Bacillus strain and harmful organism controlling agents

Abstract

A novel crystal protein as an effective ingredient in harmful organism controlling agents, Bacillus thuringiensis var. japonensis strain N141 producing the protein, and a gene coding for the protein. This novel strain produces an insecticidal crystal toxin and is useful for a harmful organism controlling agent.

Description

FIELD OF THE INVENTION

The present invention relates to novel Bacillus thuringiensis var. japonensis strain N141, hereinafter sometimes abbreviated as N141, an insecticidal crystal protein produced thereby, a gene coding for the protein, and a harmful organism controlling agent comprising the protein.

BACKGROUND OF THE INVENTION

Bacillus thuringiensis, hereinafter abbreviated as Bt, and crystalline toxic proteins produced thereby are very useful as microbial pesticides, which do not pollute the environment (Bt agents), particularly as insecticides against lepidopterous insect pests, and in practice have been widely used in the world.

Bt is a gram-positive bacilliform bacterium which produces a crystal protein at the sporulation stage in the end of the logarithmic growth phase. When orally taken into the mid-gut of an insect, the crystal protein will be subjected to alkaline and enzymatic activation in the digestive juice to show insecticidal activities accompanied with paralyses. However, the protein does not show any toxicity to mammals. The crystal proteins produced by Bt are generally of so-called diamond-shaped, bipyramidal or rhomboidal form. These crystal proteins are formed with endospores in the sporangium and released from the sporangium together with the endospores (Hannay, C. L.; Nature, 172, 1004 (1953)).

Bt has been classified on the basis of H-antigen according to the proposal by De Barjac and Bonefoi (Entomophaga, 7, 5-31 (1962)). A large number of subspecies have been found up to now.

The insecticidal activities of these strains are highly specific and may vary with subspecies. For example, it has been known that the subspecies kurustaki and aizawai show activities against lepidopterous insects while other subspecies tenebrionis and japonensis buibui are active against coleopterous insects.

In practice, however, each of strains belonging to the same subspecies has a different insecticidal activity spectrum. Some of lepidopterous pests may have acquired resistance to the Bt strain which showed an activity against the lepidopterous pests. Further, few strains have been reported which show an effective activity against coleopterous insects.

Thus, novel Bt agents would be desirable which are also effective against the lepidopterous pests having resistance to some known Bt agents. Also, there is a need for Bt agents having an activity against coleopterous insects.

SUMMARY OF THE INVENTION

The present inventors have found a novel strain producing a crystalline protein which has an excellent insecticidal activity against lepidopterous and coleopterous insects and attained the present invention.

Accordingly, the present invention is concerned with a novel strain N141 of Bacillus thuringiensis var. japonensis which has been originally deposited at National Institute of Bioscience and Human-Technology (NIBH), Agency of Industrial Science and Technology, Ministry of International Trade and Industry, Tsukuba, Japan on Oct. 6, 1994 under Accession Number FERM P-14576. This strain has been transferred to the deposit under Budapest Treaty conditions on Sep. 25, 1995 under Accession Number FERM BP-5241.

According to another aspect of the present invention, there is provided a harmful organism controlling agent comprising as a main ingredient an insecticidal crystal protein produced by N141, hereinafter abbreviated as N141 crystal protein. Further, the present invention provides a method of protecting a plant from damage caused by a pest which comprises applying the pest with the N141 crystal protein.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is an electron microscopic photograph of Bacillus thuringiensis var. japonensis strain N141.

FIG. 2 shows a comparison of homology between the N-terminal 662 amino acids encoded by Bacillus thuringiensis var. japonensis N141 gene and the amino acid sequence encoded by Bacillus thuringiensis buibui gene.

FIG. 3 depicts the cassette pBN141 comprising Bacillus thuringiensis var. japonensis N141 gene inserted into a vector.

DESCRIPTION OF THE INVENTION

The novel strain N141 was isolated by a conventional method for isolating a bacterium of the genus Bacillus forming thermostable spores. Namely, a suspension of soil taken in Saitama, Japan was subjected to heat treatment at 50.degree. to 90.degree. C. and cultivated in a standard plating medium such as NB plate media to isolate the strain.

Features of the Novel Strain N141 Colony formation: An opaque white colony with an irregular border. Cell morphology in the growth phase: Typical of Bt. Serotype of H-antigen: 23, japonensis. Intracellular component: A sporulating cell produces an amorphous crystal protein. The electron microscopic photograph of the crystal protein is shown in FIG. 1. Alkali-soluble protein: This strain has a protein which runs to about 130,000 daltons on electrophoresis. Activity: This strain has an insecticidal activity against lepidopterous and coleopterous pests tested. Gene: Using antibodies raised by immunizing guinea pig with the crystal protein of about 130,000 daltons produced by this strain, screening was effected to clone a gene coding for the N141 crystal protein, hereinafter abbreviated as N141 gene. This gene has 3,759 bases and contains a translational region in from 47 to 3,556. Further, as compared with the known japonensis buibui gene having an activity against coleopterous insects (Japanese Patent Application Laying-open No. 65292/1994), this gene has only about 60% of homology in the amino acid sequence level with the known gene as shown in FIG. 2.

From these, the N141 of the present invention is distinguished from known strains and therefore is novel.

N141 strain may be cultivated using known standard media and fermentation methods. Carbon sources may include sucrose, maltose, glucose, fructose, molasses and soluble starch.

Nitrogen sources may include ammonium sulfate, ammonium chloride, cottonseed powder, yeast extract, soybean cake and casein hydrolysate. Minerals and vitamins may be supplied from organic carbon sources or nitrogen sources, such as molasses and yeast extract, and optionally inorganic salts and vitamins may be further added. The cultivation may preferably be carried out at a pH of 5 to 8 and a temperature of 25.degree. to 30.degree. C. for 2 to 5 days in a stirred and aerated system under aerobic conditions.

After cultivation, the insecticidal crystal protein may be isolated from the culture medium in a conventional manner such as centrifugation or filtration.

The N141 crystal protein may be employed as an active ingredient in a harmful organism controlling agent for use in controlling coleopterous and lepidopterous insects. However, the N141 strain itself may also be employed as a crystal toxin-containing ingredient without isolation of the crystalline protein.

