Patent Application
20160208317
The present invention relates to nucleic acid products and to corresponding methods for screening a biological sample for the presence of an infection-causing E. coli.
Some strains of Escherichia coli deviate from their commensal status as intestinal flora of mammals and take on a more pathogenic course with the capability to cause disease both within and outside the gut. These pathogenic strains are broadly categorized as either diarrheogenic or extra-intestinal pathogenic E. coli (ExPEC). ExPEC strains have retained the ability to survive in the gut without consequence, but have the capacity to disseminate to and colonize other host sites including the urinary tract, blood and central nervous system, resulting in disease with variable spectrum of clinical severity ranging from asymptomatic bacteriuria, to cystitis and pyelonephritis, to septic shock with multi-organ system failure.
Urinary tract infections (UTIs) are common bacterial infections associated with considerable morbidity. However, uropathogenic E. coli remains the predominant cause of these infections and is responsible for 70 to 90% of acute community-acquired uncomplicated infections, 85% of asymptomatic bacteriuria and for more than 60% of recurrent cystitis. E. coli also represents the biggest cause of bacteraemia with more than 30000 cases p.a in the UK and has more than 20% of mortality, making it one of the most common and challenging bacterial diseases seen in clinical practice. In addition, successful treatment has been complicated by a rise in both the number of antibiotic-resistant strains and the prevalence of antibiotic-resistance mechanisms.
Antibiotic resistance in ExPEC strains (unlike those causing gastrointestinal disease) is a growing concern. E. coli was historically one of the most antibiotic susceptible members of the Enterobacteriaceae family, but has now become one of the most resistant. In the last 10 years, ExPEC strains in particular have developed an alarming penchant for acquiring antibiotic resistance, with >20% of bacteraemia isolates now resistant to fluoroquinolones (predominantly through mutations in DNA gyrase) and >10% resistant to third-generation cephalosporins (through production of various extended-spectrum β-lactamases, ESBLs, particularly CTX-M types), recapitulating rises seen across Europe. This forces increased reliance on carbapenems which, in turn, drives resistance to these, the most active anti-Gram-negative antibiotics.
Recent DNA-based genotyping methods such as multi-locus sequence typing (MLST) have further advanced our understanding of these ExPEC lineages. Screening of more than 2000 bacteraemia-causing E. coli strains isolated between 2000 and 2010 from different UK centres has shown the consistent dominance of just five ST types (e.g. ST69, ST73, ST95, ST127 and ST131) among those isolates. These were collectively responsible for 30 to 60% of bacteraemia cases consistently through the ten years included in the study. Interestingly, their antibiotic resistance profiles differed markedly. Whilst four of these ST types (ST69, ST73, ST95 and ST127) remained relatively susceptible to most antibiotics, the fifth, ST131, has shown increasing resistance to a wide range of classes of antibiotics over the 10 years of the study. Starting from year 2003-2004, isolates belonging to this particular ST-type were predominantly resistant to β-lactams, fluoroquinolones and aminoglycosides. Indeed, the latest is a globally emerging lineage of E. coli and is currently under intense investigation because of its extensive antimicrobial resistance profile, which often includes ESBL production, specifically of CTX-M-15, plus fluoroquinolone and aminoglycoside resistance. In a large number of surveys of human E. coli infections, E. coli-ST131 group was repeatedly reported to be responsible of a large fraction of urine tract infection cases overall, and up to 80-90% of those representing multi antimicrobial-resistant phenotypes, in particular those showing resistant to third-generation cephalosporins. Variants of the ST131 clone frequently host plasmids encoding CTX-M-15 ESBL, but have been identified with many other β-lactamases, suggesting not only that the clone is successful and widely disseminated, but also that it is adept at acquiring locally prevalent plasmids.
The E. coli ST95, a recognized avian pathogenic E. coli (APEC) clonal group, has been found to be predominant within APEC and human ExPEC isolates with diverse host species. E. coli ST69 was identified initially in an apparent outbreak of extraintestinal infections in Berkeley, Calif., during which it accounted for 11% of all UTIs and 52% of antimicrobial-resistant UTIs. It has been subsequently identified around the world, usually as a cause of sporadic human disease and isolates belonging to this group were often associated with resistance to amoxicillin, trimethoprim and sulfamethoxazole.
In a recent published study in the north west of England (Gibreel T M et al 2012), E. coli isolates belonging to ST73, ST131, ST69, ST95 and ST127 were responsible for 16.6, 13.3, 9, 6.3 and 3.6% (collectively c. 50%) of human urinary tract infections, respectively. These findings largely agreed with our results, which were from bloodstream infections, and based on a collection of isolates more representative at the UK national level. Other international molecular epidemiology studies in Canada, France and USA have also pointed out the prevalence of these five ST types among isolates causing urine tract infections or bacteraemia.
A limited number of E. coli STs are collectively responsible for the majority of E. coli urinary tract and bloodstream infections. These STs vary in their antibiotic susceptibility. Rapid identification of particular STs could be used to tailor empiric therapy given to patients to be potentially suited for the particular ST.
STs are defined on the basis of multi-locus sequence typing (MLST), which provides consistent results that are easily comparable across laboratories. However, MLST is time consuming (6-8 h), labour intensive and expensive to perform. Alternative molecular screening strategies are needed to address these limitations and make such testing suited to a larger number of bacteriology laboratories. A screening PCR test has been described to specifically identify isolates belonging to the internationally-disseminated ST131 clone. However, this assay is based on detecting two single nucleotide polymorphisms in the pabB gene and, like many allele-specific PCRs, can suffer from reliability and specificity issues. Otherwise, there are no commercial tests or comparable assays available for the rapid identification of these E. coli STs. There is therefore a need for a more efficient identification system.
