Bacillus thuringiensis cryET5 gene and related plasmids, bacteria and insecticides

Abstract

A Bacillus thuringiensis strain isolate, designated B.t. strain EG5847, exhibits insecticidal activity against lepidopteran insects. Two novel toxin genes from B.t. strain EG5847 designated cryET4 and cryET5 produce insecticidal proteins with activity against a broad spectrum of insects of the order Lepidoptera. The cryET4 gene has a nucleotide base sequence shown in FIG. 1 and listed in SEQ ID NO:1 and produces a CryET4 gene product having the deduced amino acid sequence shown in FIG. 1 and listed in SEQ ID NO:2. The cryET5 gene has a nucleotide base sequence shown in FIG. 2 and listed in SEQ ID NO:3 and produces a CryET5 gene product having the deduced amino acid sequence shown in FIG. 2 and listed in SEQ ID NO:4.

Description

FIELD OF THE INVENTION

The present invention relates to lepidopteran-toxic proteins and the genes coding therefor. In particular, the present invention is directed to genes designated as cryET4 (SEQ ID NO:1) and cryET5 (SEQ ID NO:3) and their proteins designated respectively as CryET4 (SEQ ID NO:2) and CryET5 (SEQ ID NO:4).

BACKGROUND OF THE INVENTION

Bacillus thuringiensis (commonly known as B.t.) is a gram-positive soil bacterium that often produces cellular inclusions during sporulation which are specifically toxic to certain orders and species of insects. Many different strains of B.t. have been shown to produce these inclusions of insecticidal crystal protein (ICP). Compositions including B.t. strains which produce insecticidal proteins have been commercially available and used as environmentally acceptable insecticides because they are quite toxic to the specific target insect, but are harmless to plants and other non-targeted organisms.

B.t. ICP toxins are active in the insect only after ingestion. After ingestion by an insect, the alkaline pH and proteolytic enzymes in the mid-gut solubilize the crystal allowing the release of the toxic components. These toxic components disrupt the mid-gut cells resulting in cessation of feeding and, eventually, death of the insect. B.t. has proven to be an effective and environmentally safe insecticide in dealing with various insect pests.

A number of genes encoding crystal proteins have been cloned from many strains of B.t. A good overview is set forth in H. H ofte and H. R. Whiteley, Microbiol. Rev., 53, pp. 242-255 (1989), hereinafter "H ofte and Whiteley (1989)." This reference provides a good overview of the genes and proteins obtained from B.t. and their uses, adopts a nomenclature and classification scheme for B.t. genes and proteins, and has an extensive bibliography.

The nucleotide sequences of ICP genes responsible for a given crystal phenotype and active against the same insect order are generally more related, i.e., more homologous, than are the nucleotide sequences of B.t. genes encoding delta-endotoxin proteins active against different orders of insects. H ofte and Whiteley (1989) defines an ordered classification of genes encoding B.t. delta-endotoxin proteins based on homology of delta-endotoxin amino acid sequences, as well as similarities in insecticidal activity; a subranking has also been established based upon further refinement of sequence relationship. As noted by H ofte and Whiteley (1989), the majority of insecticidal B.t. strains are active against insects of the order Lepidoptera, i.e., caterpillar insects. Insecticidal crystal proteins specifically active against Lepidoptera have been designated CryI proteins. These ICPs are encoded by cryI genes. Other B.t. strains produce different classes of crystal proteins, e.g., CryII proteins are active against lepidopteran and (for CryIIA) dipteran insects; CryIII proteins are insecticidal to insects of the order Coleoptera, i.e., beetles; and CryIV proteins are active against insects of the order Diptera, i.e., flies and mosquitoes. A compilation of the amino acid identities for several CryI proteins as well as CryII, CryIII and CryIV proteins has been determined in Hodgman and Ellar, J. DNA Sequencing and Mapping, 1, pp. 97-106 (1990).

The CryI family of ICPs contains the largest number of known toxin genes derived from B.t., as evidenced by the survey in H ofte and Whiteley (1989) and by subsequent reports of CryI-type ICPs.

Schnepf et al., J. Biol. Chem., 260, pp. 6264-6272 (1985), reported the complete nucleotide sequence for a toxin gene from B.t. kurstaki HD-1. This gene was subsequently classified as cryIA(a) by H ofte and Whiteley (1989). The published open reading frame extends 1176 amino acids and encodes a protein with a calculated molecular mass of 133,500 Daltons (Da). Another gene, also classified as cryIA(a), was isolated from B.t. subsp. kurstaki HD-1 Dipel.RTM. by Shibano et al., Gene 34, pp. 243-251 (1985). As detailed in Table 2 of H ofte and Whiteley (1989), this gene is highly related, especially in the N terminal moiety, to cryIA(a) reported by Schnepf et al. (1985). CryIA(a) protein is broadly active against Lepidoptera; H ofte and Whiteley (1989) reports that four of five tested lepidopteran insects were sensitive to this toxin.

Other ICP genes subsequently identified as cryIA(a) that are greater than 99% identical to the holotype cryIA(a) gene have been identified in B. thuringiensis subspecies aizawai, (Shimizu et al., Agric. Biol. Chem., 52, pp. 1565-1573 (1988)), subspecies kurstaki, (Kondo et al., Agric. Biol. Chem., 51, pp. 455-463 (1987)), and subspecies entomocidus (Masson et al., Nucleic Acids Res. 17, p. 446 (1989)). The cryI-type nucleotide sequence disclosed in European Patent Application Publication No. 0 367 474, published May 9, 1990, of Mycogen Corporation, reveals a DNA sequence related to the cryIA(a) gene and its encoded protein that is 92% positionally identical to the holotype CryIA(a) ICP.

Wabiko et al., DNA, 5, pp. 305-314 (1986), describe the DNA sequence of an insecticidal toxin gene from B.t. subsp. berliner 1715, subsequently classified as cryIA(b) by H ofte and Whiteley (1989). The molecular mass of the protein encoded is 130,615 Da and sequential deletions indicate that the NH.sub.2 -terminal 612 amino acid polypeptide is toxic to lepidopteran insects. H ofte et al., Eur. J. Biochem., 161, pp. 273-280 (1986), describe the cloning and nucleotide sequencing of a variant crystal protein gene from B.t. subsp. berliner 1715, subsequently also classified as cryIA(b). The cloned gene produces an approximately 130,000 Da protein which coincides with the mass of the major protein observed in the strain. The gene has an open reading frame of 3465 bases which would encode a protein 1155 amino acids in length having a mass of 130,533 Da. Similarities of this sequence to the previously reported sequences for the cloned crystal genes from B.t. kurstaki HD-1, B.t. kurstaki HD-73 and B.t. sotto are discussed in the H ofte et al. (1986) paper. Data identifying a minimal toxic fragment required for insecticidal activity are also presented. The cryIA(b) gene discussed in H ofte et al. (1986) differs in its deduced amino acid sequence by only two amino acids from the CryIA(b) protein reported by Wabiko et al.

Other cryIA(b) genes have been disclosed in Geiser et al., Gene, 48, pp. 109-118 (1986), Hefford et al., J. Biotechnol., 6, pp. 307-322 (1987), Oeda et al., Gene, 53, pp. 113-119 (1987), Kondo et al., supra, Fischhoff et al., Bio/Technology, 5, pp. 807-813 (1987) and Haider and Ellar, Nucl. Acids Res., 16, p. 10927 (1988). Each of these six CryIA(b) ICPs is greater than 99% positionally identical to the holotype CryIA(b) toxin.

Adang et al., Gene, 36, pp. 289-300 (1985), report the cloning and complete nucleotide sequence of a crystal protein gene harbored on the 75 kilobase (kb) plasmid of strain B.t. subsp. kurstaki HD-73. The restriction map in the article identified this gene as holotype cryIA(c) under the current classification system of H ofte and Whiteley (1989). The complete sequence of the gene, spanning 3537 nucleotide base pairs (bp), coding for 1178 amino acids and potentially encoding a protein of 133,330 Da, is shown in the article. Toxicity data against Manduca sexta for the protein made by the cryIA(c) gene are also presented. CryIA(c) toxins have been isolated from several strains of B.t. subsp. kenyae that are highly related to the above-noted CryIA(c) toxin from B.t. subsp. kurstaki (greater than 99% positionally identical in deduced amino acid sequence) but whose protein products, although broadly active against lepidopteran insects, nonetheless show quantitatively different toxicities for individual insect species (Von Tersch et al., Appl. Environ. Microbiol., 57, pp. 349-358 (1991)).

Brizzard et al., Nucleic Acids Res., 16, pp. 2723-2724 (1988), describe the nucleotide sequence of crystal protein gene cryA4 (subsequently classified as cryIB by H ofte and Whiteley (1989)) isolated from B.t. subsp. thuringiensis HD-2. H ofte and Whiteley (1989) report an insecticidal specificity of CryIB toxin for Pieris brassicae.

Honee et al., Nucleic Acids Res., 16, p. 6240 (1988), describe the complete DNA sequence for the BTVI crystal protein gene isolated from B.t. subsp. entomocidus 60.5 (holotype cryIC by H ofte and Whiteley (1989)). This protein is reported to exhibit enhanced insecticidal activities against Spodoptera species.

Sanchis et al., Mol. Microbiol., 3, pp. 229-238 (1989) report the nucleotide sequence for the N-terminal coding region (2470 nucleotides) and 5' flanking region of a gene from B.t. subsp. aizawai 7.29 now classified as the cryIC gene under the classification system of H ofte and Whiteley (1989). Sanchis et al. disclose similar information about the cryIC gene in European Patent Application Publication No. 0 295 156, published Dec. 14, 1988. The open reading frame encodes a truncated polypeptide 824 amino acids long with a calculated mass of 92,906 Da.

A gene isolated from B.t. subspecies aizawai and now classified as holotype cryID under the H ofte and Whiteley (1989) system is disclosed in European Patent Application Publication No. 0 358 557, published Mar. 14, 1990 of Plant Genetic Systems, N.V. H ofte and Whiteley (1989) report selective lepidopteran toxicity against Manduca sexta for the CryID protein, the CryID toxin being largely inactive against other lepidopteran insects tested.

The holotype cryIE gene, found in a B.t. subspecies darmstadiensis strain, is disclosed in European Patent Application Publication No. 0 358 557, supra. A highly related cryIE gene from B.t. subsp. kenyae is disclosed by Visser et al., J. Bacteriol., 172, pp. 6783-6788 (1990).

Visser, Mol. Gen. Genet., 212, pp. 219-224 (1988) report the isolation and analysis of five toxin genes belonging to four different gene families from B.t. entomocidus 60.5, one of which is reported by Honee et al. (1988), supra. Two of these genes, BTIV and BTVIII, are cryIA(a)-type genes according to the H ofte and Whiteley (1989) classification scheme. The BTVI gene, also reported by Honee et al. (1988) supra, is a cryIC gene according to the H ofte and Whiteley (1989) classification scheme. The authors state that the restriction map for another gene, designated BTV, closely resembles that identified for the cryID gene isolated from B.t. strain HD68 subsp. aizawai, and disclosed in European Patent Application Publication No. 0 358 557, supra. A fifth gene, designated BTVII, is also identified and its restriction map differs significantly from the other four genes described. Toxicity data against several lepidopteran insects, S. exigua, S. littoralis, H. virescens and P. brassicae, are presented for each of the isolates. The BTV gene product was inactive against all insects tested. The BTVI protein is highly active against Spodoptera larvae, and the BTVII protein is toxic to P. brassicae.

Additional genes within the cryI family have been reported in the literature. A gene found in B.t. subsp. aizawai and described as cryIF is disclosed by Chambers et al. in J. Bacteriol., 173, pp. 3966-3976 (1991) and in PCT International Publication No. WO91/16434, published Oct. 31, 1991. A gene described as cryIG from B.t. subsp. galleria is disclosed by Smulevitch et al., FEBS Lett., 293, pp. 25-28 (1991). A gene that is highly related to the cryIG gene has been isolated from B.t. DSIR 517 by Gleave et al., J. Gen. Microbiol., 138, pp. 55-62 (1992).

