Bacillus thuringiensis isolates active against lepidopteran pests

Abstract

Novel Bacillus thuringiensis genes encoding toxins which are active against lepidopteran insects have been cloned from novel lepidopteran-active B. thuringiensis microbes. The DNA encoding the B. thuringiensis toxins can be used to transform various prokaryotic and eukaryotic microbes to express the B. thuringiensis toxins. These recombinant microbes can be used to control lepidopteran insects in various environments.

Description

BACKGROUND OF THE INVENTION

The most widely used microbial pesticides are derived from the bacterium Bacillus thuringiensis. This bacterial agent is used to control a wide range of leaf-eating caterpillars and beetles, as well as mosquitos. Bacillus thuringiensis produces a proteinaceous parasporal body or crystal which is toxic upon ingestion by a susceptible insect host. For example, B. thuringiensis subsp. kirstaki HD-1 produces a crystal inclusion consisting of a biotoxin called a delta toxin which is toxic to the larvae of a number of lepidopteran insects. The cloning, sequencing, and expression of this B.t. crystal protein gene in Escherichia coli has been described in the published literature (Schnepf, H. E. and Whitely, H. R. [1981] Proc. Natl. Acad. Sci. U.S.A. 78:2893-2987; Schnepf et al.). U.S. Pat. No. 4,448,885 and U.S. Pat. No. 4,467,036 both disclose the expression of B.t. crystal protein in E. coli.

BRIEF SUMMARY OF THE INVENTION

The subject invention concerns novel Bacillus thuringiensis isolates designated B.t. PS81A2 and PS81RR1 which have activity against all lepidopteran pests tested.

Also disclosed and claimed are novel toxin genes which express toxins toxic to lepidopteran insects. These toxin genes can be transferred to suitable hosts via a plasmid vector.

Specifically, the invention comprises novel B.t.. isolates denoted B.t.. PS81A2 and PS81RR1, mutants thereof, and novel delta endotoxin genes derived from these B.t. isolates which encode proteins which are active against lepidopteran pests. More specifically, the gene in B.t. PS81A2 encodes a 133,601 dalton endoxin, whereas the gene in B.t. PS81RR1 encodes a 133,367 dalton endotoxin.

Table 1 discloses the DNA encoding the novel toxin expressed by PS81A2. Table 2 discloses the amino acid sequence of the novel toxin expressed by PS81A2. Table 3 is a composite of Tables 1 and 2. Table 4 discloses the DNA encoding the novel toxin expressed by PS81RR1. Table 5 discloses the amino acid sequence of the novel toxin expressed by PS81RR1. Table 6 is a composite of Tables 4 and 5.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows agarose gel electrophoresis of plasmid preparations from B.t. PS81A2, B.t. PS81RR1, and B.t. HD-1.

DETAILED DISCLOSURE OF THE INVENTION

The novel toxin genes of the subject invention were obtained from novel lepidopteran-active B. thuringiensis (B.t.) isolates designated PS81A2 and PS81RR1.

Characteristics of B.t. PS81A2 and PS81RR1

Colony morphology--Large colony, dull surface, typical B.t. Vegetative cell morphology--typical B.t. Flagellar serotype--7, aizawai. Intracellular inclusions--sporulating cells produce a bipyramidal crystal. Plasmid preparations--agarose gel electrophoresis of plasmid preparations distinguishes B.t. PS81A2 and PS81RR1 from B.t. HD-1 and other B.t. isolates. See FIG. 1. Alkali-soluble proteins--B.t. PS81A2 and PS81RR1 produce 133,601 and 133,367 dalton proteins, respectively. Unique toxins--the 133,601 and 133,367 dalton toxins are different from any previously identified. Activity--B.t. PS81A2 and PS81RR1 both kill all Lepidoptera tested (Trichoplusia ni, Spodoptera exigua, and Plutella xylostella). Bioassay procedures: Spodoptera exigua--dilutions are prepared of a spore and crystal pellet, mixed with USDA Insect Diet (Technical Bulletin 1528, U.S. Department of Agriculture) and poured into small plastic trays. Neonate Spodoptera exigua larvae are placed on the diet mixture and held at 25.degree. C. Mortality is recorded after six days. Other insects--dilutions and diet are prepared in the same manner as for the Spodoptera exigua bioassay. Fourth instar larvae are used, and mortality is recorded after eight days.

B. thuringiensis PS81A2, NRRL B-18457, and B. thuringiensis PS81RR1, NRRL B-18458, and mutants thereof, can be cultured using standard known media and fermentation techniques. Upon completion of the fermentation cycle, the bacteria can be harvested by first separating the B.t. spores and crystals from the fermentation broth by means well known in the art. The recovered B.t. spores and crystals can be formulated into a wettable powder, a liquid concentrate, granules or other formulations by the addition of surfactants, dispersants, inert carriers and other components to facilitate handling and application for particular target pests. The formulation and application procedures are all well known in the art and are used with commercial strains of B. thuringiensis (HD-1) active against Lepidoptera, e.g., caterpillars. B.t. PS81A2 and B.t. PS81RR1, and mutants thereof, can be used to control lepidopteran pests.

A subculture of B.t. PS81A2 and PS81RR1 and the E. coli hosts harboring the toxin genes of the invention, were deposited in the permanent collection of the Northern Research Laboratory, U.S. Department of Agriculture, Peoria, Ill., U.S.A. The accession numbers and deposit dates are as follows:

______________________________________ AccessionSubculture Number Deposit Date______________________________________B.t. PS81A2 NRRL B-18457 March 14, 1989B.t. PS81RR1 NRRL B-18458 March 14, 1989E. coli(NM522)(pMYC389) NRRL B-18448 February 24, 1989E. coli(NM522)(pMYC390) NRRL B-18449 February 24, 1989______________________________________

The subject cultures have been deposited under conditions that assure that access to the cultures will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 USC 122. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.

Further, the subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., they will be stored with all the care necessary to keep them viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposit, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the cultures. The depositor acknowledges the duty to replace the deposits should the depository be unable to furnish a sample when requested, due to the condition of the deposit(s). All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them.

The toxin genes of the subject invention can be introduced into a wide variety of microbial hosts. Expression of the toxin gene results, directly or indirectly, in the intracellular production and maintenance of the pesticide. With suitable hosts, e.g., Pseudomonas, the microbes can be applied to the situs of lepidopteran insects where they will proliferate and be ingested by the insects. The result is a control of the unwanted insects. Alternatively, the microbe hosting the toxin gene can be treated under conditions that prolong the activity of the toxin produced in the cell. The treated cell then can be applied to the environment of target pest(s). The resulting product retains the toxicity of the B.t. toxin.

Where the B.t. toxin gene is introduced via a suitable vector into a microbial host, and said host is applied to the environment in a living state, it is essential that certain host microbes be used. Microorganism hosts are selected which are known to occupy the "phytosphere" (phylloplane, phyllosphere, rhizosphere, and/or rhizoplane) of one or more crops of interest. These microorganisms are selected so as to be capable of successfully competing in the particular environment (crop and other insect habitats) with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing the polypeptide pesticide, and, desirably, provide for improved protection of the pesticide from environmental degradation and inactivation.

A large number of microorganisms are known to inhabit the phyloplane (the surface of the plant leaves) and/or the rhizosphere (the soil surrounding plant roots) of a wide variety of important crops. These microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms, such as bacteria, e.g., genera Bacillus, Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhixobium, Rhodopseufomonas, Methylophilius, Agrobacterium, Acetobacter, Lactobaccilus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes; fungi, particularly yeast, e.g., genera Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotorula, and Aureobasidium. Of particular interest are such phytosphere bacterial species as Pseudomonas syringae. Pseudomonas fluorescens, Serratia marcescens, Acetobacter xylinum, Agrobacterium tumefaciens, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus, and Azotobacter vinlandii; and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, C. diffluens, C. laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, Sporobolomyces roseus, S. odorus, Kluyveromyces veronae, and Aureobasidium pollulans. Of particular interest are the pigmented microorganisms.

A wide variety of ways are available for introducing a B.t. gene expressing a toxin into the microorganism host under conditions which allow for stable maintenance and expression of the gene. One can provide for DNA constructs which include the transcriptional and translational regulatory signals for expression of the toxin gene, the toxin gene under their regulatory control and a DNA sequence homologous with a sequence in the host organism, whereby integration will occur, and/or a replication system which is functional in the host, whereby integration or stable maintenance will occur.

The transcriptional initiation signals will include a promoter and a transcriptional initiation start site. In some instances, it may be desirable to provide for regulative expression of the toxin, where expression of the toxin will only occur after release into the environment. This can be achieved with operators or a region binding to an activator or enhancers, which are capable of induction upon a change in the physical or chemical environment of the microorganisms. For example, a temperature sensitive regulatory region may be employed, where the organisms may be grown up in the laboratory without expression of a toxin, but upon release into the environment, expression would begin. Other techniques may employ a specific nutrient medium in the laboratory, which inhibits the expression of the toxin, where the nutrient medium in the environment would allow for expression of the toxin. For translational initiation, a ribosomal binding site and an initiation codon will be present.

Various manipulations may be employed for enhancing the expression of the messenger RNA, particularly by using an active promoter, as well as by employing sequences, which enhance the stability of the messenger RNA. The transcriptional and translational termination region will involve stop codon(s), a terminator region, and optionally, a polyadenylation signal. A hydrophobic "leader" sequence may be employed at the amino terminus of the translated polypeptide sequence in order to promote secretion of the protein across the inner membrane.

In the direction of transcription, namely in the 5' to 3' direction of the coding or sense sequence, the construct will involve the transcriptional regulatory region, if any, and the promoter, where the regulatory region may be either 5' or 3' of the promoter, the ribosomal binding site, the initiation codon, the structural gene having an open reading frame in phase with the initiation codon, the stop codon(s), the polyadenylation signal sequence, if any, and the terminator region. This sequence as a double strand may be used by itself for transformation of a microorganism host, but will usually be included with a DNA sequence involving a marker, where the second DNA sequence may be joined to the toxin expression construct during introduction of the DNA into the host.

By a marker is intended a structural gene which provides for selection of those hosts which have been modified or transformed. The marker will normally provide for selective advantage, for example, providing for biocide resistance, e.g., resistance to antibiotics or heavy metals; complementation, so as to provide prototropy to an auxotrophic host, or the like. Preferably, complementation is employed, so that the modified host may not only be selected, but may also be competitive in the field. One or more markers may be employed in the development of the constructs, as well as for modifying the host. The organisms may be further modified by providing for a competitive advantage against other wild-type microorganisms in the field. For example, genes expressing metal chelating agents, e.g., siderophores, may be introduced into the host along with the structural gene expressing the toxin. In this manner, the enhanced expression of a siderophore may provide for a competitive advantage for the toxin-producing host, so that it may effectively compete with the wild-type microorganisms and stably occupy a niche in the environment.

Where no functional replication system is present, the construct will also include a sequence of at least 50 basepairs (bp), preferably at least about 100 bp, and usually not more than about 1000 bp of a sequence homologous with a sequence in the host. In this way, the probability of legitimate recombination is enhanced, so that the gene will be integrated into the host and stably maintained by the host. Desirably, the toxin gene will be in close proximity to the gene providing for complementation as well as the gene providing for the competitive advantage. Therefore, in the event that a toxin gene is lost, the resulting organism will be likely to also lose the complementing gene and/or the gene providing for the competitive advantage, so that it will be unable to compete in the environment with the gene retaining the intact construct.

A large number of transcriptional regulatory regions are available from a wide variety of microorganism hosts, such as bacteria, bacteriophage, cyanobacteria, algae, fungi, and the like. Various transcriptional regulatory regions include the regions associated with the trp gene, lac gene, gal gene, the lambda left and right promoters, the Tac promoter, the naturally-occurring promoters associated with the toxin gene, where functional in the host. See for example, U.S. Pat. Nos. 4,332,898, 4,342,832 and 4,356,270. The termination region may be the termination region normally associated with the transcriptional initiation region or a different transcriptional initiation region, so long as the two regions are compatible and functional in the host.

Where stable episomal maintenance or integration is desired, a plasmid will be employed which has a replication system which is functional in the host. The replication system may be derived from the chromosome, an episomal element normally present in the host or a different host, or a replication system from a virus which is stable in the host. A large number of plasmids are available, such as pBR322, pACYC184, RSF1010, pRO1614, and the like. See for example, Olson et al., (1982) J. Bacteriol. 150:6069, and Bagdasarian et al., (1981) Gene 16P237, and U.S. Pat. Nos. 4,356,270, 4,362,817, and 4,371,625.

The B.t. gene can be introduced between the transcriptional and translational initiation region and the transcriptional and translational termination region, so as to be under the regulatory control of the initiation region. This construct will be included in a plasmid, which will include at least one replication system, but may include more than one, where one replication system is employed for cloning during the development of the plasmid and the second replication system is necessary for functioning in the ultimate host. In addition, one or more markers may be present, which have been described previously. Where integration is desired, the plasmid will desirably include a sequence homologous with the host genome.

The transformants can be isolated in accordance with conventional ways, usually employing a selection technique, which allows for selection of the desired organism as against unmodified organisms or transferring organisms, when present. The transformants then can be tested for pesticidal activity.