The rapid identification of these STs, which are markedly different according to their antibiotic susceptibilities profiles, will allow the treatment options to be adjusted rapidly while waiting for the time-consuming antibiogram (18-24 h). This option potentially contributes to preventing the overuse of some of the most powerful antibiotics (such as carbapenems) by identifying those patients with E. coli infections that might respond to narrower-spectrum antibiotics. By preventing over-reliance on e.g. carbapenems, this strategy will reduce selection pressure for the spread of resistance to these last-resource antibiotics.
The present invention solves the above-identified problems by providing a rapid multiplex PCR assay for targeting and identifying specific E. coli strains in a single isolated sample.
By providing a rapid and reliable identification of specific E. coli ST-lineage probes and validation thereof, the invention also provides a rapid multiplex PCR assay for targeting specific E. coli strains in a single isolated sample.
Sequence analyses of 300 publically-available genome sequences deposited in the Genbank database were used to identify sequence-specific DNA regions that are conserved within, but differ between the five major ST types and ST-lineage respective genomes (lineage differed by one or two locus types according to the MLST typing scheme). The number of specific regions identified for each ST varies from 2 to 12 as detailed in Table 1. Five of these ST-specific regions have been selected as targets for the development of a rapid multiplex PCR assay (in the first instance) and their sensitivity and specificity has been evaluated.
ST-specific primers targeting the five selected regions were designed to amplify fragments distinct in sizes in order to facilitate their detection in a single PCR reaction. The expected sizes of amplified products were 104, 200, 310, 404 and 490 bp for the ST69, ST95, ST131, ST127 and ST73-specific targets, respectively (Table 2). Amplification reaction mixtures containing each of the ten primers at a final concentration of 0.2 μM used purified genomic DNA as a template and were performed with the following cycling conditions; an initial denaturation step at 94° C. for 3 min; 30 cycles of 94° C. for 30 sec, 60° C. for 30 sec and 72° C. for 30 sec; and one final cycle of 72° C. for 5 min. The assay was evaluated using 532 isolates of known MLST types; these enclosed isolates of diverse ST types and were obtained from human, cattle or poultry from three different countries as detailed in Table 3. All isolates belonging to ST or ST-complex 69 (n=19), 73 (n=57), 95 (n=23), 127 (n=11) and 131 (n=48) amplified the expected product sizes and were all correctly assigned to the corresponding ST groups by the PCR assay (Table 3). The remaining isolates (n=374) which belonged to other diverse ST types had no PCR products except for two ST12, one ST1056 and one with a new identified ST type (combination of alleles not assigned to an ST type in the MLST database) which were in consequence misidentified as ST95 (n=2), ST73 (n=1) and ST127 (n=1), respectively. In summary, the assay allowed the identification of all five major ST types with an overall accuracy of 99.25%.
The present invention solves one or more of the above-identified problems by providing a simple, one-step assay for detecting the presence or absence of multiple infection-causing E. coli strains in a single isolated sample.
In more detail, a method for detecting the presence or absence of one or more infection-causing E. coli in a sample is provided. Said method comprises applying said sample to one or more wells, wherein said one or more wells comprises: a first probe that binds to a nucleic acid target sequence, wherein said nucleic acid target sequence is defined by E. coli ST 69 region 1 (SEQ ID NO: 31) plus region 2 (SEQ ID NO: 32) nucleic acid sequences, and wherein the first probe comprises at least 10 contiguous nucleotides having at least 80% complementarity to a corresponding 10 contiguous nucleotide sequence of said target sequence; a second probe that binds to a nucleic acid target sequence, wherein said nucleic acid target sequence is defined by E. coli ST 73 region 1 (SEQ ID NO: 1) plus region 2 (SEQ ID NO: 2) nucleic acid sequences, and wherein the second probe comprises at least 10 contiguous nucleotides having at least 80% complementarity to a corresponding 10 contiguous nucleotide sequence of said target sequence; a third probe that binds to a nucleic acid target sequence, wherein said nucleic acid target sequence is defined by E. coli ST 95 regions 1-9 (SEQ ID NOs: 3-11) nucleic acid sequences, and wherein the third probe comprises at least 10 contiguous nucleotides having at least 80% complementarity to a corresponding 10 contiguous nucleotide sequence of said target sequence; a fourth probe that binds to a nucleic acid target sequence, wherein said nucleic acid target sequence is defined by E. coli ST 127 regions 1-7 (SEQ ID NOs: 24-30) nucleic acid sequences, and wherein the fourth probe comprises at least 10 contiguous nucleotides having at least 80% complementarity to a corresponding 10 contiguous nucleotide sequence of said target sequence; a fifth probe that binds to a nucleic acid target sequence, wherein said nucleic acid target sequence is defined by E. coli ST 131 regions 1-12 (SEQ ID NOs: 12-23) nucleic acid sequences, and wherein the fifth probe comprises at least 10 contiguous nucleotides having at least 80% complementarity to a corresponding 10 contiguous nucleotide sequence of said target sequence; allowing nucleic acid present in the sample to contact with the probe within said well; detecting the presence or absence of sample nucleic acid that has bound to one or more of said probes; wherein the presence of sample nucleic acid bound to one or more of said probes confirms that nucleic acid from one or more of said infection-causing E. coli is present within the sample, and wherein the absence of sample nucleic acid bound to one or more of said probes confirms that nucleic acid from said infection-causing E. coli is absent from the sample.
