Patent Grant
12098361
This Application claims the benefit of foreign priority to EP Patent Application EP 21182469.3 filed Jun. 29, 2021, the entire disclosure of which is herein incorporated by reference.
Incorporation by Reference of the Sequence Listing
The content of the ASCII text file of the sequence listing named-1AR1888.TXT 1B78174, 4939226-4727000 bytes in size, created on Sep. 16, 2022, is incorporated herein by reference in its entirety.
The field of the invention relates to attenuated Histomonas meleagridis (H. meleagridis) strains and vaccines against histomonosis based thereon.
H. meleagridis is a flagellated extracellular poultry parasite of the order Tritrichomonadida. It causes histomonosis (also called histomoniasis, blackhead disease or infectious typhlohepatitis), an important disease of gallinaceous birds, especially in turkeys and chickens. The disease can be very devastating in turkeys, in which the parasite causes serious ceacal lesions and liver necrosis that can lead up to 100% mortality (McDougald, 2005). In chickens, histomonosis is typically less severe and the infection is generally confined to the caeca (Hess et al., 2015). Histomonosis and the parasite are known for more than 100 years, which in the second half of the 20th century led to the introduction of effective prophylactic and chemotherapeutic drugs with the almost disappearance of the disease (Liebhart et al., 2017). The situation drastically changed at the beginning of the present century, when these active compounds were banned as a result of amendments in drug legislation in the European Union and the USA and histomonosis reappeared with most severe consequences in turkeys (Clark & Kimminau, 2017). In addition, histomonosis became more prevalent in chickens aided by the tendency to increase free-range farming, enabling bird's easy access to the parasite.
In an attempt to prevent mortality, veterinarians can only rely on the implementation of proper flock management and the very early administration of the aminoglycoside antibiotic paramomycin, often without success. Accordingly, safe and effective vaccines against histomonosis are needed.
WO 2014/006018 A1 discloses a vaccine formulation consisting of a Histomonas component consisting of an attenuated culture of H. meleagridis, a bacterial component consisting of one or more single bacterial strains, and pharmaceutically acceptable non-biological formulation compounds.
Hess et al., 2008, discloses an attenuated culture of H. meleagridis which is used for the formulation of a live vaccine. EP 1 721 965 A1 also discloses such an attenuated culture.
However, producing an attenuated culture of H. meleagridis, especially when starting from a field isolate, is a time-consuming and laborious process when based on conventional methods such as prolonged passaging of the H. meleagridis cells in vitro without any guided selection for genomic traits. It is therefore an object of the present invention to provide improved methods of attenuating H. meleagridis as well as attenuated H. meleagridis strains and vaccines based thereon.
The present invention provides an H. meleagridis strain having at least one attenuating feature selected from the group consisting of:
The present invention further provides an H. meleagridis strain having at least one attenuating feature verifiable by:
In a further aspect, the present invention provides a method of attenuating H. meleagridis, comprising the steps of
In another aspect, the present invention provides a vaccine comprising cells of the strain as defined herein or cells as defined herein, wherein the cells are live or inactivated, and at least one pharmaceutically acceptable excipient. This vaccine is preferably for use in prevention of histomonosis. It is preferably formulated as a gel or as a semi-solid matrix.
In yet another aspect, the present invention provides a method of vaccinating a bird against histomonosis, comprising the steps of obtaining the vaccine as defined herein and administering the vaccine to the bird.
In the course of the present invention, the genomes of a virulent H. meleagridis strain as well as of an attenuated H. meleagridis strain were sequenced to obtain the first whole genome sequences of H. meleagridis. Four genes were identified whose inactivation or disruption by mutation was involved in attenuation. Based on this, the strain of the present invention can be obtained e.g. by guided selection for mutations acquired during passaging or acquired by mutagenesis or, more directly, genome editing such as by CRISPR-Cas. Further, the present invention simplifies and accelerates attenuation of H. meleagridis, in particular also of new genotypes, thereby enabling unimpeded production of vaccines against this commercially important disease in poultry.
The detailed description given below relates to all of the above aspects of the invention unless explicitly excluded.
The majority of early molecular studies focused on the phylogenetic positioning of H. meleagridis, with just a handful of research papers reporting genetic information on few protein coding genes (Bilic & Hess, 2020). Recently, omics-based approaches revealed a transcriptome, as well as the results of proteome and exoproteome analyses (Mazumdar et al, 2017; Monoyios et al, 2017; Monoyios et al, 2018; Mazumdar et al, 2019). However, the complete genome of H. meleagridis is not available in the prior art.
In vitro, the parasite H. meleagridis can typically be propagated only in the presence of bacteria (Hess et al., 2015). H. meleagridis is usually propagated through an in vitro xenic culture, together with turkey or chicken caecal flora. The culture may be set up by inoculating an intestinal content of a bird suffering from histomonosis into a suitable cell culture medium.
In order to standardize this procedure and to obtain a more defined culture, a clonal or mono-eukaryotic culture may be established by transferring a single H. meleagridis cell to fresh medium via micromanipulation (Hess et al., 2006). Further improvement of such culture can be achieved by the replacement of ill-defined caecal bacterial flora by a single bacterial strain, without compromising the virulence of the parasite (Ganas et al., 2012).