Suitable host cells, where the pesticide-containing cells will be treated to prolong the activity of the toxin in the cell when the then treated cell is applied to the environment of target pest(s), may include either prokaryotes or eukaryotes, normally being limited to those cells which do not produce substances toxic to higher organisms, such as mammals. However, organisms which produce substances toxic to higher organisms could be used, where the toxin is unstable or the level of application sufficiently low as to avoid any possibility of toxicity to a mammalian host. As hosts, of particular interest will be the prokaryotes and the lower eukaryotes, such as fungi. Illustrative prokaryotes, both Gram-negative and -positive, include Enterobacteriaceae, such as Escherichia, Erwinia, Shigella, Salmonella, and Proteus; Bacillaceae; Rhizobium; Spirillaceae, such as photobacterium, Zymomonas, Serratia, Aeromonas, Vibrio, Desulfovibrio, Spirillum; Lactobacillaceae; Pseudomonadaceae, such as Pseudomonas and Acetobacter; Azotobacteraceae, Actinomycetales, and Nitrobacteraceae. Among eukaryotes are fungi, such as Phycomycetes and Ascomycetes, which includes yeast, such as Saccharomyces and Schizosaccharomyces; and Basidiomycetes yeast, such as Rhodotorula, Aureobasidium, Sporobolomyces, and the like.

Characteristics of particular interest in selecting a host cell for purposes of production include ease of introducing the B.t. gene into the host, availability of expression systems, efficiency of expression, stability of the pesticide in the host, and the presence of auxiliary genetic capabilities. Characteristics of interest for use as a pesticide microcapsule include protective qualities for the pesticide, such as thick cell walls, pigmentation, and intracellular packaging or formation of inclusion bodies; leaf affinity; lack of mammalian toxicity; attractiveness to pests for ingestion; ease of killing and fixing without damage to the toxin; and the like. Other considerations include ease of formulation and handling, economics, storage stability, and the like.

Host organisms of particular interest include yeast, such as Rhodotorula sp., Aureobasidium sp., Saccharomyces sp., and sporobolomyces sp.; phylloplane organisms such as Pseudomonas sp., Erwinia sp. and flavobacterium sp.; or such other organisms as Escherichia, Lactobacillus sp., Bacillus sp., Streptomyces sp., and the like. Specific organisms include Pseudomonas aeruginose, Pseudomonas fluorescens, Saccharomyces cerevisiae, Bacillus thuringiensis, Escherichia coli, Bacillus subtilis, Streptomyces lividans and the like.

The cell will usually be intact and be substantially in the proliferative form when treated, rather than in a spore form, although in some instances spores may be employed.

Treatment of the microbial cell, e.g., a microbe containing the B.t. toxin gene, can be by chemical or physical means, or by a combination of chemical and/or physical means, so long as the technique does not deleteriously affect the properties of the toxin, nor diminish the cellular capability in protecting the toxin. Examples of chemical reagents are halogenating agents, particularly halogens of atomic no. 17-80. More particularly, iodine can be used under milk conditions and for sufficient time to achieve the desired results. Other suitable techniques include treatment with aldehydes, such as formaldehyde and glutaraldehyde; antiinfectives, such as zephiran chloride and cetylpyridinium chloride; alcohols, such as isopropyl and ethanol; various histologic fixatives, such as Lugol iodine, Bouin's fixative, and Helly's fixative (See: Humason, Gretchen L., Animal Tissue Techniques, W. H. Freeman and Company, 1967); or a combination of physical (heat) and chemical agents that preserve and prolong the activity of the toxin produced in the cell when the cell is administered to the host animal. Examples of physical means are short wavelength radiation such as gamma-radiation and X-radiation, freezing, UV irradiation, lyophilization, and the like.

the cells generally will have enhanced structural stability which will enhance resistance to environmental conditions. Where the pesticide is in a proform, the method of inactivation should be selected so as not to inhibit processing of the proform to the mature form of the pesticide by the target pest pathogen. For example, formaldehyde will crosslink proteins and could inhibit processing of the proform of a polypeptide pesticide. The method of inactivation or killing retains at least a substantial portion of the bio-availability or bioactivity of the toxin.

The cellular host containing the B.t. insecticidal gene may be grown in any convenient nutrient medium, where the DNA construct provides a selective advantage, providing for a selective medium so that substantially all or all of the cells retain the B.t. gene. These cells may then be harvested in accordance with conventional ways. Alternatively, the cells can be treated prior to harvesting.

The B.t. cells may be formulated in a variety of ways. They may be employed as wettable powders, granules or dusts, by mixing with various inert materials, such as inorganic minerals (phyllosilicates, carbonates, sulfates, phosphates, and the like) or botanical materials (powdered corncobs, rice hulls, walnut shells, and the like). The formulations may include spreader-sticker adjuvants, stabilizing agents, other pesticidal additives, or surfactants. Liquid formulations may be aqueous-based or non-aqueous and employed as foams, gels, suspensions, emulsifiable concentrates, or the like. The ingredients may include rheological agents, surfactants, emulsifiers, dispersants, or polymers.

The pesticidal concentration will vary widely depending upon the nature of the particular formulation, particularly whether it is a concentrate or to be used directly. The pesticide will be present in at least 1% by weight and may be 100% by weight. The dry formulations will have from about 1-95% by weight of the pesticide while the liquid formulations will generally be from about 1-60% by weight of the solids in the liquid phase. The formulations will generally have from about 10.sup.2 to about 10.sup.4 cells/mg. These formulations will be administered at about 50 mg (liquid or dry) to 1 kg or more per hectare.

The formulations can be applied to the environment of the lepidopteran pest(s), e.g., plants, soil or water, by spraying, dusting, sprinkling, or the like.

Mutants of PS81A2 and PS81RR1 can be made by procedures well known in the art. For example, an asporogenous mutant can be obtained through ethylmethane sulfonate (EMS) mutagenesis of PS81A2 and PS81RR1. The mutants can be made using ultraviolet light and nitrosoguanidine by procedures well known in the art.

A smaller percentage of the asporogenous mutants will remain intact and not lyse for extended fermentation periods; these strains are designated lysis minus (-). Lysis minus strains can be identified by screening asporogenous mutants in shake flask media and selecting those mutants that are still intact and contain toxin crystals at the end of the fermentation. Lysis minus strains are suitable for a cell fixation process that will yield a protected, encapsulated toxin protein.

To prepare a phage resistant variant of said asporogenous mutant, an aliquot of the phage lysate is spread onto nutrient agar and allowed to dry. An aliquot of the phage sensitive bacterial strain is then plated directly over the dried lysate and allowed to dry. The plates are incubated at 30.degree. C. The plates are incubated for 2 days and, at that time, numerous colonies could be seen growing on the agar. Some of these colonies are picked and subcultured onto nutrient agar plates. These apparent resistant cultures are tested for resistance by cross streaking with the phage lysate. A line of the phage lysate is streaked on the plate and allowed to dry. The presumptive resistant cultures are then streaked across the phage line. Resistant bacterial cultures show no lysis anywhere in the streak across the phage line after overnight incubation at 30.degree. C. The resistance to phage is then reconfirmed by plating a lawn of the resistant culture onto a nutrient agar plate. The sensitive strain is also plated in the same manner to serve as the positive control. After drying, a drop of the phage lysate is plated in the center of the plate and allowed to dry. Resistant cultures showed no lysis in the area where the phage lysate has been placed after incubation at 30.degree. C. for 24 hours.

Following are examples which illustrate procedures, including the best mode, for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

EXAMPLE 1

Culturing B.t. PS81A2 and PS81RR1

A subculture of B.t. PS81A2 and PS81RR1, or mutants thereof, can be used to inoculate the following medium, a peptone, glucose, salts medium.

______________________________________Bacto Peptone 7.5 g/lGlucose 1.0 g/lKH.sub.2 PO.sub.4 3.4 g/lK.sub.2 HPO.sub.4 4.35 g/lSalt Solution 5.0 ml/lCaCl.sub.2 Solution 5.0 ml/lSalts Solution (100 ml)MgSO.sub.4.7H.sub.2 O 2.46 gMnSO.sub.4.H.sub.2 O 0.04 gZnSO.sub.4.7H.sub.2 O 0.28 gFeSO.sub.4.7H.sub.2 O 0.40 gCaCl.sub.2 Solution (100 ml)CaCl.sub.2.2H.sub.2 O 3.66 gpH 7.2______________________________________

The salts solution and CaCl.sub.2 solution are filter-sterilized and added to the autoclaved and cooked broth at the time of inoculation. Flasks are incubated at 30.degree. C. on a rotary shaker at 200 rpm for 64 hr.

The above procedure can be readily scaled up to large fermentors by procedures well known in the art.

The B.t. spores and/or crystals, obtained in the above fermentation, can be isolated by procedures well known in the art. A frequently-used procedure is to subject the harvested fermentation broth to separation techniques, e.g., centrifugation.

EXAMPLE 2

Cloning of Novel Toxin Gene From Isolate PS81A2 and Transformation into Escherichia coli

Total cellular DNA was prepared from B.t. cells grown to a low optical density (OD.sub.600 =1.0). The cells were recovered by centrifugation and protoplasted in TES buffer (30 mM Tris-Cl, 10 mM ethylenediaminetetraacetic acid [EDTA], 50 mM NaCl, pH=8.0) containing 20% sucrose and 50 mg/ml lysozyme. The protoplasts were lysed by addition of sodium dodecyl sulfate (SDS) to a final concentration of 4%. The cellular material was precipitated overnight at 4.degree. C. in 100 mM (final concentration) neutral potassium chloride. The supernate was extracted twice with phenol/chloroform (1:1). The DNA was precipitated with ethanol and purified by isopycnic banding on a cesium gradient.

Total cellular DNA from PS81A2 and B.t.k. HD-1 was digested with EcoRI and separated by electrophoresis on a 0.8% Agarose-TAE-buffered gel. A southern blot of the gel was probed with the NsiI to NsiI fragment of the toxin gene contained in plasmid pM3,130-7 of NRRL B-18332 and the NsiI to KpnI fragment of the "4.5 Kb class" toxin gene (Kronstad and Whitely [1986] Gene U.S.A. 43:29-40). These two fragments were combined and used as the probe. Results show that hybridizing fragments of PS81A2 are distinct from those of HD-1. Specifically, a 3.0 Kb hybridizing band in PS81A2 was detected instead of the 3.8 Kb and 1.8 Kb hybridizing bands seen in HD-1.

Two hundred micrograms of PS81A2 total cellular DNA was digested with EcoRI and separated by electrophoresis on a preparative 0.8% Agarose-TAE gel. The 2.5 Kb to 3.5 Kb region of the gel was cut out and the DNA from it was electroeluted and concentrated using an ELUTIP.TM.-d (Schleicher and Schuell, Keens, N.H.) ion exchange column. The isolated EcoRI fragments were ligated to LAMBDA ZAP.TM. EcoRI arms (Stratagene Cloning Systems, La Jolla, Calif.) and packaged using Gigapak GOLD.TM. (Stratagene) extracts. The packaged recombinant phage were plated with E. coli strain BB4 (Stratagene) to give high plaque density. The plaques were screened by standard nucleic acid hybridization procedure with radiolabeled probe. The plaques that hybridized were purified and re-screened at a lower plaque density. The resulting purified phage were grown with R408 M13 helper phage (Stratagene) and the recombinant BlueScript.TM. (Stratagene) plasmid was automatically excised and packaged. The "phagemid" was re-infected in XL1-Blue E. coli cells (Stratagene) as part of the automatic excision process. The infected XL1-Blue cells were screened for ampicillin resistance and the resulting colonies were analyzed by standard miniprep procedure to find the desired plasmid. The plasmid, designated pM6,31-1, contains an approximate 3.0 Kb EcoRI insert and was sequenced using Stratagene's T7 and T3 primers plus a set of existing B.t. endotoxin gene oligonucleotide primers. About 1.8 Kb of the toxin gene was sequenced, and data analysis comparing PS81A2 to other cloned B.t. endotoxin genes showed that the PS81A2 sequence was unique. A synthetic oligonucleotide (CAGATCCACGAGGCTTATCTTCCAGAACTAC) was constructed to one of the regions in the PS81A2 sequence that was least homologous relative to other exiting B.t. endotoxin genes.

PS81A2 total cellular DNA partially digested with Sau3A and fractionated by electrophoresis into a mixture of 9-23 Kb fragments on a 0.6% agarose-TAE gel was ligated into Lambda DASH.TM. (Stratagene). The packaged phage at a high titer were plated on P2392 e. coli cells (Stratagene) and screened using the radiolabeled synthetic oligonucleotide (aforementioned) as a nucleic acid hybridization probe. Hybridizing plaques were rescreened at a lower plaque density. A single purified hybridizing plaque was used to infect P2392 E. coli cells in liquid culture for preparation of phage for DNA isolation. DNA was isolated by standard procedures. Preparative amounts of recombinant phage DNA were digested with SalI (to release the inserted DNA from lambda arms) and separated by electrophoresis on a 0.6% Agarose-TAE gel. The large fragments, electroeluted and concentrated as described above, were ligated to SalI-digested and dephosphorylated pUC19 (NEB). The ligation mixture was introduced by transformation into E. coli DH5(alpha) competent cells (BRL) and plated on LB agar containing ampicillin, isopropyl-(Beta)-DF-thiogalactoside (IPTG) and 5-Bromo-4-chloro-3-indolyl-(Beta)-D-galactoside (XGAL). White colonies (with insertions in the (Beta)-galactosidase gene of pUC19) were subjected to standard miniprep procedures to isolate the plasmid, designated pM4,122-3. The full length toxin gene was sequenced by using oligonucleotide primers made to the "4.5 Kb class" toxin gene and by "walking" with primers made to the sequence of PS81A2.