In a further embodiment, the first well comprises the first probe and wherein the second to fifth probes are substantially absent from the first well; the second well comprises the second probe and wherein the first, third to fifth probes are substantially absent from the second well; the third well comprises the third probe and wherein the first to second and fourth to fifth probes are substantially absent from the third well; the fourth well comprises the fourth probe and wherein the first to third and fifth probes are substantially absent from the fourth well; and the fifth well comprises the fifth probe and wherein the first to fourth probes are substantially absent from the fifth well.
In one embodiment, the probes comprise a tag and/or a label. Said tag and/or label is incorporated during extension of the probe(s) such that the amplification product(s) become tagged/labelled. The probes can be labelled with different labels or tags. Each probe can be immobilised within its respective well, and said immobilisation can be permanent or transient.
In one embodiment, an array of target nucleic acid sequences is provided. The array is defined by: region 1 plus region 2 nucleic acid target sequence of E. coli ST 69 (SEQ ID NOs: 31 and 32), wherein said target nucleic acid sequence comprises at least 10 contiguous nucleotides thereof; and region 1 plus region 2 nucleic acid target sequence of E. coli ST 73 (SEQ ID NOs: 1 and 2), wherein said target nucleic acid sequence comprises at least 10 contiguous nucleotides thereof; and regions 1-9 nucleic acid target sequence of E. coli ST 95 (SEQ ID NOs: 3-11), wherein said target nucleic acid sequence comprises at least 10 contiguous nucleotides thereof; and regions 1-7 nucleic acid target sequence of E. coli ST 127 (SEQ ID NOs: 24-30), wherein said target nucleic acid sequence comprises at least 10 contiguous nucleotides thereof; and regions 1-12 nucleic acid target sequence of E. coli ST 131 (SEQ ID NOs: 12-23), wherein said target nucleic acid sequence comprises at least 10 contiguous nucleotides thereof.
In one embodiment, the array of target nucleic acid sequences is provided for use in detecting the presence or absence of an infection-causing E. coli.
In one embodiment, a set of nucleic acid probe sequences comprising at least 10 contiguous nucleotides having at least 80% complementarity to a corresponding 10 contiguous nucleotide sequence of a target sequence is provided. The nucleic acid probe sequences are defined region 1 plus region 2 nucleic acid target sequence of E. coli ST 69 (SEQ ID NOs: 31 and 32); and region 1 plus region 2 nucleic acid target sequence of E. coli ST 73 (SEQ ID NOs: 1 and 2); and regions 1-9 nucleic acid target sequence of E. coli ST 95 (SEQ ID NOs: 3-11); and regions 1-7 nucleic acid target sequence of E. coli ST 127 (SEQ ID NOs: 24-30); and regions 1-12 nucleic acid target sequence of E. coli ST 131 (SEQ ID NOs: 12-23).
In another embodiment, a probe nucleic acid sequence comprising at least 20 contiguous nucleotides having at least 80% complementarity to a corresponding 20 contiguous nucleotide sequence of a target sequence is provided. The probe nucleic acid sequence is defined by: region 1 plus region 2 nucleic acid target sequence of E. coli ST 69 (SEQ ID NOs: 31 and 32); or region 1 plus region 2 nucleic acid target sequence of E. coli ST 73 (SEQ ID NOs: 1 and 2); or regions 1-9 nucleic acid target sequence of E. coli ST 95 (SEQ ID NOs: 3-11); or regions 1-7 nucleic acid target sequence of E. coli ST 127 (SEQ ID NOs: 24-30); or regions 1-12 nucleic acid target sequence of E. coli ST 131 (SEQ ID NOs: 12-23).
In one embodiment, a set of nucleic acid probe sequences comprising at least 20 contiguous nucleotides having at least 80% complementarity to a corresponding 20 contiguous nucleotide sequence of a target sequence is provided. The set of nucleic acid probe sequences is defined by: region 1 plus region 2 nucleic acid target sequence of E. coli ST 69 (SEQ ID NOs: 31 and 32); and region 1 plus region 2 nucleic acid target sequence of E. coli ST 73 (SEQ ID NOs: 1 and 2); and regions 1-9 nucleic acid target sequence of E. coli ST 95 (SEQ ID NOs: 3-11); and regions 1-7 nucleic acid target sequence of E. coli ST 127 (SEQ ID NOs: 24-30); and regions 1-12 nucleic acid target sequence of E. coli ST 131 (SEQ ID NOs: 12-23).
In another embodiment, an array of polypeptide markers encoded by a target nucleic acid sequence is provided. This array is defined by: region 1 plus region 2 nucleic acid target sequence of E. coli ST 69 (SEQ ID NOs: 31 and 32); and region 1 plus region 2 nucleic acid target sequence of E. coli ST 73 (SEQ ID NOs: 1 and 2); and regions 1-9 nucleic acid target sequence of E. coli ST 95 (SEQ ID NOs: 3-11); and regions 1-7 nucleic acid target sequence of E. coli ST 127 (SEQ ID NOs: 24-30); and regions 1-12 nucleic acid target sequence of E. coli ST 131 in (SEQ ID NOs: 12-23). The polypeptide markers are provided for use in detecting the presence or absence of an infection-causing E. coli.
In one embodiment, a test card for use in a method of the invention is provided. Said test card comprises at least five wells, wherein the first well includes the first probe, the second well includes the second probe, the third well includes the third probe, the fourth well includes the fourth probe, and the fifth well includes the fifth probe. The test card is provided wherein: the first well comprises the first probe and wherein the second to fifth probes are substantially absent from the first well; the second well comprises the second probe and wherein the first, third to fifth probes are substantially absent from the second well; the third well comprises the third probe and wherein the first to second and fourth to fifth probes are substantially absent from the third well; the fourth well comprises the fourth probe and wherein the first to third and fifth probes are substantially absent from the fourth well; and the fifth well comprises the fifth probe and wherein the first to fourth probes are substantially absent from the fifth well. The probes are immobilized on the surface of the respective wells; preferably wherein the probes are present in lyophilized form adsorbed to the surface of the respective wells.
