Gram-negative bacteria can cause diseases of significant public health and economic concern in humans and other animals. Vaccine strategies are being pursued to combat these infections. These strategies are based on the identification of conserved, immunogenic cell surface components; however, the detection of conserved molecules that would confer protection against the vast majority of strains from a single species has proven problematic.
The exterior surface of the outer membrane of all Gram-negative bacteria contains an amphiphillic carbohydrate molecule termed lipopolysaccharide (LPS) that by virtue of its surface location can be considered as a candidate vaccine antigen. As its name suggests this molecule contains a lipid region that anchors the molecule in the outer membrane, by virtue of both ester (O-) linked and amide (N-) linked fatty acids. The lipid A region and specifically the fatty acids are responsible for the endotoxic activity of the Gram-negative bacterium and consists in most species of a disaccharide of glucosamine sugars that are phosphorylated and the ester and amide linked fatty acids as shown in
The core oligosaccharide can be arbitrarily divided into an outer and inner core and is connected to the lipid A region via one or more ketose sugar(s), 2-keto-3-deoxy-octulosonic acid (Kdo). An O-antigenic polymeric repeating unit (O-antigen) can be present or absent beyond the core oligosaccharide of the LPS molecule. The O-antigen is a variable moiety between strains of the same species and is often the antigen responsible for the serotyping schemes adopted to classify a species. Due to its variable nature within most species the O-antigen is not a good vaccine candidate as antibodies directed to one O-antigen will be serotype specific, and not offer protection to other serotypes of the same strain. Similarly the outer core region can be somewhat variable within a species and is also therefore not a good vaccine candidate. However what is arbitrarily termed the inner core oligosaccharide has been found to be conserved within several species, and is the vaccine antigen of choice in this application. Conserved regions of LPS molecules have been identified in the core oligosaccharide of several species, and examples of core oligosaccharide structures are detailed in
The endotoxicity of the lipid A region is due to the fatty acid residues. Removal of the ester-linked fatty acids leaves an O-deacylated LPS species that is no longer endotoxic. Removal of all fatty acids i.e. both the amide and ester-linked fatty acids can be performed chemically, but involves harsh conditions which can effect other regions of the LPS molecule. Even the mild chemical conditions employed to effect O-deacylation can effect ester-linked residues elsewhere in the LPS.
LPS based vaccines generally require the removal of fatty acids from the lipid A region of the molecule to reduce the endotoxicity. Preferably, this detoxification step does not modify the carbohydrate epitopes on the LPS molecule, however commonly available techniques do not permit this.
Current methods employed are to chemically O-deacylate LPS producing an O-deacylated LPS molecule (LPS-OH) which can be used either directly or following further modification to conjugate to a suitable protein carrier to produce a glycoconjugate vaccine candidate. Removal of the remaining N-linked fatty acids from LPS-OH would greatly improve conjugation strategies, as this would create a completely water-soluble molecule amenable to all subsequent manipulations. However, chemical methods currently employed to de-N-acylate LPS molecules also modify some residues in the inner core, thus altering the structure of potentially immunogenic epitopes on the LPS molecule. For example the phosphoethanolamine (PEtn) residue of the inner core oligosaccharide of Neisseria meningitidis LPS (
According to a first aspect of the invention, there is provided a method of preparing a vaccine comprising:
separating lipopolysaccharide from a bacterium of interest;
de-esterfying the lipopolysaccharide;
removing at least one N-linked fatty acid from the lipopolysaccharide with an isolated amidase activity; and
conjugating the modified lipopolysaccharide to a suitable carrier molecule.
According to a second aspect of the invention, there is provided a method of recovering a modified lipopolysaccharide from a bacterium of interest comprising:
separating lipopolysaccharide from the bacterium of interest;
de-esterfying the lipopolysaccharide;
removing at least one N-linked fatty acid from the lipopolysaccharide with an isolated amidase activity; and recovering the modified LPS.
According to a third aspect of the invention, there is provided an isolated or purified mono-N-acylated-de-O-acylated lipopolysaccharide (LPS) molecule or de-N-acylated-de-O-acylated LPS molecule from a bacterium of interest conjugated to a carrier protein.
According to a fourth aspect of the invention, there is provided use of the conjugate as described above for the immunization of individuals having or suspected of having or at risk of developing an infection from the bacterium of interest.