A novel gene related to cryI-type genes is disclosed in PCT International Publication No. WO 90/13651, published Nov. 15, 1990, of Imperial Chemical Industries PLC. This gene encodes an 81 kDa polypeptide (Cry pJH11) that is broadly insecticidal and more distantly related to the family of cryI sequences than are most other reported cryI-type sequences. Four cryI-type sequences are disclosed in European Patent Application Publication No. 0 405 810, published Jan. 2, 1991, of Mycogen Corporation. Inspection of the cryI-type sequences revealed that one of the disclosed genes (cry 81IB2) belongs to the cryIC class, one (cry 81IB) belongs to the cryID class, and one (cry 81IA) belongs to the cryIF class. The fourth disclosed cryI sequence (cry 81IA2) appears to belong to a new class. Two cryI sequences are disclosed in European Patent Application Publication No. 0 401 979, published Dec. 12, 1990, of Mycogen Corporation. One of the disclosed sequences (PS82A2) appears to encode a novel gene, the other sequence (PS82RR) is highly related to the novel sequence cry 81IA2 disclosed in European Patent Application Publication No. 0 405 810.

Five novel cry sequences are disclosed in European Patent Application Publication No. 0 462 721, published Dec. 27, 1991, of Mycogen Corporation. These Cry proteins are reported to be nematocidal.

SUMMARY OF THE INVENTION

Briefly stated, one aspect of the present invention relates to a purified, isolated cryET4 gene having a nucleotide base sequence coding for the amino acid sequence shown in FIG. 1 and listed in SEQ ID NO:2.

The isolated cryET4 gene has a coding region extending from nucleotide bases 99 to 3602 (including the stop codon) in the nucleotide base sequence shown in FIG. 1 and listed in SEQ ID NO:1.

The present invention also relates to the isolated CryET4 protein which is obtainable from the cryET4 gene, and which has the amino acid sequence shown in FIG. 1 (SEQ ID NO:2), and which is insecticidal to lepidopteran insects.

Another aspect of the present invention relates to a purified, isolated cryET5 gene having a nucleotide base sequence coding for the amino acid sequence shown in FIG. 2 and listed in SEQ ID NO:4.

The isolated cryET5 gene has a coding region extending from nucleotide bases 67 to 3756 (including the stop codon) in the nucleotide base sequence shown in FIG. 2 and listed in SEQ ID NO:3.

The present invention also relates to the isolated CryET5 protein which is obtainable from the cryET5 gene, and which has the amino acid sequence shown in FIG. 2 (SEQ ID NO:4), and which is insecticidal to lepidopteran insects.

Additionally, the present invention relates to biologically pure cultures of a Bacillus thuringiensis bacterium designated as strain EG7279 transformed with a cryET4 gene having a coding region listed in SEQ ID NO:1 and strain EG7283 transformed with a cryET5 gene having a coding region listed in SEQ ID NO:3 or mutants thereof having insecticidal activity against lepidopteran insects susceptible to the CryET4 and CryET5 proteins, respectively.

The invention also relates to a biologically pure culture of a Bacillus thuringiensis bacterium designated as strain EG5847 or mutants thereof having insecticidal activity against lepidopteran insects susceptible to B.t. strain EG5847. B.t. strain EG5847 is a wild type isolate and is the B.t. strain from which the cryET4 and cryET5 genes were isolated.

Additional aspects of the present invention relate to recombinant plasmids containing the cryET4 and cryET5 genes; bacteria transformed with the recombinant plasmids and capable of expressing the cryET4 and/or cryET5 genes; insecticide compositions comprising the proteins and/or one or both of the transformed bacteria and/or other bacteria containing the CryET4 or CryET5 protein, with an agriculturally acceptable carrier; a method of controlling lepidopteran insects using the insecticides; plants transformed with and capable of expressing the cryET4 and/or cryET5 genes; and hybridization probes containing the cryET4 or cryET5 gene wherein the gene or at least an oligonucleotide portion of it is labeled for such use.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 comprises FIGS. 1A through 1J and shows the nucleotide sequence of the cryET4 gene (SEQ ID NO:1) and the deduced amino acid sequence of the CryET4 protein (SEQ ID NO:2).

FIG. 2 comprises FIGS. 2A through 2J and shows the nucleotide sequence of the cryET5 gene (SEQ ID NO:3) and the deduced amino acid sequence of the CryET5 protein (SEQ ID NO:4).

FIG. 3 is a photograph of an ethidium bromide stained agarose gel containing size-fractionated plasmids of B.t. strains EG5847 and HD-1, with plasmid sizes in megadaltons (MDa) being shown. The abbreviations in FIG. 3 are as follows: "ori" indicates the loading site and "lin" means linear DNA.

FIG. 4 is a photograph of a Coomassie blue stained gel containing size-fractionated proteins from B.t. strains EG5847, EG7279 and EG7283, obtained by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

FIG. 5 comprises FIGS. 5A and 5B and is a restriction map of the recombinant plasmids pEG291 (5A) and pEG1108 (5B), both of which contain the cloned cryET4 gene. The location and orientation of the cryET4 gene are indicated by the arrow.

FIG. 6 comprises FIGS. 6A, 6B, 6C and 6D and is a restriction map of the recombinant plasmids pEG292 (6A), pEG300 (6B), pEG1110 (6C) and pEG1111 (6D). Plasmids pEG292 and pEG300 contain 5' and 3' portions of the cryET5 gene, respectively. Plasmids pEG1110 and pEG1111 contain the entire cloned cryET5 gene. The location and direction of transcription of the cryET5 gene are indicated by the arrows.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Two novel Bacillus thuringiensis (B.t.) toxin genes, designated cryET4 (SEQ ID NO:1) and cryET5 (SEQ ID NO:3), were obtained from a novel B.t. isolate designated EG5847. Isolation of B.t. strain EG5847, isolation of the novel toxin genes cryET4 and cryET5, construction of Bacillus/E. coli shuttle vectors containing cryET4 (pEG1108) and cryET5 (pEG1111), and transformation of pEG1108 and pEG1111 into a B.t. host (B.t. strain EG10368) to produce recombinant B.t. strains EG7279 and EG7283 expressing respectively the CryET4 (SEQ ID NO:2) and CryET5 (SEQ ID NO:4) toxin protein gene products, are described generally in the Examples.

Subcultures of B.t. strains EG5847, EG10368, EG7279 and EG7283 were deposited in the permanent collection of the Agricultural Research Service Culture Collection, Northern Regional Research Laboratory (NRRL), U.S. Department of Agriculture, 1815 North University Street, Peoria, Ill. 61604, U.S.A. The accession numbers and deposit dates are as follows:

______________________________________Subculture Accession No. Deposit Date______________________________________B.t. EG5847 NRRL B-21110 June 9, 1993B.t. EG10368 NRRL B-21125 July 20, 1993B.t. EG7279 NRRL B-21112 June 9, 1993B.t. EG7283 NRRL B-21111 June 9, 1993______________________________________

These microorganism deposits were made under the provisions of the "Budapest Treaty on the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure." All restrictions on the availability to the public of these deposited microorganisms will be irrevocably removed upon issuance of a U.S. patent based on this application.

The present invention is intended to cover mutants and recombinant or genetically engineered derivatives, e.g., truncated versions, of the cryET4 gene listed in SEQ ID NO:1 and the cryET5 gene listed in SEQ ID NO:3 that yield a protein with insecticidal properties essentially the same as those of the CryET4 protein listed in SEQ ID NO:2 and the CryET5 protein listed in SEQ ID NO:4. Likewise, the present invention covers those gene nucleotide base sequences that encode the amino acid sequences of the CryET4 protein (SEQ ID NO:2) and the CryET5 protein (SEQ ID NO:4). Variations may be made in the cryET4 and cryET5 gene nucleotide base sequences shown in FIGS. 1 and 2, respectively, and listed in SEQ ID NO:1 and SEQ ID NO:3, respectively, which do not affect the amino acid sequence of the gene product, since the degeneracy of the genetic code is well known to those skilled in the art. Moreover, there may be some variations or truncations in the coding regions of the cryET4 and cryET5 nucleotide base sequences which allow expression of the gene and production of functionally equivalent forms of the CryET4 and CryET5 insecticidal proteins. These variations or truncations, which can be determined without undue experimentation by those of ordinary skill in the art with reference to the present specification, are to be considered within the scope of the appended claims, since they are fully equivalent to the specifically claimed subject matter.

It has been shown that proteins of identical structure and function may be constructed by changing the amino acid sequence, if such changes do not alter the protein secondary structure (Kaiser and Kezdy, Science, 223, pp. 249-255 (1984)). Single amino acid substitutions have been introduced by site-directed mutagenesis at various positions of CryIA(a) toxin protein without altering the insecticidal properties of the parent toxin (Ge et al., Proc. Natl. Acad. Sci. USA, 86, pp. 4037-4041 (1989)). The present invention includes mutants of the amino acid sequences disclosed herein which have an unaltered protein secondary structure or, if the structure is altered, where the mutant has retained substantially equivalent biological activity compared to the unaltered protein.

The cryET4 gene (SEQ ID NO:1) and cryET5 (SEQ ID NO:3) gene are also useful as DNA hybridization probes, for discovering similar or closely related cryET4-type and cryET5-type genes in other B.t. strains. The cryET4 gene (SEQ ID NO:1) and cryET5 gene (SEQ ID NO:3), or unique portions or derivatives thereof capable of hybridizing selectively to a target nucleic acid, e.g., homologous oligonucleotides of 12 or more nucleotides, or larger portions of the genes, that contain nucleotide sequences unique to the cryET4 gene or cryET5 gene and that are different from similar sized nucleotide segments in known, prior art B.t. toxin genes, can be labeled for use as hybridization probes using conventional procedures. An exemplary label is a radioactive label.

Both the cryET4 gene (SEQ ID NO:1), its corresponding insecticidal CryET4 protein (SEQ ID NO:2) and the cryET5 gene (SEQ ID NO:2) and its corresponding insecticidal CryET5 protein (SEQ ID NO:4) were first identified in B.t. strain EG5847, a novel B.t. isolate. The characteristics of B.t. strain EG5847 are more fully described in the Examples.

The Bacillus strains described herein may be cultured using conventional growth media and standard fermentation techniques. The B.t. strains harboring the cryET4 gene (SEQ ID NO:1) or the cryET5 gene (SEQ ID NO:3), or both genes, may be fermented, as described in Example 1, until the cultured B.t. cells reach the stage of their growth cycle when the CryET4 crystal protein (SEQ ID NO:2) or the CryET5 crystal protein (SEQ ID NO:4) is formed. For sporogenous B.t. strains, fermentation is typically continued through the sporulation stage when the crystal protein is formed along with spores. The B.t. fermentation culture is then typically harvested by centrifugation, filtration or the like to separate fermentation culture solids containing the crystal protein from the culture medium.

The separated fermentation solids are primarily CryET4 crystal protein (SEQ ID NO:2) or CryET5 crystal protein (SEQ ID NO:4) and B.t. spores (if a sporulating host is employed), along with some cell debris, some intact cells and residual fermentation medium solids. If desired, the crystal protein may be separated from the other recovered solids via conventional methods, e.g., density gradient fractionation.

The B.t. strains exemplified in this disclosure are sporulating varieties (spore forming or sporogenous strains) but the cryET4 gene (SEQ ID NO:1) and cryET5 gene (SEQ ID NO:3) also have utility in asporogenous Bacillus strains, i.e., strains that produce the crystal protein without production of spores. It should be understood that references to "fermentation cultures" of B.t. strains containing the cryET4 gene (SEQ ID NO:1) or the cryET5 gene (SEQ ID NO:3) in this disclosure are intended to cover sporulated B.t. cultures, i.e., B.t. cultures containing the CryET1 crystal protein and spores, and sporogenous Bacillus strains that have produced crystal proteins during the vegetative stage, as well as asporogenous Bacillus strains containing the cryET4 gene (SEQ ID NO:1) or cryET5 (SEQ ID NO:3) gene in which the culture has reached the growth stage where the crystal protein is actually produced.