One key prior art problem that has been addressed by Applicant is the provision of a robust set of probes that are mutually compatible (i.e. retain accurate binding specificity) within a single set of assay conditions (i.e. a singleplex format). One particular advantage associated with the method of the present invention is speed. By way of example, the method of the invention is typically completed in about 30 minutes. This speed is owing to the fact that the invention allows PCR to be conducted on crude extract, thereby omitting the genomic DNA extraction step before amplification. In contrast, existing multiplex assays utilising traditional PCR amplification and ultra-fast high resolution agarose electrophoresis is done in about an hour at the very least.
Another advantage associated with the uniplex (aka singleplex) assay method of the present invention is an increased sensitivity, which enables quantitative detection of E. coli (for example, bacterial load) in the sample, in addition to simply determining the presence or absence of a particular E. coli in the sample.
E. coli strains in the sample can be subjected to load calibration for each target. This enables the quantification of specific load of each E. coli strain in the sample. Advantageously, this feature of the present invention allows the determination of the predominant strains in samples where multiple strains are present. For example, the uniplex assay method of the invention permits one to ascertain the predominant E. coli strain in samples where multiple strains are present. In addition, the method of the invention allows for the quantitative detection of E. coli strains in samples over time, which is particularly useful when there is fluctuation in bacterial load of specific strains.
Moreover, while existing systems employ hybridisation performed on a membrane, the assay method of the present invention is carried out in a closed (e.g. sterile) system, thus reducing the likelihood of contamination, which provides another advantage.
Probes 1-5 respectively permit sensitive detection of E. coli of the following ST lineages:
Thus, the above-defined method provides a rapid assay for the detection of any one or more of said infection-causing E. coli strains in a uniplex (aka singleplex) assay format. Similarly, said method provides a rapid assay for the confirmation that all of said infection-causing E. coli strains are absent from a sample in a single (uniplex) assay. A uniplex assay means that each of the multiple individual detection well assays is performed under the same assay conditions and/or substantially at the same time. In use, a single sample is applied to the test card, which sample is then populated into each test well.
In one embodiment, the test card may include one or both of said sixth or seventh wells (plus corresponding probes). Alternative ‘control’ probe/probe targets may be employed. Said ‘control’ probes may be used in combination with any of the hereinbefore described embodiments.
Control probes 6-7 respectively permit sensitive detection of:
The presence of one or more ‘control’ probes allows (substantially simultaneous) confirmation that the assay is otherwise performing normally. For example, the sample is spiked with E. coli bacteriophage MS2 (MS2 IC) prior to nucleic acid extraction. Detection of bacteriophage MS2 nucleic acid in the sample using bacteriophage MS2 probe allows confirmation of the various stages involved in the uniplex assay being completed successfully. Bacteriophage MS2 simply provides one example of an internal control, although any suitable alternative may be utilised with the method of the present invention.
In one embodiment, the test card includes a probe which permits detection of human ribonuclease P gene (RNAse P). The presence of human RNAse P nucleic acid in the sample indicates that human biological material has been collected. Alternatively, other human genome markers may be used as probe targets and their corresponding probes may be included on the test card.
The assay method of the present invention may include a nucleic acid amplification step, in which case each probe of the present invention is employed in combination with a pair of (forward and reverse) primers—said primer pair cooperate to amplify a stretch of target nucleic acid, which is then recognised by the probe (by binding thereto) during the detection step. By way of example, primers 1f (forward) & 1r (reverse) coordinate with the first probe, and in use all three nucleic acid sequences are included in the first well. The same applies to primers 2f & 2r in combination with the second probe (within the second well) through to primers 7f & 7r in combination with the seventh probe (within the seventh well).
Example primer sequences of the invention are exemplified in Tables 2, 4 and 5 and are also set out below.
Primer 1f comprises a nucleic acid sequence that has at least 80% sequence identity to GGCAACAAGCATAAA (SEQ ID NO: 33), and primer 1r comprises a nucleic acid sequence that has at least 80% sequence identity to AGGGCGTTCAGAATC (SEQ ID NO: 34).
Primer 2f comprises a nucleic acid sequence that has at least 80% sequence identity to TTCCATTTCCCATGA (SEQ ID NO: 35), and primer 2r comprises a nucleic acid sequence that has at least 80% sequence identity to TGCATACCATTTAAG (SEQ ID NO: 36).
Primer 3f comprises a nucleic acid sequence that has at least 80% sequence identity to GCTGCGTTGCCTTTC (SEQ ID NO: 37), and primer 3r comprises a nucleic acid sequence that has at least 80% sequence identity to ATAGCGGTCGATTAC (SEQ ID NO: 38).
Primer 4f comprises a nucleic acid sequence that has at least 80% sequence identity to TTCTCAATCTCTTCC (SEQ ID NO: 39), and primer 4r comprises a nucleic acid sequence that has at least 80% sequence identity to CTCTGTCCCAATTCC (SEQ ID NO: 40).
Primer 5f comprises a nucleic acid sequence that has at least 80% sequence identity to ATTCCATCGCAAGAC (SEQ ID NO: 41), and primer 5r comprises a nucleic acid sequence that has at least 80% sequence identity to AATGTCCGGGATTAT (SEQ ID NO: 42).