In the course of the present invention the genomes of two H. meleagridis strains, a monoxenic clonal virulent and an attenuated strain were sequenced. Both genomes were analysed in respect to their differing virulent phenotypes. Mutations in genes that were inactivated or modified in the course of attenuation were found. Details are disclosed in Example 1.
For stronger attenuation (and, in some cases, better growth in vitro) it is preferred when the H. meleagridis strain has at least two, preferably at least three, especially all of the attenuating features disclosed herein.
For similar reasons, according to a preferred embodiment, the attenuating feature(s) of the strain is/are homozygous (e.g. with respect to attenuating feature (a), (b), (c) and/or (d)).
Vaccine safety is a particular concern in live vaccines. Therefore, it is desirable when the attenuating features are stable, such that the probability for reversion to a virulent form is reduced. Accordingly, in a further preferred embodiment, the inactivation of the gene is a deletion of the gene, preferably a full deletion of the gene (e.g. with respect to attenuating feature (a) or (b)).
According to a further preferred embodiment, the truncating mutation (attenuating feature (c) and/or (d)) is a frameshift mutation or a point mutation leading to a premature stop codon. It is particularly preferred when the truncating mutation of attenuating feature (c) has the coding sequence identified by SEQ ID NO: 5 or a coding sequence with at least 95%, preferably at least 96%, more preferably at least 97%, even more preferably at least 98%, yet even more preferably at least 99%, especially at least 99.5% or even at least 99.9% sequence identity thereto (i.e. to the entire sequence identified by SEQ ID NO: 5). In addition, or alternatively thereto, it is particularly preferred when the truncating mutation of attenuating feature (d) has the coding sequence identified by SEQ ID NO: 6 or a coding sequence with at least 95%, preferably at least 96%, more preferably at least 97%, even more preferably at least 98%, yet even more preferably at least 99%, especially at least 99.5% or even at least 99.9% sequence identity thereto (i.e. to the entire sequence identified by SEQ ID NO: 6).
In a further preferred embodiment, the strain has attenuating feature (a), wherein a genomic PCR of the strain with forward primer AGGATGTTTCAATTTCCTCGC (SEQ ID NO: 7) and reverse primer CGGTTGTCCATTTTTCAAACAG (SEQ ID NO: 8) does not yield a product. In yet another preferred embodiment, the strain has attenuating feature (b), wherein a genomic PCR of the strain with forward primer GCGGGAAAACAAACGAAAC (SEQ ID NO: 9) and reverse primer ATAGCCATTGGTCCTGGTC (SEQ ID NO: 10) yields a product with a size between 850 bp to 950 bp (e.g. 894 bp) comprising the sequence identified by SEQ ID NO: 15 or a sequence with at least 90%, preferably at least 93%, more preferably at least 95%, even more preferably at least 97.5%, yet even more preferably at least 98%, especially at least 99% sequence identity thereto (i.e. to the entire sequence identified by SEQ ID NO: 15).
In another preferred embodiment, the strain has attenuating feature (c), wherein a genomic PCR of the strain with forward primer TTGATTATGGGGCAACAGAAG (SEQ ID NO: 11) and reverse primer TTGGCGAAGTCTTTCAAGAG (SEQ ID NO: 12) yields a product with a size between 450 bp to 550 bp (e.g. 488 bp) comprising the sequence identified by SEQ ID NO: 16.
According to another preferred embodiment, the strain has attenuating feature (d), wherein a genomic PCR of the strain with forward primer AAATGTTATCCATCGTGACCTC (SEQ ID NO: 13) and reverse primer GATAGCCTTCTTTGGCTTCC (SEQ ID NO: 14) yields a product with a size between 350 bp to 450 bp (e.g. 409 bp) comprising the sequence identified by SEQ ID NO: 17.
In the context of the present invention, for introducing at least one attenuating feature as disclosed herein into H. meleagridis cells, all methods known in the art may be used. For instance, based on the gene sequences and coding sequences disclosed herein (in particular SEQ ID NOs: 1-4), targeted gene modification or knock out may be performed, in particular by CRISPR-Cas9. CRISPR-Cas9 methods have already been established in trichomonads, see e.g. Janssen et al., 2018, and Molgora et al., 2021; especially these methods may be used for the present invention. Alternatives to CRISPR-Cas9 are also available, such as gene knockout or gene replacement via selection markers, which has been established in trichomonads for a long time (see e.g. Land et al, 2003 and Bras et al, 2013. The attenuating features may also be introduced with less targeted approaches (e.g. if vaccination with genetically modified organisms is not allowed under certain regulatory regimes) long known in the art, such as by random mutagenesis followed by screening for appropriate mutants or by longer periods of in vitro cultivation followed by screening for appropriate mutants (in particular for mutants having an inactivation of the gene with the sequence identified by SEQ ID NO: 1, as this inactivation turned out to facilitate in vitro growth, thereby conferring a selective advantage).