Mutants of B.t. strains harboring the cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) can be made by procedures well known in the art. For example, an asporogenous mutant can be obtained through ethylmethane sulfonate mutagenesis. Mutants can also be made using ultraviolet light and nitrosoguanidine by procedures that are well known to those skilled in the art. References in this specification to "mutants" of wild-type or recombinant B.t. strains harboring the cryET4 gene or cryET5 gene refer to those derivatives which are capable of producing toxin protein exhibiting insecticidal activity against lepidopteran insects, at least equivalent to the insecticidal activity of the parent strain.

The CryET4 protein (SEQ ID NO:2) is an insecticidal compound active against a large number of lepidopteran insects, particularly those described in Example 4. The CryET4 protein (SEQ ID NO:2) may be used as the active ingredient in insecticidal formulations useful for controlling lepidopteran insects.

The CryET5 protein (SEQ ID NO:4) is an insecticidal compound active against a large number of lepidopteran insects, particularly those described in Example 4. The CryET5 protein (SEQ ID NO:4) may be used as the active ingredient in insecticidal formulations useful for controlling lepidopteran insects.

Such insecticidal formulations or compositions typically contain agriculturally acceptable carriers or adjuvants in addition to the active ingredient and are prepared and used in a manner well known to those skilled in the art.

The CryET4 protein (SEQ ID NO:2) or CryET5 protein (SEQ ID NO:4) may be employed in insecticidal formulations in isolated or purified form, e.g., as the crystal protein itself. Alternatively, the CryET4 protein (SEQ ID NO:2) or CryET5 protein (SEQ ID NO:4) may be present in the recovered fermentation solids, obtained from culturing of a Bacillus strain, e.g., Bacillus thuringiensis or other microorganism host carrying the cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) and capable of producing the CryET4 or CryET5 protein. The CryET4 protein or CryET5 protein is thus associated with the B.t. bacterium which produced the protein, as an intimate mixture of crystal protein, cell debris and spores, if any, in the recovered fermentation solids. The recovered fermentation solids containing the CryET4 or CryET5 protein may be dried, if desired, prior to incorporation in the insecticidal formulation. Genetically engineered or transformed B.t. strains or other host microorganisms containing a recombinant plasmid that expresses the cloned cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3), obtained by recombinant DNA procedures, may also be used. For construction of recombinant B.t. strains containing either the cryET4 gene or cryET5 gene, B.t. var. kurstaki strain EG10368 is a preferred host, and this B.t. strain is utilized in Example 2. B.t. strain EG10368 is a crystal-negative, toxin plasmid-free, naturally occurring mutant of B.t. strain HD73-26 (described in U.S. Pat. No. 5,080,897, issued to Gonzalez, Jr. et al. on Jan. 14, 1992) that is highly transformable with recombinant plasmids, particularly those isolated from E. coli strains, e.g., DH5.alpha..

The formulations or compositions of this invention containing the insecticidal CryET4 protein (SEQ ID NO:2) or CryET5 protein (SEQ ID NO:4) as the active component are applied at an insecticidally effective amount which will vary depending on such factors as, for example, the specific lepidopteran insects to be controlled, the specific plant or crop to be treated and the method of applying the insecticidally active compositions.

The insecticide compositions are made by formulating the insecticidally active component with the desired agriculturally acceptable carrier. The formulated compositions may be in the form of a dust or granular material, or a suspension in oil (vegetable or mineral), or water or oil/water emulsions, or as a wettable powder, or in combination with any other carrier material suitable for agricultural application. Suitable agricultural carriers can be solid or liquid and are well known in the art. The term "agriculturally acceptable carrier" covers all adjuvants, e.g., inert components, dispersants, surfactants, tackifiers, binders, etc. that are ordinarily used in insecticide formulation technology; these are well known to those skilled in insecticide formulation.

The formulations containing the CryET4 protein (SEQ ID NO:2) or CryET5 protein (SEQ ID NO:4) and one or more solid or liquid adjuvants are prepared in known manners, e.g., by homogeneously mixing, blending and/or grinding the insecticidally active CryET4 or CryET5 protein component with suitable adjuvants using conventional formulation techniques.

The insecticidal compositions of this invention are applied to the environment of the target lepidopteran insect, typically onto the foliage of the plant or crop to be protected, by conventional methods, preferably by spraying. Other application techniques, e.g., dusting, sprinkling, soaking, soil injection, seed coating, seedling coating or spraying, or the like, are also feasible and may be required for insects that cause root or stalk infestation. These application procedures are well known in the art.

The cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) may be introduced into a variety of microorganism hosts without undue experimentation, using procedures well known to those skilled in the art for transforming suitable hosts under conditions which allow for stable maintenance and expression of the cloned genes. Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1982). Suitable hosts that allow the cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) gene to be expressed and the CryET4 protein (SEQ ID NO:2) or CryET5 protein (SEQ ID NO:4) to be produced include B.t. and other Bacillus species such as B. subtilis or B. megaterium. A general method for the transformation of Bacillus strains is provided by Macaluso et al. in J. Bacteriol., 173, pp. 1353-1356 (1991) and Mettus et al. in Appl. Environ. Microbiol., 56, pp. 1128-1134 (1990). Genetically altered or engineered microorganisms containing the cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) can also contain other toxin genes present in the same microorganism; these genes could concurrently produce ICPs different from the CryET4 protein or CryET5 protein.

Plant-colonizing or root-colonizing microorganisms may also be employed as the host for the cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3). Exemplary microorganism hosts for B.t. toxin genes include the plant-colonizing microbe Clavibacter xyli subsp. cynodontis, as described by Turner et al. in Appl. Environ. Microbiol., 57, pp. 3522-3528, and root-colonizing pseudomonad strains, as described by Obukowicz et al. in Gene, 45, pp. 327-331 (1986). Procedures such as those described by Turner et al. (1991) supra, and Obukowicz et al. (1986), supra, are well known to those skilled in the art and available for introducing the cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) into such microorganism hosts under conditions which allow for stable maintenance and expression of the gene in the resulting transformants.

The transformants, i.e., host microorganisms that harbor a cloned gene in a recombinant plasmid, can be isolated in accordance with conventional methods, usually employing a selection technique, which allows growth of only those host microorganisms that contain a recombinant plasmid. The transformants then can be tested for insecticidal activity. These techniques are standard procedures well known to those skilled in the art.

Characteristics of particular interest in selecting a host cell for purposes of production include ease of introducing the gene into the host, availability of expression systems, efficiency of expression, stability of the CryET4 or CryET5 insecticidal protein in the host, and the presence of auxiliary genetic capabilities. The cellular host containing the insecticidal cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) may be grown in any convenient nutrient medium, where expression of the cryET4 gene or cryET5 gene is obtained and CryET4 protein (SEQ ID NO:2) or CryET5 protein (SEQ ID NO:4) produced, typically to sporulation. The sporulated cells containing the crystal protein may then be harvested in accordance with conventional methods, e.g., centrifugation or filtration.

The cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3), particularly the toxin portion (N-terminal moiety) thereof, may also be incorporated into a plant which is capable of expressing the gene and producing CryET4 protein (SEQ ID NO:2) or CryET5 protein (SEQ ID NO:4), rendering the plant more resistant to insect attack. Genetic engineering of plants with the cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) may be accomplished by introducing the desired DNA containing the gene into plant tissues or cells, using DNA molecules of a variety of forms and origins that are well known to those skilled in plant genetic engineering. Examples of techniques for introducing DNA into plant tissue are disclosed in European Patent Application Publication No. 0 289 479, published Nov. 1, 1988, of Monsanto Company and by Perlak et al. in "Modification of the Coding Sequence Enhances Plant Expression of Insect Control Protein Genes," Proc. Natl. Acad. Sci. USA, 88, pp. 3324-3328 (1991).

DNA containing the cryET4 gene (SEQ ID NO:1) or cryET5 gene (SEQ ID NO:3) or a modified gene, operatively associated with a suitable plant promoter, e.g., CaMV35S, capable of effecting production of the CryET4 protein (SEQ ID NO:2) or CryET5 protein (SEQ ID NO:4), may be delivered into the plant cells or tissues directly by infectious plasmids, such as Ti, the plasmid from Agrobacterium tumefaciens, viruses or microorganisms like A. tumefaciens. Additionally, the use of lysosomes or liposomes, microinjection by mechanical methods and by other techniques familiar to those skilled in plant genetic engineering may be used.

The basic methods employed in the construction and evaluation of the recombinant plasmids and recombinant microorganism hosts described in this specification are generally well know to those proficient in the art of molecular cloning. Descriptions of these general laboratory procedures and definitions of nomenclature may be found in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1982) and in a subsequent edition by Sambrook et al. (1989).

The characteristics of the CryET4 protein (SEQ ID NO:2) and CryET5 protein (SEQ ID NO:4), sequencing of the cryET4 gene (SEQ ID NO:1) and cryET5 gene (SEQ ID NO:3), comparison of sequence data to known B.t. toxin genes and insecticidal activity of the CryET4 and CryET5 proteins are described in the following specific, non-limiting examples.

EXAMPLE 1

Characterization of B.t. EG5847

B.t. strain EG5847 is a wild-type isolate, identified by visual examination of the colony as exhibiting a unique crystal morphology, and was isolated as a colony from maize dust. The colony contained endospores and bipyramidal and flat, diamond-shaped crystalline inclusions. Subsequent insect bioassay of this wild-type B.t. strain confirmed its insecticidal activity towards lepidopteran insects.

The complement of native plasmids contained within isolated B.t. EG5847 was determined by modified Eckhardt agarose gel electrophoresis as described by Gonz alez, Jr. et al., in Proc. Natl. Acad. Sci. USA, 79, pp. 6951-6955 (1982). The results, as shown in FIG. 3, revealed the presence of 5, 8, 12, 18 and 110 MDa plasmids. This pattern of native plasmids did not correspond to patterns typical of known serovars (Carlton and Gonz alez, pp. 246-252, in Molecular Biology of Microbial Differentiation, J. A. Hoch and P. Setlow, ed., American Society for Microbiology, Washington, D.C. (1985)).

Wild-type B.t. strain EG5847 was grown for five days at 25.degree. C. in DSM medium (described by Donovan et al. in Appl. Environm. Microbiol., 58, pp. 3921-3927 (1992)) until sporulation and cell lysis had occurred. Recombinant B.t. strains EG7279 (Example 2), containing the cryET4 gene, and EG7283 (Example 2), containing the cryET5 gene, were grown in DSM medium containing 3 .mu.g of chloramphenicol per ml in a similar manner. Fermentation solids containing spores and crystal proteins were isolated by centrifugation. Crystal proteins were purified from the spores and cell debris by sucrose density gradient centrifugation (described by Koller et al. in Biochem. Biophys. Res. Communic., 184, pp. 692-699 (1992)). Aliquots of the washed crystals were solubilized by heating in Laemmli buffer (10% (w/w) glycerol, 5% (w/w) 2-mercaptoethanol, 1% (w/v) SDS, 0.188M Tris HCl pH 6.8, 0.01% (v/v) bromphenol blue) at 100.degree. C. for 5 minutes. The solubilized crystal proteins were size fractionated by SDS-polyacrylamide gel electrophoresis. After size fractionation, the proteins were visualized by staining with Coomassie Blue R-250 dye.

FIG. 4 shows the results of these protein size fractionation analyses where lane 1 is a molecular mass size standard, lane 2 is B.t. strain EG5847, lane 3 is B.t. strain EG2729 and lane 4 is B.t. strain EG7283. The numbers on the left side indicate the apparent molecular masses, in kilodaltons (kDa), of the crystal proteins synthesized by the B.t. strains. As shown in lane 3, a crystal protein having a mass of approximately 130 kDa was observed from EG7279. As shown in lane 4 for EG7283, a crystal protein having a mass of approximately 130 kDa was produced. The wild type strain EG5847 exhibited a large protein band of approximately 130 kDa. The observed masses of the crystal proteins are in agreement with the masses predicted from the DNA sequences obtained in Example 3.