The biological sample is typically a sample that has been taken from a patient (i.e. an ex vivo and/or isolated sample). In one embodiment, a nucleic acid extraction step may be performed on the sample—conventional nucleic acid extraction protocols are well known in the art. The extracted nucleic acid sample is then applied so that is contacts each of the wells (and thus each of the probes within said wells). In another embodiment, the sample taken from the patient is directly applied to a well.
The nucleic acid ‘hybridization reaction’ (comprising probe and primers working together) step of the present invention is typically performed at a temperature of 50-70° C. (for example, 55-65° C. or 56-64° C. or 57-63° C. or 58-62° C. or 59-61° C. or approximately 60° C.). Said temperature is typically held for a time period of 10-30 seconds (for example, 15-25 seconds or 17-23 seconds or 19-21 seconds or approximately 20 seconds). If a nucleic acid amplification step is included in the method of the invention, said ‘hybridization reaction’ (comprising probe and primers added in excess at the beginning) step is preferably included in each cycle of the amplification step.
If a nucleic acid amplification step is employed, this step is typically performed at a temperature of 90-100° C. (for example, 92-98° C. or 94-96° C. or approximately 95° C. degrees) for a typical period of 0.1-10 seconds (for example, 0.5-5 seconds or 0.7-2 seconds or approximately 1 second) followed by a reduced temperature of 50-70° C. (for example, 55-65° C. or 57-63° C. or 59-61° C. or approximately 60° C.) for a period 10-30 seconds (for example, 15-25 seconds or 17-23 seconds or 19-21 seconds or approximately 20 seconds). If a nucleic acid amplification step is employed, said step typically includes 35-55 cycles (for example, 40-50 cycles or 44-46 cycles or approximately 45 cycles). A reverse transcription step is typically employed at the very start at a temperature of 40-60° C. (for example, 45-55° C. or 48-52° C. or approximately 50° C.) for a time period of 3-7 minutes (for example, 4-6 minutes or approximately 5 minutes).
In one embodiment, the method may be performed in an Applied Biosystems 7900HT (high throughput) instrument. By way of example, said instrument may employ a 384 well test card (aka plate) RT-PCR platform that allows, for example, 8 different samples to be analysed in parallel via 8 distinct columns present on a single test card—see
In one embodiment, the method employs PCR such as RT-PCR.
In use, a sample (typically extracted nucleic acid samples) is mixed with 2-times to 5-times concentrated buffer (e.g. PCR buffer; also referred to as reaction mix). For example, Xμl of sample is mixed with the same volume (Xμl) of 2-times concentrated buffer. The sample (including buffer) is then applied to each well—typically a volume in the range of 0.1-50 μl, or 0.5-30 μl, or 0.5-20 μl, or 0.5-10 μl, or 1-5 μl is delivered to each well. Preferably approximately 0.5 μl, 1 μl, 4 μl, 3 μl, 4 μl or 5 μl of sample (including buffer) is delivered to each well.
In one embodiment a test card is provided. In another embodiment there is no test card and the sample is applied to one or more wells.
A well of the invention is herein intended to embrace any structure providing a volume for retaining a sample.
In the case of a test card comprising a columnar arrangement of wells (see, for example,
Each well includes one specific probe type of the present invention (and optionally the corresponding primer pair). In one embodiment, said probe is present in its well in a lyophilized form. Thus, once the liquid sample has been applied to the well surface, the lyophilized probe (optionally including the corresponding primer pair) becomes re-hydrated, thereby allowing the detection step to proceed within a liquid medium.
A well of the present invention is designed to hold slightly more than the relevant liquid volume (sample plus buffer/reaction mix) of the assay that is to be performed in said well. Each well is discrete to allow location of a single probe type within a single well, thereby permitting the method to detect the presence or absence of specific target E. coli strains. Following application of sample to the test card, all of the wells containing probe(s) may be sealed shut by use of one or more films/sheets, thereby preventing accidental migration of liquid (and potentially probes) between wells. A well of the present invention may be positioned in the same horizontal plane as the test card, though equally may be positioned above or below said plane.
Compared to a standard battery of multiplex reaction set-ups, the present invention offers time and resource savings in both reaction set up manipulations and permits collation of data from multiple instruments.
The present invention also provides a test card for use in the hereinbefore described methods. In one embodiment, the test card is made from a plastics material. For the purpose of assisting the user, the test card should have sufficient rigidity to support the weight of the card (including applied sample), for example when in a substantially horizontal position as typically held by the user during normal use.
The test card comprises a plurality of wells (optionally arranged in a columnar format to permit sample application by centrifugal delivery), wherein at least seven wells are provided, and wherein the first well includes the first probe, the second well includes the second probe, the third well includes the third probe, the fourth well includes the fourth probe, the fifth well includes the fifth probe, and the sixth well includes the seventh probe of the present invention as herein defined. Each well typically only includes (a plurality of) one specific probe of the present invention. By way of example, in one embodiment, the first probe is present in the first well (though typically absent from any of the other wells), and the second probe is present in the second well (though typically absent from any of the other wells), and so on.
Each probe may optionally be associated with its corresponding primer pair. Thus, in addition to the first probe, the first well may include the first pair of corresponding forward and reverse primers. Each well typically only includes (a plurality of) one specific primer pair of the present invention. By way of example, in one embodiment, the first primer pair (and the first probe) is present in the first well but typically absent from any of the other wells, and the second primer pair (and the second probe) is present in the second well but typically absent from any of the other wells, and so on. Alternatively, more than one probe (and optionally its corresponding primer pair) may be present in a single well.