The plasmid pM4,122-3 contains about 15 Kb of PS81A2 DNA including the 3.522 Kb which encodes the 133,601 dalton endotoxin. The ORF of the PS81A2 toxin gene was isolated from pM4,122-3 and subcloned into the Bacillus shuttle vector pBClac as a 5.5 Kb blunt-ended DraIII fragment. E. coli NM522 cells were transformed and plated on LB agar supplemented with ampicillin. The resulting colonies were analyzed by standard miniprep procedures to isolate plasmids that contained the insert. The desired plasmid, pMYC389, contains the coding sequence of the PS81A2 toxin gene.

EXAMPLE 3

Cloning of Novel Toxin Gene From Isolate PS81RR1 and Transformation in Escherichia coli

Total cellular DNA was prepared from B.t. cells grown to a low optical density (OD.sub.600 =1.0). The cells were recovered by centrifugation and protoplasted in TES buffer (30 mM Tris-Cl, 10 mM ethylenediaminetetraacetic acid [EDTA], 50 mM NaCl, pH=8.0) containing 20% sucrose and 50 mg/ml lysozyme. The protoplasts were lysed by addition of sodium dodecyl sulfate (SDS) to a final concentration of 4%. The cellular material was precipitated overnight at 4.degree. C. in 100 mM (final concentration) neutral potassium chloride. The supernate was extracted twice with phenol/chloroform (1:1). The DNA was precipitated with ethanol and purified by isopycnic banding on a cesium chloride gradient.

Total cellular DNA from PS81RR1 and B.t.k. HD-1 was digested with EcoRI and separated by electrophoresis on a 0.8% Agarose-TAE-buffered gel. A southern blot of the gel was probed with the NsiI to NsiI fragment of the toxin gene contained in plasmid pM3,130-7 of NRRL B-18332 and the NsiI to KpnI fragment of the "4.5 Kb class? toxin gene (Kronstad and Whitely [1986] Gene USA 43:29-40). These two fragments were combined and used as the probe. Results show that hybridizing fragments of PS81RR1 are distinct from those of HD-1. specifically, a 2.3 Kb hybridizing band in PS81RR1 was detected instead of the 3.8 Kb and 1.8 Kb hybridizing bands seen in HD-1.

Two hundred micrograms of PS81RR1 total cellular DNA was digested with EcoRI and separated by electrophoresis on a preparative 0.8% Agarose-TAE gel. The 2.2 Kb to 2.4 Kb region of the gel was cut out and the DNA from it was electroeluted and concentrated using an ELUTIP.TM.-d (Schleicher and Schuell, Keene, N.H.) ion exchange column. The isolated EcoRI fragments were ligated to LAMBDA ZAP.TM. EcoRI arms (Stratagene Cloning Systems, La Jolla, Calif.) and packaged using Gigapak GOLD.TM. (Stratagene) extracts. The packaged recombinant phage were plated with E. coli strain BB4 (Stratagene) to give high plaque density. The plaques were screened by standard nucleic acid hybridization procedure with radiolabeled probe. The plaques that hybridized were purified and re-screened at a lower plaque density. The resulting purified phage were grown with R408 M13 helper phage (Stratagene) and the recombinant BlueScript.TM. (Stratagene) plasmid was automatically excised and packaged. The "phagemid" was re-infected in XL1-Blue E. coli cells (Stratagene) as part of the automatic excision process. The infected XL1-Blue cells were screened for ampicillin resistance and the resulting colonies were analyzed by standard miniprep procedure to find the desired plasmid. The plasmid, designated pM3,31-3, contains an approximate 2.3 Kb EcoRI insert and was sequenced using Stratagene's T7 and T3 primers plus a set of existing B.t. endotoxin oligonucleotide primers. About 600 bp of the toxin gene was sequenced, and data analysis comparing PS81RR1 to other cloned B.t. endotoxin genes showed that the PS81RR1 sequence was unique. A synthetic oligonucleotide (CGTGGATATGGTGAATCTTATC) was constructed to one of the regions in the PS81RR1 sequence that was least homologous relative to other existing B.t. endotoxin genes.

PS81RR1 total cellular DNA partially digested with Sau3A and fractionated by electrophoresis into a mixture of 9-23 Kb fragments on a 0.6% agarose-TAE gel was ligated into Lambda GEM.TM.-11 ) (PROMEGA). The packaged phage at a high titer were plated on P2392 E. coli cells (Stratagene) and screened using the radiolabeled synthetic oligomnucleotide (aforementioned) as a nucleic acid hybridization probe. Hybridizing plaques were rescreened at a lower plaque density. A single purified hybridizing plaque was used to infect P2392 E. coli cells in liquid culture for preparation of phage for DNA isolation. DNA was isolated by standard procedures. Preparative amounts of recombinant phage DNA were digest with SalI, to release the inserted DNA from lambda arms, and separated by electrophoresis on a 0.6% Agarose-TAE gel. The large fragments, electroeluted and concentrated as described above, were ligated to SalI-digested and dephosphorylated pUC19 (NEB). The ligation mixture was introduced by transformation into E. coli DH5(alpha) competent cells (BRL) and plated on LB agar containing ampicillin, isopropyl-(Beta)-D-thiogalactoside (IPTG) and 5-Bromo-4 -Chloro-3-indolyl-(Beta)-D-galactoside (XGAL). White colonies (with insertions in the (Beta)-galactosidase gene of pUC19) were subjected to standard miniprep procedures to isolate the plasmid, designated pM1,RR1-A. The full length toxin gene was sequenced by using oligonucleotide primers made to the "4.5 Kb class" toxin gene and by "walking" with primers made to the sequence of PS81RR1.

The plasmid pM1,RR1-A contains about 13 Kb of PS81RR1 DNA including the 3.540 Kb which encodes the 133,367 dalton endotoxin. The ORF of the PS81RR1 toxin gene was isolated from pM1,RR1-A on a 3.8 Kb NdeI fragment and ligated into the Bacillus shuttle vector pBC1ac. E. coli NM522 cells were transformed and the resulting colonies were analyzed by standard miniprep procedures to isolate plasmids that contained the correct insert. The desired plasmid, pMYC390, contains the coding sequence of the PS81RR1 toxin gene.

The above cloning procedures were conducted using standard procedures unless otherwise noted.

The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. Also, methods for the use of lambda bacteriophage as a cloning vehicle, i.e., the preparation of lambda DNA, in vitro packaging, and transfection of recombinant DNA, are well known in the art. These procedures are all described in Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. Thus, it is within the skill of those in the genetic engineering art to extract DNA from microbial cells, perform restriction enzyme digestions, electrophorese DNA fragments, tail and anneal plasmid and insert DNA, ligate DNA, transform cells, prepare plasmid DNA, electrophorese proteins, and sequence DNA.

The restriction enzymes disclosed herein can be purchased from Bethesda Research Laboratories, Gaithersburg, MD. New England Biolabs, Beverly, Md. or Boehringer-Mannheim, Indianapolis, Ind. The enzymes are used according to the instructions provided by the supplier.

Plasmid pMYC386 containing the B.t. toxin genes, can be removed from the transformed host microbes by use of standard well-known procedures. For example, E. coli NRRL B-18449 can be subjected to cleared lysate isopycnic density gradient procedures, and the like, to recover pMYC386.

EXAMPLE 4

Insertion of Toxin Genes Into Plants

The novel genes coding for the novel insecticidal toxins, as disclosed herein, can be inserted into plant cells using the Ti plasmid from Agrobacter tumefaciens. Plant cells can then be caused to regenerate into plants (Zambryski, P., Joos, H., Gentello, C;, Leemans, J., Van Montague, M. and Schell, J [1983] Cell 32:1033-1043). A particularly useful vector in this regard is pEND4K (Klee, H. J., Yanofsky, M. F. and Nester, E. W. [1985] Bio/Technology 3:637-642). This plasmid can replicate both in plant cells and in bacteria and has multiple cloning sites for passenger genes. The toxin gene, for example, can be inserted into the BamHI site of pEND4K, propagated in E. coli, and transformed into appropriate plant cells.

EXAMPLE 5

Cloning of Novel B. thuringiensis Genes Into Baculoviruses

The novel genes of the invention can be cloned into baculoviruses such as Autographa californica nuclear polyhedrosis virus (AcNPV). Plasmids can be constructed that contain the AcNPV genome cloned into a commercial cloning vector such as pUC8. The AcNPV genome is modified so that the coding region of the polyhedrin gene is removed and a unique cloning site for a passenger gene is placed directly behind the polyhedrin promoter. Examples of such vectors are pGP-B6874, described by Pennock et al. (Pennock, G. D., Shoemaker, C. and Miller, L. K. [1984] Mol. Cell. Biol. 4:399-406), and pAC380, described by Smith et al. (Smith, G. E., Summers, M. D. and Fraser, J. J. [1983] Mol Cell. Biol. 3:2156-2165). The gene coding for the novel protein toxin of the invention can be modified with BamHI linkers at appropriate regions both upstream and downstream from the coding region and inserted into the passenger site of one of the AcNPV vectors.

As disclosed previously, the nucleotide sequences encoding the novel B.t. toxin genes are shown in Tables 1 and 4. The deduced amino acid sequences are shown in Tables 2 and 5.

It is well known in the art that the amino acid sequence of a protein is determined by the nucleotide sequence of the DNA. Because of the redundancy of the genetic code, i.e., more than one coding nucleotide triplet (codon) can be used for most of the amino acids used to make proteins, different nucleotide sequences can code for a particular amino acid. Thus, the genetic code can be depicted as follows:

______________________________________Phenylalanine (Phe) TTK Histidine (His) CAKLeucine (Leu) XTY Glutamine (Gln) CAJIsoleucine (Ile) ATM Asparagine (Asn) AAKMethionine (Met) ATG Lysine (Lys) AAJValine (Val) GTL Aspartic acid (Asp) GAKSerine (Ser) QRS Glutamic acid (Glu) GAJProline (Pro) CCL Cysteine (Cys) TGKThreonine (Thr) ACL Tryptophan (Trp) TGGAlanine (Ala) GCL Arginine (Arg) WGZTyrosine (Tyr) TAK Glycine (Gly) GGLTermination signal TAJ______________________________________ Key: Each 3-letter deoxynucleotide triplet corresponds to a trinucleotide of mRNA, having a 5'-end on the left and a 3'-end on the right. All DNA sequences given herein are those of the strand whose sequence correspond to the mRNA sequence, with thymine substituted for uracil. The letters stand for the purine or pyrimidine bases forming the deoxynucleotide sequence. A=adenine G=guanine C=cytosine T=thymine X=T or C if Y is A or G X=C if Y is C or T Y=A, G, C or T if X is C Y=A or G if X is T W=C or A if Z is A or G W - C if Z is C or T Z =A, G, C or T if W is C Z=A or G if W is A QR=TC if S is A, G, C or T; alternatively QR=AG if S is T or C J=A or G K=T or C L=A, T, C or G M=A, C or T

The above shows that the novel amino acid sequences of the B.t. toxins can be prepared by equivalent nucleotide sequences encoding the same amino acid sequence of the protein. Accordingly, the subject invention includes such equivalent nucleotide sequences. In addition it has been shown that proteins of identified structure and function may be constructed by changing the amino acid sequence if such changes do not alter the protein secondary structure (Kaiser, E. T. and Kezdy, F. J. [1984] Science 223:249-255). Thus, the subject invention includes mutants of the amino acid sequence depicted herein which do not alter the protein secondary structure, or if the structure is altered, the biological activity is retained to some degree.