EXAMPLE 2

Cloning of the cryET4 and cryET5 Genes

Genomic DNA was isolated from B.t. strain EG5847 and then digested with HindIII. cryI-like genes were identified by Southern blotting (described by Southern, J. Mol. Biol. 98, pp. 503-517 (1975)). A radiolabelled 700 bp EcoR1 fragment of the cryIA(a) gene (described by Schnepf et al., J. Biol. Chem., 260, pp. 6264-6272 (1985)) was used as a hybridization probe to identify cryI-like genes containing HindIII restriction fragments of EG5847 DNA. The 700 bp cryIA(a) fragment hybridized to several HindIII restriction fragments of EG5847 DNA including fragments of approximately 5.0 kb and 4.7 kb.

The 5.0 kb and 4.7 kb cryIA(a)-hybridizing HindIII restriction fragments of B.t. strain EG5847 were cloned as follows. DNA fragments of approximately 4-8 kb from HindIII digests of EG5847 genomic DNA were purified by agarose gel electrophoresis and electroelution. These fragments were ligated to the E. coli plasmid vector pUC18 and the ligation mixture was then used to transform E. coli. Ampicillin-resistant E. coli colonies were blotted to nitrocellulose filters (Grunstein et al., Proc. Natl. Acad. Sci. USA 72, pp. 3961-3965 (1975)). The filters were probed with the radiolabelled 700 bp cryIA(a) gene fragment. Two positive colonies, designated as E. coli strains EG7286 and EG7287, were identified and were selected for further analysis.

HindIII digestion of a plasmid, designated pEG291, isolated from E. coli strain EG7286 revealed a HindIII insert fragment 5.0 kb in size in pUC18. The restriction map of plasmid pEG291 is shown in FIG. 5A.

An E. coli/B. thuringiensis shuttle vector containing the 5.0 kb HindIII fragment was constructed by ligating BamHI digested Bacillus plasmid pNN101 (Norton et al., Plasmid, 13, pp. 211-214 (1985)) into the unique BamHI site of pEG291 (FIG. 5B). The resulting plasmid, designated pEG1108 (FIG. 5B), contains a full length open reading frame which has been designated as the cryET4 gene (SEQ ID NO:1).

E. coli strain EG7287 contained a plasmid, designated pEG292, which had a 4.7 kb HindIII insert in pUC18. DNA sequencing as described in Example 3 indicated that an open reading frame present in the 4.7 kb insert was truncated at its 3'-end (FIG. 6A). The truncated portion was isolated using a synthetic oligonucleotide having the sequence 5'-AAGTTTCGCATCCATCGATG-3' (SEQ ID NO:5). The oligonucleotide, designated WD162, was homologous to nucleotides 2253 to 2272 of the open reading frame identified in plasmid pEG292. Southern blot analyses as described above indicated that WD162 (SEQ ID NO:5) hybridized to a 3.2 kb HincII restriction fragment of EG5847 DNA. Radiolabelled WD162 was then used in colony blot experiments as described above to probe E. coli cells that contained a plasmid library consisting of size-selected HincII restriction fragments of EG5847 DNA. Several E. coli colonies hybridized with WD162 and one colony, designated E. coli strain EG7288, was selected for further analysis.

HincII restriction analysis of a recombinant plasmid, designated pEG300, isolated from E. coli EG7288, indicated that a 3.9 kb HincII fragment was present in pUC18. DNA sequencing as described below showed that pEG300 contained an open reading frame truncated at its 5'-end by the HincII cleavage site (FIG. 6B).

The full length open reading frame was constructed by excising a 2.6 kb XbaI-BsmI fragment containing the 5' portion of the open reading frame from plasmid pEG292 and inserting the fragment into the XbaI-BsmI restriction sites of plasmid pEG300 (FIG. 6A and 6B). The resulting plasmid, designated pEG1110 (FIG. 6C), contains a full length open reading frame which has been designated as the cryET5 gene (SEQ ID NO:3).

An E. coli/B. thuringiensis expression vector containing the full length open reading frame of the cryET5 gene was constructed by ligating XbaI digested Bacillus plasmid pNN101 (Norton, supra) into the unique XbaI site of plasmid pEG1110 (FIG. 6D). The resulting construct was designated plasmid pEG1111.

Plasmids pEG1108 and pEG1111 are capable of replicating in both E. coli and B.t. The plasmids were transformed by electroporation (Macaluso et al., J. Bacteriol., 173, pp. 1353-1356 (1991)) into the acrystalliferous B.t. strain EG10368 resulting in B.t. strains EG7279 (pEG1108) and EG7283 (pEG1111), respectively containing the cryET4 and cryET5 genes. Both of these B.t. strains are capable of expressing their respective protein toxin genes, as described in Example 4.

EXAMPLE 3

Sequencing of the cryET4 and cryET5 Genes

The complete DNA sequence of the cryET4 gene was determined using plasmid pEG291 (Example 2). Plasmid pEG291 was sequenced by standard methods (Sanger et al., Proc. Natl. Acad. Sci. USA, 74, pp. 5463-5467 (1977)). The DNA sequences of the appropriate subclones of the 5.0 kb HindIII fragment were joined to give a continuous sequence of 3713 nucleotides which is shown in FIG. 1 and is designated as SEQ ID NO:1. Inspection of the sequence revealed an open reading frame beginning at position 99 and extending to position 3602 (including the stop codon). The gene has been designated cryET4. The deduced 1167 amino acid sequence of the gene product is shown in FIG. 1 and is designated as SEQ ID NO:2. The mass of the CryET4 protein (SEQ ID NO:2) encoded by the cryET4 gene (SEQ ID NO:1), as deduced from the open reading frame, is 132,774 Da. Among CryI-type protein toxins reported in the literature, the CryIA(a) protein appears to be most closely related to the CryET4 protein. CryET4 exhibits 69% amino acid homology with CryIA(a).

The complete DNA sequence of the cryET5 gene (SEQ ID NO:3) was determined by the Sanger method as described above. Subcloned gene fragments from pEG292, pEG300 and pEG1110 were sequenced. The DNA sequences of the subcloned fragments were joined to give a continuous sequence of 3,934 nucleotides which is shown in FIG. 2 and is designated as SEQ ID NO:3. Inspection of the sequence revealed an open reading frame beginning at position 67 and extending to position 3756 (including the stop codon). The gene has been designated cryET5. The deduced 1229 amino acid sequence of the gene product encoded by the cryET5 gene (SEQ ID NO:3) is shown in FIG. 2 and is designated as SEQ ID NO:4. The mass of the CryET5 protein (SEQ ID NO:4) encoded by the cryET5 gene (SEQ ID NO:3), as deduced from the open reading frame, is 139,783 Da. Among CryI-type proteins reported in the literature, the CryIB protein appears to be most closely related to the CryET5 protein. CryET5 exhibits 83% amino acid homology with CryIB.

EXAMPLE 4

Insecticidal Activity of Recombinant Strains Harboring cryET4 and cryET5 Genes

PLC.sub.50 values of purified CryET4 and CryET5 crystal proteins were determined against lepidopteran insects, and these are listed in Tables 1 and 2, respectively. The PLC.sub.50 dose is that amount of insecticidal crystal protein (ICP) which killed half of the insects tested, i.e., the median lethal concentration. CryET4 and CryET5 crystal proteins were isolated from B.t. strains EG7279 and EG7283, respectively, (described in Example 2) by sucrose density gradient centrifugation as described above. The amount of crystal protein recovered from the gradients was quantified by the Bradford protein assay (Bradford, Anal. Biochem., 72, p. 248 (1976)) after solubilization of the recovered crystal proteins with base and a reducing agent. Known amounts of purified crystals were diluted in 0.005% Triton.RTM. X-100 (v/v). Aliquots of eight two-fold serial dilutions (50 .mu.l) were applied to the surfaces of 32 wells (1.8 cm.sup.2 surface area) containing insect diet and dried for 1 hour at 30.degree. C. A general purpose Noctuidae artificial diet (E. G. King et al., Handbook of Insect Rearing, Vol. 2, P. Singh and R. F. Moore (eds.), pp. 323-328, Elsevier Science Publishers B.V., Amsterdam (1985)) was used for Trichoplusia ni, Ostrinia nubilalis and Heliothis virescens. Other standard diets were used for the other lepidopteran insects tested. One neonate larva (third-instar larva in the case of P. xylostella) was added to each well, and the wells were incubated at 30.degree. C. Mortality was recorded after seven days.

The insecticidal activity of CryET4 protein was compared with the activity of CryIA(a) protein (Schnepf et al., J. Biol. Chem., 260, pp. 6264-6272 (1985)). CryET4 exhibits a 69% amino acid sequence homology with CryIA(a). The results are presented in Table 1.

TABLE 1______________________________________PLC.sub.50 Bioassay Activity of Purified CryET4 PLC.sub.50 (ng ICP/well)Insect Species CryET4 CryIA(a)______________________________________Heliothis virescens 593 (493-711)** 94 (76-113)Helicoverpa zea 1,290 (1,046-1,599) 3,725 (3,004-4,551)Lymantria dispar 9,929 (5,767-26,039) 185 (138-243)Ostrinia nubilalis 197 (121-299) 34 (27-42)Pseudoplusia includens 33 (29-37) 14 (12-16)Plutella xylostella 30 (22-41) 12 (10-14)Javelin.sup. .RTM. *-resistantP. xylostella 4,758 (3,135-6,897) >50,000Spodoptera exiqua 1,748 (1,286-2,591) >20,000Spodoptera frugiperda 1,161 (555-2,115) >10,000Trichoplusia ni 62 (53-74) 80 (54-113)______________________________________ *Javelin is a commercial B.t. bioinsecticide. **Range in parentheses indicates 95% confidence level.

The PLC.sub.50 results in Table 1 indicate that the CryET4 protein (SEQ ID NO:2) exhibits good insecticidal activity to a broad spectrum of lepidopteran insects.

The results show that the CryET4 protein is more toxic than CryIA(a) against Helicoverpa zea (corn earworm/bollworm), Javelin.RTM.-resistant Plutella xylostella (diamondback moth), Spodoptera exigua (beet armyworm) and Spodoptera frugiperda (fall armyworm).

Particularly noteworthy is the very good activity against Spodoptera exigua (beet armyworm), an insect pest that not only is not susceptible to CryIA(a), but also is recalcitrant to most B.t. toxin proteins, and very good activity against Spodoptera frugiperda (fall armyworm), another recalcitrant insect pest. Activity against Pseudoplusia includens (soybean looper), Plutella xylostella (diamondback moth) and Trichoplusia ni (cabbage looper) was also good, comparable to that exhibited by CryIA(a).

Insect bioassay tests with CryET4 protein were also carried out against another lepidopteran insect, Agrotis ipsilon (black cutworm), which was found not to be susceptible to control with CryET4.

The insecticidal activity of CryET5 protein was compared with the activity of CryIB protein (Brizzard et al., Nucleic Acids Res. 16, 2723-2724 (1988)). CryET5 exhibits an 83% amino acid sequence homology with CryIB. Dilutions of purified CryET5 crystals were prepared in 0.005% Triton.RTM. X-100. Aliquots of appropriate dilutions (50 .mu.l) were applied to the surfaces of 32 wells and assayed as indicated above. The results are presented in Table 2.

TABLE 2______________________________________PLC.sub.50 Bioassay Activity of Purified CryET5 PLC.sub.50 (ng ICP/well)Insect Species CryET5 CryIB______________________________________Lymantria dispar 880 (555-1,397)** 3,580 (1,293-20,123)Ostrinia nubilalis 32 (29-37) 83 (51-123)Pseudoplusia includens 555 (437-646) 52 (44-61)Plutella xylostella 157 (127-193) 27 (23-32)Javelin.sup. .RTM. *-resistantP. xylostella 47 (23-80) 43 (35-55)Spodoptera frugiperda 2,812 (1,831-4,514) >10,000Trichoplusia ni 22 (19-27) 205 (176-241)______________________________________ *Javelin is a commercial B.t. bioinsecticide. **Range in parentheses indicates 95% confidence level.

