BCMP84 protein, compositions, diagnostic and therapeutic uses thereof

Information

  • Patent Application
  • 20040053830
  • Publication Number
    20040053830
  • Date Filed
    March 06, 2003
    21 years ago
  • Date Published
    March 18, 2004
    20 years ago
Abstract
The present invention relates to the use of a protein (BCMP84) isolated from breast cancer cell line membrane preparations, compositions comprising the protein, including vaccines, and antibodies which are immunospecific for the protein in the diagnosis, treatment and/or prophylaxis of breast, bladder and/or tonsil cancer.
Description


BACKGROUND OF THE INVENTION

[0002] 1. Field of the Invention


[0003] The present invention relates to the use of a protein (BCMP84) isolated from breast cancer cell line membrane preparations, compositions comprising the protein, including vaccines, and antibodies which are immunospecific for the protein in the diagnosis, treatment and/or prophylaxis of breast, bladder and/or tonsil cancer.


[0004] 2. Description of the Related Art


[0005] Breast cancer is the most frequently diagnosed cancer in women. The implementation of screening programs for the early detection of breast cancer, and the advent of anti-cancer treatments, such as chemotherapy, radiotherapy and anti-estrogen therapies, to augment surgical resection have improved the survival of breast cancer patients.


[0006] However, some breast tumors become refractory to such treatments, as the cancer cells develop resistance to chemotherapy drugs or lose their hormone sensitivity, leading to recurrent or metastatic disease which is often incurable. More recently, attention has focused on the development of immunological therapies (Green, M. C., Murray, J. L. & Hortobagyi, G. N. Monoclonal antibody therapy for solid tumors. Cancer Treat. Rev. 26, 269-286 (2000); Davis, I. D. An overview of cancer immunotherapy. Immunol. Cell Biol. 78, 179-195 (2000); Knuth, A. Jager, D. & Jager, E. Cancer immunotherapy in clinical oncology. Cancer Chemother Pharmacol. 46, S46-51 (2000); Shiku, H., Wang, L., Ikuta, Y., Okugawa, T., Schmitt, M., Gu, X., Akiyoshi, K., Sunamoto, J. & Nakamura, H. Development of a cancer vaccine: peptides, proteins and DNA. Cancer Chemother. Pharmacol. 46, S77-82 (2000); Saffran, D. C., Reiter, R. E., Jakobovits, A. & Witte, O. N. Target antigens for prostate cancer immunotherapy. Cancer Metastasis Rev. 18, 437-449 (1999)), such as cancer vaccines and monoclonal antibodies (mAbs), as a means of initiating and targeting a host immune response against tumor cells. In 1998 the FDA approved the use of Herceptin (Stebbing, J., Copson, E. & O'Reilly, S. Herceptin (trastuzamab) in advanced breast cancer. Cancer Treat. Rev. 26, 287-290 (2000); Dillman, R. O. Perceptions of Herceptin: a monoclonal antibody for the treatment of breast cancer. Cancer Biother. Radiopharm. 14, 5-10 (1999); Miller, K. D. & Sledge, G. W. Toward checkmate: biology and breast cancer therapy for the new millennium. Invest. New Drugs 17, 417-427 (1999)), a mAb that recognizes the erbB2/HER2-neu receptor protein, as a treatment for metastatic breast cancer. In combination with chemotherapy, Herceptin has been shown to prolong the time to disease progression, when compared to patients receiving chemotherapy alone (Baselga, J., Norton, L., Albanell, J., Kim, Y.-M. & Mendelsohn, J. Recombinant humanized anti-HER2 antibody (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res. 58, 2825-2831 (1998)). However, Herceptin is only effective in treating the 10-20% of patients whose tumours over-express the erbB2 protein. Thus, the identification of other suitable targets or antigens for immunotherapy of breast, bladder and tonsil cancer has become increasingly important.


[0007] An ideal protein target for cancer immunotherapy should have a restricted expression profile in normal tissues and be over-expressed in tumors, such that the immune response will be targeted to tumor cells and not against other organs. In addition, the protein target should be exposed on the cell surface, where it will be accessible to therapeutic agents. Tumor antigens have been identified for a number of cancer types, by using techniques such as differential screening of cDNA (Hubert, R. S., et. al., STEAP: a prostate-specific cell-surface antigen highly expressed in human prostate tumors. Proc. Natl. Acad, Sci. USA 96, 14523-14528 (1999); Lucas, S., et al., MAGE-B5, MAGE-B6, MAGE-C2 and MAGE-C3: four new members of the MAGE family with tumor-specific expression. Int. J. Cancer 87, 55-60 (2000)), and the purification of cell-surface antigens that are recognized by tumor-specific antibodies (Catimel, B., et. al., Purification and characterization of a novel restricted antigen expressed by normal and transformed human colonic epithelium. J. Biol. Chem. 271, 25664-25670 (1996)). More recently, DNA ‘chips’ containing up to 10,000 expressed sequence elements have been used to characterise tumour cell gene expression (Dhanasekaran, S. M., et al., 2001, Nature 412, 822-826). However, there are several reasons why the numerous and extensive previous transcriptomic analysis of breast, bladder and tonsil cancer may not have revealed all, or even most, tumour associated proteins. These include; (i) a lack of correlation between transcript and disease-associated protein levels, particularly common for membrane proteins that often have a long half-life and as such do not have a high mRNA turnover. Therefore, whilst the difference in protein levels between normal and cancerous cells are consistent it is often difficult to associate changes in the mRNA for a given membrane protein with the cancerous state. (ii) Translocation of a protein in the disease state rather than simply differential levels of the transcript, for example, erbB2/HER2-neu, shows much greater plasma-membrane localisation in cancer cells than normal breast cells, and the transcription factors oestrogen receptor and STAT3 translocate to the nucleus to exert their tumorigenic effects. (iii) Novel/uncharacterised genes are not highly represented within the ‘closed system’ of a cDNA array where there are restrictions on the number of expressed sequence elements per chip and the knowledge and availability of DNA clones.


[0008] As an alternative approach to identifying tumor antigens and as set forth in parent application Ser. No. 09/791,392 incorporated in its entirety herein, we have used proteomics to characterize the complement of proteins in cell membranes isolated from the breast cancer cell line MDA-MB-468. In this way, we have identified a protein, designated BCMP84 (GenBank accession code: AAGO1893) which was purified from MDA-MB-468 cell membranes, purified by 1 D electrophoresis and characterized by mass spectrometry before being cloned. BCMP-84 shows restricted expression to a few tissues, with elevated expression in some breast tumors, breast cancer cell lines and tumor tissues, including bladder and tonsil tumor tissues, suggesting that it may be a suitable target for therapy and diagnosis of breast, lung and/or tonsil cancer.