Each probe may be immobilised within its respective well—said immobilisation may be permanent (e.g. via a covalent link, optionally introduced by any commercially available chemical cross-linking reagents) or transient (e.g. via a non-covalent bond such as a hydrogen bond, or via an ionic bond). For example, the first probe may be immobilised within the first well, and the second probe may be immobilised within the second well, and so on. Immobilisation of the respective probes makes the test cards easier to handle, improves storage stability, and minimises the risk of probe migration between wells. The probes are preferably immobilised within the wells by simple adsorption on to a surface present in the wells, such as on to a wall of a well. Thus, in one embodiment, a probe-containing solution is prepared, applied to the surface of a well, and then allowed to dry on the surface of the well. Conventional stabilising compounds (e.g. sugars) may be added to the probe-containing solution prior to application to a well surface.
The test card may include one or more additional wells. Each of the above-described test card embodiments may further include one or more wells for detecting atypical E. coli strains. Each of the above-described test card embodiments may further include one or more ‘control’ wells.
In one embodiment there is provided a polypeptide marker encoded by a target nucleic acid sequence, and a method for the detection thereof. Such a polypeptide marker can be detected by conventional protein detection methods including the use of antibodies, HPLC, mass spectroscopy. In one embodiment, the polypeptide markers of the invention are at least 10 amino acids in length. In one embodiment, the polypeptide markers of the invention are at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acids in length.
Reference to at least 80% sequence identity includes at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and 100% sequence identity (to each and every nucleic acid sequence presented herein and/or to each and every SEQ ID NO presented herein).
The one-letter reference code for nucleotides employed throughout this specification means:
All nucleic acid sequences presented herein are presented in a 5′-to-3′ (left-to-right) orientation.
The probes of the invention are designed to hybridise to their target nucleic acid sequence present on the target E. coli strain in question. It is preferred that the binding conditions are such that a high level of specificity is provided—i.e. hybridisation of the probe occurs under “stringent conditions”. In general, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target (or complement) sequence hybridises to a perfectly matched probe. In this regard, the Tm of probes of the present invention, at a salt concentration of about 0.02M or less at pH 7, is for example above 60° C., such as about 70° C.
Premixed buffer solutions are commercially available (eg. EXPRESSHYB Hybridisation Solution from CLONTECH Laboratories, Inc.), and hybridisation can be performed according to the manufacturer's instructions.
Probes of the present invention are screened to minimise self-complementarity and dimer formation (probe-probe binding), and are selected so as to have minimal homology with human DNA. The selection process typically involves comparing a candidate probe sequence with human DNA and rejecting the probe if the homology is greater than 50%. The aim of this selection process is to reduce annealing of probe to contaminating human DNA sequences and hence allow improved specificity of the assay.
Any of the probes described herein may comprise a tag and/or label. The tag and/or label may, for example, be located (independently of one another) towards the middle or towards or at the 5′ or 3′ end of the herein described probes, for example at the 5′ end.
Hence, following hybridisation of tagged/labelled probe to target nucleic acid, the tag/label is associated with the target nucleic acid. Alternatively, if an amplification step is employed, the probes may act as primers during the method of the invention and the tag/label may therefore become incorporated into the amplification product as the primer is extended.
Examples of suitable labels include detectable labels such as radiolabels or fluorescent or coloured molecules, enzymatic markers or chromogenic markers—e.g. dyes that produce a visible colour change upon hybridisation of the probe. By way of example, the label may be digoxygenin, fluorescein-isothiocyanate (FITC), R-phycoerythrin, Alexa 532 or Cy3. The probes preferably contain a Fam label (e.g. a 5′ Fam label), and/or a minor groove binder (MGB). The label may be a reporter molecule, which is detected directly, such as by exposure to photographic or X-ray film. Alternatively, the label is not directly detectable, but may be detected indirectly, for example, in a two-phase system. An example of indirect label detection is binding of an antibody to the label.
Examples of suitable tags include “complement/anti-complement pairs”. The term “complement/anti-complement pair” denotes non-identical moieties that form a non-covalently associated, stable pair under appropriate conditions. Examples of suitable tags include biotin and streptavidin (or avidin). By way of example, a biotin tag may be captured using streptavidin, which may be coated onto a substrate or support such as a bead (for example a magnetic bead) or membrane. Likewise, a streptavidin tag may be captured using biotin, which may be coated onto a substrate or support such as a bead (for example a magnetic bead) or membrane. Other exemplary complement/anti-complement pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope) pairs, and the like. Another example is a nucleic acid sequence tag that binds to a complementary sequence. The latter may itself be pre-labelled, or may be attached to a surface (eg. a bead) which is separately labelled. An example of the latter embodiment is the well-known LuminexR bead system. Other exemplary pairs of tags and capture molecules include receptor/ligand pairs and antibody/antigen (or hapten or epitope) pairs. Where subsequent dissociation of the complement/anti-complement pair is desirable, the complement/anti-complement pair has a binding affinity of, for example, less than 109 M−1.
The probes of the invention may be labelled with different labels or tags, thereby allowing separate identification of each probe when used in the method of the present invention.
Any conventional method may be employed to attach nucleic acid tags to a probe of the present invention (e.g. to the 5′ end of the defined binding region of the probe). Alternatively, nucleic acid probes of the invention (with pre-attached nucleic acid tags) may be constructed by commercial providers.
The sample is for example a clinical sample (or is derived from a clinical sample) such as: blood, sputum, nose and throat swabs, bronchoalveolar lavage, tracheal aspirate, nasopharyngeal aspirates, lung tissue samples, cerebrospinal fluid, archaeological, faecal samples. The sample is preferably a human tissue/sample or is a sample derived therefrom (e.g. a nucleic acid extracted sample).