For the present invention, the attenuating features disclosed herein can be introduced into virtually any isolate of H. meleagridis. Since also homogeneity of the obtained culture is usually preferred, it is a preferred embodiment of the present invention to start with a clonal culture of H. meleagridis, preferably a clonal culture established by micro-manipulation of a H. meleagridis culture. Such clonal cultures have been disclosed e.g. in EP 1 721 965 A and contain only H. meleagridis derived from a single cell. Such cultures are therefore homogeneous with respect to the parasite component of the culture and specifically preferred for making the strains and vaccines against H. meleagridis infections.
Typically, the strain or vaccine also comprises a bacterial component (which supports growth). According to a further preference, the strain is a single bacterial strain culture (as disclosed in WO 2014/006018 A1), for instance a single bacterial strain culture consisting of H. meleagridis and E. coli.
The vaccine according to the present invention is specifically for the prevention of histomonosis in birds, preferably in poultry, especially in turkey and chicken, and in game birds, especially pheasant, partridge, guinea fowl and quail.
The pharmaceutically acceptable excipient in the vaccine according to the present invention can be any compound usually contained in a vaccine, especially in a poultry vaccine. The pharmaceutically acceptable excipient can therefore be a buffer, an adjuvant, especially aluminium hydroxide, a preservative, a filler, a stabiliser, a nutrient, and usually consists of a combination of two or more of such compounds.
The vaccine can be formulated in any form suitable for a vaccine, e.g. as a tablet, especially a coated tablet, a capsule, a water-in-oil emulsion, a food product, a spray formulation, a liquid formulation, especially an additive to drinking water, an injectable formulation, especially already packaged in a syringe, as gel, as gel pad or combinations thereof. The formulation as a gel has turned out to be particularly effective for vaccinating flocks.
The vaccine according to the present invention usually comprises at least one pharmaceutically acceptable carrier or diluent such as water, saline, culture fluid, stabilisers, carbohydrates, proteins, protein containing agents such as bovine serum or skimmed milk and buffers or any combination thereof as pharmaceutically acceptable non-biological formulation compound. The stabiliser may be SPGA. SPGA contains 0.218 M sucrose (74.62 g), 0.00376 M KH2PO4 (0.52 g), K2HPO4 0.0071 M (1.25 g), potassium glutamate 0.0049 M (0.912 g) and 1% serum albumin (10 g). Various modifications of the foregoing amounts of ingredients of SPGA are known to those skilled in the art and sodium glutamate is frequently substituted for potassium glutamate, but the modified compositions are still designated as SPGA. For example, an SPGA stabilizer may contain monosodium glutamate rather than monopotassium glutamate; another SPGA stabilizer contains per liter of sterile distilled water, 74.62 g sucrose, 0.45 g KH2PO4, 1.35 g K2HPO4, 0.956 g monosodium L-glutamate, and 40 ml of a 25% solution of albuminosol (human albumin). In general, an SPGA stabilizer contains from about 2 to about 10% of sugar, e.g. sucrose; from about 0.05 to about 0.3% of a mono- or dibasic alkali metal phosphate salt or mixture thereof, e.g. KH2PO4, K2HPO4, NaH2PO4, or Na2HPO4, from about 0.05 to about 0.2% of a glutamic acid alkali metal salt, e.g. sodium or potassium glutamate; and from about 0.5% to about 2% serum albumin, e.g. bovine serum albumin or human albumin. Various substitutions of ingredients in the formulation of SPGA stabilizer can be made. For example, a starch hydrolysate, e.g. glucose or dextran may be substituted wholly or partly for sucrose and casein or PVP may be substituted wholly or partly for albumin. The carbohydrates include, for example, sorbitol, mannitol, starch, sucrose, glucose, dextran or combinations thereof. Additionally, proteins such as albumin or casein or protein containing agents such as bovine serum or skimmed milk may be useful as pharmaceutically acceptable carrier or diluents. Buffers for use as pharmaceutically acceptable carriers or diluents include maleate, phosphate, CABS, piperidine, glycine, citrate, malate, formate, succinate, acetate, propionate, piperazine, pyridine, cacodylate, succinate, MES, histidine, bis-tris, phosphate, ethanolamine, ADA, carbonate, ACES, PIPES, imidazole, BIS-TRIS propane, BES, MOPS, HEPES, TES, MOPSO, MOBS, DIPSO, TAPSO, TEA, pyrophosphate, HEPPSO, POPSO, tricine, hydrazine, glycylglycine, TRIS, EPPS, bicine, HEPBS, TAPS, AMPD, TABS, AMPSO, taurine, borate, CHES, glycine, ammonium hydroxide, CAPSO, carbonate, methylamine, piperazine, CAPS, or any combination thereof. The vaccine formulation may be lyophilized or freeze-dried. In some embodiments the vaccine according to the present invention may further comprise at least one adjuvant (in particular if the cells are inactivated). Examples of adjuvants include Freund's complete adjuvant or Freund's incomplete adjuvant, vitamin E, non-ionic block polymers, muramyldipeptides, saponins, mineral oil, vegetable oil, carbopol aluminium hydroxide, aluminium phosphate, aluminium oxide, oil-emulsions (e.g. of Bayol F® or Marcol 52®), saponins or vitamin-E solubilisate or any combination thereof. In some embodiments the vaccine may comprise adjuvants particularly useful for mucosal application for example E. coli heat-labile toxin or Cholera toxin. The vaccine formulation according to the present invention may be administered opthalmically (eye drop), in ovo, intradermally, intraperitoneally, intravenously, subcutaneously, orally, by spray vaccination, via the cloaca or intramuscularly. Eye drop, in ovo and spray administration are preferred when the subject is poultry. Spray administration is particularly preferred to administer the vaccine formulation to large numbers of subjects. It is specifically preferred to provide the vaccine according to the present invention in capsuled or coated form. This allows suitable preservation of the bacterium/protozoa mixture.