According to a fifth aspect of the invention, there is provided use of the conjugate as described above in the manufacture of a medicament for the immunization of individuals having or suspected of having or at risk of developing an infection from the bacterium of interest.
a) is a schematic representation of the core oligosaccharide of the Neisseria meningitidis LPS molecule.
b) is a schematic representation of the core oligosaccharide of the Neisseria meningitidis mutant strain galE LPS molecule.
c) is a schematic representation of the core oligosaccharide of the Haemophilus influenzae mutant strain licl IpsA LPS molecule.
d) is a schematic representation of the core oligosaccharide of the Mannheimia haemolytica mutant strain losB LPS molecule.
a is the Dd1 amino acid sequence.
b is the Dd2 amino acid sequence.
a is the 1H-NMR spectrum of Neisseria meningitidis strain L3 galE O-deacylated LPS before treatment with Dictyostelium discoideum amidase.
b is the 1H-NMR spectrum of Neisseria meningitidis strain L3 galE O-deacylated LPS after treatment with Dictyostelium discoideum amidase.
a is the MALDI-MS spectrum of CRM197 protein
b is the MALDI-MS spectrum of CRM197 protein following bromo-acetyl activation
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference. There is disclosed herein novel enzymes, processes and antigenic structures useful in producing vaccines and compounds useful in combating gram-negative bacteria. Enzymes were isolated from the slime mould Dictyostelium discoideum and used to specifically degrade lipopolysaccharide (LPS). Enzymatic degradation permits residues of the LPS molecule, including immunogenic epitopes of the core oligosaccharide portion of the LPS, to remain unmodified during this enzymatic removal of fatty acids from the lipid A region of the LPS molecule. Also disclosed are strategies employed to obtain and purify desired enzymatic activities either directly from Dictyostelium discoideum or following cloning and expression in an appropriate expression system, and uses of enzymes isolated in this way.
According to an aspect of the invention there is provided a method of preparing a vaccine comprising:
separating the lipopolysaccharide from a bacterium of interest;
de-esterfying the lipopolysaccharide;
removing at least one N-linked fatty acid from the lipopolysaccharide with an isolated amidase activity; and
conjugating the modified lipopolysaccharide to a suitable carrier molecule.
The bacterium is preferably a gram-negative bacterium. As will be appreciated by one of skill in the art, the bacterium may not necessarily be a known or positively identified bacterium but need only be sufficiently purified or isolated so that the lipopolysaccharide can be recovered therefrom.
As used herein, ‘purified’ does not require absolute purity, but only that the material has been purified, for example, by 2 fold, by 5 fold, by 10 fold or more.
As used herein, ‘isolated’ requires that the material in question has been removed from its natural environment.
In a preferred embodiment, the amidase activity is from a peptide having at least 70% identity to the amino acid sequence as set forth in either SEQ ID No. 1 (FAAI/Dd1) or SEQ ID No. 2 (FAAII/Dd2). In other embodiments, the peptide may have at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity or at least 95% identity to the amino acid sequence as set forth in either SEQ ID No. 1 or No. 2 or is a peptide having an amino acid sequence as set forth in either SEQ ID No. 1 or SEQ ID No. 2.
It is noted that the amidase activity is isolated, meaning that it has been isolated or purified from the host organism, as discussed above. Specifically, it is noted that the host organism may be an organism that has native amidase activity such as Dictyostelium discoideum or may be an organism comprising an expression system arranged to express either Dd1 (SEQ ID No. 1) or Dd2 (SEQ ID No. 2) as discussed below.
In accordance with another aspect of the invention, there is provided an isolated or purified mono-N-acylated-de-O-acylated LPS molecule or de-N-acylated-de-O-acylated LPS molecule from a bacterium of interest conjugated to a carrier protein. The a mono-N-acylated-de-O-acylated LPS molecule or de-N-acylated-de-O-acylated LPS molecule may be from any suitable Gram negative bacterium, for example, but by no means limited to Neisseria meningitidis, Haemophilus influenzae or Mannheimia haemolytica, as shown in
As discussed below, the inventors surprisingly discovered that the isolated form of the amidase is able to modify or react with substrates (LPS from specific bacterial strains) which are not substrates for the intact organism (Neisseria meningitidis and Mannheimia haemolytica). As shown in
Accordingly, in some embodiments, there is provided a purified, water-soluble O-deacylated LPS having at least one N-linked fatty acid removed. The LPS may be from Neisseria meningitidis, Haemophilus influenzae or Mannheimia haemolytica, which are shown in
In some embodiments, the LPS is separated from, isolated from or recovered from the bacterium of interest using means known in the art, for example, by a phenol extraction and treatment with DNase, RNase and proteinases. Other suitable means known in the art may also be used.
The LPS may be de-esterfied using any suitable means known in the art, for example, enzymatically or by treatment with a suitable base, for example but by no means limited to hydrazine, mild NaOH, KOH or the like.
The modified LPS may be recovered by any suitable means known in the art, for example, by passing the material through a 10 kDa spin column and then separating further on a Sephadex G-10 chromatography column. It is noted that such methods for recovering a fraction of a specific size are well known to those of skill in the art.
Methods of conjugation and suitable carrier proteins are discussed in greater detail below.