TABLE 1__________________________________________________________________________ 10 20 30 40 50 601 ATGGAGAATA ATATTGAAAA TCAATGCATA CCTTACAATT GTTTAAATAA TCCTGAAGTA61 GAGATATTAG GGATTGAAAG GTCAAATAGT AACGTAGCAG CAGAAATCGG CTTGGGGCTT121 AGTCGTCTGC TCGTTTCCCG AATTCCACTA GGGGATTTTA TACTTGGCTT GTTTGATGTA181 ATATGGGGGG CTATAGGTCC TTCACAATGG GATATATTTT TAGAGCAAAT TGAGCTATTG241 ATCGGCCAAA GAATAGAGGA ATTCGCTAGG AATCAGGCAA TTTCTAGATT ACAAGGGCTA 310 320 330 340 350 360301 AGCAATCTTT ACCGAATTTA CACAAATGCT TTTAAAAACT GGGAAGTAGA TCCTACTAAT361 CCAGCATTAA GAGAAGAGAT GCGTATTCAA TTTAATGACA TGAACAGTGC TCTTACAACA421 GCTATTCCTC TTTTTTCAGT TCAAGGTTAT GAAATTCCTC TTTTATCAGT ATATGTTCAA481 GCTGCAAATT TACATTTATC GGTTTTGAGA GATGTTTCAG TGTTTGGACA ACGTTGGGGA541 TTTGATGTAG CAACAATCAA TAGTCGTTAT AATGATTTAA CTAGGCTTAT TGGCGAATAT 610 620 630 640 650 660601 ACTGATTATG CTGTACGTTG GTATAATACG GGGTTAAATC GTTTACCACG TAATGAAGGG661 GTACGAGGAT GGGCAAGATT TAATAGGTTT AGAAGAGAGT TAACAATATC AGTATTAGAT721 ATTATTTCTT TTTTCCAAAA TTACGATTCT AGATTATATC CAATTCCGAC AATCTATCAA781 TTAACGCGGG AAGTATATAC AGATCCGGTA ATTAATATAA CTGATTATAG AGTTACCCCA841 AGTTTCGAGA GTATTGAAAA TTCAGCTATT AGAAGTCCCC ATCTTATGGA TTTCTTAAAT 910 920 930 940 950 960901 AATATAATTA TTGACACTGA TTTAATTAGA GGCGTTCACT ATTGGGCGGG GCATCGTGTA961 ACTTCTCATT TTACCGGTAG TTCGCAAGTG ATAAGCTCCC CTCAATACGG GATAACTGCA1021 AACGCAGAAC CGAGTCGAAC TATTGCTCCT AGCACTTTTC CAGGTCTTAA TCTATTTTAT1081 AGAACACTAT CAGACCCTTT CTTCCGAAGA TCCGATAATA TTATGCCAAC ATTAGGAATA1141 AATGTAGTGC AGGGGGTAGG ATTCATTCAA CCAAATAATG GTGAAGTTCT ATATAGAAGG 1210 1220 1230 1240 1250 12601201 AGAGGAACAG TAGATTCTCT TGATGAGTTG CCAATTGACG GTGAGAATTC ATTAGTTGGA1261 TATAGTCATA GATTAAGTCA CGTTACATTA ACCAGGTCGT TATATAATAC TAATATAACT1321 AGCTTGCCAA CATTTGTTTG GACACATCAC AGTGCTACTG ATCGAAATAT AATCTATCCG1381 GATGTAATTA CACAAATACC ATTGGTAAAA TCATTCTCCC TTACTTCAGG TACCTCTGTA1441 GTCAGAGGCC CAGGATTTAC AGGAGGGGAT ATCATCCGAA CTAACGTTAA TGGTAATGTA 1510 1520 1530 1540 1550 15601501 CTAAGTATGA GTCTTAATTT TAGTAATACA TCATTACAGC GGTATCGCGT GAGAGTTCGT1561 TATGCTGCTT CTCAAACAAT GGTCATGAGA GTAAATGTTG GAGGGAGTAC TACTTTTGAT1621 CAAGGATTCC CTAGTACTAT GAGTGCAAAT GGGTCTTTGA CATCTCAATC ATTTAGATTT1681 GCAGAATTTC CTGTAGGCAT TAGTACATCT GGCAGTCAAA CTGCTGGAAT AAGTATAAGT1741 AATAATCCAG GTAGACAAAC GTTTCACTTA GATAGAATTG AATTTATCCC AGTTGATGCA 1810 1820 1830 1840 1850 18601801 ACATTTGAAG CAGAATATGA TTTAGAAAGA GCACAAAAGG CGGTGAATTC GCTGTTTACT1861 TCTTCCAATC AAATCGAGTT AAAAACAGAT GTGACGGATT ATCATATTGA TCAAGTATCC1921 AATTTAGTAG ATTGTTTATC CGATGAATTT TGTCTGGATG AAAAGCGAGA ATTGTCCGAG1981 AAAGTCAAAC ATGCGAAGCG ACTCAGTGAT GAGCGGAATT TACTTCAAGA TCCAAACTTC2041 AGAGGGATCA ATAGGCAACC AGACCGTCCG TGGAGAGGAA GTACGGATAT TACCATCCAA 2110 2120 2130 2140 2150 21602101 GGAGGAGATG ACGTATTCAA AGAGAATTAC GTCACACTAC CAGGTACCTT TGATGAGTGC2161 TATCCAACGT ATTTGTATCA AAAAATAGAT GAGTCGAAAT TAAAAGCCTA TAACCGTTAC2221 CAATTAAGAG GGTATATCGA AGATAGTCAA GACTTAGAAA TCTATTTAAT TCGCTACAAT2281 GCAAAACACG AAACAGTAAA TGTACCAGGT ACGGGTTCCT TATGGCCGCT TTCAGTCGAA2341 AGTCCAATTG GAAGGTGTGG AGAACCGAAT CGGTGTGTGC CACACCTTGA ATGGAATCCT 2410 2420 2430 2440 2450 24602401 GATTTAGATT GTTCCTGCAG AGACGGGGAA AAATGTGCAC ATCATTCCCA TCATTTCTCC2461 TTGGACATTG ATGTTGGATG CACAGACTTG CAAGAGGATC TAGGCGTGTG GGTTGTATTC2521 AAGATTAAGA CGCAGGAAGG TTATGCAAGA TTAGGAAATC TGGAATTTAT CGAAGAGAAA2581 CCATTAATTG GAGAAGCACT GTCTCGTGTG AAGAGAGCGG AAAAAAAATG GAGAGACAAA2641 CGGGAAAAAC TACAATTGGA AACAAAACGA GTATATACAG AGGCAAAAGA AGCTGTGGAT 2710 2720 2730 2740 2750 27602701 GCTTTATTCG TAGATTCTCA ATATGATAGA TTACAAGCAG ATACAAACAT TGGTATGATT2761 CATGCGGCAG ATAGACTTGT TCATCAGATC CACGAGGCTT ATCTTCCAGA ACTACCTTTC2821 ATTCCAGGAA TAAATGTGGT GATTTTTGAA GAATTAGAAA ACCGTATTTC TACTGCATTA2881 TCCCTATATG ATGCGAGAAA TGTCATTAAA AATGGCGATT TCAATAATGG CTTATCATGC2941 TGGAACGTGA AAGGGCATGT AGATGTAGTA GAACAAAACA ACCACCGTTC GGTCCTTGTT 3010 3020 3030 3040 3050 30603001 GTCCCGGAAT GGGAAGCAGA AGTGTCACAA ACAATTCGTG TCTGTCCGGG GCGTGGCTAT3061 ATCCTCCGTG TTACAGCGTA CAAAGAGGGA TATGGAGAAG GTTGCGTAAC CATCCATGAG3121 ATCGAGAACA ATACAGACGA ACTAAAATTT AAAAACTGTG AAGAAGAGGA AGTGTATCCA3181 ACGGATACAG GAACGTGTAA TAGTTATACT GCACACCAAG GTACAGCAGG ATCCACAGAT3241 TCATGTAATT CCCGTAATAT CAGATATGAG GATGCATATG AAATGAATAC TACAGCATCT 3310 3320 3330 3340 3350 33603301 GTTAATTACA AACCGACTTA CGAAGAAGAA AGGTATACAG ATGTACAAGG AGATAATCAT3361 TGTGAATATG ACAGAGGGTA TGTGAATTAT CGACCAGTAC CAGCTGGTTA TGTGACAAAA3421 GAATTAGAGT ACTTCCCAGA AACCGATAAG GTATGGATTG AGATCGGAGA AACGGAAGGG3481 AAGTTTATTG TAGACAATGT CGAATTACTC CTTATGGAGG AA__________________________________________________________________________ TABLE 2__________________________________________________________________________ 5 10 151 Met Glu Asn Asn Ile Glu Asn Gln Cys Ile Pro Tyr Asn Cys Leu16 Asn Asn Pro Glu Val Glu Ile Leu Gly Ile Glu Arg Ser Asn Ser31 Asn Val Ala Ala Glu Ile Gly Leu Gly Leu Ser Arg Leu Leu Val46 Ser Arg Ile Pro Leu Gly Asp Phe Ile Leu Gly Leu Phe Asp Val61 Ile Trp Gly Ala Ile Gly Pro Ser Gln Trp Asp Ile Phe Leu Glu76 Gln Ile Glu Leu Leu Ile Gly Gln Arg Ile Glu Glu Phe Ala Arg91 Asn Gln Ala Ile Ser Arg Leu Gln Gly Leu Ser Asn Leu Tyr Arg106 Ile Tyr Thr Asn Ala Phe Lys Asn Trp Glu Val Asp Pro Thr Asn121 Pro Ala Leu Arg Glu Glu Met Arg Ile Gln Phe Asn Asp Met Asn136 Ser Ala Leu Thr Thr Ala Ile Pro Leu Phe Ser Val Gln Gly Tyr151 Glu Ile Pro Leu Leu Ser Val Tyr Val Gln Ala Ala Asn Leu His166 Leu Ser Val Leu Arg Asp Val Ser Val Phe Gly Gln Arg Trp Gly181 Phe Asp Val Ala Thr Ile Asn Ser Arg Tyr Asn Asp Leu Thr Arg196 Leu Ile Gly Glu Tyr Thr Asp Tyr Ala Val Arg Trp Tyr Asn Thr211 Gly Leu Asn Arg Leu Pro Arg Asn Glu Gly Val Arg Gly Trp Ala226 Arg Phe Asn Arg Phe Arg Arg Glu Leu Thr Ile Ser Val Leu Asp241 Ile Ile Ser Phe Phe Gln Asn Tyr Asp Ser Arg Leu Tyr Pro Ile256 Pro Thr Ile Tyr Gln Leu Thr Arg Glu Val Tyr Thr Asp Pro Val271 Ile Asn Ile Thr Asp Tyr Arg Val Thr Pro Ser Phe Glu Ser Ile286 Glu Asn Ser Ala Ile Arg Ser Pro His Leu Met Asp Phe Leu Asn301 Asn Ile Ile Ile Asp Thr Asp Leu Ile Arg Gly Val His Tyr Trp316 Ala Gly His Arg Val Thr Ser His Phe Thr Gly Ser Ser Gln Val331 Ile Ser Ser Pro Gln Tyr Gly Ile Thr Ala Asn Ala Glu Pro Ser346 Arg Thr Ile Ala Pro Ser Thr Phe Pro Gly Leu Asn Leu Phe Tyr361 Arg Thr Leu Ser Asp Pro Phe Phe Arg Arg Ser Asp Asn Ile Met376 Pro Thr Leu Gly Ile Asn Val Val Gln Gly Val Gly Phe Ile Gln391 Pro Asn Asn Gly Glu Val Leu Tyr Arg Arg Arg Gly Thr Val Asp406 Ser Leu Asp Glu Leu Pro Ile Asp Gly Glu Asn Ser Leu Val Gly421 Tyr Ser His Arg Leu Ser His Val Thr Leu Thr Arg Ser Leu Tyr436 Asn Thr Asn Ile Thr Ser Leu Pro Thr Phe Val Trp Thr His His451 Ser Ala Thr Asp Arg Asn Ile Ile Tyr Pro Asp Val Ile Thr Gln466 Ile Pro Leu Val Lys Ser Phe Ser Leu Thr Ser Gly Thr Ser Val481 Val Arg Gly Pro Gly Phe Thr Gly Gly Asp Ile Ile Arg Thr Asn496 Val Asn Gly Asn Val Leu Ser Met Ser Leu Asn Phe Ser Asn Thr511 Ser Leu Gln Arg Tyr Arg Val Arg Val Arg Tyr Ala Ala Ser Gln526 Thr Met Val Met Arg Val Asn Val Gly Gly Ser Thr Thr Phe Asp541 Gln Gly Phe Pro Ser Thr Met Ser Ala Asn Gly Ser Leu Thr Ser556 Gln Ser Phe Arg Phe Ala Glu Phe Pro Val Gly Ile Ser Thr Ser571 Gly Ser Gln Thr Ala Gly Ile Ser Ile Ser Asn Asn Pro Gly Arg586 Gln Thr Phe His Leu Asp Arg Ile Glu Phe Ile Pro Val Asp Ala601 Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala Gln Lys Ala Val616 Asn Ser Leu Phe Thr Ser Ser Asn Gln Ile Glu Leu Lys Thr Asp631 Val Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Asp Cys646 Leu Ser Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu661 Lys Val Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu676 Gln Asp Pro Asn Phe Arg Gly Ile Asn Arg Gln Pro Asp Arg Gly691 Trp Arg Gly Ser Thr Asp Ile Thr Ile Gln Gly Gly Asp Asp Val706 Phe Lys Glu Asn Tyr Val Thr Leu Pro Gly Thr Phe Asp Glu Cys721 Tyr Pro Thr Tyr Leu Tyr Gln Lys Ile Asp Glu Ser Lys Leu Lys736 Ala Tyr Asn Arg Tyr Gln Leu Arg Gly Tyr Ile Glu Asp Ser Gln751 Asp Leu Glu Ile Tyr Leu Ile Arg Tyr Asn Ala Lys His Glu Thr766 Val Asn Val Pro Gly Thr Gly Ser Leu Trp Pro Leu Ser Val Glu781 Ser Pro Ile Gly Arg Cys Gly Glu Pro Asn Arg Cys Val Pro His796 Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys Arg Asp Gly Glu811 Lys Cys Ala His His Ser His His Phe Ser Leu Asp Ile Asp Val826 Gly Cys Thr Asp Leu Gln Glu Asp Leu Gly Val Trp Val Val Phe841 Lys Ile Lys Thr Gln Glu Gly Tyr Ala Arg Leu Gly Asn Leu Glu856 Phe Ile Glu Glu Lys Pro Leu Ile Gly Glu Ala Leu Ser Arg Val871 Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Gln886 Leu Glu Thr Lys Arg Val Tyr Thr Glu Ala Lys Glu Ala Val Asp901 Ala Leu Phe Val Asp Ser Gln Tyr Asp Arg Leu Gln Ala Asp Thr916 Asn Ile Gly Met Ile His Ala Ala Asp Arg Leu Val His Gln Ile931 His Glu Ala Tyr Leu Pro Glu Leu Pro Phe Ile Pro Gly Ile Asn946 Val Val Ile Phe Glu Glu Leu Glu Asn Arg Ile Ser Thr Ala Leu961 Ser Leu Tyr Asp Ala Arg Asn Val Ile Lys Asn Gly Asp Phe Asn976 Asn Gly Leu Ser Cys Trp Asn Val Lys Gly His Val Asp Val Val991 Glu Gln Asn Asn His Arg Ser Val Leu Val Val Pro Glu Trp Glu1006 Ala Glu Val Ser Gln Thr Ile Arg Val Cys Pro Gly Arg Gly Tyr1021 Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr Gly Glu Gly Cys1036 Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp Glu Leu Lys Phe1051 Lys Asn Cys Glu Glu Glu Glu Val Tyr Pro Thr Asp Thr Gly Thr1066 Cys Asn Asp Tyr Thr Ala His Gln Gly Thr Ala Gly Ser Thr Asp1081 Ser Cys Asn Ser Arg Asn Ile Arg Tyr Glu Asp Ala Tyr Glu Met1096 Asn Thr Thr Ala Ser Val Asn Tyr Lys Pro Thr Tyr Glu Glu Glu1111 Arg Tyr Thr Asp Val Gln Gly Asp Asn His Cys Glu Tyr Asp Arg1126 Gly Tyr Val Asn Tyr Arg Pro Val Pro Ala Gly Tyr Val Thr Lys1141 Glu Leu Glu Tyr Phe Pro Glu Thr Asp Lys Val Trp Ile Glu Ile1156 Gly Glu Thr Glu Gly Lys Phe Ile Val Asp Asn Val Glu Leu Leu1171 Leu Met Glu Glu__________________________________________________________________________ TABLE 3 5 10 15 20 Met Glu Asn Asn Ile Glu Asn Gln Cys Ile Pro Tyr Asn Cys Leu Asn Asn Pro Glu Val ATG GAG AAT AAT ATT GAA AAT CAA TGC ATA CCT TAC AAT TGT TTA AAT AAT CCT GAA GTA 25 30 35 40 Glu Ile Leu Gly Ile Glu Arg Ser Asn Ser Asn Val Ala Ala Glu Ile Gly Leu Gly Leu GAG ATA TTA GGG ATT GAA AGG TCA AAT AGT AAC GTA GCA GCA GAA ATC GGC TTG GGG CTT 45 50 55 60 Ser Arg Leu Leu Val