[0009] BCMP84 is a 104-amino acid protein with an S-100/IcaBP-type calcium binding domain (amino acids 18 to 60) with an apparent MW 13.6 of kDa.


[0010] The proteomics approach undertaken in this study has revealed the association of BCMP84 protein with breast, bladder and tonsil cancer. As set forth herein, it is now demonstrated that this association with carcinoma cells is not simply due to an up-regulation of protein expression but is also via the translocation of the protein to the malignant cell plasma membrane.


[0011] Also, and as demonstrated herein in accordance with the present invention, it has been found that BCMP84 is localised to the plasma membrane in breast cancer derived cell lines. Furthermore, BCMP84 expression shows a statistically significant correlation with oestrogen receptor negative breast tumours. The expression of BCMP84 in bladder and tonsil carcinomas has also been investigated. In well-differentiated tumour cells BCMP84 is translocated from the cell cytoplasm (where it is observed in normal tissues) to the plasma membrane. These findings suggest that BCMP84 may be a suitable target for therapy and diagnosis of breast, bladder and tonsil cancer, and thereby support the corresponding aspect of the present invention.


[0012] WO99/47669 disclosed a large number of sequences derived from an EST database. These included a sequence, identified as sequence ID 17, which corresponds to BCMP84 as discussed herein. However, this disclosure did not provide any isolated protein, nor did it identify BCMP84 as being localized to the peripheral membrane and therefore particularly useful in an immunotherapeutic approach to breast, bladder and/or tonsil cancer. The sequence was indicated as equivalent to any of the other 70 or so sequences identified, from a computer database, as being more highly expressed in breast, bladder or tonsil cancer tissue.



SUMMARY OF THE INVENTION

[0013] Thus, in a first aspect, the present invention provides a substantially pure, isolated or recombinant polypeptide which is selected from the group consisting of:


[0014] a) the amino acid sequence comprising or consisting of the sequence as shown in FIG. 1 (SEQ ID NO: 2);


[0015] b) a derivative having one or more amino acid substitutions, modification, deletions or insertions relative to the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2); and


[0016] c) a fragment of a polypeptide as defined in a) or b) above, which is at least ten amino acids long.


[0017] The term “polypeptides” includes peptides, polypeptides and proteins. These are used interchangeably unless otherwise specified. Polypeptides of the present invention are in isolated or recombinant form, and may be fused to other moieties. In particular, fusions of the BCMP84 polypeptides with localisation-reporter proteins such as the Green Fluorescent Protein (U.S. Pat. Nos. 5,625,048; 5,777,079; 6,054,321 and 5,804,387) or the DsRed fluorescent protein (Matz, M. V., et al., (1999). Fluorescent proteins from nonbioluminescent Anthozoa species (Nature Biotech. 1999, 17:969-973) are specifically contemplated by the present invention.


[0018] They are provided in substantially pure form, that is to say, they are free, to a substantial extent, from other proteins. Thus, a polypeptide of the present invention may be provided in a composition in which it is the predominant component present (i.e. it is present at a level of at least 50%; preferably at least 75%, at least 80%, at least 85%, at least 90%, at least 95%; or at least 98% when determined on a weight/weight basis excluding solvents or carriers).


[0019] In further aspects of the invention, the polypeptides of the invention, derivatives and fragments thereof, antibodies thereto, and agonists and antagonists thereof, may be used as part of diagnostic assays including screening assays, to identify the presence or instances of e.g. breast, bladder and/or tonsil cancer in a patient, as well as to identify other agents that may serve in like capacity, as either diagnostic or possibly therapeutic agents for the treatment of such diseases., all as more fully described and illustrated herein.


[0020] Accordingly, the present invention will be better understood from a consideration of the ensuing detailed description which proceeds with reference to the following drawing figures.







BRIEF DESCRIPTION OF THE DRAWINGS

[0021]
FIG. 1: shows the nucleotide (SEQ ID NO: 1) and predicted amino acid (SEQ ID NO: 2) sequences of BCMP84. The tandem mass spectrum is in bold and italicized. MALDI mass spectra are in bold and underlined;


[0022]
FIG. 2: shows tissue distribution of BCMP84 mRNA. Levels of mRNA in normal tissues and breast carcinoma cell lines were quantified by real time RT-PCR. mRNA levels are expressed as the number of copies ng−1 cDNA; and


[0023]
FIG. 3: shows the expression of BCMP84 in normal and tumor breast tissues. Levels of BCMP84 mRNA in matched normal and tumor tissues from seven breast cancer patients were measured by real time RT-PCR. mRNA levels are expressed as the number of copies ng−1 cDNA.







DETAILED DESCRIPTION

[0024] In order to more fully appreciate the present invention, polypeptides within the scope of a)-c) above will now be discussed in greater detail.


[0025] Polypeptides Within the Scope of a)


[0026] A polypeptide within the scope of a), may consist of the particular amino acid sequence given in FIG. 1 (SEQ ID NO: 2) or may have an additional N-terminal and/or an additional C-terminal amino acid sequence relative to the sequence given in FIG. 1 (SEQ ID NO: 2).


[0027] A BCMP84 polypeptide may be in the form of a ‘mature’ protein or may be part of a larger protein such as a fusion protein. Additional N-terminal or C-terminal sequences may be provided for various reasons. It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, a pre-, pro- or prepro-protein sequence, or a sequence which aids in identification or purification such as an affinity tag, for example, but without limitation, multiple histidine residues, a FLAG tag, HA tag or myc tag. Additional sequences can also be useful in altering the properties of a polypeptide to aid in identification or purification. For example, a fusion protein may be provided in which a polypeptide is linked to a moiety capable of being isolated by affinity chromatography. The moiety may be an antigen or an epitope and the affinity column may comprise immobilised antibodies or immobilised antibody fragments which bind to said antigen or epitope (desirably with a high degree of specificity). The fusion protein can usually be eluted from the column by addition of an appropriate buffer.


[0028] Techniques for providing such additional sequences are well known in the art. Additional sequences may be provided in order to alter the characteristics of a particular polypeptide. This can be useful in improving expression or regulation of expression in particular expression systems. For example, an additional sequence may provide some protection against proteolytic cleavage.


[0029] An additional sequence which may provide stability during recombinant production may also be used. Such sequences may be optionally removed as required by incorporating a cleavable sequence as an additional sequence or part thereof. Thus, a polypeptide may be fused to other moieties including other polypeptides. Such additional sequences and affinity tags are well known in the art. Additional N-terminal or C-terminal sequences may be provided for various reasons. Techniques for providing such additional sequences are well known in the art.