The PLC.sub.50 results in Table 2 indicate that the CryET5 protein (SEQ ID NO:4) exhibits good insecticidal activity to a broad spectrum of lepidopteran insects.

The results show that the CryET5 protein is more toxic than CryIB against Spodoptera frugiperda (fall armyworm) and Trichoplusia ni (cabbage looper). The CryET5 protein and CryIB protein both exhibited excellent insecticidal activity against Javelin.RTM.-resistant Plutella xylostella (diamondback moth), a B.t.-resistant insect pest that is not susceptible to CryIA-type toxin proteins, and to Ostrinia nubilalis (European corn borer).

Insect bioassay tests with CryET5 protein were also carried out against a few other lepidopteran insects, but these were found not to be susceptible to control with CryET5: Agrotis ipsilon (black cutworm), Heliothis virescens (tobacco budworm), Helicoverpa zea (corn earworm/bollworm) and Spodoptera exigua (beet armyworm).

The present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and, accordingly, reference should be made to the appended claims, rather than to the foregoing specification as indicating the scope of the invention.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 5(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3713 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 99..3602(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:AAATTCATAATATGAATCATACGTTTTAAAGTGTTGTGAAGAAAAGAGAATTGATCTTTA60GAATTTTTTTATTTTAACCAAAGAGAAAGGGGTAACTTATGGAGATAAATAAT113MetGluIleAsnAsn15CAGAAGCAATGCATACCATATAATTGCTTAAGTAATCCTGAGGAAGTA161GlnLysGlnCysIleProTyrAsnCysLeuSerAsnProGluGluVal101520CTTTTGGATGGGGAGAGGATATTACCTGATATCGATCCACTCGAAGTT209LeuLeuAspGlyGluArgIleLeuProAspIleAspProLeuGluVal253035TCTTTGTCGCTTTTGCAATTTCTTTTGAATAACTTTGTTCCAGGGGGA257SerLeuSerLeuLeuGlnPheLeuLeuAsnAsnPheValProGlyGly404550GGCTTTATTTCAGGATTAGTTGATAAAATATGGGGGGCTTTGAGACCA305GlyPheIleSerGlyLeuValAspLysIleTrpGlyAlaLeuArgPro556065TCTGAATGGGACTTATTTCTTGCACAGATTGAACGGTTGATTGATCAA353SerGluTrpAspLeuPheLeuAlaGlnIleGluArgLeuIleAspGln70758085AGAATAGAAGCAACAGTAAGAGCAAAAGCAATCACTGAATTAGAAGGA401ArgIleGluAlaThrValArgAlaLysAlaIleThrGluLeuGluGly9095100TTAGGGAGAAATTATCAAATATACGCTGAAGCATTTAAAGAATGGGAA449LeuGlyArgAsnTyrGlnIleTyrAlaGluAlaPheLysGluTrpGlu105110115TCAGATCCTGATAACGAAGCGGCTAAAAGTAGAGTAATTGATCGCTTT497SerAspProAspAsnGluAlaAlaLysSerArgValIleAspArgPhe120125130CGTATACTTGATGGTCTAATTGAAGCAAATATCCCTTCATTTCGGATA545ArgIleLeuAspGlyLeuIleGluAlaAsnIleProSerPheArgIle135140145ATTGGATTTGAAGTGCCACTTTTATCGGTTTATGTTCAAGCAGCTAAT593IleGlyPheGluValProLeuLeuSerValTyrValGlnAlaAlaAsn150155160165CTACATCTCGCTCTATTGAGAGATTCTGTTATTTTTGGAGAGAGATGG641LeuHisLeuAlaLeuLeuArgAspSerValIlePheGlyGluArgTrp170175180GGATTGACGACAAAAAATGTCAATGATATCTATAATAGACAAATTAGA689GlyLeuThrThrLysAsnValAsnAspIleTyrAsnArgGlnIleArg185190195GAAATTCATGAATATAGCAATCATTGCGTAGATACGTATAACACAGAA737GluIleHisGluTyrSerAsnHisCysValAspThrTyrAsnThrGlu200205210CTAGAACGTCTAGGGTTTAGATCTATAGCGCAGTGGAGAATATATAAT785LeuGluArgLeuGlyPheArgSerIleAlaGlnTrpArgIleTyrAsn215220225CAGTTTAGAAGAGAACTAACACTAACTGTATTAGATATTGTCGCTCTT833GlnPheArgArgGluLeuThrLeuThrValLeuAspIleValAlaLeu230235240245TTCCCGAACTATGACAGTAGACTGTATCCGATCCAAACTTTTTCTCAA881PheProAsnTyrAspSerArgLeuTyrProIleGlnThrPheSerGln250255260TTGACAAGAGAAATTGTTACATCCCCAGTAAGCGAATTTTATTATGGT929LeuThrArgGluIleValThrSerProValSerGluPheTyrTyrGly265270275GTTATTAATAGTGGTAATATAATTGGTACTCTTACTGAACAGCAGATA977ValIleAsnSerGlyAsnIleIleGlyThrLeuThrGluGlnGlnIle280285290AGGCGACCACATCTTATGGACTTCTTTAACTCCATGATCATGTATACA1025ArgArgProHisLeuMetAspPhePheAsnSerMetIleMetTyrThr295300305TCAGATAATAGACGGGAACATTATTGGTCAGGACTTGAAATGACGGCT1073SerAspAsnArgArgGluHisTyrTrpSerGlyLeuGluMetThrAla310315320325TATTTTACAGGATTTGCAGGAGCTCAAGTGTCATTCCCTTTAGTCGGG1121TyrPheThrGlyPheAlaGlyAlaGlnValSerPheProLeuValGly330335340ACTAGAGGGGAGTCAGCTCCACCATTAACTGTTAGAAGTGTTAATGAT1169ThrArgGlyGluSerAlaProProLeuThrValArgSerValAsnAsp345350355GGAATTTATAGAATATTATCGGCACCGTTTTATTCAGCGCCTTTTCTA1217GlyIleTyrArgIleLeuSerAlaProPheTyrSerAlaProPheLeu360365370GGCACCATTGTATTGGGAAGTCGTGGAGAAAAATTTGATTTTGCGCTT1265GlyThrIleValLeuGlySerArgGlyGluLysPheAspPheAlaLeu375380385AATAATATTTCACCTCCGCCATCTACAATATACAGACATCCTGGAACA1313AsnAsnIleSerProProProSerThrIleTyrArgHisProGlyThr390395400405GTAGATTCACTAGTCAGTATACCGCCACAGGATAATAGCGTACCACCG1361ValAspSerLeuValSerIleProProGlnAspAsnSerValProPro410415420CACAGGGGATCTAGTCATCGATTAAGTCATGTTACAATGCGCGCAAGT1409HisArgGlySerSerHisArgLeuSerHisValThrMetArgAlaSer425430435TCCCCTATATTCCATTGGACGCATCGCAGCGCAACCACTACAAATACA1457SerProIlePheHisTrpThrHisArgSerAlaThrThrThrAsnThr440445450ATTAATCCAAATGCTATTATCCAAATACCACTAGTAAAAGCATTTAAC1505IleAsnProAsnAlaIleIleGlnIleProLeuValLysAlaPheAsn455460465CTTCATTCAGGTGCCACTGTTGTTAGAGGACCAGGGTTTACAGGTGGT1553LeuHisSerGlyAlaThrValValArgGlyProGlyPheThrGlyGly470475480485GATATCCTTCGAAGAACGAATACTGGCACATTTGCAGATATGAGAGTA1601AspIleLeuArgArgThrAsnThrGlyThrPheAlaAspMetArgVal490495500AATATTACTGGGCCATTATCCCAAAGATATCGTGTAAGAATTCGCTAT1649AsnIleThrGlyProLeuSerGlnArgTyrArgValArgIleArgTyr505510515GCTTCTACGACAGATTTACAATTTTTCACGAGAATCAATGGAACTTCT1697AlaSerThrThrAspLeuGlnPhePheThrArgIleAsnGlyThrSer520525530GTAAATCAAGGTAATTTCCAAAGAACTATGAATAGAGGGGATAATTTA1745ValAsnGlnGlyAsnPheGlnArgThrMetAsnArgGlyAspAsnLeu535540545GAATCTGGAAACTTTAGGACTGCAGGATTTAGTACGCCTTTTAGTTTT1793GluSerGlyAsnPheArgThrAlaGlyPheSerThrProPheSerPhe550555560565TCAAATGCGCAAAGTACATTCACATTGGGTACTCAGGCTTTTTCAAAT1841SerAsnAlaGlnSerThrPheThrLeuGlyThrGlnAlaPheSerAsn570575580CAGGAAGTTTATATAGATCGAATTGAATTTGTCCCGGCAGAAGTAACA1889GlnGluValTyrIleAspArgIleGluPheValProAlaGluValThr585590595TTCGAGGCAGAATCTGATTTAGAAAGAGCGCAAAAGGCGGTGAATGCC1937PheGluAlaGluSerAspLeuGluArgAlaGlnLysAlaValAsnAla600605610CTGTTTACTTCTACAAACCAACTAGGGCTAAAAACAGATGTGACGGAT1985LeuPheThrSerThrAsnGlnLeuGlyLeuLysThrAspValThrAsp615620625TATCAGATTGATCAAGTGTCCAATTTAGTAGAATGTTTATCAGATGAA2033TyrGlnIleAspGlnValSerAsnLeuValGluCysLeuSerAspGlu630635640645TTTTGTCTGGATGAAAAGAGAGAATTGTCCGAGAAAGTCAAACATGCA2081PheCysLeuAspGluLysArgGluLeuSerGluLysValLysHisAla650655660AAGCGACTTAGTGATAAGCGGAACCTACTTCAAGATCCAAACTTCACA2129LysArgLeuSerAspLysArgAsnLeuLeuGlnAspProAsnPheThr665670675TCTATCAATAGACAACTAGACCGTGGATGGAGAGGAAGTACGGATATT2177SerIleAsnArgGlnLeuAspArgGlyTrpArgGlySerThrAspIle680685690ACCATCCAAGGAGGAAATGACGTATTCAAAGAGAATTACGTCACACTA2225ThrIleGlnGlyGlyAsnAspValPheLysGluAsnTyrValThrLeu695700705CCAGGTACCTTTGATGAGTGTTATCCAACGTATTTGTATCAAAAAATA2273ProGlyThrPheAspGluCysTyrProThrTyrLeuTyrGlnLysIle710715720725GATGAGTCAAAATTAAAAGCCTATACTCGCTATGAATTAAGAGGGTAT2321AspGluSerLysLeuLysAlaTyrThrArgTyrGluLeuArgGlyTyr730735740ATTGAAGATAGTCAAGATTTAGAAGTCTATTTGATTCGTTACAATGCG2369IleGluAspSerGlnAspLeuGluValTyrLeuIleArgTyrAsnAla745750755AAACATGAAACAGTAAATGTTCCCGGTACAGGGTCCTTATGGCCGCTT2417LysHisGluThrValAsnValProGlyThrGlySerLeuTrpProLeu760765770TCAGTCGAAAGCCCAATCGGAAGGTGCGGAGAACCGAATCGATGTGTG2465SerValGluSerProIleGlyArgCysGlyGluProAsnArgCysVal775780785CCACATATTGAATGGAATCCTGATTTAGATTGTTCGTGTAGGGATGGG2513ProHisIleGluTrpAsnProAspLeuAspCysSerCysArgAspGly790795800805GAGAAGTGTGCCCATCATTCGCATCATTTCTCTCTAGATATTGATGTT2561GluLysCysAlaHisHisSerHisHisPheSerLeuAspIleAspVal810815820GGATGTACAGACCTAAATGAGGACCTAGGTGTATGGGTGATCTTTAAG2609GlyCysThrAspLeuAsnGluAspLeuGlyValTrpValIlePheLys825830835ATTAAAACGCAGGATGGCCATGCAAGATTAGGAAATCTAGAGTTTCTC2657IleLysThrGlnAspGlyHisAlaArgLeuGlyAsnLeuGluPheLeu840845850GAAGAGAAACCATTGTTAGGAGAAGCGTTAGCTCGTGTGAAAAGAGCG2705GluGluLysProLeuLeuGlyGluAlaLeuAlaArgValLysArgAla855860865GAGAAAAAATGGAGAGACAAACGCGAACAATTGCAGTTTGAAACGAAT2753GluLysLysTrpArgAspLysArgGluGlnLeuGlnPheGluThrAsn870875880885ATCGTTTACAAAGAGGCAAAAGAATCTGTAGATGCTTTATTCGTAGAT2801IleValTyrLysGluAlaLysGluSerValAspAlaLeuPheValAsp890895900TCTCACTATAATAGATTACAAGCGGATACGAACATTACGATGATTCAT2849SerHisTyrAsnArgLeuGlnAlaAspThrAsnIleThrMetIleHis905910915GCGGCAGATAAACGCGTTCATCGAATCCGAGAGGCTTATCTTCCGGAA2897AlaAlaAspLysArgValHisArgIleArgGluAlaTyrLeuProGlu920925930TTATCCGTTATCCCAGGTGTAAATGCGGACATTTTTGAAGAATTAGAA2945LeuSerValIleProGlyValAsnAlaAspIlePheGluGluLeuGlu935940945GGTCTTATTTTCACTGCATTCTCCCTATATGATGCGAGAAATATCATT2993GlyLeuIlePheThrAlaPheSerLeuTyrAspAlaArgAsnIleIle950955960965AAAAACGGTGATTTCAATAATGGTTTATCGTGTTGGAACGTGAAAGGG3041LysAsnGlyAspPheAsnAsnGlyLeuSerCysTrpAsnValLysGly970975980CATGTAGATATACAACAGAATGATCATCGTTCTGTCCTCGTTGTCCCG3089HisValAspIleGlnGlnAsnAspHisArgSerValLeuValValPro985990995GAATGGGAATCAGAGGTATCACAAGAAGTCCGCGTATGTCCAGGTCGT3137GluTrpGluSerGluValSerGlnGluValArgValCysProGlyArg100010051010GGCTATATTCTTCGTGTCACAGCGTACAAAGAGGGCTACGGAGAAGGA3185GlyTyrIleLeuArgValThrAlaTyrLysGluGlyTyrGlyGluGly101510201025TGCGTAACGATCCATGAGATCGAAGACAATACAGACGAATTGAAGTTT3233CysValThrIleHisGluIleGluAspAsnThrAspGluLeuLysPhe1030103510401045AGTAACTGCATAGAAGAGGAAGTCTATCCAACGGATACAGGTAATGAT3281SerAsnCysIleGluGluGluValTyrProThrAspThrGlyAsnAsp105010551060TATACTGCACACCAAGGTACAACAGGATGCGCAGATGCATGTAATTCC3329TyrThrAlaHisGlnGlyThrThrGlyCysAlaAspAlaCysAsnSer106510701075CGTAATGTTGGATATGAGGATGGATATGAAATAAATACTACAGCATCT3377ArgAsnValGlyTyrGluAspGlyTyrGluIleAsnThrThrAlaSer108010851090GTTAATTACAAACCGACTTATGAAGAAGAAATGTATACAGATGTACGA3425ValAsnTyrLysProThrTyrGluGluGluMetTyrThrAspValArg109511001105AGAGATAATCATTGTGAATATGACAGAGGATATGGGAACCATACACCG3473ArgAspAsnHisCysGluTyrAspArgGlyTyrGlyAsnHisThrPro1110111511201125TTACCAGCTGGTTATGTAACAAAAGAATTAGAGTACTTCCCTGAAACA3521LeuProAlaGlyTyrValThrLysGluLeuGluTyrPheProGluThr113011351140GATACAGTATGGATAGAGATTGGAGAAACGGAAGGAACATTCATCGTA3569AspThrValTrpIleGluIleGlyGluThrGluGlyThrPheIleVal114511501155GATAGTGTGGAATTACTCCTCATGGAGGAATAAGATTGTACGAAATCGAC3619AspSerValGluLeuLeuLeuMetGluGlu11601165TTTAAATGGCTCATTCTAAACAAAAAGTAGTCGTCTAATCTCTGTAACAAATAGAAAAGT3679AAATATTTGTAGAAAAAAGAAAAAGGACATTACT3713(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1167 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetGluIleAsnAsnGlnLysGlnCysIleProTyrAsnCysLeuSer151015AsnProGluGluValLeuLeuAspGlyGluArgIleLeuProAspIle202530AspProLeuGluValSerLeuSerLeuLeuGlnPheLeuLeuAsnAsn354045PheValProGlyGlyGlyPheIleSerGlyLeuValAspLysIleTrp505560GlyAlaLeuArgProSerGluTrpAspLeuPheLeuAlaGlnIleGlu65707580ArgLeuIleAspGlnArgIleGluAlaThrValArgAlaLysAlaIle859095ThrGluLeuGluGlyLeuGlyArgAsnTyrGlnIleTyrAlaGluAla100105110PheLysGluTrpGluSerAspProAspAsnGluAlaAlaLysSerArg115120125ValIleAspArgPheArgIleLeuAspGlyLeuIleGluAlaAsnIle130135140ProSerPheArgIleIleGlyPheGluValProLeuLeuSerValTyr145150155160ValGlnAlaAlaAsnLeuHisLeuAlaLeuLeuArgAspSerValIle165170175PheGlyGluArgTrpGlyLeuThrThrLysAsnValAsnAspIleTyr180185190AsnArgGlnIleArgGluIleHisGluTyrSerAsnHisCysValAsp195200205ThrTyrAsnThrGluLeuGluArgLeuGlyPheArgSerIleAlaGln210215220TrpArgIleTyrAsnGlnPheArgArgGluLeuThrLeuThrValLeu225230235240AspIleValAlaLeuPheProAsnTyrAspSerArgLeuTyrProIle245250255GlnThrPheSerGlnLeuThrArgGluIleValThrSerProValSer260265270GluPheTyrTyrGlyValIleAsnSerGlyAsnIleIleGlyThrLeu275280285ThrGluGlnGlnIleArgArgProHisLeuMetAspPhePheAsnSer290295300MetIleMetTyrThrSerAspAsnArgArgGluHisTyrTrpSerGly305310315320LeuGluMetThrAlaTyrPheThrGlyPheAlaGlyAlaGlnValSer325330335PheProLeuValGlyThrArgGlyGluSerAlaProProLeuThrVal340345350ArgSerValAsnAspGlyIleTyrArgIleLeuSerAlaProPheTyr355360365SerAlaProPheLeuGlyThrIleValLeuGlySerArgGlyGluLys370375380PheAspPheAlaLeuAsnAsnIleSerProProProSerThrIleTyr385390395400ArgHisProGlyThrValAspSerLeuValSerIleProProGlnAsp405410415AsnSerValProProHisArgGlySerSerHisArgLeuSerHisVal420425430ThrMetArgAlaSerSerProIlePheHisTrpThrHisArgSerAla435440445ThrThrThrAsnThrIleAsnProAsnAlaIleIleGlnIleProLeu450455460ValLysAlaPheAsnLeuHisSerGlyAlaThrValValArgGlyPro465470475480GlyPheThrGlyGlyAspIleLeuArgArgThrAsnThrGlyThrPhe485490495AlaAspMetArgValAsnIleThrGlyProLeuSerGlnArgTyrArg500505510ValArgIleArgTyrAlaSerThrThrAspLeuGlnPhePheThrArg515520525IleAsnGlyThrSerValAsnGlnGlyAsnPheGlnArgThrMetAsn530535540ArgGlyAspAsnLeuGluSerGlyAsnPheArgThrAlaGlyPheSer545550555560ThrProPheSerPheSerAsnAlaGlnSerThrPheThrLeuGlyThr565570575GlnAlaPheSerAsnGlnGluValTyrIleAspArgIleGluPheVal580585590ProAlaGluValThrPheGluAlaGluSerAspLeuGluArgAlaGln595600605LysAlaValAsnAlaLeuPheThrSerThrAsnGlnLeuGlyLeuLys610615620ThrAspValThrAspTyrGlnIleAspGlnValSerAsnLeuValGlu625630635640CysLeuSerAspGluPheCysLeuAspGluLysArgGluLeuSerGlu645650655LysValLysHisAlaLysArgLeuSerAspLysArgAsnLeuLeuGln660665670AspProAsnPheThrSerIleAsnArgGlnLeuAspArgGlyTrpArg675680685GlySerThrAspIleThrIleGlnGlyGlyAsnAspValPheLysGlu690695700AsnTyrValThrLeuProGlyThrPheAspGluCysTyrProThrTyr705710715720LeuTyrGlnLysIleAspGluSerLysLeuLysAlaTyrThrArgTyr725730735GluLeuArgGlyTyrIleGluAspSerGlnAspLeuGluValTyrLeu740745750IleArgTyrAsnAlaLysHisGluThrValAsnValProGlyThrGly755760765SerLeuTrpProLeuSerValGluSerProIleGlyArgCysGlyGlu770775780ProAsnArgCysValProHisIleGluTrpAsnProAspLeuAspCys785790795800SerCysArgAspGlyGluLysCysAlaHisHisSerHisHisPheSer805810815LeuAspIleAspValGlyCysThrAspLeuAsnGluAspLeuGlyVal820825830TrpValIlePheLysIleLysThrGlnAspGlyHisAlaArgLeuGly835840845AsnLeuGluPheLeuGluGluLysProLeuLeuGlyGluAlaLeuAla850855860ArgValLysArgAlaGluLysLysTrpArgAspLysArgGluGlnLeu865870875880GlnPheGluThrAsnIleValTyrLysGluAlaLysGluSerValAsp885890895AlaLeuPheValAspSerHisTyrAsnArgLeuGlnAlaAspThrAsn900905910IleThrMetIleHisAlaAlaAspLysArgValHisArgIleArgGlu915920925AlaTyrLeuProGluLeuSerValIleProGlyValAsnAlaAspIle930935940PheGluGluLeuGluGlyLeuIlePheThrAlaPheSerLeuTyrAsp945950955960AlaArgAsnIleIleLysAsnGlyAspPheAsnAsnGlyLeuSerCys965970975TrpAsnValLysGlyHisValAspIleGlnGlnAsnAspHisArgSer980985990ValLeuValValProGluTrpGluSerGluValSerGlnGluValArg99510001005ValCysProGlyArgGlyTyrIleLeuArgValThrAlaTyrLysGlu101010151020GlyTyrGlyGluGlyCysValThrIleHisGluIleGluAspAsnThr1025103010351040AspGluLeuLysPheSerAsnCysIleGluGluGluValTyrProThr104510501055AspThrGlyAsnAspTyrThrAlaHisGlnGlyThrThrGlyCysAla106010651070AspAlaCysAsnSerArgAsnValGlyTyrGluAspGlyTyrGluIle107510801085AsnThrThrAlaSerValAsnTyrLysProThrTyrGluGluGluMet109010951100TyrThrAspValArgArgAspAsnHisCysGluTyrAspArgGlyTyr1105111011151120GlyAsnHisThrProLeuProAlaGlyTyrValThrLysGluLeuGlu112511301135TyrPheProGluThrAspThrValTrpIleGluIleGlyGluThrGlu114011451150GlyThrPheIleValAspSerValGluLeuLeuLeuMetGluGlu115511601165(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3934 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 67..3756(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION: 