When the crystal toxin-containing ingredient is used in a harmful organism controlling agent, it may generally be mixed with a suitable carrier, including a natural mineral fiber such as talc or kaolin, a solid carrier such as diatomaceous earth, or a liquid carrier such as water, and optionally an emulsifier, dispersant, suspending agent, penetrant, spreader and/or stabilizer may be added to formulate into any practical dosage form such as wettable powder, dust, granule or flowable agent.

Optionally, the agent may be formulated or sprayed together with other herbicide, pesticide, fungicide, plant growth-regulator, synergist, attractant, plant nutrient and/or fertilizer so long as they do not interfere with the crystalline toxin.

According to the present invention, the amount of the crystal toxin-containing ingredient applied may vary depending upon an application site, time and method, a pest to be controlled, and a crop to be protected; however, the amount of effective ingredient applied may usually about 0.1 to 99% by weight, preferably about 0.5 to 50% by weight of the agent.

Amounts of various ingredients in the agent of the present invention are exemplified below:

______________________________________ Effective Auxiliary ingredient Carrier Surfactant ingredients______________________________________Wettable powder 1-70 15-93 3-10 0-5Dust 0.01-30 67-99.5 0-3Granule 0.01-30 67-99.5 0-8Flowable agent 1-70 10-90 1-20 0-10______________________________________ All the amounts shown in the above Table are % by weight.

When applied, a wettable powder or flowable agent is diluted with a predetermined amount of water before spraying while a dust or granule is directly sprayed without dilution with water.

Examples of each ingredient used in the agent may be as follows:

(Wettable powder) Effective ingredient: the crystal toxin-containing material according to the present invention; Carrier: calcium carbonate, kaolinite, Zeeklite D, Zeeklite PEP, diatomaceous earth, talc; Surfactant: Sorpol, calcium lignin sulfonate, Lunox; Other ingredients: Carplex # 80. (Dust) Effective ingredient: the crystal toxin-containing material according to the present invention; Carrier: calcium carbonate, kaolinite, Zeeklite D, diatomaceous earth, talc; Other ingredients: diisopropyl phosphate, Carplex # 80. (Granule) Effective ingredient: the crystal toxin-containing material according to the present invention; Carrier: wheat flour, wheat bran, corn grits, Zeeklite D, Other ingredients: paraffin, soybean oil. (Flowable agent) Effective ingredient: the crystal toxin-containing material according to the present invention; Carrier: water; Surfactant: Sorpol, sodium lignin sulfonate, Lunox, Nippol; Other ingredients: ethylene glycol, propylene glycol.

Formulation examples of the harmful organism controlling agent comprising the crystal toxin-containing material according to the present invention as an effective ingredient are given below but the present invention is not limited thereto. All parts are by weight.

______________________________________Formulation Example 1: Wettable powder______________________________________crystal toxin-containing material 25 partsaccording to the present inventionZeeklite PEP (mixture of kaolinite and sericite; 66 partsZeeklite Industry Co.; trade name)Sorpol 5039 (anionic surfactant; Toho Chemical Co.; 4 partstrade name)Carplex #80 (white carbon; Shionogi Pharmaceutical Co.; 3 partstrade name)Calcium lignin sulfonate 2 parts______________________________________

The above ingredients are homogeneously mixed and pulverized to yield a wettable powder.

Upon application, the wettable powder is diluted 500 to 2,000 times and sprayed so that the amount of crystal toxin-containing ingredient applied is 0.1 to 5 kg per hectare.

______________________________________Formulation Example 2: Dust______________________________________crystal toxin-containing material 3.0 partsaccording to the present inventionclay 95 partsdiisopropyl phosphate 1.5 partsCarplex #80 (white carbon; Shionogi Pharmaceutical Co.; 0.5 partstrade name)______________________________________

The above ingredients are homogeneously mixed and pulverized to yield a dust.

Upon application, the dust is sprayed so that the amount of crystal toxin-containing ingredient applied is 0.1 to 5 kg per hectare.

______________________________________Formulation Example 3: Flowable agent______________________________________crystal toxin-containing material 35 partsaccording to the present inventionLunox 1000C (anionic surfactant; Toho Chemical Co.; 0.5 parttrade name)Sorpol 3353 (nonionic surfactant; Toho Chemical Co.; 10 parttrade name)1% aqueous Xanthane gum solution (natural high polymer) 20 partwater 34.5 part______________________________________

The above ingredients except the crystal toxin-containing ingredient of the present invention are homogeneously dissolved, mixed with the crystal toxin-containing material, thoroughly stirred and wet-pulverized in a sand mill to yield a flowable agent.

Upon application, the flowable agent is diluted 50 to 2,000 times and sprayed so that the amount of crystal toxin-containing ingredient applied is 0.1 to 5 kg per hectare.

The method of protecting a plant from damage caused by lepidopterous and/or coleopterous pests according to the present invention generally comprises treating, e.g., by spraying, a plant infected or suspected to be infected with the pest, with the harmful organism controlling agent diluted with a diluent such as water. The effective ingredient of the controlling agent is a toxic .delta.-endotoxin. If desired, the toxic .delta.-endotoxin may be applied in an isolated form separately from a bacterium producing the toxin to the plant or infectious pest. Generally, however, it is not necessary to isolate the crystalline protein from the bacterium.

Pests which may be destroyed by the method of the present invention include insects of the order Lepidoptera or Coleoptera.

Lepidopterous insects may include armyworms, such as common cutworm (Spodoptera litura), beat armyworm (Spodoptera exigua) and cabbage armyworm (Mamestra brassicae); diamondback moth (Plutella xylostella), rice leafroller (Cnaphalocrocis medinalis), rice stem borer (Chilo suppressalis), rice skipper (Parnara guttata), common white (Pieris rapae crucivora), oriental moth (Monema flavescens) and common yellow swallowtail (Papilio machaon hippocrates).