[0030] Additional sequences may be provided in order to alter the characteristics of a particular polypeptide. This can be useful in improving expression or regulation of expression in particular expression systems.


[0031] Additional N-terminal or C-terminal sequences may, however, be present simply as a result of a particular technique used to obtain a polypeptide of the present invention and need not provide any particular advantageous characteristic to the polypeptide of the present invention. Such polypeptide are within the scope of the present invention.


[0032] Whatever additional N-terminal or C-terminal sequence is present, it is preferred that the resultant polypeptide should exhibit the immunological activity of the polypeptide having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2).


[0033] Polypeptides Within the Scope of b)


[0034] Turning now to the polypeptides defined in b) above, it will be appreciated by the person skilled in the art that these polypeptides are derivatives of the polypeptide given in a) above, provided that such derivatives exhibit the immunological or biological activity of the polypeptide having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2).


[0035] Alterations in the amino acid sequence of a protein can occur which do not affect the function of a protein. These include amino acid deletions, insertions modifications and substitutions and can result from alternative splicing and/or the presence of multiple translation start sites and stop sites. Polymorphisms may arise as a result of the infidelity of the translation process. Thus changes in amino acid sequence may be tolerated which do not affect the protein's function.


[0036] Modifications include naturally occurring modifications such as, and without limitation, post-translational modifications and also non-naturally occurring modifications such as may be introduced by mutagenesis.


[0037] The skilled person will appreciate that various changes can often be made to the amino acid sequence of a polypeptide which has a particular activity to produce derivatives (sometimes known as variants or “muteins”) having at least a proportion of said activity, and preferably having a substantial proportion of said activity. Such derivatives of the polypeptides described in a) above are within the scope of the present invention and are discussed in greater detail below. They include allelic and non-allelic derivatives.


[0038] An example of a derivative of the present invention is a polypeptide as defined in a) above, apart from the substitution of one or more amino acids with one or more other amino acids. The skilled person is aware that various amino acids have similar properties. One or more such amino acids of a substance can often be substituted by one or more other such amino acids without eliminating a desired activity of that substance.


[0039] Thus, the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains). Of these possible substitutions, it is preferred that glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine and isoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic).


[0040] Other amino acids which can often be substituted for one another include:


[0041] phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains);


[0042] lysine, arginine and histidine (amino acids having basic side chains);


[0043] aspartate and glutamate (amino acids having acidic side chains);


[0044] asparagine and glutamine (amino acids having amide side chains); and


[0045] cysteine and methionine (amino acids having sulfur-containing side chains).


[0046] aspartic acid and glutamic acid can substitute for phospho-serine and phospho-threonine, respectively (amino acids with acidic side chains).


[0047] Substitutions of this nature are often referred to as “conservative” or “semi-conservative” amino acid substitutions.


[0048] In one particular embodiment the substituted amino acid(s) significantly affect the activity of the polypeptide and may be selected specifically to render dominant negative activity on the polypeptide. In another embodiment, the substituted amino acid(s) may be selected specifically to render the polypeptide constitutively active.


[0049] Amino acid deletions or insertions may also be made relative to the amino acid sequence given in a) above. Thus, for example, amino acids which do not have a substantial effect on the activity of the polypeptide, or at least which do not eliminate such activity, may be deleted. Such deletions can be advantageous since the overall length and the molecular weight of a polypeptide can be reduced whilst still retaining activity. This can enable the amount of polypeptide required for a particular purpose to be reduced—for example, dosage levels can be reduced.


[0050] Amino acid insertions relative to the sequence given in a) above can also be made. This may be done to alter the properties of a polypeptide of the present invention (e.g. to assist in identification, purification or expression, as explained above in relation to fusion proteins).


[0051] Amino acid changes relative to the sequence given in a) above can be made using any suitable technique e.g. by using site-directed mutagenesis (Hutchinson et al., 1978, J. Biol. Chem. 253:6551).


[0052] It should be appreciated that amino acid substitutions or insertions within the scope of the present invention can be made using naturally occurring or non-naturally occurring amino acids. Whether or not natural or synthetic amino acids are used, it is preferred that only L-amino acids are present.


[0053] Whatever amino acid changes are made (whether by means of substitution, insertion or deletion), preferred polypeptides of the present invention have at least 50% sequence identity with a polypeptide as defined in a) above, more preferably the degree of sequence identity is at least 75%. Sequence identities of at least 80%, at least 85%, at least 90%, at least 95% or at least 98% are most preferred.


[0054] The term identity can be used to describe the similarity between two polypeptide sequences. The degree of amino acid sequence identity can be calculated using a program such as “besffif” (Smith and Waterman, Advances in Applied Mathematics, 482-489 (1981)) to find the best segment of similarity between any two sequences. The alignment is based on maximising the score achieved using a matrix of amino acid similarities, such as that described by Schwarz and Dayhof (1979) Atlas of Protein Sequence and Structure, Dayhof, M. O., Ed pp 353-358.


[0055] A software package well known in the art for carrying out this procedure is the CLUSTAL program. It compares the amino acid sequences of two polypeptides and finds the optimal alignment by inserting spaces in either sequence as appropriate. The amino acid identity or similarity (identity plus conservation of amino acid type) for an optimal alignment can also be calculated using a software package such as BLASTx. This program aligns the largest stretch of similar sequence and assigns a value to the fit. For any one pattern comparison, several regions of similarity may be found, each having a different score. One skilled in the art will appreciate that two polypeptides of different lengths may be compared over the entire length of the longer fragment. Alternatively small regions may be compared. Normally sequences of the same length are compared for a useful comparison to be made.


[0056] Where high degrees of sequence identity are present there will be relatively few differences in amino acid sequence. Thus, for example there may be less than 20, less than 10, or even less than 5 differences.


[0057] Polypeptides Within the Scope of c)


[0058] As discussed supra, it is often advantageous to reduce the length of a polypeptide, provided that the resultant reduced length polypeptide still has a desired activity or can give rise to useful antibodies. Feature c) of the present invention therefore covers fragments of polypeptides a) or b) above.


[0059] The skilled person can determine whether or not a particular fragment has activity using the techniques disclosed above. Preferred fragments are at least 10 amino acids long. They may be at least 20, at least 50 or at least 100 amino acids long.