2253..2272(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:AAACTATTCAATGGAGAAAAATTGAATAGTTGTAATGTAAGCACACCGAAAAAAGGAGGA60GTTATATTGACTTCAAATAGGAAAAATGAGAATGAAATTATAAATGCT108LeuThrSerAsnArgLysAsnGluAsnGluIleIleAsnAla1510TTATCGATTCCAACGGTATCGAATCCTTCCACGCAAATGAATCTATCA156LeuSerIleProThrValSerAsnProSerThrGlnMetAsnLeuSer15202530CCAGATGCTCGTATTGAAGATAGCTTGTGTGTAGCCGAGGTGAACAAT204ProAspAlaArgIleGluAspSerLeuCysValAlaGluValAsnAsn354045ATTGATCCATTTGTTAGCGCATCAACAGTCCAAACGGGTATAAACATA252IleAspProPheValSerAlaSerThrValGlnThrGlyIleAsnIle505560GCTGGTAGAATATTGGGCGTATTAGGTGTGCCGTTTGCTGGACAACTA300AlaGlyArgIleLeuGlyValLeuGlyValProPheAlaGlyGlnLeu657075GCTAGTTTTTATAGTTTTCTTGTTGGGGAATTATGGCCTAGTGGCAGA348AlaSerPheTyrSerPheLeuValGlyGluLeuTrpProSerGlyArg808590GATCCATGGGAAATTTTCCTGGAACATGTAGAACAACTTATAAGACAA396AspProTrpGluIlePheLeuGluHisValGluGlnLeuIleArgGln95100105110CAAGTAACAGAAAATACTAGGAATACGGCTATTGCTCGATTAGAAGGT444GlnValThrGluAsnThrArgAsnThrAlaIleAlaArgLeuGluGly115120125CTAGGAAGAGGCTATAGATCTTACCAGCAGGCTCTTGAAACTTGGTTA492LeuGlyArgGlyTyrArgSerTyrGlnGlnAlaLeuGluThrTrpLeu130135140GATAACCGAAATGATGCAAGATCAAGAAGCATTATTCTTGAGCGCTAT540AspAsnArgAsnAspAlaArgSerArgSerIleIleLeuGluArgTyr145150155GTTGCTTTAGAACTTGACATTACTACTGCTATACCGCTTTTCAGAATA588ValAlaLeuGluLeuAspIleThrThrAlaIleProLeuPheArgIle160165170CGAAATGAAGAAGTTCCATTATTAATGGTATATGCTCAAGCTGCAAAT636ArgAsnGluGluValProLeuLeuMetValTyrAlaGlnAlaAlaAsn175180185190TTACACCTATTATTATTGAGAGACGCATCCCTTTTTGGTAGTGAATGG684LeuHisLeuLeuLeuLeuArgAspAlaSerLeuPheGlySerGluTrp195200205GGGATGGCATCTTCCGATGTTAACCAATATTACCAAGAACAAATCAGA732GlyMetAlaSerSerAspValAsnGlnTyrTyrGlnGluGlnIleArg210215220TATACAGAGGAATATTCTAACCATTGCGTACAATGGTATAATACAGGG780TyrThrGluGluTyrSerAsnHisCysValGlnTrpTyrAsnThrGly225230235CTAAATAACTTAAGAGGGACAAATGCTGAAAGTTGGTTGCGGTATAAT828LeuAsnAsnLeuArgGlyThrAsnAlaGluSerTrpLeuArgTyrAsn240245250CAATTCCGTAGAGACCTAACGTTAGGGGTATTAGATTTAGTAGCCCTA876GlnPheArgArgAspLeuThrLeuGlyValLeuAspLeuValAlaLeu255260265270TTCCCAAGCTATGATACTCGCACTTATCCAATCAATACGAGTGCTCAG924PheProSerTyrAspThrArgThrTyrProIleAsnThrSerAlaGln275280285TTAACAAGAGAAATTTATACAGATCCAATTGGGAGAACAAATGCACCT972LeuThrArgGluIleTyrThrAspProIleGlyArgThrAsnAlaPro290295300TCAGGATTTGCAAGTACGAATTGGTTTAATAATAATGCACCATCGTTT1020SerGlyPheAlaSerThrAsnTrpPheAsnAsnAsnAlaProSerPhe305310315TCTGCCATAGAGGCTGCCATTTTCAGGCCTCCGCATCTACTTGATTTT1068SerAlaIleGluAlaAlaIlePheArgProProHisLeuLeuAspPhe320325330CCAGAACAACTTACAATTTACAGTGCATCAAGCCGTTGGAGTAGCACT1116ProGluGlnLeuThrIleTyrSerAlaSerSerArgTrpSerSerThr335340345350CAACATATGAATTATTGGGTGGGACATAGGCTTAACTTCCGCCCAATA1164GlnHisMetAsnTyrTrpValGlyHisArgLeuAsnPheArgProIle355360365GGAGGGACATTAAATACCTCAACACAAGGACTTACTAATAATACTTCA1212GlyGlyThrLeuAsnThrSerThrGlnGlyLeuThrAsnAsnThrSer370375380ATTAATCCTGTAACATTACAGTTTACGTCTCGAGACGTTTATAGAACA1260IleAsnProValThrLeuGlnPheThrSerArgAspValTyrArgThr385390395GAATCAAATGCAGGGACAAATATACTATTTACTACTCCTGTGAATGGA1308GluSerAsnAlaGlyThrAsnIleLeuPheThrThrProValAsnGly400405410GTACCTTGGGCTAGATTTAATTTTATAAACCCTCAGAATATTTATGAA1356ValProTrpAlaArgPheAsnPheIleAsnProGlnAsnIleTyrGlu415420425430AGAGGCGCCACTACCTACAGTCAACCGTATCAGGGAGTTGGGATTCAA1404ArgGlyAlaThrThrTyrSerGlnProTyrGlnGlyValGlyIleGln435440445TTATTTGATTCAGAAACTGAATTACCACCAGAAACAACAGAACGACCA1452LeuPheAspSerGluThrGluLeuProProGluThrThrGluArgPro450455460AATTATGAATCATATAGTCATAGATTATCTCATATAGGACTAATCATA1500AsnTyrGluSerTyrSerHisArgLeuSerHisIleGlyLeuIleIle465470475GGAAACACTTTGAGAGCACCAGTCTATTCTTGGACGCATCGTAGTGCA1548GlyAsnThrLeuArgAlaProValTyrSerTrpThrHisArgSerAla480485490GATCGTACGAATACGATTGGACCAAATAGAATTACACAAATACCATTG1596AspArgThrAsnThrIleGlyProAsnArgIleThrGlnIleProLeu495500505510GTAAAAGCACTGAATCTTCATTCAGGTGTTACTGTTGTTGGAGGGCCA1644ValLysAlaLeuAsnLeuHisSerGlyValThrValValGlyGlyPro515520525GGATTTACAGGTGGGGATATCCTTCGTAGAACAAATACGGGTACATTT1692GlyPheThrGlyGlyAspIleLeuArgArgThrAsnThrGlyThrPhe530535540GGAGATATACGATTAAATATTAATGTGCCATTATCCCAAAGATATCGC1740GlyAspIleArgLeuAsnIleAsnValProLeuSerGlnArgTyrArg545550555GTAAGGATTCGTTATGCTTCTACTACAGATTTACAATTTTTCACGAGA1788ValArgIleArgTyrAlaSerThrThrAspLeuGlnPhePheThrArg560565570ATTAATGGAACCACTGTTAATATTGGTAATTTCTCAAGAACTATGAAT1836IleAsnGlyThrThrValAsnIleGlyAsnPheSerArgThrMetAsn575580585590AGGGGGGATAATTTAGAATATAGAAGTTTTAGAACTGCAGGATTTAGT1884ArgGlyAspAsnLeuGluTyrArgSerPheArgThrAlaGlyPheSer595600605ACTCCTTTTAATTTTTTAAATGCCCAAAGCACATTCACATTGGGTGCT1932ThrProPheAsnPheLeuAsnAlaGlnSerThrPheThrLeuGlyAla610615620CAGAGTTTTTCAAATCAGGAAGTTTATATAGATAGAGTCGAATTTGTT1980GlnSerPheSerAsnGlnGluValTyrIleAspArgValGluPheVal625630635CCAGCAGAGGTAACATTTGAGGCAGAATATGATTTAGAAAGAGCACAA2028ProAlaGluValThrPheGluAlaGluTyrAspLeuGluArgAlaGln640645650AAGGCGGTGAATGCTCTGTTTACTTCTACAAATCCAAGAAGATTGAAA2076LysAlaValAsnAlaLeuPheThrSerThrAsnProArgArgLeuLys655660665670ACAGATGTGACAGATTATCATATTGACCAAGTGTCCAATATGGTGGCA2124ThrAspValThrAspTyrHisIleAspGlnValSerAsnMetValAla675680685TGTTTATCAGATGAATTTTGCTTGGATGAGAAGCGAGAATTATTTGAG2172CysLeuSerAspGluPheCysLeuAspGluLysArgGluLeuPheGlu690695700AAAGTGAAATATGCGAAGCGACTCAGTGATGAAAGAAACTTACTCCAA2220LysValLysTyrAlaLysArgLeuSerAspGluArgAsnLeuLeuGln705710715GATCCAAACTTCACATTCATCAGTGGGCAATTAAGTTTCGCATCCATC2268AspProAsnPheThrPheIleSerGlyGlnLeuSerPheAlaSerIle720725730GATGGACAATCAAACTTCCCCTCTATTAATGAGCTATCTGAACATGGA2316AspGlyGlnSerAsnPheProSerIleAsnGluLeuSerGluHisGly735740745750TGGTGGGGAAGTGCGAATGTTACCATTCAGGAAGGGAATGACGTATTT2364TrpTrpGlySerAlaAsnValThrIleGlnGluGlyAsnAspValPhe755760765AAAGAGAATTACGTCACACTACCGGGTACTTTTAATGAGTGTTATCCA2412LysGluAsnTyrValThrLeuProGlyThrPheAsnGluCysTyrPro770775780AATTATTTATATCAAAAAATAGGAGAGTCAGAATTAAAAGCTTATACG2460AsnTyrLeuTyrGlnLysIleGlyGluSerGluLeuLysAlaTyrThr785790795CGCTATCAATTAAGAGGGTATATTGAAGATAGTCAAGATCTAGAGATT2508ArgTyrGlnLeuArgGlyTyrIleGluAspSerGlnAspLeuGluIle800805810TATTTAATTCGTTACAATGCAAAGCATGAAACATTGGATGTTCCAGGT2556TyrLeuIleArgTyrAsnAlaLysHisGluThrLeuAspValProGly815820825830ACCGATTCCCTATGGCCGCTTTCAGTTGAAAGCCCAATCGGAAGGTGC2604ThrAspSerLeuTrpProLeuSerValGluSerProIleGlyArgCys835840845GGAGAACCAAATCGATGCGCACCACATTTTGAATGGAATCCTGATCTA2652GlyGluProAsnArgCysAlaProHisPheGluTrpAsnProAspLeu850855860GATTGTTCCTGCAGAGATGGAGAAAGATGTGCGCATCATTCCCATCAT2700AspCysSerCysArgAspGlyGluArgCysAlaHisHisSerHisHis865870875TTCACTTTGGATATTGATGTTGGGTGCACAGACTTGCATGAGAACCTA2748PheThrLeuAspIleAspValGlyCysThrAspLeuHisGluAsnLeu880885890GGCGTGTGGGTGGTATTCAAGATTAAGACGCAGGAAGGTTATGCAAGA2796GlyValTrpValValPheLysIleLysThrGlnGluGlyTyrAlaArg895900905910TTAGGAAATCTGGAATTTATCGAAGAGAAACCATTAATTGGAGAAGCA2844LeuGlyAsnLeuGluPheIleGluGluLysProLeuIleGlyGluAla915920925CTGTCTCGTGTGAAGAGAGCGGAAAAAAAATGGAGAGACAAACGGGAA2892LeuSerArgValLysArgAlaGluLysLysTrpArgAspLysArgGlu930935940AAACTACAATTGGAAACAAAACGAGTATATACAGAGGCAAAAGAAGCT2940LysLeuGlnLeuGluThrLysArgValTyrThrGluAlaLysGluAla945950955GTGGATGCTTTATTCGTAGATTCTCAATATGATCAATTACAAGCGGAT2988ValAspAlaLeuPheValAspSerGlnTyrAspGlnLeuGlnAlaAsp960965970ACAAACATTGGCATGATTCATGCGGCAGATAAACTTGTTCATCGAATT3036ThrAsnIleGlyMetIleHisAlaAlaAspLysLeuValHisArgIle975980985990CGAGAGGCGTATCTTTCAGAATTACCTGTTATCCCAGGTGTAAATGCG3084ArgGluAlaTyrLeuSerGluLeuProValIleProGlyValAsnAla99510001005GAAATTTTTGAAGAATTAGAAGGTCACATTATCACTGCAATGTCCTTA3132GluIlePheGluGluLeuGluGlyHisIleIleThrAlaMetSerLeu101010151020TACGATGCGAGAAATGTCGTTAAAAATGGTGATTTTAATAATGGATTA3180TyrAspAlaArgAsnValValLysAsnGlyAspPheAsnAsnGlyLeu102510301035ACATGTTGGAATGTAAAAGGGCATGTAGATGTACAACAGAGCCATCAT3228ThrCysTrpAsnValLysGlyHisValAspValGlnGlnSerHisHis104010451050CGTTCTGACCTTGTTATCCCAGAATGGGAAGCAGAAGTGTCACAAGCA3276