In another embodiment of the invention, there is provided a method of recovering a modified lipopolysaccharide from a bacterium of interest comprising:
separating the lipopolysaccharide from the bacterium of interest;
de-esterfying the lipopolysaccharide layer;
removing at least one N-linked fatty acid from the lipopolysaccharide with an isolated amidase activity; and recovering the modified LPS.
In these embodiments, a modified LPS is recovered which is water-soluble as at least one of the two N-linked fatty acids has been removed and the LPS has been O-deacylated. Most importantly however, the important core components of the LPS are intact and substantially retain their native conformation or structure, as described below. Furthermore, the modified LPS is more amenable to subsequent conjugation steps, as discussed herein.
Dictyostelium discoideum is, a soil-living amoeba which, produces both esterases and amidases, having the specific degradative effect on LPS that is required [Verret, C R; Rev. Infect. Dis (1984) δ: 452-454]. In the natural environment Dictyostelium discoideum feeds on bacterial LPS, engulfing the organism, removing the fatty acids on the lipid A as its food source without any modifications to the carbohydrate groups.
Other researchers [Gustafson et al US application publication #2003/0138448 A1] have proposed using the intact Dictyostelium discoideum species to degrade intact bacterial species with the deacylated LPS molecule being purified from this mixture. However certain bacterial species cannot efficiently support the growth of Dictyostelium discoideum, including Neisseria meningitidis. The growth of Dictyostelium discoideum was examined utilising various bacterial strains as food sources. Dictyostelium discoideum cells were plated on a lawn of each of the following bacterial strains, capsulated Neisseria meningitidis L3, non-encapsulated Neisseria meningitidis L3, capsulated Neisseria meningitidis L3 galE, Haemophilus influenzae 1003 lic1 lpsA, Haemophilus influenzae 1003 lic1 lpt6, Haemophilus influenzae 162, Mannheimia haemolytica losB and Klebsiella aerogenes on SM and chocolate media. The growth of Dictyostelium discoideum on Klebsiella aerogenes and Haemophilus influenzae was normal. However, growth on Neisseria meningitidis whether encapsulated or not and Mannheimia haemolytica was severely inhibited and therefore the desired deacylated LPS molecule of Neisseria meningitidis and Mannheimia haemolytica would not be effectively produced utilising the current methodologies.
As illustrated herein it was therefore unexpected that even though Dictyostelium discoideum could not grow directly on Neisseria meningitidis and Mannheimia haemolytica, enzymes produced by Dictyostelium discoideum were capable of degrading the purified derivatives of Neisseria meningitidis and Mannheimia haemolytica LPS that we provided as substrates with the required specificity.
The enzymes disclosed herein have specific activity on residues in the lipid A region of the LPS molecule as illustrated in
Dictyostelium discoideum acts on the Lipid A region of the LPS in a sequential manner initially utilising esterases to remove the ester linked fatty acids and then FAAI uses this O-deacylated substrate to remove the N-linked fatty acid from the GlcN-I residue and then in turn, FAAII utilises the FAAI product as its substrate to remove the N-linked fatty acid from the GlcN-II residue. All these degradative enzymatic processes are specific and do not cause any modifications to the remainder of the LPS molecule. We prepare LPS-OH, now only containing the amide linked fatty acids, and add this to the supernatant following incubation of Dictyostelium discoideum cells with killed Klebsiella aerogenes cells. Klebsiella aerogenes is the bacteria most commonly used as the substrate for growth of Dictyostelium discoideum used in the art. Incubation of the supernatant with the LPS-OH for 16 h at 22° C. and subsequent purification, as detailed in the examples, provides de-N-acylated molecules which are readily amenable to the subsequent manipulations of our conjugation strategies and most importantly contain the conserved core oligosaccharide region with no alterations to its structure. Without the enzymatic removal of the N-linked fatty acid(s) an amphiphillic molecule remains which is difficult to manipulate and produce glycoconjugates from.
In an embodiment of the invention there are provided amino acid sequences for the two fatty acid amidases produced by Dictyostelium discoideum (
In an embodiment of the invention there are provided nucleic acid sequences deduced from the amino acid sequences as set forth in SEQ ID No. 1 or SEQ ID No. 2, the two fatty acid amidases produced by Dictyostelium discoideum. The genomic sequences are shown in
In an embodiment of the invention there is provided a method to utilise the isolated amidase activity on the isolated O-deacylated LPS to produce molecules (
In an embodiment of the invention there is provided an LPS-derived product obtainable by activity of at least one of the amino acid sequence described above, and uses thereof as antigens and in the manufacture of vaccines.
In an embodiment of the invention there is provided a modified lipopolysaccharide (“LPS”) molecule wherein at least one N-linked fatty acid has been removed without modification of antigenic residues in the inner core. The chemically O-deacylated and enzymatically N-deacylated molecules exemplary examples of which are shown in
In an embodiment of the invention there is provided a modified LPS molecule above wherein at least the glycosidic phosphate group from the lipid A has also been removed.