Coleopterous insects may include grubs, such as cupreous chafer (Anomala cuprea), Anomala schonfeldti, soybean beetle (Anomala rufocuprea), Asiatic garden beetle (Maladera castanea), chestnut brown chafer (Adoretus tenuimaculatus) and Japanese beetle (Popillia japonica); lady beetles, such as 28-spotted ladybird (Epilachna vigintioctopunctata) and large 28-spotted ladybird (Epilachna vigintioctomaculata); weevils, such as rice water weevil (Lissorhoptrus oryzophilus), Scepticus griseus, sweetpotato weevil (Cylas formicarius), hunting billbug (Sphenophrus venatus vestius) and maize weevil (Sitophilus zeamaise); leaf beetles, such as striped flea beetle (Phyllotreta striolata) and cucurbit leaf beetle (Aulacophora femoralis); click beetles, such as Melanotus okinawaensis; longicorn beetles, such as Japanese pine sawer (Monochamus alternatus) and sesame-spotted longicorn beetle (Mesosa myops); bark beetles, such as Japanese bark beetle (Scolytus japonicus) and alnus ambrosia beetle (Xylosandrus germanus); flour beetles, such as yellow mealworm (Tenebrio molitor) and red flour beetle (Tribolium castaneum).

The method of the present invention may be used to protect a wide variety of plants which are subject to infection with lepidopterous or coleopterous insect pests. The plants to be protected by the method of the present invention include vegetables such as cabbage and cauliflower, fruit trees such as citrus and apples, grains such as rice, wheat and beans, stored grains, stored foods, lawn in golf courses and gardens, industrial crops such as tea and sugarcane, as well as flower. Also, trees in non-crop lands such as parks and forests.

N141 gene may be isolated from N141 strain. The whole DNA of N141 strain may be digested with one or more restriction enzymes and the resulting DNA fragments may be size-fractionated into DNA fractions of 2 to 5 Kbp. The fractions may be ligated to a suitable vector and used to transform Escherichia coli. A transformed E. coli possessing a desired gene may be identified by enzyme immunoassay using antibodies against the N141 crystal protein.

The N141-derived crystal protein gene DNA thus identified may be treated with a suitable restriction enzyme and the resulting DNA fragment is ligated to a suitable cloning vector to make a gene cassette.

The gene cassette may be used to transform a microorganism, such as E. coli, and the base sequence of N141 crystal gene may then be determined by gene analysis methods such as dideoxy method.

Further, the gene cassette may also be used to transform a gram-positive bacterium having an insecticidal activity, such as Bt. Thus, a transformed Bt may be produced which is effective to control a wider variety of insects.

To express the N141 gene in a plant, a suitable restriction site may be introduced into both sides of each gene or a portion thereof in the gene cassette. This may be carried out by site-directed mutagenesis.

The portion of N141 gene coding for an insecticidally effective portion of N141 protein may be inserted into the nuclear genome of a single plant cell in a stable manner and the thus transformed cells may be used to produce a transformed plant which is resistant to insects.

The thus transformed plant may be used to produce transformed plants having the same properties, or the insecticidally effective portion of N141 gene may be introduced into other varieties of the same or related plant species. A seed produced from the transformed plant contains the insecticidally effective portion of N141 gene as a stable genome insert.

The N141 strain may further be transformed with a foreign Bt gene having one or more insecticidal activities, whereby a transformed N141 strain may be produced which is useful for destroying a wider variety of pests.

The N141 crystal protein may be used to immunize guinea pig to prepare an antibody specific to this crystal protein.

In the protected area, i.e., in the area to which N141 strain and/or N141 crystal protein has been applied, certain insects will ingest the N141 strain and/or N141 crystal protein or mixture thereof, or transformed plants and/or microorganisms incorporating the N141 gene, and as a result they are killed or injured by the N141 crystal protein.

EXAMPLES

The present invention will be further illustrated by the following examples but is not limited thereto.

Example 1: Isolation and Properties of N141 Strain

N141 strain was isolated from soil taken in Saitama, Japan.

Ten mg of a soil sample was placed in an Erlenmeyer flask and 10 mL of sterilized water was injected thereinto. The flask was shaken for 30 minutes and allowed to stand for some time. Two mL of the supernatant was taken out and immediately heated at 80.degree. C. for 10 minutes. The heated solution was then diluted in two steps, 10 times and 100 times, respectively. Each solution (1 mL) of the x10 and x100 diluted solutions was incubated on an NB plating medium (8.4 g NUTRIENT BROTH, 20 g agar per liter of sterilized water) at 30.degree. C. for 24 to 48 hours.

Features of the Novel Strain N141 Colony formation: An opaque white colony with an irregular border. Cell morphology in the growth phase: Typical of Bt. Serotype of H-antigen: 23, japonensis. Intracellular component: A sporulating cell produces an amorphous crystal protein. The electron microscopic photograph of the crystal protein is shown in FIG. 1. Alkali-soluble protein: This strain has a protein which runs to about 130,000 daltons on electrophoresis. Activity: This strain has an insecticidal activity against lepidopterous and coleopterous pests tested. Gene: Using antibodies raised by immunizing guinea pig with the crystal protein of about 130,000 daltons produced by this strain, screening was effected to clone a gene coding for the N141 crystal protein, hereinafter abbreviated as N141 gene. This gene has 3,759 bases and contains a translational region in from 47 to 3,556. Further, as compared with the known japonensis buibui gene having an activity against coleopterous insects (Japanese Patent Application Laying-open No. 65292/1994), this gene has only about 60% of homology in the amino acid sequence level with the known gene as shown in FIG. 2. Example 2: Storage and Sterilization of N141 Strain

Desirably, for longtime storage of N141 strain, N141 is subjected to rotary shaking culture with NB liquid medium (8.4 g NUTRIENT BROTH per liter of sterilized water) at 30.degree. C. and 150-200 rpm for 24 to 72 hours and equal amounts of the culture medium and 30% glycerol are mixed and stored at -80.degree. C., or alternatively, said culture medium is centrifuged and the resulting cells are suspended in a protective liquid (10% skim milk, 1% sodium glutamate) and dried under vacuum.

Sterilization of N141 strain is carried out in an autoclave at 120.degree. C. for 20 minutes.

Example 3: Purification of Crystal Protein of N141 Strain

A platinum loopful of N141 strain was inoculated in a test tube containing 5 mL of NB liquid medium (8.4 g NUTRIENT BROTH per liter of sterilized water) and reciprocal shaking culture was carried out at 30.degree. C. for 12 to 24 hours to yield a seed culture. The seed culture was inoculated in a 500 mL Erlenmeyer flask containing 100 ml of NB liquid medium (8.4 g NUTRIENT BROTH per liter of sterilized water) in a final concentration of 1% and shaking culture was effected at 30.degree. C. and 150 rpm for 72 to 96 hours. Thereafter, cells, spores and crystal proteins were collected by centrifugation. A suitable amount of buffer (Tris-HCl, NaCl, EDTA) was added to the resulting precipitate and the mixture was subjected to ultrasonication to yield a suspension.