The vaccine according to the present invention preferably contains 1×102 to 1×106, preferably 1×103 to 5×105, especially 5×103 to 1×105 H. meleagridis cells per dose and/or 1×105 to 1×1011, preferably 1×107 to 5×1010, especially 5×107 to 1×1010 bacterial cells (such as E. coli) per dose.
According to a preferred embodiment, the vaccine according to the present invention is formulated as a dose form, i.e. it is already formulated to be administered without further partition/formulation/separation steps.
The term “preventing” or “prevention” as used herein means to stop a disease state or condition from occurring in a bird completely or almost completely or at least to a (preferably significant) extent, especially when the bird is predisposed to such a risk of contracting a disease state or condition.
“Percent (%) sequence identity” with respect to a reference nucleotide sequence is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Gaps cause a lack of identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2, Megalign (DNASTAR) or the “needle” pairwise sequence alignment application of the EMBOSS software package. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, however, % nucleotide sequence identity values are calculated using the sequence alignment of the computer programme “needle” of the EMBOSS software package (publicly available from European Molecular Biology Laboratory; Rice et al., EMBOSS: the European Molecular Biology Open Software Suite, Trends Genet. 2000 June; 16(6):276-7, PMID: 10827456).
The needle programme can be accessed under a web site or downloaded for local installation as part of the EMBOSS package. It runs on many widely-used UNIX operating systems, such as Linux.
To align two nucleotide sequences, the needle programme is preferably run with the following parameters:
The % nucleotide sequence identity of a given nucleotide sequence A to, with, or against a given nucleotide sequence B (which can alternatively be phrased as a given nucleotide sequence A that has or comprises a certain % nucleotide sequence identity to, with, or against a given nucleotide sequence B) is calculated as follows:
100 times the fraction X/Y
“Sequence similarity”, “sequence identity”, “sharing a sequence” and similar terms shall also apply to the reverse complement of a sequence, i.e. the expression “sequence A is 80% identical to sequence B” shall also be true if “sequence A is 80% identical to the reverse complement (or antisense sequence) of sequence B”.
The present invention is further illustrated by the following figures and examples, without being restricted thereto.
Materials & Methods
Protozoan Cultures
Next generation sequencing experiments were performed using virulent and attenuated, monoxenic mono-eukaryotic H. meleagridis cultures propagated in vitro, both of which were derived from the same H. meleagridis cell. Cultivation was performed in the presence of E. coli DH5α. The cultures were incubated at 41° C. in Medium 199 containing Earl's salts, (Gibcom™, Invitrogen GmbH, Austria) supplemented with 15% heat-inactivated foetal bovine serum (FBS) (Gibco™, Invitrogen GmbH, Austria) and 0.25% of sterilized rice starch (Carl Roth GmbH+Co. KG, Germany). Cells were passaged every 3 days by transferring 2 ml of the old culture into a new T25 flask (Sarstedt, Inc., Germany).
In order to remove majority of the bacteria before sequencing, H. meleagridis cells were purified through a series of washing steps using pre-warmed M199 media without serum (Monoyios et al, 2017). The cell pellets were immediately frozen at −80° C. until further use.