In an embodiment of the invention there is provided a modified LPS molecule substantially free of fatty acids linked to the Lipid A region and having a linker attached to an aldehydro group. The aldehydro group will preferably have been made available by removal of a phosphate group. The generation of the aldehydro group creates a specific functionality available for conjugation away from the antigenic epitopes of the core oligosaccharide.
In some scenarios the carbohydrate molecule may be linked to a carrier protein via a linker molecule. The linker molecule may be but is not restricted to squarate, cystamine, N-succinimidyl 3-maleimidopropionate, adipic acid dihydrazide, ε-aminohexanoic acid, chlorohexanol dimethyl acetal, D-glucuronolactone and p-nitrophenylamine. As will be apparent to one of skill in the art, other suitable linker molecules may be used.
In one embodiment cystamine is chosen as the linker as it terminates with a thiol moiety which would facilitate conjugation via sulphur chemistry and therefore not involve any of the amino groups in the carbohydrate molecule, modification of which would alter antigenic epitopes in the derived glycoconjugate.
This carrier protein may be but is not restricted to CRM197, tetanus toxoid (TT), diphtheria toxoid, HSA, BSA, detoxified P. aeruginosa toxin A, cholera toxin/toxoid, pertussis toxin/toxoid, Clostridium perfringens exotoxins/toxoid, hepatitis B surface antigen, hepatitis B core antigen, rotavirus VP 7 protein, N19 polyepitope, respiratory syncytial virus F and G proteins. As will be apparent to one skilled in the art, other suitable carrier proteins may be used.
In some cases the carrier protein may be activated. Activating agents include but are not restricted to 3,3′-Dithiodipropionic acid di-N-hydroxysuccinimide ester (DTSP) and N-succinimidyl-bromo-acetate. As will be apparent to one skilled in the art, other suitable activating agents may be used.
In an embodiment of the invention there is provided a method of inducing an immune response in a mammal comprising administering an antigen comprising a modified LPS molecule substantially free of fatty acids linked to the Lipid A region.
The glycoconjugate is then administered to a mammal in the presence of an adjuvant. The adjuvants to be utilised include but are not restricted to alum, MF59 (squalene) and archaeosomes. As will be apparent to one skilled in the art, other suitable adjuvants may be used.
Bacterial species and the diseases they cause that could be targeted by such a strategy could include, but are not restricted to Neisseria meningitidis (meningitis), Haemophilus influenzae (otitis media), Mannheimia haemolytica (ovine and bovine pneumonic pasteurellosis (shipping fever) and ovine septicemia), Actinobacillus pleuropneumoniae (porcine fibrinohemorrhagic necrotizing pleuropneumoniae) and Pasteurella multocida (avian fowl cholera, bovine hemorrhagic septicemia, porcine atrophic rhinitis). Antibodies generated to the immunising glycoconjugate would be T-cell dependent and have immunological memory, so that when the antibody specific bacterial antigen is exposed to the immune system a rapid antibody response would facilitate recognition and killing of the foreign antigen.
The invention will now be illustrated by way of examples. However, it is to be understood that the examples are for illustrative purposes and are not necessarily limiting.
Several Gram-negative bacteria were grown on chocolate agar and SM media plates and Dictyostelium discoideum was seeded in the corner of each plate and incubated at 22° C. in order to observe if the bacterial culture could support growth of Dictyostelium. As Table 1 shows Neisseria meningitidis, whether capsulated or non-capsulated and Mannheimia haemolytica were unable to support growth whereas Klebsiella aerogenes and Haemophilus influenzae were able to support growth.
Neisseria meningitidis L3 galE
Neisseria meningitidis L3 capsulated
Neisseria meningitidis L3 non-capsulated
Haemophilus influenzae 1003 lic1 IpsA
Haemophilus influenzae 1003 lic1 Ipt6
Haemophilus influenzae 162
Mannheimia haemolytica losB
Klebsiella aerogenes
1+++, excellent growth; ++, growth; +, poor growth; −, no growth; * no bacterial growth on this media.