Example 4: Properties of N141 Crystal Protein

The suspension obtained in Example 3 was subjected to electrophoresis on 8% SDS-PAGE gel to investigate an electrophoretic pattern. Also, western blotting analysis was carried out using antibodies. As a result, it was revealed that N141 strain produces a crystal protein with a molecular weight of about 130,000 daltons.

Example 5: Insecticidal Activity of N141 Strain against Cupreous Chafer (Anomala cuprea)

The suspension prepared in Example 3 was diluted to a predetermined concentration and a spreader was added thereto. The thus prepared sample solution was mixed into leaf mould which had previously sterilized, and cupreous chafer (Anomala cuprea) was released. As a result of observation, an insecticidal activity against cupreous chafer (Anomala cuprea) was recognized.

Example 6:Insecticidal Activity of N141 Strain and N141 Crystal Protein against Diamondback Moth (Plutella xylostella)

The suspension prepared in Example 3 was diluted to a predetermined concentration and a spreader was added thereto to prepare a sample solution. A leaf of cabbage was immersed into the sample solution, air-dried thoroughly and placed into a styrol cup containing a wet filter paper. Larvae of diamondback moth (Plutella xylostella) in the middle of 3 larval instars stage were released into the cup and a mortality after 6 days was calculated from the following equation. The test was performed in 5-plicate with 5 larvae in each zone. ##EQU1##

The results are shown in Table 1.

TABLE 1______________________________________Insecticidal activity of N141 strain and N141 crystalprotein against larvae of diamondback moth (Plutellaxylostella) in the middle of 3 larval instars stageConcentration (ppm) Mortality (%)______________________________________10000 1003000 1001000 100 100 50______________________________________ Example 7: Insecticidal Activity of N141 Strain and N141 Crystal Protein against Bombyx mori

The suspension prepared in Example 3 was diluted to a predetermined concentration and a spreader was added thereto to prepare a sample solution. A leaf of mulberry was immersed into the sample solution, air-dried thoroughly and placed into a styrol cup containing a wet filter paper. Larvae of Bombyx mori on the second day of of 3 larval instars stage were released into the cup and a mortality after 6 days was calculated from the following equation. The test was performed in 5-plicate with 5 larvae in each zone. ##EQU2##

The results are shown in Table 2.

TABLE 2______________________________________Insecticidal activity of N141 strain and N141 crystalprotein against larvae of Bombyx mori on thesecond day of 3 larval instars stageConcentration (ppm) Mortality (%)______________________________________3000 1001000 95 100 50______________________________________ Example 8: Isolation of N141 Gene

The whole DNA was prepared from N141 strain and partially digested with EcoRI. The digested DNAs were fractionated and DNA fragments of about 2 to 5 Kbp were ligated to a phage vector .lambda.gt11 digested with EcoRI. These vectors were used to transform E. coli. The recombinant E. coli clones were screened with antibodies raised by immunizing guinea pig with about 130 kDa protein which was assumed to be N141 crystal protein, to identify clones containing N141 gene. DNAs were prepared from the identified recombinant E. coli clones and digested with restriction enzyme EcoRI. The digested DNA fragments were subjected to electrophoresis on 0.8% agarose gel to identify an inserted DNA fragment of about 3.4 Kbp.

Example 9: Cloning of N141 Gene

The DNA fragments prepared in Example 8 were fractionated and ligated to a plasmid vector Bluescript II SK (-) digested with EcoRI so as to construct a gene cassette (pBN141; FIG. 3). This pBN141 was not of full length and cloning was again repeated. The base sequence of a DNA fragment containing a full length N141 gene was determined by the dideoxy method.

Example 10: Base and Amino Acid Sequences of N141 Gene

The base sequence consisted of 3759 bases as shown in SEQ ID NO:1. The open reading frame (ORF) consisted of 3510 bases, i.e. from 47th to 3556th bases, and coded for 1169 amino acids (the 1170th base being a termination codon). The amino acid sequence of the N-terminal 662 amino acids of this N141 protein was compared with those of a protein encoded by the known japonensis buibui gene which shows an activity against coleopterous insects (Japanese Patent Application Laying-open No. 65292/1994). It was found that the two genes had a homology in the amino acid level of only about 60% as shown in FIG. 2.

Example 11: Expression of N141 Crystal Protein in E. coli DH5.alpha.

To produce the crystal protein from N141 gene, the gene cassette pBN141 was used to transform E. coli DH5.alpha.. The resulting recombinant E. coli, hereinafter referred to E. coli: DH5.alpha.(pBN141), was incubated in LB-amp liquid medium (10 g Trypton, 10 g NaCl, 5 g Yeast extract, 0.2% glucose, 50 mg ampicillin per liter of sterilized water) at 37.degree. C. for about 3 hours. IPTG was added to a final concentration of 1 mM and further incubated at 37.degree. C. for 20 hours. After culture, the culture medium was centrifuged and 4 unit volumes of Lysis buffer were added to unit weight of the precipitate to suspend at room temperature for 10 hours. Then, Lysozyme was added and mixed in a final concentration of 1 mg/mL and allowed to stand on ice for 10 minutes. Further, Triton X-100 was added and mixed in a final concentration of 1% and allowed to stand at room temperature for 10 minutes. After centrifugation the supernatant was recovered.

Example 12: Properties of Protein Expressed in E. coli: DH5.alpha. (pBN141)

The supernatant obtained in Example 11 was subjected to electrophoresis on 8% SDS-PAGE gel and to western blotting using antibodies. As a result, it was confirmed that E. coli: DH5.alpha. (pBN141) produced N141 crystal protein.

Example 13: Insecticidal Activity of the Protein Expressed in E. coli: DH5.alpha. (pBN141) against Larvae of Diamondback Moth (Plutella xylostella)

To the supernatant solution obtained in Example 11, a spreader was added and diluted to prepare a sample solution. A leaf of cabbage was immersed into the sample solution, air-dried thoroughly and placed into a styrol cup containing a wet filter paper. Larvae of diamondback moth (Plutella xylostella) in the middle of 3 larval instars stage were released into the cup and a mortality after 6 days was calculated from the following equation. The test was performed in 5-plicate with 5 larvae in each zone. ##EQU3##

The results are shown in Table 3.