DNA Extraction
For Illumina sequencing, DNA was extracted with QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). The extraction of high molecular weight DNA, used for MINion sequencing, was performed according to a previously published protocol (Nicholls et al, 2019). Briefly, 108 cells were pelleted by centrifugation at 4500×g for 10 min. The cells were re-suspended in 10 ml TLB (10 mM Tris-Cl pH 8.0, 25 mM EDTA pH 8.0, 0.5% (w/v) SDS, 20 μg/ml RNase A (Qiagen, Hilden, Germany)), vortexed at full speed for 5 seconds and incubated at 37° C. for 1 hour, with gentle mix by inversion every 30 minutes. Then, complete 100 μl of Proteinase K (Qiagen, Hilden, Germany) were added to obtain a final concentration of 200 μg/ml. The solution was gently mixed by inversion and incubated at 50° C. for 2 hours, with slow end-over-end rotations every 30 minutes. After completion, the sample was centrifuged at 200×g, and the viscous supernatant containing cell lysate was distributed into two 15 ml Falcon tubes prepared with phase-lock gel. Then, 5 ml of TE-saturated phenol pH 7.5 (Sigma-Aldrich) were added to the lysates and placed on a rotator at 20 rpm for 10 minutes. The preparations were centrifuged at 3000×g for 10 minutes and the aqueous phases were poured into two new 15 ml tubes containing phase-lock gel; followed by the addition of 2.5 ml buffer saturated phenol pH 7.5 and 2.5 ml chloroform-isoamyl alcohol 24:1 mix to each tube. Phase separation was carried out as described above and both aqueous phases were combined. The DNA was precipitated by the addition of 4 ml 5M ammonium acetate and 30 ml ice-cold 96% ethanol, for 4 days at −20° C. Precipitated DNA was collected by centrifugation at 10,000×g and washed twice in 70% ethanol. After the final spin down, the sample was air dried for 15 minutes at room temperature and 200 μl EB (10 mM Tris-Cl pH8, 0.02% (v/v) Triton X-100) were added to the DNA pellet that was kept at +4° C. until completely dissolved. DNA quantity and quality were assessed using Qubit™ dsDNA BR Assay Kit (Invitrogen, Life technologies), NanoDrop 2000 (Thermo Fisher Scientific) and Agilent 4200 TapeStation System using Genomic DNA Screen tape (Agilent technologies).
Illumina Sequencing
For each H. meleagridis strain a paired-end Illumina library was prepared from 1.5 μg DNA using TruSeq DNA PCR-Free Library Kit (Illumina). Sequencing (150 bp PE) was carried out on Illumina HiSeq 3000/4000 platform. Resulting reads were imported into CLC Genomics Workbench 12.0 quality trimmed and adapters were removed. The processed reads were assembled into contigs using the De Novo Assembly workflow.
Libraries for Nanopore sequencing were prepared from 0.8 μg of high molecular weight H. meleagridis DNA using SQK-LSK109 1D ligation kit (Oxford Nanopore Technologies, Oxford, UK). Libraries were sheared by using the g-TUBE (Covaris) and centrifuged at 6,000 rpm in an Eppendorf 5424 centrifuge for 2×1 min, inverting the tube between centrifugations. DNA repair (NEBNext® FFPE DNA Repair Mix, M6630S, New England Biolabs GmbH, Frankfurt am Main, Germany) and End repair/dA-tailing (NEBNext® Ultram II End Repair/dA-Tailing Module, New England Biolabs GmbH, Frankfurt am Main, Germany) were performed by adding 27 μl nuclease-free water (NFW), 3.5 μl FFPE Repair Buffer, 2 μl FFPE DNA Repair Mix, 3.5 μl Ultra II End-prep reaction buffer and 3 μl Ultra II End-prep enzyme mix to 20 ul of the previously sheared DNA in a 0.2 ml thin-walled PCR tube. Using a thermocycler, the mixture was incubated at 20° C. for 5 minutes and 65° C. for 5 mins. The preparation was transferred to a 1.5 ml Eppendorf DNA LoBind tube and cleaned up using a 60 μl of Agencourt AMPure XP beads (Beckman Coulter Life Sciences, Vienna, Austria), incubated at room temperature with end over end mixing for 5 min, washed twice with 200 μl fresh 70% ethanol and allowed to air dry for 30 seconds. Adapter Ligation was performed by adding 60 μl DNA sample from the previous step, 25 μl Ligation Buffer (LNB), 10 μl T4 DNA Ligase (NEBNext® Quick Ligation Module) and 5 μl Adapter Mix (AMX) in a 1.5 ml Eppendorf DNA LoBind tube, incubating the preparation at room temperature for 10 min. The adaptor-ligated DNA was cleaned up by adding 40 μl of Agencourt AMPure XP beads (Beckman Coulter, Life Sciences, Vienna, Austria), incubated at room temperature with end over end mixing for 5 min. The beads were washed twice with 250 μl Long Fragment Buffer (LFB) and allowed to air dry for 30 seconds. The DNA was eluted by adding 15 μl Elution Buffer (EB) and incubated for 10 minutes at 37° C. Flow Cell Priming was carried out with the introduction of 800 μl of the priming mix into the flow cell via the priming port, with a 5-minute incubation period. The DNA Library was prepared for loading adding 37.5 μl Sequencing Buffer (SQB) and 25.5 μl Loading Beads (LB) to 12 μl of the previously generated DNA Library. Flow cells (FLO-MIN106) were run with the standard MinKNOW software. Base calling option was enabled for a run duration of ˜48 h, with a Bias Voltage of −180 mV and time between mux scans of 1.5 h.