Two fatty acid amidases were identified from the Dictyostelium discoideum genome (
The genomic DNA sequences for the two genes are as shown in
Gene Dd1 was obtained by PCR using genomic DNA of Dictyostelium as template. Gene specific primers used were
NRC 191 and NRC 192 introduce restriction sites XhoI at the 5′ end and SalI at the 3′ end respectively of the Dd I gene. The restriction sites were designed for cloning the Dd I gene into the protein expression vector pNRC71. The PCR conditions used to amplify the Dd1 gene were as follows: —
For 25 cycles with a final extension step for 10 min at 68° C. The PCR product obtained with the above set of primers was cloned into the pCR2.1 plasmid (TA cloning kit, Invitrogen) and transformed into E. coli strain TOP10F′ (Invitrogen). The right clones obtained with Dd1 gene insert were restricted with XhoI/SalI and cloned into the protein expression vector pNRC71 (which encode maltose binding protein (MBP)-6× His- thrombin cleavage site at the N-terminus of the fusion protein) and transformed into E. coli strain BL21 cells (Novagen). The recombinant Dd 1 protein expressed as MBP-6× His fusion protein (
Cloning and expression of Dd1(Δ1-11) MBP fusion protein.
As the full length recombinant Dd1—MBP fusion protein was expressed as an insoluble protein in E. coli inclusion bodies, which required additional solubilization procedures to extract the protein, another alternative approach producing a truncated Dd1—MBP fusion protein lacking the first 11 amino acid was adopted. Truncated Dd1 protein which lacked the first 11 amino acids at the N-terminus was cloned as MBP-6×His fusion protein. Gene specific primers NRC197 (5′CTCGAGAAATCATTTTAGATGGAAAA3′) (SEQ ID No. 7) and NRC 198 (5′GTCGACTTATTTTAAATTTTTGGTGT3′) (SEQ ID No. 8) were used to PCR amplify the gene using genomic DNA of Dictyostelium as template. The PCR conditions used was same as the above used to amplify full length Dd1 gene. NRC 197 and NRC 198 introduce restriction sites XhoI at the 5′ end and SalI at the 3′ end respectively of the Dd I gene. The restriction sites were designed for cloning the Dd I gene into the protein expression vector pNRC71.
The obtained recombinant protein was purified by amylose resin affinity chromatography using BioLogic chromatography system from BioRad. The purified fusion protein which contains MBP and a 6×His tag at the N-terminus was proteolytically digested with thrombin. The thrombin cleaved MBP protein containing the 6×His tag was removed by passing on to a Ni-NTA column by affinity chromatography. The flow through collected contained pure Δ1-11 Dd1 protein. The over expressed recombinant protein was confirmed by Western blot analysis using anti polyhistidine antibody (Sigma) (
Dictyostelium cells grown utilizing Klebsiella aerogenes as food source were harvested and used to isolate RNA. Total RNA from Dictyostelium cells was isolated using RNeasy Midi kit (Qiagen). The RNA isolated was quantitated and 2 μg of RNA was used in the Reverse-Transcription reaction. The Gene specific primer NRC 190 (5′ GTCGACTTAGTTATTTGGGTTTGTGCTTTTG) (SEQ ID No. 9) was used in the Reverse Transcription reaction to obtain the cDNA. The cDNA obtained was used as the template in the subsequent PCR to amplify Dd2 gene using gene specific primers NRC189 (5′CATATGCACCACCATCATCACCACACATCTTCTTCATTTGTAAAAGTAGTA G 3′) (SEQ ID No. 10) and NRC190. NRC 189 introduces restriction site NdeI as well as 6×HIS tag at the 5′ end and NRC 190 introduces SalI at the 3′ end of the Dd2 gene. The PCR product obtained using the above set of primers was cloned into the pCR2.1 plasmid (TA cloning kit, Invitrogen) and transformed into E. coli TOP10F′ (Invitrogen). The right clones obtained with the His6-Dd2 insert were restriction digested with NdeI/SalI and cloned into pCW-MaIET vector, which encodes MBP-Thrombin cleavage site at the N-terminus of Dd2 protein. The recombinant Dd 2 protein expressed as MBP-6×His fusion protein (
The enzymatic activity of the fatty acid amidase homologues Dd 1 and Dd 2 were established by using synthetic substrate arachidonoyl p-nitroaniline (Cayman chemical, USA) (
The enzyme activity using synthetic substrate was determined by monitoring the release of p-nitroaniline at 382 nm (E=13500m−1 cm−1) on a UV—visible spectrophotometer. The amidase activity of Dd1 and Dd2 was confirmed by initiating the reaction by adding 100 ul of recombinant proteins Dd1 or 2 (1 mg/ml in 20 mM Tris pH 7.4) to 160 ul of reaction buffer (125 mM Tris pH8.0 and 1 mMEDTA) followed by the addition of 20 ul of substrate (10 mg/ml in 75% DMSO). Recombinantly expressed Dd1 and Dd2 both caused release of p-nitroaniline as revealed by formation of a yellow colour on reaction with the synthetic substrate.