Ser Arg Ile Pro Leu Gly Asp Phe Ile Leu Gly Leu Phe Asp Val AGT CGT CTG CTC GTT TCC CGA ATT CCA CTA GGG GAT TTT ATA CTT GGC TTG TTT GAT GTA 65 70 75 80 Ile Trp Gly Ala Ile Gly Pro Ser Gln Trp Asp Ile Phe Leu Glu Gln Ile Glu Leu Leu ATA TGG GGG GCT ATA GGT CCT TCA CAA TGG GAT ATA TTT TTA GAG CAA ATT GAG CTA TTG 85 90 95 100 Ile Gly Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala Ile Ser Arg Leu Gln Gly Leu ATC GGC CAA AGA ATA GAG GAA TTC GCT AGG AAT CAG GCA ATT TCT AGA TTA CAA GGG CTA 105 110 115 120 Ser Asn Leu Tyr Arg Ile Tyr Thr Asn Ala Phe Lys Asn Trp Glu Val Asp Pro Thr Asn AGC AAT CTT TAC CGA ATT TAC ACA AAT GCT TTT AAA AAC TGG GAA GTA GAT CCT ACT AAT 125 130 135 140 Pro Ala Leu Arg Glu Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr CCA GCA TTA AGA GAA GAG ATG CGT ATT CAA TTT AAT GAC ATG AAC AGT GCT CTT ACA ACA 145 150 155 160 Ala Ile Pro Leu Phe Ser Val Gln Gly Tyr Glu Ile Pro Leu Leu Ser Val Tyr Val Gln GCT ATT CCT CTT TTT TCA GTT CAA GGT TAT GAA ATT CCT CTT TTA TCA GTA TAT GTT CAA 165 170 175 180 Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser Val Phe Gly Gln Arg Trp Gly GCT GCA AAT TTA CAT TTA TCG GTT TTG AGA GAT GTT TCA GTG TTT GGA CAA CGT TGG GGA 185 190 195 200 Phe Asp Val Ala Thr Ile Asn Ser Arg Tyr Asn Asp Leu Thr Arg Leu Ile Gly Glu Tyr TTT GAT GTA GCA ACA ATC AAT AGT CGT TAT AAT GAT TTA ACT AGG CTT ATT GGC GAA TAT 205 210 215 220 Thr Asp Tyr Ala Val Arg Trp Tyr Asn Thr Gly Leu Asn Arg Leu Pro Arg Asn Glu Gly ACT GAT TAT GCT GTA CGT TGG TAT AAT ACG GGG TTA AAT CGT TTA CCA CGT AAT GAA GGG 225 230 235 240 Val Arg Gly Trp Ala Arg Phe Asn Arg Phe Arg Arg Glu Leu Thr Ile Ser Val Leu Asp GTA CGA GGA TGG GCA AGA TTT AAT AGG TTT AGA AGA GAG TTA ACA ATA TCA GTA TTA GAT 245 250 255 260 Ile Ile Ser Phe Phe Gln Asn Tyr Asp Ser Arg Leu Tyr Pro Ile Pro Thr Ile Tyr Gln ATT ATT TCT TTT TTC CAA AAT TAC GAT TCT AGA TTA TAT CCA ATT CCG ACA ATC TAT CAA 265 270 275 280 Leu Thr Arg Glu Val Tyr Thr Asp Pro Val Ile Asn Ile Thr Asp Tyr Arg Val Thr Pro TTA ACG CGG GAA GTA TAT ACA GAT CCG GTA ATT AAT ATA ACT GAT TAT AGA GTT ACC CCA 285 290 295 300 Ser Phe Glu Ser Ile Glu Asn Ser Ala Ile Arg Ser Pro His Leu Met Asp Phe Leu Asn AGT TTC GAG AGT ATT GAA AAT TCA GCT ATT AGA AGT CCC CAT CTT ATG GAT TTC TTA AAT 305 310 315 320 Asn Ile Ile Ile Asp Thr Asp Leu Ile Arg Gly Val His Tyr Trp Ala Gly His Arg Val AAT ATA ATT ATT GAC ACT GAT TTA ATT AGA GGC GTT CAC TAT TGG GCG GGG CAT CGT GTA 325 330 335 340 Thr Ser His Phe Thr Gly Ser Ser Gln Val Ile Ser Ser Pro Gln Tyr Gly Ile Thr Ala ACT TCT CAT TTT ACC GGT AGT TCG CAA GTG ATA AGC TCC CCT CAA TAC GGG ATA ACT GCA 345 350 355 360 Asn Ala Glu Pro Ser Arg Thr Ile Ala Pro Ser Thr Phe Pro Gly Leu Asn Leu Phe Tyr AAC GCA GAA CCG AGT CGA ACT ATT GCT CCT AGC ACT TTT CCA GGT CTT AAT CTA TTT TAT 365 370 375 380 Arg Thr Leu Ser Asp Pro Phe Phe Arg Arg Ser Asp Asn Ile Met Pro Thr Leu Gly Ile AGA ACA CTA TCA GAC CCT TTC TTC CGA AGA TCC GAT AAT ATT ATG CCA ACA TTA GGA ATA 385 390 395 400 Asn Val Val Gln Gly Val Gly Phe Ile Gln Pro Asn Asn Gly Glu Val Leu Tyr Arg Arg AAT GTA GTG CAG GGG GTA GGA TTC ATT CAA CCA AAT AAT GGT GAA GTT CTA TAT AGA AGG 405 410 415 420 Arg Gly Thr Val Asp Ser Leu Asp Glu Leu Pro Ile Asp Gly Glu Asn Ser Leu Val Gly AGA GGA ACA GTA GAT TCT CTT GAT GAG TTG CCA ATT GAC GGT GAG AAT TCA TTA GTT GGA 425 430 435 440 Tyr Ser His Arg Leu Ser His Val Thr Leu Thr Arg Ser Leu Tyr Asn Thr Asn Ile Thr TAT AGT CAT AGA TTA AGT CAC GTT ACA TTA ACC AGG TCG TTA TAT AAT ACT AAT ATA ACT 445 450 455 460 Ser Leu Pro Thr Phe Val Trp Thr His His Ser Ala Thr Asp Arg Asn Ile Ile Tyr Pro AGC TTG CCA ACA TTT GTT TGG ACA CAT CAC AGT GCT ACT GAT CGA AAT ATA ATC TAT CCG 465 470 475 480 Asp Val Ile Thr Gln Ile Pro Leu Val Lys Ser Phe Ser Leu Thr Ser Gly Thr Ser Val GAT GTA ATT ACA CAA ATA CCA TTG GTA AAA TCA TTC TCC CTT ACT TCA GGT ACC TCT GTA 485 490 495 500 Val Arg Gly Pro Gly Phe Thr Gly Gly Asp Ile Ile Arg Thr Asn Val Asn Gly Asn Val GTC AGA GGC CCA GGA TTT ACA GGA GGG GAT ATC ATC CGA ACT AAC GTT AAT GGT AAT GTA 505 510 515 520 Leu Ser Met Ser Leu Asn Phe Ser Asn Thr Ser Leu Gln Arg Tyr Arg Val Arg Val Arg CTA AGT ATG AGT CTT AAT TTT AGT AAT ACA TCA TTA CAG CGG TAT CGC GTG AGA GTT CGT 525 530 535 540 Tyr Ala Ala Ser Gln Thr Met Val Met Arg Val Asn Val Gly Gly Ser Thr Thr Phe Asp TAT GCT GCT TCT CAA ACA ATG GTC ATG AGA GTA AAT GTT GGA GGG AGT ACT ACT TTT GAT 545 550 555 560 Gln Gly Phe Pro Ser Thr Met Ser Ala Asn Gly Ser Leu Thr Ser Gln Ser Phe Arg Phe CAA GGA TTC CCT AGT ACT ATG AGT GCA AAT GGG TCT TTG ACA TCT CAA TCA TTT AGA TTT 565 570 575 580 Ala Glu Phe Pro Val Gly Ile Ser Thr Ser Gly Ser Gln Thr Ala Gly Ile Ser Ile Ser GCA GAA TTT CCT GTA GGC ATT AGT ACA TCT GGC AGT CAA ACT GCT GGA ATA AGT ATA AGT 585 590 595 600 Asn Asn Pro Gly Arg Gln Thr Phe His Leu Asp Arg Ile Glu Phe Ile Pro Val Asp Ala AAT AAT CCA GGT AGA CAA ACG TTT CAC TTA GAT AGA ATT GAA TTT ATC CCA GTT GAT GCA 605 610 615 620 Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala Gln Lys Ala Val Asn Ser Leu Phe Thr ACA TTT GAA GCA GAA TAT GAT TTA GAA AGA GCA CAA AAG GCG GTG AAT TCG CTG TTT ACT 625 630 635 640 Ser Ser Asn Gln Ile Glu Leu Lys Thr Asp Val Thr Asp Tyr His Ile Asp Gln Val Ser TCT TCC AAT CAA ATC GAG TTA AAA ACA GAT GTG ACG GAT TAT CAT ATT GAT CAA GTA TCC 645 650 655 660 Asn Leu Val Asp Cys Leu Ser Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu AAT TTA GTA GAT TGT TTA TCC GAT GAA TTT TGT CTG GAT GAA AAG CGA GAA TTG TCC GAG 665 670 675 680 Lys Val Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro Asn Phe AAA GTC AAA CAT GCG AAG CGA CTC AGT GAT GAG CGG AAT TTA CTT CAA GAT CCA AAC TTC 685 690 695 700 Arg Gly Ile Asn Arg Gln Pro Asp Arg Gly Trp Arg Gly Ser Thr Asp Ile Thr Ile Gln AGA GGG ATC AAT AGG CAA CCA GAC CGT GGC TGG AGA GGA AGT ACG GAT ATT ACC ATC CAA 705 710 715 720 Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val Thr Leu Pro Gly Thr Phe Asp Glu Cys GGA GGA GAT GAC GTA TTC AAA GAG AAT TAC GTC ACA CTA CCA GGT ACC TTT GAT GAG TGC 725 730 735 740 Tyr Pro Thr Tyr Leu Tyr Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Asn Arg Tyr TAT CCA ACG TAT TTG TAT CAA AAA ATA GAT GAG TCG AAA TTA AAA GCC TAT AAC CGT TAC 745 750 755 760 Gln Leu Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Leu Ile Arg Tyr Asn CAA TTA AGA GGG TAT ATC GAA GAT AGT CAA GAC TTA GAA ATC TAT TTA ATT CGC TAC AAT 765 770 775 780 Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp Pro Leu Ser Val Glu GCA AAA CAC GAA ACA GTA AAT GTA CCA GGT ACG GGT TCC TTA TGG CCG CTT TCA GTC GAA 785 790 795 800 Ser Pro Ile Gly Arg Cys Gly Glu Pro Asn Arg Cys Val Pro His Leu Glu Trp Asn Pro AGT CCA ATT GGA AGG TGT GGA GAA CCG AAT CGG TGT GTG CCA CAC CTT GAA TGG AAT CCT 805 810 815 820 Asp Leu Asp Cys Ser Cys Arg Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser GAT TTA GAT TGT TCC TGC AGA GAC GGG GAA AAA TGT GCA CAT CAT TCC CAT CAT TTC TCC 825 830 835 840 Leu Asp Ile Asp Val Gly Cys Thr Asp Leu Gln Glu Asp Leu Gly Val Trp Val Val Phe TTG GAC ATT GAT GTT GGA TGC ACA GAC TTG CAA GAG GAT CTA GGC GTG TGG GTT GTA TTC 845 850 855 860 Lys Ile Lys Thr Gln Glu Gly Tyr Ala Arg Leu Gly Asn Leu Glu Phe Ile Glu Glu Lys AAG ATT AAG ACG CAG GAA GGT TAT GCA AGA TTA GGA AAT CTG GAA TTT ATC GAA GAG AAA 865 870 875 880 Pro Leu Ile Gly Glu Ala Leu Ser Arg Val Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys CCA TTA ATT GGA GAA GCA CTG TCT CGT GTG AAG AGA GCG GAA AAA AAA TGG AGA GAC AAA 885 890 895 900 Arg Glu Lys Leu Gln Leu Glu Thr Lys Arg Val Tyr Thr Glu Ala Lys Glu Ala Val Asp CGG GAA AAA CTA CAA TTG GAA ACA AAA CGA GTA TAT ACA GAG GCA AAA GAA GCT GTG GAT 905 910 915 920 Ala Leu Phe Val Asp Ser Gln Tyr Asp Arg Leu Gln Ala Asp Thr Asn Ile Gly Met Ile GCT TTA TTC GTA GAT TCT CAA TAT GAT AGA TTA CAA GCA GAT ACA AAC ATT GGT ATG ATT 925 930 935 940 His Ala Ala Asp Arg Leu Val His Gln Ile His Glu Ala Tyr Leu Pro Glu Leu Pro Phe CAT GCG GCA GAT AGA CTT GTT CAT CAG ATC CAC GAG GCT TAT CTT CCA GAA CTA CCT TTC 945 950 955 960 Ile Pro Gly Ile Asn Val Val Ile Phe Glu Glu Leu Glu Asn Arg Ile Ser Thr Ala Leu ATT CCA GGA ATA AAT GTG GTG ATT TTT GAA GAA TTA GAA AAC CGT ATT TCT ACT GCA TTA 965 970 975 980 Ser Leu Tyr Asp Ala Arg Asn Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys TCC CTA TAT GAT GCG AGA AAT GTC ATT AAA AAT GGC GAT TTC AAT AAT GGC TTA TCA TGC 985 990 995 1000 Trp Asn Val Lys Gly His Val Asp Val Val Glu Gln Asn Asn His Arg Ser Val Leu Val TGG AAC GTG AAA GGG CAT GTA GAT GTA GTA GAA CAA AAC AAC CAC CGT TCG GTC CTT GTT 1005 1010 1015 1020 Val Pro Glu Trp Glu Ala Glu Val Ser Gln Thr Ile Arg Val Cys Pro Gly Arg Gly Tyr GTC CCG GAA TGG GAA GCA GAA GTG TCA CAA ACA ATT CGT GTC TGT CCG GGG CGT GGC TAT 1025 1030 1035 1040 Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr Ile His Glu ATC CTC CGT GTT ACA GCG TAC AAA GAG GGA TAT GGA GAA GGT TGC GTA ACC ATC CAT GAG 1045 1050 1055 1060 Ile Glu Asn Asn Thr Asp Glu Leu Lys Phe Lys Asn Cys Glu Glu Glu Glu Val Tyr Pro ATC GAG AAC AAT ACA GAC GAA CTA AAA TTT AAA AAC TGT GAA GAA GAG GAA GTG TAT CCA 1065 1070 1075 1080 Thr Asp Thr Gly Thr Cys Asn Asp Tyr Thr Ala His Gln Gly Thr Ala Gly Ser Thr Asp ACG GAT ACA GGA ACG TGT AAT GAT TAT ACT GCA CAC CAA GGT ACA GCA GGA TCC ACA GAT 1085 1090 1095 1100 Ser Cys Asn Ser Arg Asn Ile Arg Tyr Glu Asp Ala Tyr Glu Met Asn Thr Thr Ala Ser TCA TGT AAT TCC CGT AAT ATC AGA TAT GAG GAT GCA TAT GAA ATG AAT ACT ACA GCA TCT 1105 1110 1115 1120 Val Asn Tyr Lys Pro Thr Tyr Glu Glu Glu Arg Tyr Thr Asp Val Gln Gly Asp Asn His GTT AAT TAC AAA CCG ACT TAC GAA GAA GAA AGG TAT ACA GAT GTA CAA GGA GAT AAT CAT 1125 1130 1135 1140 Cys Glu Tyr Asp Arg Gly Tyr Val Asn Tyr Arg Pro Val Pro Ala Gly Tyr Val Thr Lys TGT GAA TAT GAC AGA GGG TAT GTG AAT TAT CGA CCA GTA CCA GCT GGT TAT GTG ACA AAA 1145 1150 1155 1160 Glu Leu Glu Tyr Phe Pro Glu Thr Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly GAA TTA GAG TAC TTC CCA GAA ACC GAT AAG GTA TGG ATT GAG ATC GGA GAA ACG GAA GGG 1165 1170 Lys Phe Ile Val Asp Asn Val Glu Leu Leu Leu Met Glu Glu AAG TTT ATT GTA GAC AAT GTC GAA TTA CTC CTT ATG GAG GAA TABLE 4__________________________________________________________________________ 10 20 30 40 50 