Genome Assembly and Annotation
For processing of Nanopore reads, FAST5 files were converted to FASTQ using the Guppy basecaller followed by adapters trimming with Porechop. A draft assembly was generated using Flye (parameters −g 50 m—meta) from the Nanopore reads. To scan for E. coli contigs and contaminations, the draft assembly was divided into 1 Kb windows and analyzed through the Taxonomic Profiling tool of CLC Genomics Workbench 12, Microbial Genomics Module (Qiagen, Hilden, Germany) against the complete bacterial genome database. Contigs matching in their entirety to bacteria were removed from the draft assembly. For assembly refining, Illumina reads were subsampled to 30 million and aligned to the draft assembly by minimap2 (Li, 2018) (default parameters) followed by three rounds of refining with racon (Vaser et al, 2017) (default parameters). The quality of the refined assembly was evaluated in the following way: a reference assembly made only from Illumina reads was constructed using the De Novo Assembly tool from CLC Genomics Workbench 12 (Qiagen, Hilden, Germany), as Illumina reads have higher base-level accuracy compared to Nanopore reads. Then, the average similarity between the refined assembly and the Illumina assembly was computed by the program dnadiff of the MUMmer package (Marcais et al, 2018). To evaluate genome completeness, a set of eukaryotic core genes was downloaded from the CEGMA web page and BLASTed to the refined assembly (E-value<10−3) in order to estimate the percentage of eukaryotic core genes in the refined assembly. For genome annotation, the transcriptome dataset from Mazumdar et al., 2017, was used as input for training of the AUGUSTUS gene predictor using the web interface of this tool (Hoff & Stanke, 2013). After training, the local version of AUGUSTUS (Stanke et al., 2006) was run on the refined assembly of each strain (parameters—strand-both—genemodel=partial). Functional annotation of coding genes was made using the Blast2GO tool from CLC Genomics Workbench 12 (Qiagen, Germany). Annotation of repetitive sequences and transposons was performed by RepeatMasker 4.0.7 assessed in November 2019 (parameters—species “trichomonas”) (Smit et al, 2013).
Identification of variants between the genomes of virulent and attenuated H. meleagridis strains
For variants identification (single-nucleotide polymorphisms—SNPs—and indels), the assembly of the attenuated strain was aligned against the virulent strain using nucmer from the MUMmer package (Marcais et al, 2018) followed by variant calling with the show-snps tool (parameters -C -l -r). To validate the accuracy of variant calling, Illumina reads from both strains were aligned to the assembly of the virulent strain with Bowtie2 (default parameters) (Langmead & Salzberg, 2012). Then, variants with minimum coverage of 30 in both strains and minimum reference allele frequency of 80% were regarded as true homozygous SNPs (or indels) between the two strains. SNPs located in coding regions were extracted and their potential impact on protein stability was predicted using the online tool PROVEAN (Choi & Chan, 2015).
Confirmation of variants between virulent and attenuated strains
In order to validate variants that caused premature stops in the corresponding coding regions, conventional PCRs were performed. To confirm the two deletions, conventional and real-time PCRs were employed. Real-time PCRs were done in 20 μl reaction mixture on the AriaMx real time cycler (Agilent Technologies, USA) using Brilliant III UltraFast qPCR Master Mix (Agilent Technologies, USA) with 30 nM ROX as reference dye, 500 nM primers and 100 nM TaqMan probe. Thermal profile of real-time reactions was as follows: 15-minute at 95° C., followed by 40 cycles of 15 seconds at 95° C. and of 30 seconds at 60° C. Fluorescence was detected and reported at each cycle during the 60° C. step. All conventional PCRs were performed in 25 μl reaction by using HotStar Taq Master Mix Kit (Qiagen, Vienna, Austria) and 0.4 μM of each primer. Thermo-cycling conditions for all conventional PCRs were: one cycle of 95° C. for 15 minutes; 40 cycles of 95° C. for 30 seconds, 51° C. or 52° C. (depending on the target region) for 30 seconds and 72° C. for 1 minute; followed by final elongation step at 72° C. for 10 minutes. Amplification products (25 μl) were electrophoresed in a 1.0% Tris acetate-EDTA-agarose gel, stained with ethidium bromide and visualized under UV light (Biorad Universal Hood II, Bio-Rad Laboratories, California, USA). Fragment sizes were determined with reference to a lkb ladder (Invitrogen, Life Technologies, Austria). Amplification products (25 μl) were electrophoresed in a 1.0% Tris acetate-EDTA-agarose gel, stained with ethidium bromide and visualized under UV light (Biorad Universal Hood II, Bio-Rad Laboratories, California, USA). Fragment sizes were determined with reference to a 1 kb ladder (Invitrogen, Life Technologies, Austria). PCR products of the expected sizes were excised from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Vienna, Austria) according to the manufacturer's instructions. Direct fluorescence-based sequencing was performed by LGC Genomics GmbH (Berlin, Germany) using the PCR primers.
Sequences
Further sequence information with respect to the attenuating features found in the course of the present invention:
(a)
The whole genomes of two H. meleagridis strains—a virulent and an attenuated strain—were sequenced and annotated with the goals of expanding genomic information on this important poultry pathogen and investigating the genomic basis of attenuation. The strains used for whole genome sequencing originated from a single parasitic cell that was transferred via micromanipulation from the initial culture into the fresh suitable medium, establishing a so called “mono-eukaryotic clonal culture”. Further prolonged in vitro cultivation resulted in the attenuation of the parasite. As aliquots of every cultivation passage were cryopreserved, retracement to the original virulent H. meleagridis was possible.