Polyclonal antiserum (NRC-Dd2) was raised against recombinant Dd2 protein expressed in E. coli. The recombinant protein expressed as MBP-6×His fusion protein was purified by amylose resin affinity chromatography. MBP present at the N terminus of the purified protein was removed by cleavage with thrombin. The protein free from MBP was separated by passing on to a Ni-NTA column and the pure protein obtained was used to immunize New Zealand white rabbits (100g per immunisation at day 0, 14 and 28). The polyclonal antisera obtained recognized a 70 kDa protein in Dictyostelium cell lysates, which is the expected size of the translated protein (
More specifically the antisera was also able to pull down the 70 kDa in vivo protein from amidase active purified supernatant from Dictyostelium cell lysates by immunoprecipitation. The immunoprecipitated protein sequence was confirmed as the 70 kDa amidase by MALDI-TOF MS amino acid sequence analysis following excision and tryptic digestion of the specific band from a Coomassie stained gel (
Because Dd1 and Dd2 are eukaryotic enzymes, which when over expressed in E. coli may not be optimally functional due to the necessity of post-translational modification or any other activating factors present in the host for complete activity, Dictyostelium discoideum over-expression vectors to express Dd1 and Dd2 in Dictyostelium discoideum itself are preferably utilised. Gene Dd1 was obtained by PCR using genomic DNA of Dictyostelium as template. Gene specific primers used were
NRC 193 and 194 introduce restriction sites EcoRI at the 5′ end and HindIII at the 3′ end respectively of the Dd I gene. The restriction sites were designed for cloning the Dd1 gene into the Dictyostelium protein expression vector pDEXRH. Gene Dd2 was PCR amplified using Dd2 cDNA obtained by reverse transcription reaction of mRNA from Dictyostelium cells using gene specific primer NRC 190 (5′ GTCGACTTAGTTATTTGGGTTTGTGCTTTTG3′) (SEQ ID No. 9). For PCR amplification primers NRC195 (5′ AAGCTTATGACATCTTCTTCATTTGTAAAAGTAG3′) (SEQ ID No. 13) and NRC196 (5′MGCTTTTAGTGATGATGGTGATGATGGTTATTTGGGTTTGTGCCTTTTGTT 3′) (SEQ ID No. 14) were used. NRC195 and 196 introduce restriction sites HindIII both at the 5′ end and 3′ end of the gene, which enables to clone Dd2 gene in pDEXRH vector at HindIII site. Both Dd1 and Dd2 genes were cloned in Dictyostelium protein expression pDEXRH vector and transformed into Dictyostelium. The expression level of the recombinant protein is very low. Alternatively, Dd1 and Dd2 are also cloned with a 6×His tag at the N-terminus in pVS4 vector. An advantage of using Dictyostelium discoideum pVS4 vector is that it encodes a cleavable secretary signal peptide at the N-terminus of the fusion protein. By this method the over-expressed protein that is secreted in the culture medium is readily purified using Ni-NTA affinity chromatography.
Dictyostelium discoideum was grown to logarithmic phase (3×106 cells/ml) in liquid AX2 media (pH 6.7; 7.15 g/l yeast extract, 14.3 g/l peptone, 18.6 g/1 maltose, 0.486 g/l KH2PO4, 0.616 g/l Na2HPO4.2H2O). The cells were harvested and washed 2× with PBS and immediately suspended in PBS with phenol-killed and PBS washed cells of Klebsiella aerogenes to continue their growth, now utilising Klebsiella aerogenes as a food source with O-deacylated LPS (LPS-OH) supplied as an additional substrate.
When Dictyostelium discoideum was allowed to grow in the presence of Klebsiella aerogenes for 24 h, it was expected to produce amidase activity. The ratio of the number of bacterial cells and Dictyostelium discoideum cells that optimised N-deacylation of the purified LPS-OH substrate was standardised to 1×1011 vs. 5×107 cells/ml respectively.
Therefore to utilise these enzymes during growth of Dictyostelium discoideum, LPS-OH isolated from the Gram-negative bacterium Neisseria meningitidis immunotype L3 galE mutant was added to the Klebsiella aerogenes/Dictyostelium discoideum mixture.
The expected products following Neisseria meningitidis L3 galE LPS-OH incubation with the supernatant from growth of Dictyostelium discoideum and Klebsiella aerogenes are detailed in
In some instances it will be preferable to retain the second N-linked fatty acid, although the structure lacking this second fatty acid may still be desired in some situations. For use in preparing a vaccine, the structure containing the second fatty acid may be preferred.
Following 24 h incubation of Neisseria meningitidis L3 galE LPS-OH to the suspension of Dictyostelium discoideum and Klebsiella aerogenes at 22° C. with agitation, the cells were pelleted and the supernatant was lyophilised and examined by CE-ES-MS (
The doubly charged ion at m/z 1018.72− and the triply charged ion at 678.93-corresponds to a molecular weight of 2039.4 amu consistent with the composition 2GlcN, 1 FA, 2P, 2 Kdo, 2Hep, GlcNAc, PEtn as illustrated in the schematic above. The doubly charged ion at m/z 905.42− corresponds to the loss of the second fatty acid residue from the lipid A region.