ArgSerAspLeuValIleProGluTrpGluAlaGluValSerGlnAla1055106010651070GTTCGCGTCTGTCCGGGGCGTGGCTATATCCTTCGTGTCACAGCGTAC3324ValArgValCysProGlyArgGlyTyrIleLeuArgValThrAlaTyr107510801085AAAGAGGGATATGGAGAGGGCTGCGTAACGATCCATGAAATCGAGAAC3372LysGluGlyTyrGlyGluGlyCysValThrIleHisGluIleGluAsn109010951100AATACAGACGAACTAAAATTTAAAAACTGTGAAGAAGAGGAAGTGTAT3420AsnThrAspGluLeuLysPheLysAsnCysGluGluGluGluValTyr110511101115CCAACGGATACAGGAACGTGTAATGATTATACTGCACACCAAGGTACA3468ProThrAspThrGlyThrCysAsnAspTyrThrAlaHisGlnGlyThr112011251130GCAGCATGTAATTCCCGTAATGCTGGATATGAGGATGCATATGAAGTT3516AlaAlaCysAsnSerArgAsnAlaGlyTyrGluAspAlaTyrGluVal1135114011451150GATACTACAGCATCTGTTAATTACAAACCGACTTATGAAGAAGAAACG3564AspThrThrAlaSerValAsnTyrLysProThrTyrGluGluGluThr115511601165TATACAGATGTACGAAGAGATAATCATTGTGAATATGACAGAGGGTAT3612TyrThrAspValArgArgAspAsnHisCysGluTyrAspArgGlyTyr117011751180GTGAATTATCCACCAGTACCAGCTGGTTATGTGACAAAAGAATTAGAA3660ValAsnTyrProProValProAlaGlyTyrValThrLysGluLeuGlu118511901195TACTTCCCAGAAACAGATACAGTATGGATTGAGATTGGAGAAACGGAA3708TyrPheProGluThrAspThrValTrpIleGluIleGlyGluThrGlu120012051210GGAAAGTTTATTGTAGATAGCGTGGAACTACTCCTCATGGAAGAATAGGATCA3763GlyLysPheIleValAspSerValGluLeuLeuLeuMetGluGlu121512201225123CAAGTATAGCAGTTTAATAAATATTAATTAAAATAGTAGTCTAACTTCCGTTCCAATTAA3823ATAAGTAAATTACAGTTGTAAAAAGAAAACGGACATCACTCTTCAGAGAGCGATGTCCGT3883TTTTTATATGGTGTGTGCTAATGATAAATGTGCACGAAATTATATTGTCAA3934(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1229 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:LeuThrSerAsnArgLysAsnGluAsnGluIleIleAsnAlaLeuSer151015IleProThrValSerAsnProSerThrGlnMetAsnLeuSerProAsp202530AlaArgIleGluAspSerLeuCysValAlaGluValAsnAsnIleAsp354045ProPheValSerAlaSerThrValGlnThrGlyIleAsnIleAlaGly505560ArgIleLeuGlyValLeuGlyValProPheAlaGlyGlnLeuAlaSer65707580PheTyrSerPheLeuValGlyGluLeuTrpProSerGlyArgAspPro859095TrpGluIlePheLeuGluHisValGluGlnLeuIleArgGlnGlnVal100105110ThrGluAsnThrArgAsnThrAlaIleAlaArgLeuGluGlyLeuGly115120125ArgGlyTyrArgSerTyrGlnGlnAlaLeuGluThrTrpLeuAspAsn130135140ArgAsnAspAlaArgSerArgSerIleIleLeuGluArgTyrValAla145150155160LeuGluLeuAspIleThrThrAlaIleProLeuPheArgIleArgAsn165170175GluGluValProLeuLeuMetValTyrAlaGlnAlaAlaAsnLeuHis180185190LeuLeuLeuLeuArgAspAlaSerLeuPheGlySerGluTrpGlyMet195200205AlaSerSerAspValAsnGlnTyrTyrGlnGluGlnIleArgTyrThr210215220GluGluTyrSerAsnHisCysValGlnTrpTyrAsnThrGlyLeuAsn225230235240AsnLeuArgGlyThrAsnAlaGluSerTrpLeuArgTyrAsnGlnPhe245250255ArgArgAspLeuThrLeuGlyValLeuAspLeuValAlaLeuPhePro260265270SerTyrAspThrArgThrTyrProIleAsnThrSerAlaGlnLeuThr275280285ArgGluIleTyrThrAspProIleGlyArgThrAsnAlaProSerGly290295300PheAlaSerThrAsnTrpPheAsnAsnAsnAlaProSerPheSerAla305310315320IleGluAlaAlaIlePheArgProProHisLeuLeuAspPheProGlu325330335GlnLeuThrIleTyrSerAlaSerSerArgTrpSerSerThrGlnHis340345350MetAsnTyrTrpValGlyHisArgLeuAsnPheArgProIleGlyGly355360365ThrLeuAsnThrSerThrGlnGlyLeuThrAsnAsnThrSerIleAsn370375380ProValThrLeuGlnPheThrSerArgAspValTyrArgThrGluSer385390395400AsnAlaGlyThrAsnIleLeuPheThrThrProValAsnGlyValPro405410415TrpAlaArgPheAsnPheIleAsnProGlnAsnIleTyrGluArgGly420425430AlaThrThrTyrSerGlnProTyrGlnGlyValGlyIleGlnLeuPhe435440445AspSerGluThrGluLeuProProGluThrThrGluArgProAsnTyr450455460GluSerTyrSerHisArgLeuSerHisIleGlyLeuIleIleGlyAsn465470475480ThrLeuArgAlaProValTyrSerTrpThrHisArgSerAlaAspArg485490495ThrAsnThrIleGlyProAsnArgIleThrGlnIleProLeuValLys500505510AlaLeuAsnLeuHisSerGlyValThrValValGlyGlyProGlyPhe515520525ThrGlyGlyAspIleLeuArgArgThrAsnThrGlyThrPheGlyAsp530535540IleArgLeuAsnIleAsnValProLeuSerGlnArgTyrArgValArg545550555560IleArgTyrAlaSerThrThrAspLeuGlnPhePheThrArgIleAsn565570575GlyThrThrValAsnIleGlyAsnPheSerArgThrMetAsnArgGly580585590AspAsnLeuGluTyrArgSerPheArgThrAlaGlyPheSerThrPro595600605PheAsnPheLeuAsnAlaGlnSerThrPheThrLeuGlyAlaGlnSer610615620PheSerAsnGlnGluValTyrIleAspArgValGluPheValProAla625630635640GluValThrPheGluAlaGluTyrAspLeuGluArgAlaGlnLysAla645650655ValAsnAlaLeuPheThrSerThrAsnProArgArgLeuLysThrAsp660665670ValThrAspTyrHisIleAspGlnValSerAsnMetValAlaCysLeu675680685SerAspGluPheCysLeuAspGluLysArgGluLeuPheGluLysVal690695700LysTyrAlaLysArgLeuSerAspGluArgAsnLeuLeuGlnAspPro705710715720AsnPheThrPheIleSerGlyGlnLeuSerPheAlaSerIleAspGly725730735GlnSerAsnPheProSerIleAsnGluLeuSerGluHisGlyTrpTrp740745750GlySerAlaAsnValThrIleGlnGluGlyAsnAspValPheLysGlu755760765AsnTyrValThrLeuProGlyThrPheAsnGluCysTyrProAsnTyr770775780LeuTyrGlnLysIleGlyGluSerGluLeuLysAlaTyrThrArgTyr785790795800GlnLeuArgGlyTyrIleGluAspSerGlnAspLeuGluIleTyrLeu805810815IleArgTyrAsnAlaLysHisGluThrLeuAspValProGlyThrAsp820825830SerLeuTrpProLeuSerValGluSerProIleGlyArgCysGlyGlu835840845ProAsnArgCysAlaProHisPheGluTrpAsnProAspLeuAspCys850855860SerCysArgAspGlyGluArgCysAlaHisHisSerHisHisPheThr865870875880LeuAspIleAspValGlyCysThrAspLeuHisGluAsnLeuGlyVal885890895TrpValValPheLysIleLysThrGlnGluGlyTyrAlaArgLeuGly900905910AsnLeuGluPheIleGluGluLysProLeuIleGlyGluAlaLeuSer915920925ArgValLysArgAlaGluLysLysTrpArgAspLysArgGluLysLeu930935940GlnLeuGluThrLysArgValTyrThrGluAlaLysGluAlaValAsp945950955960AlaLeuPheValAspSerGlnTyrAspGlnLeuGlnAlaAspThrAsn965970975IleGlyMetIleHisAlaAlaAspLysLeuValHisArgIleArgGlu980985990AlaTyrLeuSerGluLeuProValIleProGlyValAsnAlaGluIle99510001005PheGluGluLeuGluGlyHisIleIleThrAlaMetSerLeuTyrAsp101010151020AlaArgAsnValValLysAsnGlyAspPheAsnAsnGlyLeuThrCys1025103010351040TrpAsnValLysGlyHisValAspValGlnGlnSerHisHisArgSer104510501055AspLeuValIleProGluTrpGluAlaGluValSerGlnAlaValArg106010651070ValCysProGlyArgGlyTyrIleLeuArgValThrAlaTyrLysGlu107510801085GlyTyrGlyGluGlyCysValThrIleHisGluIleGluAsnAsnThr109010951100AspGluLeuLysPheLysAsnCysGluGluGluGluValTyrProThr1105111011151120AspThrGlyThrCysAsnAspTyrThrAlaHisGlnGlyThrAlaAla112511301135CysAsnSerArgAsnAlaGlyTyrGluAspAlaTyrGluValAspThr114011451150ThrAlaSerValAsnTyrLysProThrTyrGluGluGluThrTyrThr115511601165AspValArgArgAspAsnHisCysGluTyrAspArgGlyTyrValAsn117011751180TyrProProValProAlaGlyTyrValThrLysGluLeuGluTyrPhe1185119011951200ProGluThrAspThrValTrpIleGluIleGlyGluThrGluGlyLys120512101215PheIleValAspSerValGluLeuLeuLeuMetGluGlu12201225(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:AAGTTTCGCATCCATCGATG20__________________________________________________________________________

Claims

1. An isolated cryET5 gene having a nucleotide base sequence coding for the amino acid sequence shown in FIG. 2 and listed in SEQ ID NO:4.

2. An isolated cryET5 gene according to claim 1 wherein the gene has a coding region extending from nucleotide bases 67 to 3756 in the nucleotide base sequence shown in FIG. 2 and listed in SEQ ID NO:3.

3. A recombinant plasmid containing the gene of claim 1 or 2.

4. A biologically pure culture of a bacterium transformed with and capable of expressing the recombinant plasmid of claim 3.

5. The bacterium of claim 4 wherein the bacterium is Bacillus thuringiensis.

6. The Bacillus thuringiensis bacterium of claim 5 deposited with the NRRL having accession number NRRL B-21111 and being designated as strain EG7283, or mutants thereof having insecticidal activity against lepidopteran insects at least equivalent to that of B.t. strain EG7283.

7. An insecticide composition comprising the bacterium of claim 4, a lepidopteran-toxic protein produced by such bacterium, and an agriculturally acceptable carrier.