601 ATGGAGATAA TGAATAATCA GAATCAATGC GTTCCTTATA ACTGTTTGAA TGATCCGACA61 ATTGAAATAT TAGAAGGAGA AAGAATAGAA ACTGGTTACA CCCCAATAGA TATTTCCTTG121 TCGCTAACGC AATTTCTGTT GAGTGAATTT GTCCCAGGTG CTGGGTTTGT ATTAGGTTTA181 ATTGATTTAA TATGGGGGTT TGTGGGTCCC TCTCAATGGG ATGCATTTCT TGTGCAAATT241 GAACAGTTAA TTAACCAAAG AATAGAGGAA TTCGCTAGGA ACCAAGCAAT TTCTAGATTA 310 320 330 340 350 360301 GAAGGGCTAA CCAACCTTTA TCAAATTTAC GCAGAAGCTT TTAGAGAGTG GGAAGCAGAT361 CCTACTAATC CAGCATTAAC AGAAGAGATG CGTATTCAGT TCAATGACAT GAACAGTGCT421 CTTACAACCG CTATTCCTCT TTTTACAGTT CAAAATTATC AAGTACCTCT TCTATCAGTA481 TATGTTCAAG CTGCAAATTT ACATTTATCG GTTTTGAGAG ATGTTTCAGT GTTTGGACAA541 CGTTGGGGAT TTGATGTAGC AACAATCAAT AGTCGTTATA ATGATTTAAC TAGGCTTATT 610 620 630 640 650 660601 GGCACCTATA CAGATTATGC TGTACGCTGG TATAATACGG GATTAGAACG TGTATGGGGA661 CCGGATTCTA GAGATTGGGT AAGGTATAAT CAATTTAGAA GAGAGCTAAC ACTAACTGTA721 TTAGATATCG TTTCTCTGTT CCCGAACTAT GATAGTAGAA CGTATCCAAT TCGAACAGTT781 TCCCAATTAA CTAGAGAAAT TTATACAAAC CCAGTATTAG AAAATTTTGA TGGTAGTTTT841 CGTGGAATGG CTCAGAGAAT AGAACAGAAT ATTAGGCAAC CACATCTTAT GGATCTCCTT 910 920 930 940 950 960901 AATAGTATAA CCATTTATAC TGATGTGCAT AGAGGCTTTA ATTATTGGTC AGGACATCAA961 ATAACAGCTT CTCCTGTCGG TTTTGCGGGG CCAGAATTTA CTTTTCCTAG ATATGGAACC1021 ATGGGAAATG CTGCTCCACC CGTACTGATC TCAACTACTG GTTTGGGGAT TTTTAGAACA1081 TTATCTTCAC CTCTTTACAG AAGAATTATA CTTGGTTCAG GCCCAAATAA TCAGAACCTG1141 TTTGTCCTTG ATGGAACGGA ATTTTCTTTT GCCTCCCTAA CAGCCGATTT ACCTTCTACT 1210 1220 1230 1240 1250 12601201 ATATACAGAC AAAGGGGAAC GGTCGATTCA CTAGATGTAA TACCGCCACA GGATAATAGT1261 GTGCCAGCAC GTGCGGGATT TAGTCATCGA TTAAGTCATG TTACAATGCT GAGCCAAGCA1321 GCTGGAGCAG TTTACACCTT GAGAGCTCCA ACGTTTTCTT GGCGACATCG TAGTGCTGAA1381 TTCTCTAACC TAATTCCTTC ATCACAAATC ACACAGATAC CTTTAACAAA GTCTATTAAT1441 CTTGGCTCTG GGACCTCTGT TGTTAAAGGA CCAGGATTTA CAGGAGGAGA TATTCTTCGA 1510 1520 1530 1540 1550 15601501 AGAACTTCAC CTGGCCAGAT TTCAACCTTA AGAGTGACTA TTACTGCACC ATTATCACAA1561 AGATATCGCG TAAGAATTCG CTACGCTTCT ACTACAAATT TACAATTCCA TACATCAATT1621 GACGGAAGAC CTATTAATCA GGGGAATTTT TCAGCAACTA TGAGTAGTGG GGGTAATTTA1681 CAGTCCGGAA GCTTTAGGAC TGCAGGTTTT ACTACTCCGT TTAACTTTTC AAATGGATCA1741 AGTATATTTA CGTTAAGTGC TCATGTCTTC AATTCAGGCA ATGAAGTTTA TATAGATCGA 1810 1820 1830 1840 1850 18601801 ATTGAATTTG TTCCGGCAGA AGTAACATTT GAGGCGGAAT ATGATTTAGA AAGAGCGCAA1861 GAGGCGGTGA ATGCTCTGTT TACTTCTTCC AATCAACTAG GATTAAAAAC AAATGTGACG1921 GACTATCATA TTGATCAAGT GTCCAATCTA GTCGAATGTT TATCCGGTGA ATTCTGTCTG1981 GATGAAAAGA GAGAATTGTC CGAGAAAGTC AAACATGCGA AGCGACTCAG TGATGAGCGG2041 AATTTACTTC AAGACCCAAA CTTCAGAGGC ATCAATAGAC AACCAGACCG TGGCTGGAGA 2110 2120 2130 2140 2150 21602101 GGCAGTACGG ATATTACCAT CCAAGGAGGA GATGACGTAT TCAAAGAGAA TTACGTCACA2161 CTACCGGGTA CCTTTAATGA GTGTTATCCT ACGTATCTGT ATCAAAAAAT AGATGAGTCG2221 AAATTAAAAG CCTATACCCG TTACCAATTA AGAGGGTACA TCGAGGATAG TCAAGACTTA2281 GAAATCTATT TAATTCGCTA CAATACAAAA CACGAAACAG TAAATGTGCC AGGTACGGGT2341 TCCTTATGGC CGCTTTCAGT CGAAAATCCA ATTGGAAAGT GCGGAGAACC AAATCGATGC 2410 2420 2430 2440 2450 24602401 GCACCACAAC TTGAATGGAA TCCTGATCTA GATTGTTCCT GCAGAGACGG GGAAAAATGT2461 GCACATCACT CCCATCATTT CTCCTTGGAC ATTGATATTG GATGTACAGA TTTAAATGAG2521 AACTTAGGTG TATGGGTGAT ATTCAAAATT AAGACGCAAG ATGGTCACGC AAGACTAGGT2581 AATCTAGAGT TTCTCGAAGA GAAACCATTA GTAGGCGAAT CGTTAGCACG CGTGAAGAGA2641 GCGGAGAAGA AGTGGAGAGA CAAACGAGAG AAATTGCAAG TGGAAACAAA TATCGTTTAT 2710 2720 2730 2740 2750 27602701 AAAGAGGCAA AAGAATCTGT AGATGCTTTA TTTGTGAACT CTCAATATGA TAGATTACAA2761 GCGGATACCG ACATCGCGAT GATTCATGCG GCAGATAAAC GCGTTCATCG AATTCGAGAA2821 GCATATCTTC CAGAGTTATC TGTAATTCCG GGTGTCAATG CGGGCATTTT TGAAGAATTA2881 GAGGGACGTA TTTTCACAGC CTACTCTTTA TATGATGCGA GAAATGTCAT TAAAAATGGC2941 GATTTCAATA ATGGCTTATC ATGCTGGAAC GTGAAAGGGC ATGTAGATGT AGAAGAACAA 3010 3020 3030 3040 3050 30603001 AACAACCACC GTTCGGTTCT TGTTGTCCCG GAATGGGAAG CAGAGGTGTC ACAAGAGGTT3061 CGTGTCTGTC CAGGTCGTGG CTATATCCTA CGTGTTACAG CGTACAAAGA GGGATATGGA3121 GAAGGTTGCG TAACGATTCA TGAGATCGAA GACAATACAG ACGAACTGAA ATTCAGCAAC3181 TGTGTAGAAG AGGAAGTATA TCCAAACAAC ACGGTAACGT GTAATGATTA TACTGCAAAT3241 CAAGAAGAAT ACGGGGGTGC GTACACTTCT CGTAATCGTG GATATGGTGA ATCTTATGAA 3310 3320 3330 3340 3350 33603301 AGTAATTCTT CCATACCAGC TGAGTATGCG CCAGTTTATG AGGAAGCATA TATAGATGGA3361 AGAAAAGAGA ATCCTTGTGA ATCTAACAGA GGATATGGGG ATTACACGCC ACTACCAGCT3421 GGTTATGTGA CAAAAGAATT AGAGTACTTC CCAGAAACCG ATAAGGTATG GATTGAGATC3481 GGGGAAACGG AAGGAACATT CATCGTGGAT AGCGTGGAAT TACTCCTTAT GGAGGAA*__________________________________________________________________________ Segment 1* TABLE 5__________________________________________________________________________ 5 10 151 Met Glu Ile Met Asn Asn Gln Asn Gln Cys Val Pro Tyr Asn Cys16 Leu Asn Asp Pro Thr Ile Glu Ile Leu Glu Gly Glu Arg Ile Glu31 Thr Gly Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe46 Leu Leu Ser Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu61 Ile Asp Leu Ile Trp Gly Phe Val Gly Pro Ser Gln Trp Asp Ala76 Phe Leu Val Gln Ile Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu91 Phe Ala Arg Asn Gln Ala Ile Ser Arg Leu Glu Gly Leu Ser Asn106 Leu Tyr Gln Ile Tyr Ala Glu Ala Phe Arg Glu Trp Glu Ala Asp121 Pro Thr Asn Pro Ala Leu Thr Glu Glu Met Arg Ile Gln Phe Asn136 Asp Met Asn Ser Ala Leu Thr Thr Ala Ile Pro Leu Phe Thr Val151 Gln Asn Tyr Gln Val Pro Leu Leu Ser Val Tyr Val Gln Ala Ala166 Asn Leu His Leu Ser Val Leu Arg Asp Val Ser Val Phe Gly Gln181 Arg Trp Gly Phe Asp Val Ala Thr Ile Asn Ser Arg Tyr Asn Asp196 Leu Thr Arg Leu Ile Gly Thr Tyr Thr Asp Tyr Ala Val Arg Trp211 Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg Asp226 Trp Val Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val241 Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr256 Pro Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn271 Pro Val Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Met Ala Gln286 Arg Ile Glu Gln Asn Ile Arg Gln Pro His Leu Met Asp Leu Leu301 Asn Ser Ile Thr Ile Tyr Thr Asp Val His Arg Gly Phe Asn Tyr316 Trp Ser Gly His Gln Ile Thr Ala Ser Pro Val Gly Phe Ala Gly331 Pro Glu Phe Thr Phe Pro Arg Tyr Gly Thr Met Gly Asn Ala Ala346 Pro Pro Val Leu Ile Ser Thr Thr Gly Leu Gly Ile Phe Arg Thr361 Leu Ser Ser Pro Leu Tyr Arg Arg Ile Ile Leu Gly Ser Gly Pro376 Asn Asn Gln Asn Leu Phe Val Leu Asp Gly Thr Glu Phe Ser Phe391 Ala Ser Leu Thr Ala Asp Leu Pro Ser Thr Ile Tyr Arg Gln Arg406 Gly Thr Val Asp Ser Leu Asp Val Ile Pro Pro Gln Asp Asn Ser421 Val Pro Ala Arg Ala Gly Phe Ser His Arg Leu Ser His Val Thr436 Met Leu Ser Gln Ala Ala Gly Ala Val Tyr Thr Leu Arg Ala Pro451 Thr Phe Ser Trp Arg His Arg Ser Ala Glu Phe Ser Asn Leu Ile466 Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Ile Asn481 Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly496 Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu511 Arg Val Thr Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg526 Ile Arg Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile541 Asp Gly Arg Pro Ile Asn Gln Gln Asn Phe Ser Ala Thr Met Ser556 Ser Gly Gly Asn Leu Gln Ser Gly Ser Phe Arg Thr Ala Gly Phe571 Thr Thr Pro Phe Asn Phe Ser Asn Gly Ser Ser Ile Phe Thr Leu586 Ser Ala His Val Phe Asn Ser Gly Asn Glu Val Tyr Ile Asp Arg601 Ile Glu Phe Val Pro Ala Glu Val Thr Phe Glu Ala Glu Tyr Asp616 Leu Glu Arg Ala Gln Glu Ala Val Asn Ala Leu Phe Thr Ser Ser631 Asn Gln Leu Gly Leu Lys Thr Asn Val Thr Asp Tyr His Ile Asp646 Gln Val Ser Asn Leu Val Glu Cys Leu Ser Gly Glu Phe Cys Leu661 Asp Glu Lys Arg Glu Leu Ser Glu Lys Val Lys His Ala Lys Arg676 Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro Asn Phe Arg Gly691 Ile Asn Arg Gln Pro Asp Arg Gly Trp Arg Gly Ser Thr Asp Ile706 Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val Thr721 Leu Pro Gly Thr Phe Asn Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln736 Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gln Leu751 Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Leu Ile766 Arg Tyr Asn Thr Lys His Glu Thr Val Asn Val Pro Gly Thr Gly781 Ser Leu Trp Pro Leu Ser Val Glu Asn Pro Ile Gly Lys Cys Gly796 Glu Pro Asn Arg Cys Ala Pro Gln Leu Glu Trp Asn Pro Asp Leu811 Asp Cys Ser Cys Arg Asp Gly Glu Lys Cys Ala His His Ser His826 His Phe Ser Leu Asp Ile Asp Ile Gly Cys Thr Asp Leu Asn Glu841 Asn Leu Gly Val Trp Val Ile Phe Lys Ile Lys Thr Gln Asp Gly856 His Ala Arg Leu Gly Asn Leu Glu Phe Leu Glu Glu Lys Pro Leu871 Val Gly Glu Ser Leu Ala Arg Val Lys Arg Ala Glu Lys Lys Trp886 Arg Asp Lys Arg Glu Lys Leu Gln Val Glu Thr Asn Ile Val Tyr901 Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe Val Asn Ser Gln916 Tyr Asp Arg Leu Gln Ala Asp Thr Asp Ile Ala Met Ile His Ala931 Ala Asp Lys Arg Val His Arg Ile Arg Glu Ala Tyr Leu Pro Glu946 Leu Ser Val Ile Pro Gly Val Asn Ala Gly Ile Phe Glu Glu Leu961 Glu Gly Arg Ile Phe Thr Ala Tyr Ser Leu Tyr Asp Ala Arg Asn976 Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn991 Val Lys Gly His Val Asp Val Glu Glu Gln Asn Asn His Arg Ser1006 Val Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val1021 Arg Val Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr1036 Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu1051 Asp Asn Thr Asp Glu Leu Lys Phe Ser Asn Cys Val Glu Glu Glu1066 Val Tyr Pro Asn Asn Thr Val Thr Cys Asn Asp Tyr Thr Ala Asn1081 Gln Glu Glu Tyr Gly Gly Ala Tyr Thr Ser Arg Asn Arg Gly Tyr1096 Gly Glu Ser Tyr Glu Ser Asn Ser Ser Ile Pro Ala Glu Tyr Ala1111 Pro Val Tyr Glu Glu Ala Tyr Ile Asp Gly Arg Lys Glu Asn Pro1126 Cys Glu Ser Asn Arg Gly Tyr Gly Asp Tyr Thr Pro Leu Pro Ala1141 Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp Lys1156 Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr PHe Ile Val Asp1171 Ser Val Glu Leu Leu Leu Met Glu Glu__________________________________________________________________________ Fragment 1* TABLE 6 5 10 15 20 Met Glu Ile Met Asn Asn Gln Asn Gln Cys Val Pro Tyr Asn Cys Leu Asn Asp Pro Thr ATG GAG ATA ATG AAT AAT CAG AAT CAA TGC GTT CCT TAT AAC TGT TTG AAT GAT CCG ACA 25 30 35 40 Ile Glu Ile Leu Glu Gly Glu Arg Ile Glu Thr Gly Tyr Thr Pro Ile Asp Ile Ser Leu ATT GAA ATA TTA GAA GGA GAA AGA ATA GAA ACT GGT TAC ACC CCA ATA GAT ATT TCC TTG 45 50 55 60 Ser Leu Thr Gln Phe Leu Leu