TABLE 3______________________________________Insecticidai activity of the protein expressed in E.coli: DH5.alpha. (pBN141) against larvae of diamondback moth(Plutella xylostella) in the middle of 3 larval instars stageConcentration (ppm) Mortality (%)______________________________________20() 85100 50______________________________________ Example 14: Insecticidal Activity of the Protein Expressed in E. coli: DH5.alpha. (pBN141) against Larvae of Bombyx mori

To the supernatant solution obtained in Example 11, a spreader was added and diluted to prepare a sample solution. A leaf of mulberry was immersed into the sample solution, air-dried thoroughly and placed into a styrol cup containing a wet filter paper. Larvae of Bombyx mori on the second day of of 3 larval instars stage were released into the cup and a mortality after 6 days was calculated from the following equation. The test was performed in 5-plicate with 5 larvae in each zone. ##EQU4##

The results are shown in Table 4.

TABLE 4______________________________________Insecticidal activity of the protein expressed in E.coli: DH5.alpha. (pBN141) against larvae of Bombyx mori on thesecond day of 3 larval instars stageConcentration (ppm) Mortality (%)______________________________________200 70______________________________________

While the above examples are directed to only several embodiments of the present invention, it is apparent to those skilled in the art that many other modifications and/or changes are contemplated in the present invention. For example, any peptide having an insecticidal activity and coding for an amino acid sequence which is different from that represented by SEQ ID NO:2 in that one or more amino acids may be added, deleted and/or replaced, as well as any DNA coding for such a modified peptide are included within the scope of the present invention.