[0060] As will be discussed below, the polypeptides of the present invention will find use in a therapeutic approach to breast, bladder and/or tonsil cancer. The skilled person will appreciate that for the preparation of one or more polypeptides of the invention, the preferred approach will be based on recombinant DNA techniques. Thus, in a second aspect, the present invention provides an isolated or recombinant nucleic acid molecule which is selected from the group consisting of:


[0061] d) a DNA sequence comprising or consisting of the sequence as shown in FIG. 1 (SEQ ID NO: 1) or its RNA equivalent;


[0062] e) a sequence which is complementary to the sequences of d);


[0063] f) a sequence which codes for the same polypeptide, as the sequences of a) or b);


[0064] g) a sequence which shows substantial identity with any of those of a), b) and c);


[0065] h) a sequence which codes for a derivative or fragment of an amino acid molecule shown in FIG. 1 (SEQ ID NO:2); and


[0066] i) a fragment of d), e), f), g) or h) which is at least 5 nucleotides in length


[0067] These nucleic acid molecules are now discussed in greater detail.


[0068] The term identity can also be used to describe the similarity between two individual DNA sequences. The ‘bestfit’ program (Smith and Waterman, Advances in applied Mathematics, 482-489 (1981)) is one example of a type of computer software used to find the best segment of similarity between two nucleic acid sequences, whilst the GAP program enables sequences to be aligned along their whole length and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is preferred if sequences which show substantial identity with any of those of a), b) and c) have e.g. at least 50%, at least 75% or at least 90% or 95% sequence identity.


[0069] The polypeptides of the present invention can be coded for by a large variety of nucleic acid molecules, taking into account the well known degeneracy of the genetic code. All of these molecules are within the scope of the present invention. They can be inserted into vectors and cloned to provide large amounts of DNA or RNA for further study. Suitable vectors may be introduced into host cells to enable the expression of polypeptides of the present invention using techniques known to the person skilled in the art.


[0070] The term ‘RNA equivalent’ when used above indicates that a given RNA molecule has a sequence which is complementary to that of a given DNA molecule, allowing for the fact that in RNA ‘U’ replaces ‘T’ in the genetic code. The nucleic acid molecule may be in isolated, recombinant or chemically synthetic form.


[0071] Techniques for cloning, expressing and purifying proteins and polypeptides are well known to the skilled person. DNA constructs can readily be generated using methods well known in the art. These techniques are disclosed, for example in J. Sambrook et al., Molecular Cloning 2nd Edition, Cold Spring Harbour Laboratory Press (1989); in Old & Primrose Principles of Gene Manipulation 5th Edition, Blackwell Scientific Publications (1994); and in Stryer [Biochemistry 4th Edition, W H Freeman and Company (1995)]. Modifications of DNA constructs and the proteins expressed such as the addition of promoters, enhancers, signal sequences, leader sequences, translation start and stop signals and DNA stability controlling regions, or the addition of fusion partners may then be facilitated.


[0072] Normally the DNA construct will be inserted into a vector, which may be of phage or plasmid origin. Expression of the protein is achieved by the transformation or transfection of the vector into a host cell which may be of eukaryotic or prokaryotic origin. Such vectors and suitable host cells form third and fourth aspects of the present invention.


[0073] Knowledge of the nucleic acid structure can be used to raise antibodies and for gene therapy. Techniques for this are well-known by those skilled in the art.


[0074] By using appropriate expression systems, polypeptides of the present invention may be expressed in glycosylated or non-glycosylated form. Non-glycosylated forms can be produced by expression in prokaryotic hosts, such as E. coli.


[0075] Polypeptides comprising N-terminal methionine may be produced using certain expression systems, whilst in others the mature polypeptide will lack this residue.


[0076] Preferred techniques for cloning, expressing and purifying a polypeptide of the present invention are summarized below:


[0077] Polypeptides may be prepared natively or under denaturing conditions and then subsequently refolded. Baculoviral expression vectors include secretory plasmids (such as pACGP67 from Pharmingen), which may have an epitope tag sequence cloned in frame (e.g. myc, V5 or His) to aid detection and allow for subsequent purification of the protein. Mammalian expression vectors may include pCDNA3 and pSecTag (both Invitrogen), and pREP9 and pCEP4 (Invitrogen). E. coli systems include the pBad series (His tagged—Invitrogen) or pGex series (Pharmacia).


[0078] In addition to nucleic acid molecules coding for polypeptides according to the present invention, referred to herein as “coding” nucleic acid molecules, the present invention also includes nucleic acid molecules complementary thereto. Thus, for example, both strands of a double stranded nucleic acid molecule are included within the scope of the present invention (whether or not they are associated with one another). Also included are mRNA molecules and complementary DNA molecules (e.g. cDNA molecules).


[0079] Nucleic acid molecules which can hybridize to any of the nucleic acid molecules discussed above are also covered by the present invention. Such nucleic acid molecules are referred to herein as “hybridizing” nucleic acid molecules. Hybridizing nucleic acid molecules can be useful as probes or primers, for example.


[0080] Desirably such hybridizing molecules are at least 10 nucleotides in length and preferably are at least 25 or at least 50 nucleotides in length. The hybridizing nucleic acid molecules preferably hybridize to nucleic acids within the scope of d), e), f), g), h) or i) above specifically.


[0081] Desirably the hybridizing molecules will hybridize to such molecules under stringent hybridization conditions. One example of stringent hybridization conditions is where attempted hybridization is carried out at a temperature of from about 35° C. to about 65° C. using a salt solution which is about 0.9 molar. However, the skilled person will be able to vary such conditions as appropriate in order to take into account variables such as probe length, base composition, type of ions present, etc.


[0082] Manipulation of the DNA encoding the protein is a particularly powerful technique for both modifying proteins and for generating large quantities of protein for purification purposes. This may involve the use of PCR techniques to amplify a desired nucleic acid sequence. Thus the sequence data provided herein can be used to design primers for use in PCR so that a desired sequence can be targeted and then amplified to a high degree.


[0083] Typically primers will be at least five nucleotides long and will generally be at least ten nucleotides long (e.g. fifteen to twenty-five nucleotides long). In some cases, primers of at least thirty or at least thirty-five nucleotides in length may be used.


[0084] As a further alternative chemical synthesis may be used. This may be automated. Relatively short sequences may be chemically synthesized and ligated together to provide a longer sequence.


[0085] In addition to being used as primers and/or probes, hybridizing nucleic acid molecules of the present invention can be used as anti-sense molecules to alter the expression of substances of the present invention by binding to complementary nucleic acid molecules. This technique can be used in anti-sense therapy.


[0086] A hybridizing nucleic acid molecule of the present invention may have a high degree of sequence identity along its length with a nucleic acid molecule within the scope of d)-i) above (e.g. at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98% sequence identity). As will be appreciated by the skilled person, the higher the sequence identity a given single stranded nucleic acid molecule has with another nucleic acid molecule, the greater the likelihood that it will hybridize to a nucleic acid molecule which is complementary to that other nucleic acid molecule under appropriate conditions.