Ser Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu TCG CTA ACG CAA TTT CTG TTG AGT GAA TTT TGC CCA GGT GCT GGG TTT GTA TTA GGT TTA 65 70 75 80 Ile Asp Leu Ile Trp Gly Phe Val Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile ATT GAT TTA ATA TGG GGG TTT GTG GGT CCC TCT CAA TGG GAT GCA TTT CTT GTG CAA ATT 85 90 95 100 Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala Ile Ser Arg Leu GAA CAG TTA ATT AAC CAA AGA ATA GAG GAA TTC GCT AGG AAC CAA GCA ATT TCT AGA TTA 105 110 115 120 Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu Ala Phe Arg Glu Trp Glu Ala Asp GAA GGG CTA AGC AAC CTT TAT CAA ATT TAC GCA GAA GCT TTT AGA GAG TGG GAA GCA GAT 125 130 135 140 Pro Thr Asn Pro Ala Leu Thr Glu Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala CCT ACT AAT CCA GCA TTA ACA GAA GAG ATG CGT ATT CAG TTC AAT GAC ATG AAC AGT GCT 145 150 155 160 Leu Thr Thr Ala Ile Pro Leu Phe Thr Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val CTT ACA ACC GCT ATT CCT CTT TTT ACA GTT CAA AAT TAT CAA GTA CCT CTT CTA TCA GTA 165 170 175 180 Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val ser Val Phe Gly Gln TAT GTT CAA GCT GCA AAT TTA CAT TTA TCG GTT TTG AGA GAT GTT TCA GTG TTT GGA CAA 185 190 195 200 Arg Trp Gly Phe Asp Val Ala Thr Ile Asn Ser Arg Tyr Asn Asp Leu Thr Arg Leu Ile CGT TGG GGA TTT GAT GTA GCA ACA ATC AAT AGT CGT TAT AAT GAT TTA ACT AGG CTT ATT 205 210 215 220 Gly Thr Tyr Thr Asp Tyr Ala Val Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly GGC ACC TAT ACA GAT TAT GCT GTA CGC TGG TAT AAT ACG GGA TTA GAA CGT GTA TGG GGA 225 230 235 240 Pro Asp Ser Arg Asp Trp Val Arg Tyr Asn Gln Phe Arg Arg Glu LEu Thr Leu Thr Val CCG GAT TCT AGA GAT TGG GTA AGG TAT AAT CAA TTT AGA AGA GAG CTA ACA CTA ACT GTA 245 250 255 260 Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro Ile Arg Thr Val TTA GAT ATC GTT TCT CTG TTC CCG AAC TAT GAT AGT AGA ACG TAT CCA ATT CGA ACA GTT 265 270 275 280 Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val Leu Glu Asn Phe Asp Gly Ser Phe TCC CAA TTA ACT AGA GAA ATT TAT ACA AAC CCA GTA TTA GAA AAT TTT GAT GGT AGT TTT 285 290 295 300 Arg Gly Met Ala Gln Arg Ile Glu Gln Asn Ile Arg Gln Pro His Leu Met Asp Leu Leu CGT GGA ATG GCT CAG AGA ATA GAA CAG AAT ATT AGG CAA CCA CAT CTT ATG GAT CTC CTT 305 310 315 320 Asn Ser Ile Thr Ile Tyr Thr Asp Val His Arg Gly Phe Asn Tyr Trp Ser Gly His Gln AAT AGT ATA ACC ATT TAT ACT GAT GTG CAT AGA GGC TTT AAT TAT TGG TCA GGA CAT CAA 325 330 335 340 Ile Thr Ala Ser Pro Val Gly Phe Ala Gly Pro Glu Phe Thr Phe Pro Arg Tyr Gly Thr ATA ACA GCT TCT CCT GTC GGT TTT GCG GGG CCA GAA TTT ACT TTT CCT AGA TAT GGA ACC 345 350 355 360 Met Gly Asn Ala Ala Pro Pro Val Leu Ile Ser Thr Thr Gly Leu Gly Ile Phe Arg Thr ATG GGA AAT GCT GCT CCA CCC GTA CTG ATC TCA ACT ACT GGT TTG GGG ATT TTT AGA ACA 365 370 375 380 Leu Ser Ser Pro Leu Tyr Arg Arg Ile Ile Leu Gly Ser Gly Pro Asn Asn Gln Asn Leu TTA TCT TCA CCT CTT TAC AGA AGA ATT ATA CTT GGT TCA GGC CCA AAT AAT CAG AAC CTG 385 390 395 400 Phe Val Leu Asp Gly Thr Glu Phe Ser Phe Ala Ser Leu Thr Ala Asp Leu Pro Ser Thr TTT GTC CTT GAT GGA ACG GAA TTT TCT TTT GCC TCC CTA ACA GCC GAT TTA CCT TCT ACT 405 410 415 420 Ile Tyr Arg Gln Arg Gly Thr Val Asp Ser Leu Asp Val Ile Pro Pro Gln Asp Asn Ser ATA TAC AGA CAA AGG GGA ACG GTC GAT TCA CTA GAT GTA ATA CCG CCA CAG GAT AAT AGT 425 430 435 440 Val Pro Ala Arg Ala Gly Phe Ser His Arg Leu Ser His Val Thr Met Leu Ser Gln Ala GTG CCA GCA CGT GCG GGA TTT AGT CAT CGA TTA AGT CAT GTT ACA ATG CTG AGC CAA GCA 445 450 455 460 Ala Gly Ala Val Tyr Thr Leu Arg Ala Pro Thr Phe Ser Trp Arg His Arg Ser Ala Glu GCT GGA GCA GTT TAC ACC TTG AGA GCT CCA ACG TTT TCT TGG CGA CAT CGT AGT GCT GAA 465 470 475 480 Phe Ser Asn Leu Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Ile Asn TTC TCT AAC CTA ATT CCT TCA TCA CAA ATC ACA CAG ATA CCT TTA ACA AAG TCT ATT AAT 485 490 495 500 Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg CTT GGC TCT GGG ACC TCT GTT GTT AAA GGA CCA GGA TTT ACA GGA GGA GAT ATT CTT CGA 505 510 515 520 Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg Val Thr Ile Thr Ala Pro Leu Ser Gln AGA ACT TCA CCT GGC CAG ATT TCA ACC TTA AGA GTG ACT ATT ACT GCA CCA TTA TCA CAA 525 530 535 540 Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile AGA TAT CGC GTA AGA ATT CGC TAC GCT TCT ACT ACA AAT TTA CAA TTC CAT ACA TCA ATT 545 550 555 560 Asp Gly Arg Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Gly Asn Leu GAC GGA AGA CCT ATT AAT CAG GGG AAT TTT TCA GCA ACT ATG AGT AGT GGG GGT AAT TTA 565 570 575 580 Gln Ser Gly Ser Phe Arg Thr Ala Gly Phe Thr Thr Pro Phe Asn Phe Ser Asn Gly Ser CAG TCC GGA AGC TTT AGG ACT GCA GGT TTT ACT ACT CCG TTT AAC TTT TCA AAT GGA TCA 585 590 595 600 Ser Ile Phe Thr Leu Ser Ala His Val Phe Asn Ser Gly Asn Glu Val Tyr Ile Asp Arg AGT ATA TTT ACG TTA AGT GCT CAT GTC TTC AAT TCA GGC AAT GAA GTT TAT ATA GAT CGA 605 610 615 620 Ile Glu Phe Val Pro Ala Glu Val Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala Gln ATT GAA TTT GTT CCG GCA GAA GTA ACA TTT GAG GCG GAA TAT GAT TTA GAA AGA GCG CAA 625 630 635 640 Glu Ala Val Asn Ala Leu Phe Thr Ser Ser Asn Gln Leu Gly Leu Lys Thr Asn Val Thr GAG GCG GTG AAT GCT CTG TTT ACT TCT TCC AAT CAA CTA GGA TTA AAA ACA AAT GTG ACG 645 650 655 660 Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Glu Cys Leu Ser Gly Glu Phe Cys Leu GAC TAT CAT ATT GAT CAA GTG TCC AAT CTA GTC GAA TGT TTA TCC GGT GAA TTC TGT CTG 665 670 675 680 Asp Glu Lys Arg Glu Leu Ser Glu Lys Val Lys His Ala Lys Arg Leu Ser Asp Glu Arg GAT GAA AAG AGA GAA TTG TCC GAG AAA GTC AAA CAT GCG AAG CGA CTC AGT GAT GAG CGG 685 690 695 700 Asn Leu Leu Gln Asp Pro Asn Phe Arg Gly Ile Asn Arg Gln Pro Asp Arg Gly Trp Arg AAT TTA CTT CAA GAC CCA AAC TTC AGA GGC ATC AAT AGA CAA CCA GAC CGT GGC TGG AGA 705 710 715 720 Gly Ser Thr Asp Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val Thr GGC AGT ACG GAT ATT ACC ATC CAA GGA GGA GAT GAC GTA TTC AAA GAG AAT TAC GTC ACA 725 730 735 740 Leu Pro Gly Thr Phe Asn Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln Lys Ile Asp Glu Ser CTA CCG GGT ACC TTT AAT GAG TGT TAT CCT ACG TAT CTG TAT CAA AAA ATA GAT GAG TCG 745 750 755 760 Lys Leu Lys Ala Tyr Thr Arg Tyr Gln Leu Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu AAA TTA AAA GCC TAT ACC CGT TAC CAA TTA AGA GGG TAC ATC GAG GAT AGT CAA GAC TTA 765 770 775 780 Glu Ile Tyr Leu Ile Arg Tyr Asn Thr Lys His Glu Thr Val Asn Val Pro Gly Thr Gly GAA ATC TAT TTA ATT CGC TAC AAT ACA AAA CAC GAA ACA GTA AAT GTG CCA GGT ACG GGT 785 790 795 800 Ser Leu Trp Pro Leu Ser Val Glu Asn Pro Ile Gly Lys Cys Gly Glu Pro Asn Arg Cys TCC TTA TGG CCG CTT TCA GTC GAA AAT CCA ATT GGA AAG TGC GGA GAA CCA AAT CGA TGC 805 810 815 820 Ala Pro Gln Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys Arg Asp Gly Glu Lys Csy GCA CCA CAA CTT GAA TGG AAT CCT GAT CTA GAT TGT TCC TGC AGA GAC GGG GAA AAA TGT 825 830 835 840 Ala His His Ser His His Phe Ser Leu Asp Ile Asp Ile Gly Cys Thr Asp Leu Asn Glu GCA CAT CAC TCC CAT CAT TTC TCC TTG GAC ATT GAT ATT GGA TGT ACA GAT TTA AAT GAG 845 850 855 860 Asn Leu Gly Val Trp Val Ile Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly AAC TTA GGT GTA TGG GTG ATA TTC AAA ATT AAG ACG CAA GAT GGT CAC GCA AGA CTA GGT 865 870 875 880 Asn Leu Glu Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ser Leu Ala Arg Val Lys Arg AAT CTA GAG TTT CTC GAA GAG AAA CCA TTA GTA GGC GAA TCG TTA GCA CGC GTG AAG AGA 885 890 895 900 Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Gln Val Glu Thr Asn Ile Val Tyr GCG GAG AAG AAG TGG AGA GAC AAA CGA GAG AAA TTG CAA GTG GAA ACA AAT ATC GTT TAT 905 910 915 920 Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe Val Asn Ser Gln Tyr Asp Arg Leu Gln AAA GAG GCA AAA GAA TCT GTA GAT gCT TTA TTT GTG AAC TCT CAA TAT GAT AGA TTA CAA 925 930 935 940 Ala Asp Thr Asp Ile Ala Met Ile His Ala Ala Asp Lys Arg Val His Arg Ile Arg Glu GCG GAT ACC GAC ATC GCG ATG ATT CAT GCG GCA GAT AAA CGC GTT CAT CGA ATT CGA GAA 945 950 955 960 Ala Tyr Leu Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Gly Ile Phe Glu Glu Leu GCA TAT CTT CCA GAG TTA TCT GTA ATT CCG GGT GTC AAT GCG GGC ATT TTT GAA GAA TTA 965 970 975 980 Glu Gly Arg Ile Phe Thr Ala Tyr Ser Leu Tyr Asp Ala Arg Asn Val Ile Lys Asn Gly GAG GGA CGT ATT TTC ACA GCC TAC TCT TTA TAT gAT GCG AGA AAT GTC ATT AAA AAT GGC 985 990 995 1000 Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn Val Lys Gly His Val Asp Val Glu Glu Gln GAT TTC AAT AAT GGC TTA tCA TGC TGG AAC GTG AAA GGG CAT GTA GAT GTA GAA GAA CAA 1005 1010 1015 1020 Asn Asn His Arg Ser Val Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val AAC AAC CAC CGT TCG GTT CTT GTT GTC CCG GAA TGG GAA GCA GAG GTG TCA CAA GAG GTT 1025 1030 1035 1040 Arg Val Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr Gly CGT GTC TGT CCA GGT CGT GGC TAT ATC CTA CGT GTT ACA GCG TAC AAA GAG GGA TAT GGA 1045 1050 1055 1060 Glu Gly Cys Val Thr Ile His Glu Ile Glu Asp Asn Thr Asp Glu Leu Lys Phe Ser Asn GAA GGT TGC GTA ACG ATT CAT GAG ATC GAA GAC AAT ACA GAC GAA CTG AAA TTC AGC AAC 1065 1070 1075 1080 Cys Val Glu Glu Glu Val Tyr Pro Asn Asn Thr Val Thr Cys Asn Asp Tyr Thr Ala Asn TGT GTA GAA GAG GAA GTA TAT CCA AAC AAC ACG GTA ACG TGT AAT GAT TAT ACT GCA AAT 1085 1090 1095 1100 Gln Glu Glu Tyr Gly Gly Ala Tyr Thr Ser Arg Asn Arg Gly Tyr Gly Glu Ser Tyr Glu CAA GAA GAA TAC GGG GGT GCG TAC ACT TCT CGT AAT CGT GGA TAT GGT GAA TCT TAT GAA 1105 1110 1115 1120 Ser Asn Ser Ser Ile Pro Ala Glu Tyr Ala Pro Val Tyr Glu Glu Ala Tyr Ile Asp Gly AGT AAT TCT TCC ATA CCA GCT GAG TAT GCG CCA GTT TAT GAG GAA GCA TAT ATA GAT GGA 1125 1130 1135 1140 Arg Lys Glu Asn Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp Tyr Thr Pro Leu Pro Ala AGA AAA GAG AAT CCT TGT GAA TCT AAC AGA GGA TAT GGG GAT TAC ACG CCA CTA CCA GCT 1145 1150 1155 1160 Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp Lys Val Trp Ile Glu Ile GGT TAT GTG ACA AAA GAA TTA GAG TAC TTC CCA GAA ACC GAT AAG GTA TGG ATT GAG ATC 1165 1170 1175 Gly Glu Thr Glu Gly Thr Phe Ile Val Asp Ser Val Glu Leu Leu Leu Met Glu Glu GGG GAA ACG GAA GGA ACA TTC ATC GTG GAT AGC GTG GAA TTA CTC CTT ATG GAG GAA