If an amplification step is employed, this step may be carried out using methods and platforms known in the art, for example PCR (for example, with the use of “Fast DNA Polymerase”, Life Technologies), such as real-time PCR, block-based PCR, ligase chain reaction, glass capillaries, isothermal amplification methods including loop-mediated isothermal amplification, rolling circle amplification transcription mediated amplification, nucleic acid sequence-based amplification, signal mediated amplification of RNA technology, strand displacement amplification, isothermal multiple displacement amplification, helicase-dependent amplification, single primer isothermal amplification, and circular helicase-dependent amplification.
If employed, amplification may be carried using any amplification platform—as such, an advantage of this embodiment of the assay is that it is platform independent and not tied to any particular instrument.
In one embodiment, a general amplification step (eg. pre-detection) may be employed to increase the amount of target nucleic acid present in the sample. In this embodiment, PCR amplification primers are typically employed to amplify approximately 100-400 base pair regions of the target/complementary nucleic acid that contain the nucleotide targets of the present invention. In the presence of a suitable polymerase and DNA precursors (dATP, dCTP, dGTP and dTTP), forward and reverse primers are extended in a 5′ to 3′ direction, thereby initiating the synthesis of new nucleic acid strands that are complementary to the individual strands of the target nucleic acid. The primers thereby drive amplification of target nucleic acid sequences, thereby generating amplification products comprising said target nucleic acid sequences.
In one embodiment, an amplification step may be employed in which the probes of the present invention act as primers. In this embodiment, the probes (acting as primers) are extended from their 3′ ends (i.e. in a 5′-to-′3′) direction. The resulting amplification products typically comprise 100-400 base pair regions of the target/complementary nucleic acid. This embodiment may be employed in conjunction with a general amplification step, such as the one described above.
The detection step may be carried out by any known means. In this regard, the probe or amplification product may be tagged and/or labelled, and the detection method may therefore comprise detecting said tag and/or label.
In one embodiment, the probe(s) may comprise a tag and/or label. Thus, in one embodiment, following hybridisation of tagged/labelled probe to target nucleic acid, the tag/label becomes associated with the target nucleic acid. Thus, in one embodiment, the assay may comprise detecting the tag/label and correlating presence of tag/label with presence of E. coli nucleic acid.
In one embodiment, tag and/or label may be incorporated during extension of the probe(s). In doing so, the amplification product(s) become tagged/labelled, and the assay may therefore comprise detecting the tag/label and correlating presence of tag/label with presence of amplification product, and hence the presence of E. coli nucleic acid.
By way of example, in one embodiment, the amplification product may incorporate a tag/label (eg. via a tagged/labelled dNTP such as biotin-dNTP) as part of the amplification process, and the assay may further comprise the use of a binding partner complementary to said tag (eg. streptavidin) that includes a detectable tag/label (eg. a fluorescent label, such as R-phycoerythrin). In this way, the amplified product incorporates a detectable tag/label (e.g. a fluorescent label, such as R-phycoerythrin).
In one embodiment, the probe(s) and/or the amplification product(s) may include a further tag/label (as the complement component) to allow capture of the amplification product(s).
By way of example, a “complement/anti-complement” pairing may be employed in which an anti-complement capture component binds to said further tag/label (complement component) and thereby permits capture of the probe(s) and/or amplification product(s). Examples of suitable “complement/anti-complement” partners have been described earlier in this specification, such as a complementary pair of nucleic acid sequences, a complementary antibody-antigen pair, etc. The anti-complement capture component may be attached (eg. coated) on to a substrate or solid support—examples of suitable substrates/supports include membranes and/or beads (eg. a magnetic or fluorescent bead). Capture methods are well known in the art. For example, LuminexR beads may be employed. Alternatively, the use of magnetic beads may be advantageous because the beads (plus captured, tagged/labelled amplification product) can easily be concentrated and separated from the sample, using conventional techniques known in the art.
Immobilisation provides a physical location for the anti-complement capture component (or probes), and may serve to fix the capture component/probe at a desired location and/or facilitate recovery or separation of probe. The support may be a rigid solid support made from, for example, glass or plastic, such as a bead (for example a fluorescent or magnetic bead). Alternatively, the support may be a membrane, such as nylon or nitrocellulose membrane. 3D matrices are also suitable supports for use with the present invention—eg. polyacrylamide or PEG gels. Immobilisation to a support/platform may be achieved by a variety of conventional means. By way of example, immobilisation onto a support such as a nylon membrane may be achieved by UV cross-linking. Alternatively, biotin-labelled molecules may be bound to streptavidin-coated substrates (and vice-versa), and molecules prepared with amino linkers may be immobilised on to silanised surfaces. Another means of immobilisation is via a poly-T tail or a poly-C tail, for example at the 3′ or 5′ end. Said immobilisation techniques apply equally to the probe component (and primer pair component, if present) of the present invention.
In one embodiment, the probes of the invention comprise a nucleic acid sequence tag/label (e.g. attached to each probe at the 5′ end of the defined sequence of the probe that binds to target/complement nucleic acid). In more detail, each of the probes is provided with a different nucleic acid sequence tag/label, wherein each of said tags/labels (specifically) binds to a complementary nucleic acid sequence present on the surface of a bead. Each of the different tags/labels binds to its complementary sequence counterpart (and not to any of the complementary sequence counterparts of the other tags), which is located on a uniquely identifiable bead. In this regard, the beads are uniquely identifiable, for example by means of fluorescence at a specific wavelength. Thus, in use, probes of the invention bind to target nucleic acid (if present in the sample). Thereafter, (only) the bound probes may be extended (in the 3′ direction) in the presence of one or more labelled dNTP (eg. biotin labelled dNTPs, such as biotin-dCTPs).