The N141 crystal protein of the present invention has an activity not only against lepidopterous insects but also coleopterous insects such as cupreous chafer (Anomala cuprea) and is expected to be useful for insecticidal compositions.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3759 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: Bacillus thuringiensis var. japonensis(B) STRAIN: N141(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 47..3556(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:TTTTAAATACATTGGAGTGTAATAGACTGGTATTGGAGGAACAAGTATGAATCGA55MetAsnArgAATAATCAAAATGAATATGAAGTTATTGATGCCCCACATTGTGGGTGT103AsnAsnGlnAsnGluTyrGluValIleAspAlaProHisCysGlyCys51015CCGGCAGATGATGTTGTAAAATATCCTTTGACAGATGATCCGAATGCT151ProAlaAspAspValValLysTyrProLeuThrAspAspProAsnAla20253035GGATTGCAAAATATGAACTATAAGGAATATTTACAAACGTATGGTGGA199GlyLeuGlnAsnMetAsnTyrLysGluTyrLeuGlnThrTyrGlyGly404550GACTATACAGATCCTCTTATTAATCCTAACTTATCTGTTAGTGGAAAA247AspTyrThrAspProLeuIleAsnProAsnLeuSerValSerGlyLys556065GATGTAATACAAGTTGGAATTAATATTGTAGGGAGATTACTAAGCTTT295AspValIleGlnValGlyIleAsnIleValGlyArgLeuLeuSerPhe707580TTTGGATTCCCCTTTTCTAGTCAATGGGTTACTGTATATACCTATCTT343PheGlyPheProPheSerSerGlnTrpValThrValTyrThrTyrLeu859095TTAAACAGCTTGTGGCCGGATGACGAGAATTCTGTATGGGACGCTTTT391LeuAsnSerLeuTrpProAspAspGluAsnSerValTrpAspAlaPhe100105110115ATGGAGAGAGTAGAAGAACTTATTGATCAAAAAATCTCAGAAGCAGTA439MetGluArgValGluGluLeuIleAspGlnLysIleSerGluAlaVal120125130AAGGGTAGGGCATTGGATGACCTAACTGGATTACAATATAATTATAAT487LysGlyArgAlaLeuAspAspLeuThrGlyLeuGlnTyrAsnTyrAsn135140145TTATATGTAGAAGCATTAGATGAGTGGCTGAATAGACCAAATGGCGCA535LeuTyrValGluAlaLeuAspGluTrpLeuAsnArgProAsnGlyAla150155160AGGGCATCCTTAGTTTCTCAGCGATTTAACATTTTAGATAGCCTATTT583ArgAlaSerLeuValSerGlnArgPheAsnIleLeuAspSerLeuPhe165170175ACACAATTTATGCCAAGCTTTGGCTCTGGTCCTGGAAGTCAAAATTAT631ThrGlnPheMetProSerPheGlySerGlyProGlySerGlnAsnTyr180185190195GCAACTATATTACTTCCAGTATATGCACAAGCAGCAAACCTTCATTTG679AlaThrIleLeuLeuProValTyrAlaGlnAlaAlaAsnLeuHisLeu200205210TTATTATTAAAAGATGCAGACATTTATGGAGCTAGATGGGGGCTGAAT727LeuLeuLeuLysAspAlaAspIleTyrGlyAlaArgTrpGlyLeuAsn215220225CAAACTCAAATAGATCAATTCCATTCTCGTCAACAAAGCCTTACTCAG775GlnThrGlnIleAspGlnPheHisSerArgGlnGlnSerLeuThrGln230235240ACTTATACAAATCATTGTGTTACTGCGTATAATGATGGATTAGCGGAA823ThrTyrThrAsnHisCysValThrAlaTyrAsnAspGlyLeuAlaGlu245250255TTAAGAGGCACAACCGCTGAGAGTTGGTTTAAATACAATCAATATCGT871LeuArgGlyThrThrAlaGluSerTrpPheLysTyrAsnGlnTyrArg260265270275AGAGAAATGACTTTGACGGCAATGGATTTAGTGGCATTATTCCCATAT919ArgGluMetThrLeuThrAlaMetAspLeuValAlaLeuPheProTyr280285290TATAATTTACGACAATATCCAGATGGGACAAATCCTCAACTTACACGT967TyrAsnLeuArgGlnTyrProAspGlyThrAsnProGlnLeuThrArg295300305GAGGTCTATACAGATCCGATTGCATTTGATCCACTGGAACAACCAACT1015GluValTyrThrAspProIleAlaPheAspProLeuGluGlnProThr310315320ACTCAATTATGTCGATCATGGTACATTAACCCAGCTTTTCGAAATCAT1063ThrGlnLeuCysArgSerTrpTyrIleAsnProAlaPheArgAsnHis325330335TTGAATTTCTCTGTACTAGAAAATTCATTGATTCGTCCCCCGCACCTT1111LeuAsnPheSerValLeuGluAsnSerLeuIleArgProProHisLeu340345350355TTTGAAAGGTTAAGTAATTTGCAAATTTTAGTTAATTACCAAACAAAC1159PheGluArgLeuSerAsnLeuGlnIleLeuValAsnTyrGlnThrAsn360365370GGTAGCGCTTGGCGTGGGTCAAGGGTAAGATACCATTATTTGCATAGT1207GlySerAlaTrpArgGlySerArgValArgTyrHisTyrLeuHisSer375380385TCTATAATACAGGAAAAAAGTTACGGCCTCCTCAGTGATCCCGTTGGA1255SerIleIleGlnGluLysSerTyrGlyLeuLeuSerAspProValGly390395400GCTAATATCAATGTTCAAAATAATGATATTTATCAGATTATTTCGCAG1303AlaAsnIleAsnValGlnAsnAsnAspIleTyrGlnIleIleSerGln405410415GTTAGCAATTTTGCTAGTCCTGTTGGCTCATCATATAGTGTTTGGGAC1351ValSerAsnPheAlaSerProValGlySerSerTyrSerValTrpAsp420425430435ACTAACTTTTATTTGAGTTCAGGACAAGTAAGTGGGATTTCAGGATAT1399ThrAsnPheTyrLeuSerSerGlyGlnValSerGlyIleSerGlyTyr440445450ACACAGCAAGGTATACCAGCAGTTTGTCTTCAACAACGAAATTCAACT1447ThrGlnGlnGlyIleProAlaValCysLeuGlnGlnArgAsnSerThr455460465GATGAGTTACCAAGCTTAAATCCGGAAGGAGATATCATTAGAAATTAT1495AspGluLeuProSerLeuAsnProGluGlyAspIleIleArgAsnTyr470475480AGTCATAGGTTATCTCATATAACCCAATATCGTTTTCAAGCAACTCAA1543SerHisArgLeuSerHisIleThrGlnTyrArgPheGlnAlaThrGln485490495AGTGGTAGTCCATCAACTGTTAGCGCAAATTTACCTACTTGTGTATGG1591SerGlySerProSerThrValSerAlaAsnLeuProThrCysValTrp500505510515ACGCATCGAGATGTGGACCTTGATAATACCATTACTGCGAATCAAATT1639ThrHisArgAspValAspLeuAspAsnThrIleThrAlaAsnGlnIle520525530ACACAACTACCATTAGTAAAGGCATATGAGCTAAGTAGTGGTGCTACT1687ThrGlnLeuProLeuValLysAlaTyrGluLeuSerSerGlyAlaThr535540545GTCGTGAAAGGTCCAGGATTCACAGGAGGAGATGTAATCCGAAGAACA1735ValValLysGlyProGlyPheThrGlyGlyAspValIleArgArgThr550555560AATACTGGTGGATTCGGAGCAATAAGGGTGTCGGTCACTGGACCGCTA1783AsnThrGlyGlyPheGlyAlaIleArgValSerValThrGlyProLeu565570575ACACAACGATATCGCATAAGGTTCCGTTATGCTTCGACAATAGATTTT1831ThrGlnArgTyrArgIleArgPheArgTyrAlaSerThrIleAspPhe580585590595GATTTCTTTGTAACACGTGGAGGAACTACTATAAATAATTTTAGATTT1879AspPhePheValThrArgGlyGlyThrThrIleAsnAsnPheArgPhe600605610ACACGTACAATGAACAGGGGACAGGAATCAAGATATGAATCCTATCGT1927ThrArgThrMetAsnArgGlyGlnGluSerArgTyrGluSerTyrArg615620625ACTGTAGAGTTTACAACTCCTTTTAACTTTACACAAAGTCAAGATATA1975ThrValGluPheThrThrProPheAsnPheThrGlnSerGlnAspIle630635640ATTCGAACATCTATCCAGGGACTTAGTGGAAATGGGGAAGTATACCTT2023IleArgThrSerIleGlnGlyLeuSerGlyAsnGlyGluValTyrLeu645650655GATAGAATTGAAATCATCCCTGTGAACCCGGCACGAGAAGCAGAAGAG2071AspArgIleGluIleIleProValAsnProAlaArgGluAlaGluGlu660665670675GATTTAGAAGCAGCGAAGAAAGCGGCTAGGCAGAACTTGTTTACACGT2119AspLeuGluAlaAlaLysLysAlaAlaArgGlnAsnLeuPheThrArg680685690ACAAGGGACGGATTACAGGTAAATGTGACAGATTATCAAGTGGACCAA2167ThrArgAspGlyLeuGlnValAsnValThrAspTyrGlnValAspGln695700705GCGGCAAATTTAGTGTCATGCTTATCCGATGAACAATATGGGCATGAC2215AlaAlaAsnLeuValSerCysLeuSerAspGluGlnTyrGlyHisAsp710715720AAAAAGATGTTATTGGAAGCGGTAAGAGCGGCAAAACGCCTCAGCCGC2263LysLysMetLeuLeuGluAlaValArgAlaAlaLysArgLeuSerArg725730735GAACGCAACTTACTTCAAGATCCAGATTTTAATACAATCAATAGTACA2311GluArgAsnLeuLeuGlnAspProAspPheAsnThrIleAsnSerThr740745750755GAAGAGAATGGCTGGAAGGCAAGTAACGGTGTTACTATTAGCGAGGGC2359GluGluAsnGlyTrpLysAlaSerAsnGlyValThrIleSerGluGly760765770GGTCCATTCTTTAAAGGTCGTGCACTTCAGTTAGCAAGCGCAAGAGAA2407GlyProPhePheLysGlyArgAlaLeuGlnLeuAlaSerAlaArgGlu775780785AATTATCCAACATACATTTATCAAAAAGTAGATGCATCGGTGTTAAAG2455AsnTyrProThrTyrIleTyrGlnLysValAspAlaSerValLeuLys790795800CCTTATACACGCTATAGACTGGATGGGTTCGTGAAGAGTAGTCAAGAT2503ProTyrThrArgTyrArgLeuAspGlyPheValLysSerSerGlnAsp805810815TTAGAAATTGATCTCATTCACTATCATAAAGTCCATCTTGTGAAAAAT2551LeuGluIleAspLeuIleHisTyrHisLysValHisLeuValLysAsn820825830835GTACCAGATAATTTAGTATCCGATACTTACTCGGATGGTTCTTGCAGT2599ValProAspAsnLeuValSerAspThrTyrSerAspGlySerCysSer840845850GGAATGAATCGATGTGAGGAACAACAGATGGTAAATGCGCAACTGGAA2647GlyMetAsnArgCysGluGluGlnGlnMetValAsnAlaGlnLeuGlu855860865ACAGAACATCATCATCCGATGGATTGCTGTGAAGCGGCTCAAACACAT2695ThrGluHisHisHisProMetAspCysCysGluAlaAlaGlnThrHis870875880GAGTTTTCTTCCTATATTAATACAGGGGATCTAAATGCAAGTGTAGAT2743GluPheSerSerTyrIleAsnThrGlyAspLeuAsnAlaSerValAsp885890895CAGGGCATTTGGGTTGTATTAAAAGTTCGAACAACAGATGGGTATGCG2791GlnGlyIleTrpValValLeuLysValArgThrThrAspGlyTyrAla900905910915ACGTTAGGAAATCTTGAATTGGTAGAGGTTGGGCCATTATCGGGTGAA2839ThrLeuGlyAsnLeuGluLeuValGluValGlyProLeuSerGlyGlu920925930TCTCTAGAACGGGAACAAAGAGATAATGCGAAATGGAATGCAGAGCTA2887SerLeuGluArgGluGlnArgAspAsnAlaLysTrpAsnAlaGluLeu935940945GGAAGAAAACGTGCAGAAATAGATCGTGTGTATTTAGCTGCGAAACAA2935GlyArgLysArgAlaGluIleAspArgValTyrLeuAlaAlaLysGln950955960GCAATTAATCATCTGTTTGTAGACTATCAAGATCAACAATTAAATCCA2983AlaIleAsnHisLeuPheValAspTyrGlnAspGlnGlnLeuAsnPro965970975GAAATTGGGCTAGCAGAAATTAATGAAGCTTCAAATCTTGTAGAGTCA3031GluIleGlyLeuAlaGluIleAsnGluAlaSerAsnLeuValGluSer980985990995ATTTCGGGTGTATATAGTGATACACTATTACAGATTCCTGGGATTAAC3079IleSerGlyValTyrSerAspThrLeuLeuGlnIleProGlyIleAsn100010051010TACGAAATTTACACAGAGTTATCCGATCGCTTACAACAAGCATCGTAT3127TyrGluIleTyrThrGluLeuSerAspArgLeuGlnGlnAlaSerTyr101510201025CTGTATACGTCTCGAAATGCGGTGCAAAATGGAGACTTTAACAGTGGT3175LeuTyrThrSerArgAsnAlaValGlnAsnGlyAspPheAsnSerGly103010351040CTAGATAGTTGGAATACAACTACGGATGCATCGGTTCAGCAAGATGGC3223LeuAspSerTrpAsnThrThrThrAspAlaSerValGlnGlnAspGly104510501055AATATGCATTTCTTAGTTCTTTCGCATTGGGATGCACAAGTTTCTCAA3271AsnMetHisPheLeuValLeuSerHisTrpAspAlaGlnValSerGln1060106510701075CAATTGAGAGTAAATCCGAATTGTAAGTATGTCTTACGTGTGACAGCA3319GlnLeuArgValAsnProAsnCysLysTyrValLeuArgValThrAla108010851090AGAAAAGTAGGAGGCGGAGATGGATACGTCACAATCCGAGATGGCGCT3367ArgLysValGlyGlyGlyAspGlyTyrValThrIleArgAspGlyAla109511001105CATCACCAAGAAACTCTTACATTTAATGCATGTGACTACGATGTAAAT3415HisHisGlnGluThrLeuThrPheAsnAlaCysAspTyrAspValAsn111011151120GGTACGTATGTCAATGACAATTCGTATATAACAGAAGAAGTGGTATTC3463GlyThrTyrValAsnAspAsnSerTyrIleThrGluGluValValPhe112511301135TACCCAGAGACAAAACATATGTGGGTAGAGGTGAGTGAATCCGAAGGT3511TyrProGluThrLysHisMetTrpValGluValSerGluSerGluGly1140114511501155TCATTCTATATAGACAGTATTGAGTTTATTGAAACACAAGAGTAG3556SerPheTyrIleAspSerIleGluPheIleGluThrGlnGlu*116011651170AAGAGGGGGATCCTAACGTATAGCAACTATGAGAGGATACTCCGTACAAACAAAGATTAA3616AAAAAGGTAAAATGAATAGAACCCCCTACTGGTAGAAGGTCTGGTAGGGGGTTCTTACAT3676GAAAAAATGTAGCTGTTTACTAAGGTATATAAAAAACAGCATATTTGATAGAAAAAAATG3736AGTACCTTATAAAGAAAGAATTC3759(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1169 