Claims

1. A process for controlling lepidopteran insect pests which comprises contacting said insect pests with an insect-controlling effective amount of Bacillus thuringiensis PS81A2, having all the identifying characteristics of NRRL B-18457, or mutants thereof which have lepidopteran activity.

2. The process, according to claim 1, wherein said mutants are asporogenous mutants and/or phage resistant mutants.

3. The process, according to claim 1, wherein said insect pest is contacted with an insect-controlling effective amount of Bacillus thuringiensis PS81A2, by incorporating said Bacillus thuringiensis PS81A2 into a bait granule and placing said granule on or in the soil when planting seed of a plant upon which plant insect pest is known to feed.

4. A process for controlling soil-inhabiting insect pests of the order Lepidoptera which comprises

(1) preparing a bait granule comprising Bacillus thuringiensis PS81A2, or mutants thereof, spores or crystals; and

(2) placing said bait granule on or in the soil.

5. The process, according to claim 4, wherein said bait granule is applied at the same time corn seed is planted in the soil.

6. The process, according to claims 1 or 4, wherein substantially intact Bacillus thuringiensis PS81A2 cells, or mutants thereof, which have lepidopteran activity are treated to prolong the pesticidal activity when the substantially intact cells are applied to the environment of a target pest.

7. A composition of matter comprising Bacillus thuringiensis PS81A2, or mutants thereof, which have lepidopteran activity spores or crystals in association with an insecticide carrier, wherein said mutants are asporogenous mutants and/or phage resistant mutants.

8. The composition of matter, according to claim 7, wherein said carrier comprises phagostimulants or attractants.

9. A composition of matter comprising Bacillus thuringiensis PS81A2, or mutants thereof, which have lepidopteran activity in association with formulation ingredients applied as a seed coating, wherein said mutants are asporogenous mutants and/or phage resistant mutants.

10. Bacillus thuringiensis PS81A2 having all the identifying characteristics of NRRL B-18457, or mutants thereof which have lepidopteran activity.

11. Asporogenous and/or phage resistant mutants of Bacillus thuringiensis PS81A2.