The extended primers may be contacted with a binding partner counterpart to the labelled dNTPs (eg. a streptavidin labelled flurophore, such as streptavidin labelled R-phycoerythrin), which binds to those labelled dNTPs that have become incorporated into the extended primers. Thereafter, the labelled extended primers may be identified by allowing them to bind to their nucleic acid counterparts present on the uniquely identifiable beads. The latter may then be “called” (eg. to determine the type of bead present by wavelength emission) and the nature of the primer extension (and thus the type of target/complement nucleic acid present) may be determined.
The first probe comprises a nucleic acid sequence that has at least 80% sequence identity to TTACGACCCAAAGCGAGGCAT (SEQ ID NO: 43).
The second probe comprises a nucleic acid sequence that has at least 80% sequence identity to TCCGATGTAACCTGCAACTACGCG (SEQ ID NO: 44).
The third probe comprises a nucleic acid sequence that has at least 80% sequence identity to TCAGTGCAAGCTGGCATAGCACTA (SEQ ID NO: 45).
The fourth probe comprises a nucleic acid sequence that has at least 80% sequence identity to ACCAAGGTTCCGCTCTTGATCGAA (SEQ ID NO: 46).
The fifth probe comprises a nucleic acid sequence that has at least 80% sequence identity to AACTGTTGTAGTGGGCCTGTTCCA (SEQ ID NO: 47).
Primer 1f comprises a nucleic acid sequence that has at least 80% sequence identity to TCTGGAGGCAACAAGCATAAA (SEQ ID NO: 48), and primer 1r comprises a nucleic acid sequence that has at least 80% sequence identity to AGAGAAAGGGCGTTCAGAATC (SEQ ID NO: 49).
Primer 2f comprises a nucleic acid sequence that has at least 80% sequence identity to TCGCATTCCATTTCCCATGA (SEQ ID NO: 50), and primer 1r comprises a nucleic acid sequence that has at least 80% sequence identity to CGGCGTTGCATACCATTTAAG (SEQ ID NO: 51).
Primer 3f comprises a nucleic acid sequence that has at least 80% sequence identity to GATATTGCTGCGTTGCCTTTC (SEQ ID NO: 52), and primer 3r comprises a nucleic acid sequence that has at least 80% sequence identity to GTAGCTTCATAGCGGTCGATTAC (SEQ ID NO: 53).
Primer 4f comprises a nucleic acid sequence that has at least 80% sequence identity to ACCAGCATTCTCAATCTCTTCC (SEQ ID NO: 54), and primer 4r comprises a nucleic acid sequence that has at least 80% sequence identity to GGACTTACTCTGTCCCAATTCC (SEQ ID NO: 55).
Primer 5f comprises a nucleic acid sequence that has at least 80% sequence identity to ACCCATTCCATCGCAAGAC (SEQ ID NO: 56), and primer 5r comprises a nucleic acid sequence that has at least 80% sequence identity to GCGTCAATGTCCGGGATTAT (SEQ ID NO: 57).
Any of a variety of sequence alignment methods can be used to determine percentage identity, including, without limitation, global methods, local methods and hybrid methods, such as, e.g., segment approach methods. Protocols to determine percentage identity are routine procedures within the scope of one skilled in the. Global methods align sequences from the beginning to the end of the molecule and determine the best alignment by adding up scores of individual residue pairs and by imposing gap penalties. Non-limiting methods include, e.g., CLUSTAL W, see, e.g., Julie D. Thompson et al., CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position—Specific Gap Penalties and Weight Matrix Choice, 22 (22) Nucleic Acids Research 4673-4680 (1994); and iterative refinement, see, e.g., Osamu Gotoh, Significant Improvement in Accuracy of Multiple Protein. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments, 264(4) J. Mol. Biol. 823-838 (1996). Local methods align sequences by identifying one or more conserved motifs shared by all of the input sequences. Non-limiting methods include, e.g., Match-box, see, e.g., Eric Depiereux and Ernest Feytmans, Match-Box: A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences, 8(5) CABIOS 501-509 (1992); Gibbs sampling, see, e.g., C. E. Lawrence et al., Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment, 262 (5131) Science 208-214 (1993); Align-M, see, e.g., Ivo Van Walle et al., Align-M—A New Algorithm for Multiple Alignment of Highly Divergent Sequences, 20 (9) Bioinformatics: 1428-1435 (2004). Thus, percentage sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-19, 1992.
The same methods can be utilised for determining percentage complementarity between sequences. In this case, the percentage identity is determined between complementary base pairs, for example, between the alignment of one nucleotide with its complementary nucleotide.
Variants of the specific sequences provided above may alternatively be defined by reciting the number of nucleotides that differ between the variant sequences and the specific reference sequences provided above. Thus, in one embodiment, the sequence may comprise (or consist of) a nucleotide sequence that differs from the specific sequences provided above at no more than 2 nucleotide positions, for example at no more than 1 nucleotide position. Conservative substitutions are preferred.
By way of example, variant probe sequences may comprise nucleic acid sequences selected from: (SEQ ID NO: 1); (SEQ ID NO: 2); (SEQ ID NO: 3); (SEQ ID NO: 4) or (SEQ ID NO: 5).
Fragments of the above-mentioned sequences (and sequence variants thereof as defined above) may also be employed, for example, fragments comprising 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 base pair of the defined sequences described herein.
| Number | Date | Country | Kind |
|---|---|---|---|
| 1315527.0 | Aug 2013 | GB | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/GB2014/052615 | 8/29/2014 | WO | 00 |