[0087] In view of the foregoing description the skilled person will appreciate that a large number of nucleic acids are within the scope of the present invention. Unless the context indicates otherwise, nucleic acid molecules of the present invention may have one or more of the following characteristics:


[0088] 1) they may be DNA or RNA;


[0089] 2) they may be single or double stranded;


[0090] 3) they may be provided in recombinant form, i.e. covalently linked to a 5′ and/or a 3′ flanking sequence to provide a molecule which does not occur in nature;


[0091] 4) they may be provided without 5′ and/or 3′ flanking sequences which normally occur in nature;


[0092] 5) they may be provided in substantially pure form. Thus they may be provided in a form which is substantially free from contaminating proteins and/or from other nucleic acids; and


[0093] 6) they may be provided with introns or without introns (e.g. as cDNA).


[0094] As described herein, BCMP84 is associated with breast, bladder and tonsil cancer and as such provides a means of detection/diagnosis. Thus, in a further aspect, the present invention provides a method of screening for and/or diagnosis of breast, bladder and/or tonsil cancer and/or monitoring the effectiveness of breast, bladder and/or tonsil therapy in a subject which comprises the step of detecting and/or quantifying a polypeptide of the invention in a biological sample obtained from said subject.


[0095] A convenient means for such detection/quantifying will involve the use of antibodies. Thus, the polypeptides of the invention also find use in raising antibodies. Thus, in another aspect, the present invention provides antibodies, which bind to a polypeptide of the present invention or to a fragment of such a polypeptide. Preferred antibodies bind specifically to polypeptides of the present invention. Specifically recognising or binding specifically means that the antibodies have a greater affinity for polypeptides of the present invention than for other polypeptides.


[0096] Thus, the polypeptide of the invention, its fragments or other derivatives, may be used as an immunogen to generate antibodies which immunospecifically bind such an immunogen. Antibodies of the invention include, but are not limited to polyclonal, monoclonal, bispecific, humanized or chimeric antibodies, single chain antibodies, Fab fragments and F(ab′) fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-id) antibodies, and epitope-binding fragments of any of the above. The term “antibody” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that specifically binds an antigen. The antibodies of the invention can be of any class (e.g. IgG, IgE, IgM, IgD and IgA) or subclass of immunoglobulin molecule.


[0097] In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g. ELISA (enzyme-linked immunosorbent assay). For example, to select antibodies which recognize a specific domain of a polypeptide of the invention, one may assay generated hybridomas for a product which binds to a polypeptide fragment containing such domain. For selection of an antibody that specifically binds a first polypeptide derivative but which does not specifically bind to (or binds less avidly to) a second polypeptide derivative, one can select on the basis of positive binding to the first polypeptide derivative and a lack of binding to (or reduced binding to) the second polypeptide derivative.


[0098] For preparation of monoclonal antibodies (mAbs) directed toward a polypeptide of the invention or fragment thereof, any technique which provides for the production of antibody molecules by continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495-497), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAbs of the invention may be cultivated in vitro or in vivo. In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilizing known technology.


[0099] The monoclonal antibodies include but are not limited to human monoclonal antibodies and chimeric monoclonal antibodies (e.g. human-mouse chimeras). A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a human immunoglobulin constant region and a variable region derived from a murine mAb, (see, e.g. U.S. Pat. Nos. 4,816,567; and 4,816397, which are incorporated herein by reference in their entirety.) Humanized antibodies are antibody molecules from non-human species having one or more complementarity determining regions (CDRs) from the non-human species and a framework region from a human immunoglobulin molecule, (see, e.g. U.S. Pat. No. 5,585,089, which is incorporated herein by reference in its entirety.)


[0100] Chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in WO 87/02671; EP 184,187; EP 171,496; EP 173,494; WO 86/01533; U.S. Pat. No. 4,816,567; EP 125,023; Better et al., 1988, Science 240:1041-1043; Liu et al., 1987, Proc. Natl. Acad. Sci. USA 84:3439-3443; Liu et al., 1987, J. Immunol. 139:3521-3526; Sun et al., 1987, Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al., 1987, Canc. Res. 47:999-1005; Wood et al., 1985, Nature 314:446-449; and Shaw et al., 1988, J. Natl. Cancer Inst. 80:1553-1559; Morrison, 1985, Science 229:1202-1207; Oi et al., 1986, Bio/Techniques 4:214; U.S. Pat. No. 5,225,539; Jones et al., 1986, Nature 321:552-525; Verhoeyan et al. (1988) Science 239:1534; and Beidler et al., 1988, J. Immunol. 141:4053-4060.


[0101] Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Such antibodies can be produced using transgenic mice which are incapable of expressing endogenous immunoglobulin heavy and light chain genes, but which can express human heavy and light chain genes. The transgenic mice are immunized in the normal fashion with a selected antigen, e.g. all or a portion of a polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained using conventional hybridoma technology. The human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93). For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g. U.S. Pat. Nos. 5,625,126; 5,633,425; 5,569,825; 5,661,016; and 5,545,806. In addition, companies such as Abgenix, Inc. (Freemont, Calif.) and Genpharm (San Jose, Calif.) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.


[0102] Completely human antibodies which recognize a selected epitope can be generated using a technique referred to as “guided selection.” In this approach a selected non-human monoclonal antibody, e.g. a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope, (Jespers et a., (1994) Bio/technology 12:899-903).


[0103] The antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular, such phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e.g. human or murine). Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g. using labeled antigen or antigen bound or captured to a solid surface or bead. Phage used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein. Phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57:191-280 (1994); WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.


[0104] As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g. as described in detail below. For example, techniques to recombinantly produce Fab, Fab′ and F(ab′)2 fragments can also be employed using methods known in the art such as those disclosed in WO 92/22324; Mullinax et al., BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science 240:1041-1043 (1988) (said references incorporated by reference in their entireties).


[0105] Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993); and Skerra et a., Science 240:1038-1040 (1988).


[0106] The invention further provides for the use of bispecific antibodies, which can be made by methods known in the art. Traditional production of full length bispecific antibodies is based on the co expression of two immunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Milstein et al., 1983, Nature 305:537-539). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in WO 93/08829, and in Traunecker et al., 1991, EMBO J. 10:3655-3659.


[0107] According to a different and more preferred approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light chain binding, present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host organism. This provides for great flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains in one expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios are of no particular significance.


