization regions.
  • 3. The artificial circular RNA of claim 2 wherein at least two, and preferably all, of the hybridization regions are capable of completely hybridizing with the same target hybridization region.
  • 4. The artificial circular RNA of any one of claims 2-3 wherein at least two, and preferably all, of the hybridization regions have different nucleotide sequences.
  • 5. The artificial circular RNA of any one of claims 2-4, wherein the 2 or more hybridization regions are: a) separated by non-hybridization regions of sizes up to 20 nucleotides; orb) are not separated by non-hybridization regions; orc) are overlapping.
  • 6. The artificial circular RNA of any one of the preceding claims, wherein the one or more RNA fragments is selected from mRNA, tRNA, rRNA, non-coding RNA and viral genomic RNA.
  • 7. The artificial circular RNA of claim 6, wherein the one or more RNA fragments is viral genomic RNA.
  • 8. The artificial circular RNA of claim 7, wherein the one or more RNA fragments is positive-sense single-stranded viral genomic RNA.
  • 9. The artificial circular RNA of any of claims 6 to 7 wherein the viral genomic RNA is selected from Influenza virus, HAV, Poliovirus, Coxsackie B virus, Coronavirus and Rhinovirus (common cold).
  • 10. The artificial circular RNA of any of claims 6 to 8, wherein the viral genomic RNA is selected from Hepatitis C virus, Dengue, Zika, Chikungunya, West Nile and Yellow Fever virus.
  • 11. The artificial circular RNA of any of claims 6 to 8, wherein the viral genomic RNA is from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
  • 12. The artificial circular RNA of any of claims 7 to 11, wherein the at least one or more target disruption structures are selected from the group consisting of: (a) Internal Ribosome Entry (IRES) Domain IV and Domain V, capsid-coding region hairpin element (cHP) or SL427 from Hepatitis C Virus,(b) short Stem Loop (sHP) or capsid-coding region hairpin element (cHP) from Dengue virus,(c) 5′ untranslated region (5′UTR), Repetitive Sequence Element (RSE) or Recoding Element from Chikungunya,(d) Stem loop III (SLIII) from West Nile, and/or(e) SL-2, Replication site, Target A, Target C, Target D from Coronavirus, preferably from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
  • 13. The artificial circular RNA according to any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.:76, 77, 78 and/or 79 from Hepatitis C virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs: 25, 26, 27 and 28.
  • 14. The artificial circular RNA according to any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.:29 and/or 30 from Dengue virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 29 and 30.
  • 15. The artificial circular RNA according to any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.:80, 81 and/or 82 from Chikungunya, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 33, 35, and 31 .
  • 16. The artificial circular RNA according to any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structure of SEQ ID NO.: 83 from West Nile and wherein the target hybridization regions is SEQ ID NO.: 37.
  • 17. The artificial circular RNA according any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.: 84, 58, 85, 86, and/or 87 from Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 62, 58, 59, 60, and 61.
  • 18. The artificial circular RNA according any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.: 30 and/or 79 from Dengue Virus and Hepatitis C Virus, and wherein the target hybridization regions, for each of these target disruption structures, are elected from SEQ ID NOs.: 30 and 28.
  • 19. The artificial circular RNA according any of claims 7 to 12, wherein the at least one or more target disruption structures comprise the target disruption structures selected from the list consisting of SEQ ID NOs.: 30 and/or 83 from Dengue Virus and West Nile Virus, and wherein the target hybridization regions, for each of these target disruption structures, are respectively selected from SEQ ID NOs.: 30 and 37.
  • 20. A composition comprising the artificial circular RNA as defined in any of the previous claims.
  • 21. A kit comprising the artificial circular RNA as defined in any of claims 1 to 19 or comprising the composition as defined in claim 20, and instructions for using the artificial circular RNA or composition.
  • 22. The artificial circular RNA of any of claims 1 to 19, or the composition of claim 20, or the kit of claim 21, wherein the sequence of the artificial RNA comprises, or preferably, consists of, the following nucleotides defined in: SEQ ID NO: 2, 3, 4, 5, 6 (for Hepatitis C virus); 8, 9, 10 (for Dengue virus); 12, 13, 14, 15, 39 (for Chikungunya virus); 16 and 17 (broad spectrum activity for both Hepatitis C virus and Dengue Virus); 24 and 19 (for West Nile Virus); 21, 22 and 23 (broad spectrum activity for both Dengue and West Nile Viruses); 32 (broad spectrum activity for both Hepatitis C virus and Dengue Virus); 36, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 65, 66, 67, 68, 69, 70, 71, 72 (for Severe acute respiratory syndrome coronavirus 2).
  • 23. The artificial circular RNA of any of claims 1 to 19 or the composition of claim 20, or the kit of claim 21, wherein the one or more target hybridization region of the artificial circular RNA which completely hybridize with the two or more hybridization regions is comprised in the artificial RNA defined in SEQ ID NO.: 1, SEQ ID NO.: 7, SEQ ID NO.: 11, SEQ ID NO.: 34 and/or SEQ ID NO.: 20.
  • 24. The artificial circular RNA of any one of claims 1 to 19 and 22 and 23, or the composition of any of claims 20 to 23, or the kit of any one of claims 21 to 23 for use as a medicament.
  • 25. The artificial circular RNA of any one of claims 1 to 19 and 22 to 24, or the composition of any of claims 20 to 24, or the kit of any one of claims 21 to 24 for use in a method of preventing and/or treating a viral infection.
  • 26. The artificial circular RNA of any one of claims 1 to 19 and 22 to 25, or the composition of any of claims 20 to 25, or the kit of any one of claims 21 to 26 for use according to claim 25, wherein the viral infection is caused by Hepatitis C virus, Hepatitis A virus, Poliovirus, Influenza virus, Coxsackie B virus, rhinovirus (common cold), Dengue, Zika, Chikungunya, West Nile, Yellow Fever virus or coronavirus, such as SARS and/or MERS, preferably SARS-CoV-2.
  • 27. A method of screening for artificial circular RNA comprising two or more hybridization regions capable of disrupting by hybridization one or more target disruption structures of one or more RNA fragments, wherein the target disruption structures are defined as: iii. a first region with at least a hairpin loop preceded or followed by a second region of unpaired nucleotides; andiv. as comprising at least one target hybridization region which comprises a single-stranded region of at least 2 nucleotides, preferably 3 nucleotides or more preceded or followed by a double-stranded region of at least 5 nucleotides, preferably 10 nucleotides or more, and wherein the method comprises the steps of: d) identifying the two or more hybridization regions of the artificial circular RNA as those regions that have a total of between 7 and 100 nucleotides in length, preferably between 10 and 50 nucleotides that, when hybridizing with the at least one target hybridization region, the energy of the hybridization between the two or more hybridization regions and the at least one target hybridization region is more negative than the energy of the target disruption structure, thereby disrupting the one or more target disruption structure; wherein the the two or more hybridization regions comprised in the artificial circular RNA, are identified by RNA inverse folding tools, such as NUPACK, RNAifold, or MoiRNAiFold;e) designing an artificial circular RNA comprising the two or more hybridization regions capable of disrupting the one or more target disruption structures as identified in step a), wherein said artificial circular RNA is between 150 and 800 nucleotides in length, preferably between 200 and 600 nucleotides; andf) optionally selecting the artificial circular RNA capable of disrupting by hybridization the one or more target disruption structures as designed in step b), and optionally packaging it into a product.
Priority Claims (1)
Number Date Country Kind
20382569.0 Jun 2020 EP regional
PCT Information
Filing Document Filing Date Country Kind
PCT/EP2021/067756 6/28/2021 WO