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAsnArgAsnAsnGlnAsnGluTyrGluValIleAspAlaProHis151015CysGlyCysProAlaAspAspValValLysTyrProLeuThrAspAsp202530ProAsnAlaGlyLeuGlnAsnMetAsnTyrLysGluTyrLeuGlnThr354045TyrGlyGlyAspTyrThrAspProLeuIleAsnProAsnLeuSerVal505560SerGlyLysAspValIleGlnValGlyIleAsnIleValGlyArgLeu65707580LeuSerPhePheGlyPheProPheSerSerGlnTrpValThrValTyr859095ThrTyrLeuLeuAsnSerLeuTrpProAspAspGluAsnSerValTrp100105110AspAlaPheMetGluArgValGluGluLeuIleAspGlnLysIleSer115120125GluAlaValLysGlyArgAlaLeuAspAspLeuThrGlyLeuGlnTyr130135140AsnTyrAsnLeuTyrValGluAlaLeuAspGluTrpLeuAsnArgPro145150155160AsnGlyAlaArgAlaSerLeuValSerGlnArgPheAsnIleLeuAsp165170175SerLeuPheThrGlnPheMetProSerPheGlySerGlyProGlySer180185190GlnAsnTyrAlaThrIleLeuLeuProValTyrAlaGlnAlaAlaAsn195200205LeuHisLeuLeuLeuLeuLysAspAlaAspIleTyrGlyAlaArgTrp210215220GlyLeuAsnGlnThrGlnIleAspGlnPheHisSerArgGlnGlnSer225230235240LeuThrGlnThrTyrThrAsnHisCysValThrAlaTyrAsnAspGly245250255LeuAlaGluLeuArgGlyThrThrAlaGluSerTrpPheLysTyrAsn260265270GlnTyrArgArgGluMetThrLeuThrAlaMetAspLeuValAlaLeu275280285PheProTyrTyrAsnLeuArgGlnTyrProAspGlyThrAsnProGln290295300LeuThrArgGluValTyrThrAspProIleAlaPheAspProLeuGlu305310315320GlnProThrThrGlnLeuCysArgSerTrpTyrIleAsnProAlaPhe325330335ArgAsnHisLeuAsnPheSerValLeuGluAsnSerLeuIleArgPro340345350ProHisLeuPheGluArgLeuSerAsnLeuGlnIleLeuValAsnTyr355360365GlnThrAsnGlySerAlaTrpArgGlySerArgValArgTyrHisTyr370375380LeuHisSerSerIleIleGlnGluLysSerTyrGlyLeuLeuSerAsp385390395400ProValGlyAlaAsnIleAsnValGlnAsnAsnAspIleTyrGlnIle405410415IleSerGlnValSerAsnPheAlaSerProValGlySerSerTyrSer420425430ValTrpAspThrAsnPheTyrLeuSerSerGlyGlnValSerGlyIle435440445SerGlyTyrThrGlnGlnGlyIleProAlaValCysLeuGlnGlnArg450455460AsnSerThrAspGluLeuProSerLeuAsnProGluGlyAspIleIle465470475480ArgAsnTyrSerHisArgLeuSerHisIleThrGlnTyrArgPheGln485490495AlaThrGlnSerGlySerProSerThrValSerAlaAsnLeuProThr500505510CysValTrpThrHisArgAspValAspLeuAspAsnThrIleThrAla515520525AsnGlnIleThrGlnLeuProLeuValLysAlaTyrGluLeuSerSer530535540GlyAlaThrValValLysGlyProGlyPheThrGlyGlyAspValIle545550555560ArgArgThrAsnThrGlyGlyPheGlyAlaIleArgValSerValThr565570575GlyProLeuThrGlnArgTyrArgIleArgPheArgTyrAlaSerThr580585590IleAspPheAspPhePheValThrArgGlyGlyThrThrIleAsnAsn595600605PheArgPheThrArgThrMetAsnArgGlyGlnGluSerArgTyrGlu610615620SerTyrArgThrValGluPheThrThrProPheAsnPheThrGlnSer625630635640GlnAspIleIleArgThrSerIleGlnGlyLeuSerGlyAsnGlyGlu645650655ValTyrLeuAspArgIleGluIleIleProValAsnProAlaArgGlu660665670AlaGluGluAspLeuGluAlaAlaLysLysAlaAlaArgGlnAsnLeu675680685PheThrArgThrArgAspGlyLeuGlnValAsnValThrAspTyrGln690695700ValAspGlnAlaAlaAsnLeuValSerCysLeuSerAspGluGlnTyr705710715720GlyHisAspLysLysMetLeuLeuGluAlaValArgAlaAlaLysArg725730735LeuSerArgGluArgAsnLeuLeuGlnAspProAspPheAsnThrIle740745750AsnSerThrGluGluAsnGlyTrpLysAlaSerAsnGlyValThrIle755760765SerGluGlyGlyProPhePheLysGlyArgAlaLeuGlnLeuAlaSer770775780AlaArgGluAsnTyrProThrTyrIleTyrGlnLysValAspAlaSer785790795800ValLeuLysProTyrThrArgTyrArgLeuAspGlyPheValLysSer805810815SerGlnAspLeuGluIleAspLeuIleHisTyrHisLysValHisLeu820825830ValLysAsnValProAspAsnLeuValSerAspThrTyrSerAspGly835840845SerCysSerGlyMetAsnArgCysGluGluGlnGlnMetValAsnAla850855860GlnLeuGluThrGluHisHisHisProMetAspCysCysGluAlaAla865870875880GlnThrHisGluPheSerSerTyrIleAsnThrGlyAspLeuAsnAla885890895SerValAspGlnGlyIleTrpValValLeuLysValArgThrThrAsp900905910GlyTyrAlaThrLeuGlyAsnLeuGluLeuValGluValGlyProLeu915920925SerGlyGluSerLeuGluArgGluGlnArgAspAsnAlaLysTrpAsn930935940AlaGluLeuGlyArgLysArgAlaGluIleAspArgValTyrLeuAla945950955960AlaLysGlnAlaIleAsnHisLeuPheValAspTyrGlnAspGlnGln965970975LeuAsnProGluIleGlyLeuAlaGluIleAsnGluAlaSerAsnLeu980985990ValGluSerIleSerGlyValTyrSerAspThrLeuLeuGlnIlePro99510001005GlyIleAsnTyrGluIleTyrThrGluLeuSerAspArgLeuGlnGln101010151020AlaSerTyrLeuTyrThrSerArgAsnAlaValGlnAsnGlyAspPhe1025103010351040AsnSerGlyLeuAspSerTrpAsnThrThrThrAspAlaSerValGln104510501055GlnAspGlyAsnMetHisPheLeuValLeuSerHisTrpAspAlaGln106010651070ValSerGlnGlnLeuArgValAsnProAsnCysLysTyrValLeuArg107510801085ValThrAlaArgLysValGlyGlyGlyAspGlyTyrValThrIleArg109010951100AspGlyAlaHisHisGlnGluThrLeuThrPheAsnAlaCysAspTyr1105111011151120AspValAsnGlyThrTyrValAsnAspAsnSerTyrIleThrGluGlu112511301135ValValPheTyrProGluThrLysHisMetTrpValGluValSerGlu114011451150SerGluGlySerPheTyrIleAspSerIleGluPheIleGluThrGln115511601165Glu*1170__________________________________________________________________________

Claims

1. Bacillus thuringiensis var. japonensis strain N141.