[0108] In a preferred embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94/04690. For further details for generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 1986, 121:210.


[0109] The invention provides functionally active fragments, derivatives or analogs of the anti-polypeptide antibodies. Functionally active means that the fragment, derivative or analog is able to elicit anti-anti-idiotype antibodies (i.e. tertiary antibodies) that recognize the same antigen that is recognized by the antibody from which the fragment, derivative or analog is derived. Specifically, in a preferred embodiment the antigenicity of the idiotype of the antibody may be enhanced by deletion of framework and CDR sequences that are C-terminal to the CDR sequence that specifically recognizes the antigen. To determine which CDR sequences bind the antigen, synthetic peptides containing the CDR sequences can be used in binding assays with the antigen by any binding assay method known in the art.


[0110] The present invention provides antibody fragments such as, but not limited to, F(ab′)2 fragments and Fab fragments. Antibody fragments which recognize specific epitopes may be generated by known techniques. F(ab′)2 fragments consist of the variable region, the light chain constant region and the CH1 domain of the heavy chain and are generated by pepsin digestion of the antibody molecule. Fab fragments are generated by reducing the disulfide bridges of the F(ab′)2 fragments. The invention also provides heavy chain and light chain dimmers of the antibodies of the invention, or any minimal fragment thereof such as Fvs or single chain antibodies (SCAs) (e.g. as described in U.S. Pat. No. 4,946,778; Bird, 1988, Science 242:423-42; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334:544-54), or any other molecule with the same specificity as the antibody of the invention. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli may be used (Skerra et al., 1988, Science 242:1038-1041).


[0111] In other embodiments, the invention provides fusion proteins of the antibodies of the invention (or functionally active fragments thereof), for example in which the antibody is fused via a covalent bond (e.g. a peptide bond), at either the N-terminus or the C-terminus to an amino acid sequence of another protein (or portion thereof, preferably at least a 10, 20 or 50 amino acid portion of the protein) that is not the immunoglobulin. Preferably the antibody, or fragment thereof, is covalently linked to the other protein at the N-terminus of the constant domain. As stated above, such fusion proteins may facilitate purification, increase half-life in vivo, and enhance the delivery of an antigen across an epithelial barrier to the immune system.


[0112] The antibodies of the invention include analogs and derivatives that are either modified, i.e. by the covalent attachment of any type of molecule as long as such covalent attachment does not impair immunospecific binding. For example, but not by way of limitation, the derivatives and analogs of the immunoglobulins include those that have been further modified, e.g. by glycosylation, acetylation, pegylation, phosphylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, etc. Additionally, the analog or derivative may contain one or more non-classical amino acids.


[0113] The foregoing antibodies can be used in methods known in the art relating to the localization and activity of the polypeptides of the invention, e.g. for imaging or radioimaging these proteins, measuring levels thereof in appropriate physiological samples, in diagnostic methods, etc. and for radiotherapy.


[0114] The antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or by recombinant expression, and are preferably produced by recombinant expression techniques.


[0115] Recombinant expression of antibodies, or fragments, derivatives or analogs thereof, requires construction of a nucleic acid that encodes the antibody. If the nucleotide sequence of the antibody is known, a nucleic acid encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g. as described in Kutmeier et al., 1994, BioTechniques 17:242), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding antibody, annealing and ligation of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.


[0116] Alternatively, the nucleic acid encoding the antibody may be obtained by cloning the antibody. If a clone containing the nucleic acid encoding the particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the antibody may be obtained from a suitable source (e.g. an antibody cDNA library, or cDNA library generated from any tissue or cells expressing the antibody) by PCR amplification using synthetic primers hybridizable to the 3′ and 5′ ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence.


[0117] If an antibody molecule that specifically recognizes a particular antigen is not available (or a source for a cDNA library for cloning a nucleic acid encoding such an antibody), antibodies specific for a particular antigen may be generated by any method known in the art, for example, by immunizing an animal, such as a rabbit, to generate polyclonal antibodies or, more preferably, by generating monoclonal antibodies. Alternatively, a clone encoding at least the Fab portion of the antibody may be obtained by screening Fab expression libraries (e.g. as described in Huse et al., 1989, Science 246:1275-1281) for clones of Fab fragments that bind the specific antigen or by screening antibody libraries (See, e.g. Clackson et a., 1991, Nature 352:624; Hane et al., 1997 Proc. Natl. Acad. Sci. USA 94:4937).


[0118] Once a nucleic acid encoding at least the variable domain of the antibody molecule is obtained, it may be introduced into a vector containing the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g. WO 86/05807; WO 89/01036; and U.S. Pat. No. 5,122,464). Vectors containing the complete light or heavy chain for co-expression with the nucleic acid to allow the expression of a complete antibody molecule are also available. Then, the nucleic acid encoding the antibody can be used to introduce the nucleotide substitution(s) or deletion(s) necessary to substitute (or delete) the one or more variable region cysteine residues participating in an intrachain disulfide bond with an amino acid residue that does not contain a sulfhydyl group. Such modifications can be carried out by any method known in the art for the introduction of specific mutations or deletions in a nucleotide sequence, for example, but not limited to, chemical mutagenesis, in vitro site directed mutagenesis (Hutchinson et al., 1978, J. Biol. Chem. 253:6551), PCR based methods, etc.


[0119] In addition, techniques developed for the production of “chimeric antibodies” (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855; Neuberger et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. As described supra, a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human antibody constant region, e.g. humanized antibodies.


[0120] Once a nucleic acid encoding an antibody molecule of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing the protein of the invention by expressing nucleic acid containing the antibody molecule sequences are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing an antibody molecule coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. See, for example, the techniques described in Sambrook et al. (1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) and Ausubel et al. (eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY).


[0121] The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention.


[0122] The host cells used to express a recombinant antibody of the invention may be either bacterial cells such as Escherichia coli, or, preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule. In particular, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking, M. F. & Hofstetter, H., 1985, Gene 45:101; Cockett et al., 1990, Bio/Technology 8:2).


[0123] A variety of host-expression vector systems may be utilized to express an antibody molecule of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express the antibody molecule of the invention in situ. These include but are not limited to microorganisms such as bacteria (e.g. E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g. Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g. baculovirus) containing the antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g. cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g. Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g. COS, CHO, BHK, HEK293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g. metallothionein promoter) or from mammalian viruses (e.g. the adenovirus late promoter; the vaccinia virus 7.5K promoter).


[0124] In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions comprising an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2:1791), in which the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503-5509); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to a matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.


[0125] In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The antibody coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). In mammalian host cells, a number of viral-based expression systems (e.g. an adenovirus expression system) may be utilized.