The product from exposure of Neisseria meningitidis L3 galE LPS-OH to the Dictyostelium discoideum I Klebsiella aerogenes suspension therefore has a molecular weight of at least 225 amu smaller than the LPS-OH substrate. This is consistent with the absence of a N-linked fatty acid (3-hydroxy myristic acid) from the lipid A region of the molecule.
This was confirmed by a tandem mass spectrometry technique, which can specifically fragment selected ions from the primary mass spectrum. The nature of LPS-OH and derived molecules is such that fragmentation is enhanced between the lipid A region and the core oligosaccharide molecule, with the size of the fragmented lipid A region being indicated in the resulting mass spectrum. In this way one can compare the size of the lipid A region from intact LPS-OH to that of the product from LPS-OH exposure to the Dictyostelium discoideum/Klebsiella aerogenes suspension.
As
However, MS/MS analysis of the doubly charged ion at m/z 1018.72− from the Dictyostelium discoideum/Klebsiella aerogenes exposed LPS-OH molecule (
This mono-acylated molecule can be exploited for the development of glycoconjugates or utilised as a substrate for the second amidase FAAII. This method to induce Dictyostelium discoideum to produce the FAAI activity has been reproducibly produced with several purified LPS-OH molecules from different species including Haemophilus influenzae (
Alternatively amidase activity was isolated directly from starved Dictyostelium cells. It is well known that Dictyostelium secretes various factors to survive conditions of starvation, and we have observed that it also secretes amidases during starvation.
We used this secreted amidase to N-deacylate LPS-OH. To utilise the amidase secreted during starvation of Dictyostelium, 5×107 cells/ml were starved for 16 hrs in Sorensen's buffer (2 mM Na2HPO4.2H2O and 14.6 mM KH2PO4, pH 6.0) and the supernatant containing the secreted enzymes was collected by spinning down the cells at 2000 rpm for 2 min and the supernatant was incubated with the substrate LPS-OH (1 mg/ml), and the de-N-acylated product was isolated and identified by CE-MS from the Gram-negative bacteria Neisseria meningitidis immunotype L3 galE mutant (
Glycoconjugates with O-deacylated LPS and completely deacylated LPS derived from Neisseria meningitidis were produced in previous studies from our group [Cox et al, 2005]. The studies with O-deacylated LPS illustrated the proof-in-principle of using LPS derived glycoconjugates to induce a protective immune response against meningococcal disease; however, due to the hydrophobic nature of the O-deacylated LPS these conjugates were difficult to construct and characterise. Subsequently glycoconjugates were produced with completely deacylated LPS which were much more amenable to the manipulations involved in the production of the glycoconjugate, but did not contain crucial immunogenic epitopes in the core oligosaccharide due to losses during the harsh chemical conditions utilised to completely deacylate the LPS molecule. For this reason conjugates derived by this latter method did not induce a protective immune response to the majority of wild-type strains. A new strategy was therefore adopted which involves enzymic removal of the at least one N-linked fatty acid with the FAAI enzyme from Dictyostelium discoideum which enables retention of the immunogenic core oligosaccharide epitopes in a water-soluble molecule that is amenable to the several manipulations involved in conjugate production (
LPS was prepared from Neisseria meningitidis strain MC58 (#5) immunotype L3 galE mutant by standard methods. This LPS was then O-deacylated to produce LPS-OH by treatment at 37° C. with anhydrous hydrazine for 1 h. LPS-OH was quality controlled by sugar analysis and CE-ES-MS (
Dictyostelium discoideum cells were prepared as described above and added in the appropriate ratio to killed Klebsiella aerogenes cells as described above. LPS-OH was added to this suspension and left at 22° C. for 24 h. The suspension was pelleted by centrifugation at 10,000g and the supernatant was purified on a spin column (Amicon) with a 10 kDa cut off membrane. Two water washes were also collected. The flow through material was then lyophilised, re-dissolved in water and applied to a Sephadex G-25 column and eluted with water. The resulting carbohydrate fractions were pooled and lyophilised. The resulting material was examined by CE-ES-MS (
A well-resolved spectrum was obtained consistent with a water-soluble molecule being produced following removal of at least one N-linked fatty acid. Examination of the anomeric region of the 1H-NMR spectrum reinforces this (
˜38 mg of Dictyostelium discoideum treated LPS-OH was treated with recombinant alk. P (Roche; 700 U/ml at t=0, 700 U/ml at t=6h) for 30 h at 37° C. in order to remove the mono-phosphate esters as illustrated in
The mixture was boiled to denature the phosphatase and centrifuged (10,000g, 15 min.) and the supernatant was applied to a Sephadex G-25 column and eluted with water. The resulting carbohydrate fractions were pooled and lyophilised. The resulting material was examined by CE-ES-MS (
The doubly charged ion at m/z 1018.72- for the mono-N-acylated substrate has clearly lost either one or two phosphate residues. The completely deacylated substrate has lost both phosphate residues to give the doubly charged ion m/z 825.52−.