In order to achieve megabase-sized contigs with high base-level accuracy, the genomes of both strains were assembled using a combination of ONT long reads and Illumina short reads. The genome of H. meleagridis is 43 Mb in size, is GC poor (28%) and contains about ˜11,000 genes, with little variation between strains. Introns are scarce, with 5.2-5.7% of genes containing at maximum one intron. Repetitive regions account for about ˜2% of the genome in both strains and include microsatellites (1.63-1.75%), low complexity sequences (0.51-0.53%) and different classes of transposable elements. The overall genome duplication level in H. meleagridis was computed directly as the fraction of the genome that is duplicated instead of inferring this figure by indirect methods (i.e. Manekar & Sathe, 2019). To calculate this, the contigs were aligned to themselves with nucmer and extracted homologous regions with the show-coords tool (Marcais et al, 2018). This resulted in a duplication level of 20% for both strains. To evaluate the accuracy of the assemblies three metrics were employed: i) base-level accuracy, ii) presence of eukaryotic core genes and iii) completeness of gene models. Base-level accuracy was computed by aligning the assembly of each strain to another assembly generated using only Illumina read and computing the average genome similarity with the dnadiff (Marcais et al, 2018) tool, based on the assumption that accuracy from Illumina reads is higher compared to the ONT reads (McNaughton et al., 2019). Using this approach, 99.82% accuracy for the virulent strain and 99.79% for the attenuated strain were obtained. Next, the percentage of eukaryotic core genes was computed from the CEGMA database using BLAST. Out of total 458 core genes 395 (86%) in the virulent strain were detected and 395 (86%) in the attenuated strain, with 100% overlap between the two datasets, which was in accordance with the high similarity in gene content between strains. Last, the completeness of gene models was evaluated by classifying the CDS into complete (having stop and start codon) or partial (having only stop or only start) and found that 100% of the genes have complete CDS in both strains, underlining the high quality of the assemblies. To get an overview of genomic rearrangements for both assemblies, the contigs were aligned from the virulent strain to the attenuated strain using MAUVE (Darling et al, 2004). The alignment shows high colinearity between the two strains, no genomic rearrangements within contigs and two inverted contigs in the attenuated strain (
Differences in Gene Content Between Strains
In order to find strain-specific losses/deletions or gene duplications that have occurred during the prolonged passaging of H. meleagridis, gene content between the two sequenced strains was compared. For this analysis, the protein sequences of both strains were clustered using OMA (Altenhoff et al, 2019) to detect gene families. A total of 11,119 genes from the virulent strain and 11,137 genes from the attenuated strain were clustered into 10,063 gene families. From this dataset, 400 genes were extracted that were found only in the attenuated strain and 281 of them aligned to the virulent strain using Exonerate (Slater & Birney, 2005) (parameters-model protein2genome −percent 90−bestn 1), indicating that these genes simply represent missing annotations in the attenuated strain. Of the remaining 119 genes, five of them (g8917att→g8921att on contig 49) had no support from Illumina reads in the virulent strain, pointing to a deletion in the virulent strain. As these genes did not have any marked functional annotation, additional BLAST searches were conducted, which revealed that these five genes belonged to a phage contamination located on a chimeric contig. Using the same approach, 335 genes were extracted that were found only in the virulent strain and found that 234 of them aligned the attenuated strain using Exonerate. Of the remaining 101 genes, 99 of them had full support from Illumina reads, indicating missing annotations, while two of them (g6116vir on contig 40 and g7085vir on contig 51) had only partial support from Illumina reads in the attenuated strain (
Confirmation of Gene Deletions
In order to confirm deletions of g6116vir and g7085vir in the attenuated strain and narrow the time point, i.e. passage number, when the deletion occurred, a range of different passages was tested for the presence/absence of loci by conventional and real-time PCR. The g6116vir deletion was confirmed in the attenuated strain. The analysis showed that the deletion of the g6116vir occurred already in the xenic background between the passage 83 and 145. In addition, testing low and high passages of other unrelated H. meleagridis strains, grown as xenic clonal cultures, demonstrated that g6116vir did not change and remained as wild type throughout the in vitro cultivation.
Variants Identification Between Strains
Next, SNPs and indels between strains were analyzed to find variants affecting the coding regions (non-synonymous and missense mutations), as these are correlated with a change of gene function that occurred during the attenuation process. The critical step in this analysis is to distinguish true variants from sequencing errors introduced by the ONT reads (layer et al., 2015). After aligning the genome of the attenuated to the virulent strain with nucmer, an initial set of 17,170 SNPs was identified using the show-snps tool (Marcais et al, 2018). After removing sequencing errors (see Methods, Identification of variants between strains, above), a filtered set of 68 homozygous SNPs and 2933 heterozygous SNPs was obtained. Only homozygous SNPs were considered for the following analyses. Of the 68 homozygous SNPs, 17 were located within coding regions: of these, 4 were synonymous, 12 non-synonymous and 1 caused a premature stop codon in a protein of the attenuated strain (g337att) (
Confirmation of Variants
Similar to the confirmation of gene deletions, virulent and attenuated H. meleagridis strains from monoxenic cultivation were analyzed, which were used for NGS analysis, for the presence/absence of both truncating mutations, the SNP and the indel, by conventional PCR coupled with Sanger sequencing of PCR products. In order to narrow the timepoint in which the mutations occurred, a set of xenic cultures of different passages spanning the period during which the attenuation occurred was used for this analysis. Both truncating mutations could be confirmed in the attenuated strain grown as monoxenic culture, whereas the gene was intact in the virulent strain grown under same conditions. Moreover, the analysis showed that both the SNP and the indel already occurred in xenic conditions with the indel appearing between passage 83 and 145, and the SNP occurring later between passages 145 and 237.