[0126] As discussed above, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g. glycosylation) and processing (e.g. cleavage) of protein products may be important for the function of the protein.


[0127] For long-term, high-yield production of recombinant antibodies, stable expression is preferred. For example, cells lines that stably express an antibody of interest can be produced by transfecting the cells with an expression vector comprising the nucleotide sequence of the antibody and the nucleotide sequence of a selectable marker (e.g. neomycin or hygromycin), and selecting for expression of the selectable marker. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody molecule.


[0128] The expression levels of the antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)). When a marker in the vector system expressing antibody is amplifiable, an increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al., 1983, Mol. Cell. Biol. 3:257).


[0129] The host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, 1986, Nature 322:52; Kohler, 1980, Proc. Natl. Acad. Sci. USA 77:2197). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.


[0130] Once the antibody molecule of the invention has been recombinantly expressed, it may be purified by any method known in the art for purification of an antibody molecule, for example, by chromatography (e.g. ion exchange chromatography, affinity chromatography such as with protein A or specific antigen, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.


[0131] Alternatively, any fusion protein may be readily purified by utilizing an antibody specific for the fusion protein being expressed. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-897). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues. The tag serves as a matrix binding domain for the fusion protein. Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni2+ nitriloacetic acid-agarose columns and histidine-tagged proteins are selectively eluted with imidazole-containing buffers.


[0132] In a preferred embodiment, antibodies of the invention or fragments thereof are conjugated to a diagnostic or therapeutic moiety. The antibodies can be used for diagnosis or to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive nuclides, positron emitting metals (for use in positron emission tomography), and nonradioactive paramagnetic metal ions. See generally U.S. Pat. No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention. Suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; suitable prosthetic groups include streptavidin, avidin and biotin; suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride and phycoerythrin; suitable luminescent materials include luminol; suitable bioluminescent materials include luciferase, luciferin, and aequorin; and suitable radioactive nuclides include 125I, 131I, 111In and 99Tc.


[0133] Antibodies of the invention or fragments thereof can be conjugated to a therapeutic agent or drug moiety to modify a given biological response. The therapeutic agent or drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, α-interferon, β-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, a thrombotic agent or an anti-angiogenic agent, e.g. angiostatin or endostatin; or, a biological response modifier such as a lymphokine, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), nerve growth factor (NGF) or other growth factor.


[0134] Techniques for conjugating such therapeutic moiety to antibodies are well known, see, e.g. Arnon et al., “Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy”, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., “Antibodies For Drug Delivery”, in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, “Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review”, in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); “Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy”, in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., “The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates”, Immunol. Rev., 62:119-58 (1982).


[0135] Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described in U.S. Pat. No. 4,676,980.


[0136] An antibody with or without a therapeutic moiety conjugated to it can be used as a therapeutic that is administered alone or in combination with cytotoxic factor(s) and/or cytokine(s).


[0137] As discussed herein, the polypeptides, nucleic acid molecules, antibodies and active agents of the invention find use in the treatment or prophylaxis of breast, bladder and/or tonsil cancer. Thus, in an additional aspect, the present invention provides a pharmaceutical composition comprising an active agent which includes within its scope and thus comprises at least one polypeptide or fragment thereof, nucleic acid molecule or antibody of the invention, optionally together with one or more pharmaceutically acceptable excipients, carriers or diluents. In one aspect, the pharmaceutical composition is for use as a vaccine and so any additional components will be acceptable for vaccine use. In addition, the skilled person will appreciate that one or more suitable adjuvants may be added to such vaccine preparations.


[0138] Hereinafter, the agents, polypeptides, nucleic acids and antibodies of the present invention, for use in treatment are referred to as ‘active agents’. The term ‘treatment’ includes either therapeutic or prophylactic therapy. When a reference is made herein to a method of treating or preventing a disease or condition using a particular active agent or combination of agents, it is to be understood that such a reference is intended to include the use of that active agent or combination of agents in the preparation of a medicament for the treatment or prevention of breast, bladder and/or tonsil cancer.


[0139] In order to use active agents of the invention in therapy (human or veterinary), they will normally be formulated into a pharmaceutical composition in accordance with standard pharmaceutical practice. Therefore, the medicament will usually be supplied as part of a sterile, pharmaceutical composition which will normally include a pharmaceutically acceptable carrier. This pharmaceutical composition may be in any suitable form, (depending upon the desired method of administering it to a patient). It may be provided in unit dosage form, will generally be provided in a sealed container and may be provided as part of a kit. Such a kit would normally (although not necessarily) include instructions for use. It may include a plurality of said unit dosage forms.


[0140] The pharmaceutical composition may be adapted for administration by any appropriate route, for example by the oral (including buccal or sublingual), rectal, nasal, topical (including buccal, sublingual or transdermal), vaginal or parenteral (including subcutaneous, intramuscular, intravenous or intradermal) route. Such compositions may be prepared by any method known in the art of pharmacy, for example by admixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.


[0141] The active agents may be administered in combination, e.g. simultaneously, sequentially or separately, with one or more other therapeutically active, e.g. anti-breast, bladder or tonsil cancer agents.


[0142] Pharmaceutical compositions adapted for oral administration may be presented as discrete units such as capsules or tablets; as powders or granules; as solutions, syrups or suspensions (in aqueous or non-aqueous liquids; or as edible foams or whips; or as emulsions).


[0143] The dosage to be administered of an active agent will vary according to the particular active agent, the cancer involved (i.e. breast, bladder or tonsil cancer), the subject, and the nature and severity of the disease and the physical condition of the subject, and the selected route of administration; the appropriate dosage can be readily determined by a person skilled in the art. For the treatment of breast, bladder or tonsil cancer in humans and animals, the dosage may range from 0.01 mg/kg to 750 mg/kg. For prophylactic use in human and animals, the dosage may range from 0.01 mg/kg to 100 mg/kg.


[0144] The compositions may contain from 0.1% by weight, preferably from 10-60% by weight, of the active agent of the invention, depending on the method of administration.


[0145] Pharmaceutical compositions may be conveniently presented in unit dose forms containing a predetermined amount of an active agent of the invention per dose. Such a unit may contain for example but without limitation, 100 mg/kg to 0.1 mg/kg depending on the condition being treated, the route of administration and the age, weight and condition of the subject. Preferred unit dosage compositions are those containing a daily dose or sub-dose, as recited above, or an appropriate fraction thereof, of the active ingredient.