In order to link the Nm galE Dictyostelium discoideum/alkP product to a carrier protein to construct the glycoconjugate it was necessary to attach a linker molecule. Cystamine was used for this purpose, as this linker utilises sulphur chemistry to attach to the carrier protein and does not involve utilising amino groups so that the potentially immunogenic phosphoethanolamine moiety would not be modified during the conjugation reaction. In order to ensure that the cystamine linker is attached to the aldehydro group created by the alkaline phosphatase treatment and avoid cross-linking of the carbohydrate molecules a large excess of cystamine was reacted with the carbohydrate moiety, according to
˜25 mg of the Neisseria meningitidis galE Dicty/alkP product was reacted with a 30× molar excess of cystamine at 37° C. for 72 h in a solution of 0.1 M NaHCO3, pH 8.4. The reaction mixture was then applied to a Sephadex G-25 column and eluted with water. The resulting carbohydrate fractions were pooled and lyophilised. The resulting material was reduced with 200 mM DTT in 0.1M NaHPO4 at pH 8.1 for 1 h at room temperature. The reaction mixture was then applied to a Sephadex G-25 column and eluted with water. The resulting carbohydrate fractions were pooled and lyophilised and examined by CE-ES-MS (
The doubly charged ion at m/z 1046.72− and the triply charged ion at m/z 697.53− are consistent with the addition of the cystamine to the carbohydrate molecule.
In order to conjugate the protein carrier molecule CRM197 to the cystamine-tagged carbohydrate it was necessary to modify the amino groups on the CRM197 protein by treatment with N-succinimidyl-bromo-acetate. This was achieved by mixing CRM197 (30 mg) in 0.1 M NaHPO4, 1 mM EDTA, 0.02% sodium azide, pH 7.1 cooled to 4° C., with N-succinimidyl-bromo-acetate (22 mg in 100 μl DMF) at room temperature for 2.0h. The reaction mixture was then applied to a Sephadex G-25 column and eluted with 0.1 M NaHPO4, 5 mM EDTA, 0.02% sodium azide, pH 6.0 and stored at 4° C. until used. As shown in the two MALDI spectra (
In order to conjugate the cystamine-tagged carbohydrate molecule to the activated protein carrier 15 mg of activated CRM197 was added to ˜18 mg of carbohydrate and left at room temperature for 17 h as illustrated in
The reaction was cooled to 4° C. and then an excess of cysteine (˜50 mg) was added in order to cap any free bromo-acetate groups that may be remaining following the conjugation reaction.
The reaction mixture was then purified on a Sepharose 6B column eluting in PBS/10 mM citrate. The material was concentrated on an ultra-15 spin column and quantified for protein and carbohydrate giving a ratio of ˜11 CHO molecules per protein.
The conjugate was examined by SDS-PAGE (
The glycoconjugate was used to immunise four rabbits (3 injections of 50 pg of conjugated carbohydrate per injection three weeks apart) and the immune response monitored by LPS ELISA for strength and degree of cross-reactivity, as illustrated in
The sera was examined for functional activity in a bactericidal assay and illustrated efficient killing of the homologous strain and some killing of the wt strain when compared to the corresponding pre-immune sera (
Standard mutagenesis strategies are adopted to make FAAHI and FAAHII independent knockout mutants. The mutant is used in specific N-deacylation reactions of LPS-OH from Gram-negative bacteria when grown vegetatively, which guarantee the removal of specific fatty acid to create a defined mono-acylated molecule.
Neomycin resistance gene cassette or Blasticidin resistance gene cassette is introduced at the SspI site of Dd1 gene cloned in pCR2.1 vector (Invitrogen), the recombinant DNA obtained is transformed into Dictyostelium to generate knockout cells by homologous recombination.
Neomycin resistance gene cassette or Blasticidin resistance gene cassette is introduced at the EcoRV site of Dd2 gene cloned in pCR2.1 vector (Invitrogen), the recombinant DNA obtained is transformed into Dictyostelium to generate knockout cells by homologous recombination.
While the preferred embodiments of the invention have been described above, it will be recognized and understood that various modifications may be made therein, and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention.
Cox, A. D. et al Vaccine, 2005, 23, 5045-5054
This application claims the benefit of U.S. Provisional Patent Application 60/738,985, filed Nov. 23, 2005.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CA2006/001927 | 11/23/2006 | WO | 00 | 7/31/2008 |
| Number | Date | Country | |
|---|---|---|---|
| 60738985 | Nov 2005 | US |