Discussion
Comparison of the two H. meleagridis genomes (of the virulent and an attenuated strain, respectively) with each other showed that the gene content is very similar between the two strains, which was expected considering that the origin of both strains can be traced to a same parent cell. But it also singled out two coding regions that showed only partial support from Illumina reads in the attenuated strain. This indicated that during long term in vitro cultivation a deletion within these genes occurred in the virulent strain, which during this process became attenuated. In addition to confirming the g6116vir deletion independently in the attenuated strain, it was demonstrated that the deletion occurred already during in vitro cultivation in xenic conditions between passage 83 and 145, and not in the course of the monoxenization process through which both virulent and attenuated strains went independently. The gene g6116vir encodes for a hypothetical protein, however further BLAST searches revealed that the orthologue of g6116vir in T. vaginalis encodes for a putative cell-surface adhesin. The probable membrane association of g6116vir is supported by the presence of a transmembrane domain towards the C-terminus. This potential surface adhesin function and its loss in the attenuated strain speaks for its role in the virulence of the parasite. Aside from the role in virulence of H. meleagridis, the loss of protein encoded by g6116vir is supportive for the adaptation to the in vitro growth. Long-term cultivated parasites, which lack this gene, turned out to be much easier to cultivate and grow to much higher numbers in vitro than the parasites that were in culture for just few passages.
Further investigations on determining possible genes involved in the attenuation focused on the analysis of SNPs and indels between two genomes. A total of 13 homozygous nonsynonymous SNPs were detected in coding regions, with one of them resulting in the truncation of the protein in the attenuated strain due to the premature stop codon. The affected gene, g8794vir/g337att, encodes for LRR domain containing protein. As compared to its wild type partner in the virulent strain (g8794vir), the g337att lacks a second LRR domain located at the C-terminus, and by that may represent a pseudogenization event. This mutation was identified by the PROVEAN software tool as deleterious.
The analysis identifying indels that modify coding regions detected a single event, which due to the frameshift introduced an exchange of 38 amino acids and a premature stop codon. The gene g8786vir and its counterpart in the attenuated strain (g346att), encode a serine/threonine kinase as judged by the presence of the protein kinase ATP binding site and the serine/threonine kinase site in both coding sequences. However, due to the indel the g346att lacks a C-terminally located pleckstrin homology (PH) domain, which binds phosphoinositides and by that targets the protein to the cellular membrane. The frameshift that occurred in the mutated g346att changed the last 38 amino acids, that now are predicted to form a short transmembrane domain at the C-terminus. The functionality prediction by PROVEAN tool characterized the mutant as deleterious. The fact that its transcript could not be detected in the transcriptome of the in vitro grown parasites indicates that g8786vir/g346att might only be expressed in vivo, during the infection of the host. Expression during infection of the host is typical for virulence factors.
In conclusion, combining the sequence data from two conceptually different sequencing platforms: Nanopore long reads and Illumina short reads enabled us to assemble high-quality genome sequences from two phenotypically different H. meleagridis strains, a parasite with limited sequence data available so far. Two gene deletions and two gene truncations differing between virulent and attenuated strain were found, as disclosed above.
An H. meleagridis strain having all of attenuating features (a)-(d) disclosed hereinabove is cultivated with a single bacterial strain (namely an E. coli strain). The cells are pelleted and washed in phosphate-buffered saline. Then, phosphate-buffered saline with guar gum as a thickener is added. Thereby, a live H. meleagridis vaccine with a bacterial component is obtained.
This vaccine is administered orally (at about 1×105 H. meleagridis cells per dose) to 30 one-day-old turkeys (Converter, Hybrid Europe, Malguénac, France). Feed (commercial turkey starter feed) and water are provided ad libitum, except for a 5-hour period of feed restriction immediately after administration.
| Number | Date | Country | Kind |
|---|---|---|---|
| 21182469 | Jun 2021 | EP | regional |
| Number | Date | Country |
|---|---|---|
| WO 2014006018 | Jan 2014 | WO |
| Entry |
|---|
| Hess, M., et al., “Cloned Histomonas meleagridis passaged in vitro resulted in reduced pathogenicity and is capable of protecting turkeys from histomonosis”, Vaccine, (2008), pp. 4187-4193, vol. 26. |
| European Search Report dated Jan. 14, 2022 for European Application No. 21182469.3-1118. |
| Number | Date | Country | |
|---|---|---|---|
| 20230045943 A1 | Feb 2023 | US |