[0146] It will be recognized by one of skill in the art that the optimal quantity and spacing of individual dosages of an active agent of the invention will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the particular subject being treated, and that such optimums can be determined by conventional techniques. It will also be appreciated by one of skill in the art that the optimal course of treatment, i.e. the number of doses of an active agent of the invention given per day for a defined number of days, can be ascertained by those skilled in the art using conventional course of treatment determination tests.


[0147] Dosage regimens are adjusted to provide the optimum desired response. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.


[0148] Pharmaceutically acceptable carriers for use in the invention may take a wide variety of forms depending, e.g. on the route of administration.


[0149] Suitable excipients for tablets or hard gelatine capsules include lactose, maize starch or derivatives thereof, stearic acid or salts thereof.


[0150] Suitable excipients for use with soft gelatine capsules include for example vegetable oils, waxes, fats, semi-solid, or liquid polyols etc.


[0151] For the preparation of solutions and syrups, excipients which may be used include for example water, polyols and sugars. For the preparation of suspensions, oils (e.g. vegetable oils) may be used to provide oil-in-water or water in oil suspensions.


[0152] Pharmaceutical compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. For example, the active ingredient may be delivered from the patch by iontophoresis as generally described in Pharmaceutical Research, 3(6):318 (1986).


[0153] Pharmaceutical compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols or oils. For infections of the eye or other external tissues, for example mouth and skin, the compositions are preferably applied as a topical ointment or cream. When formulated in an ointment, the active ingredient may be employed with either a paraffinic or a water-miscible ointment base. Alternatively, the active ingredient may be formulated in a cream with an oil-in-water cream base or a water-in-oil base. Pharmaceutical compositions adapted for topical administration to the eye include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier, especially an aqueous solvent. Pharmaceutical compositions adapted for topical administration in the mouth include lozenges, pastilles and mouth washes.


[0154] Pharmaceutical compositions adapted for rectal administration may be presented as suppositories or enemas.


[0155] Pharmaceutical compositions adapted for nasal administration wherein the carrier is a solid include a coarse powder having a particle size for example in the range 20 to 500 microns which is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. Suitable compositions wherein the carrier is a liquid, for administration as a nasal spray or as nasal drops, include aqueous or oil solutions of the active ingredient.


[0156] Pharmaceutical compositions adapted for administration by inhalation include fine particle dusts or mists which may be generated by means of various types of metered dose pressurised aerosols, nebulisers or insufflators.


[0157] Pharmaceutical compositions adapted for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations.


[0158] Pharmaceutical compositions adapted for parenteral administration include aqueous and non-aqueous sterile injection solution which may contain anti-oxidants, buffers, bacteriostats and solutes which render the compostion substantially isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. Excipients which may be used for injectable solutions include water, alcohols, polyols, glycerine and vegetable oils, for example. The compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carried, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.


[0159] The pharmaceutical compositions may contain preserving agents, solubilizing agents, stabilizing agents, wetting agents, emulsifiers, sweeteners, colorants, odorants, salts (agents of the present invention may themselves be provided in the form of a pharmaceutically acceptable salt), buffers, coating agents or antioxidants. They may also contain additional therapeutically active agents in addition to the active agent of the present invention.


[0160] Dosages of the active agent of the present invention can vary between wide limits, depending upon the disease or disorder to be treated, the age and condition of the individual to be treated, etc. and a physician will ultimately determine appropriate dosages to be used. This dosage may be repeated as often as appropriate. If side effects develop the amount and/or frequency of the dosage can be reduced, in accordance with normal clinical practice.


[0161] In a further aspect, the present invention provides a method for the prophylaxis and/or treatment of breast, bladder and/or tonsil cancer in a subject, which comprises administering to said subject a therapeutically effective amount of at least one polypeptide or fragment thereof, nucleic acid molecule, antibody or other active agent of the invention.


[0162] In another aspect, the present invention provides the use of at least one polypeptide or fragment thereof, nucleic acid molecule, antibody or active agent of the invention in the preparation of a medicament for use in the prophylaxis and/or treatment of breast, bladder and/or tonsil cancer. In particular, the preparation of compositions comprising or consisting of antibodies is a preferred embodiment of this aspect of the invention.


[0163] In view of the importance of BCMP84 in breast, bladder and tonsil cancer the following form additional aspects of the present invention:


[0164] i) a method of screening for agents that modulate, i.e. up-regulate or down-regulate, the expression of a polypeptide of the invention, which comprises the step of determining the presence or absence and/or quantifying at least one polypeptide or antibody of the invention in a biological sample;


[0165] ii) a method for monitoring/assessing breast, bladder and/or tonsil cancer treatment in a patient, which comprises the step of determining the presence or absence and/or quantifying at least one polypeptide or antibody of the invention in a biological sample obtained from said patient;


[0166] iii) a method for the identification of metastatic breast, bladder and/or tonsil cancer cells in a biological sample obtained from a subject, which comprises the step of determining the presence or absence and/or quantifying at least one polypeptide or antibody of the invention.


[0167] The present invention provides methods and compositions for screening, diagnosis, prognosis and therapy of breast, bladder and/or tonsil cancer, for monitoring the effectiveness of breast, bladder and/or tonsil cancer treatment, and for drug development for treatment of breast, bladder and/or tonsil cancer.


[0168] In certain aspects, the invention provides:


[0169] (i) methods for diagnosis of breast, bladder and/or tonsil cancer that comprises analyzing a sample of breast, bladder and/or tonsil tissue by one-dimensional electrophoresis to detect a polypeptide as defined herein. These methods are also suitable for screening, prognosis, monitoring the results of therapy, drug development and discovery of new targets for drug treatment;


[0170] (ii) methods of treating breast, bladder and/or tonsil cancer, comprising administering to a patient a therapeutically effective amount of an agent that modulates (e.g. upregulates or downregulates) or complements the expression or the biological activity (or both) of a polypeptide as defined herein in patients having breast, bladder and/or tonsil cancer, in order to (a) prevent the onset or development of breast, bladder and/or tonsil cancer; (b) prevent the progression of breast, bladder and/or tonsil cancer; or (c) ameliorate the symptoms of breast, bladder and/or tonsil cancer;


[0171] (iii) methods of screening for agents that modulate (e.g. upregulate or downregulate) the expression or biological activity of a polypeptide as defined herein;


[0172] (iv) A method of screening for agents that modulate the expression or activity of a polypeptide as defined in claim 1, said method comprising:


[0173] (a) comparing the expression or activity of said polypeptide, in the presence of a candidate agent with the expression or activity of said polypeptide, in the absence of the candidate agent or in the presence of a control agent; and


[0174] (b) determining whether the candidate agent causes the expression or activity of said polypeptide, or the expression of said nucleic acid molecule, to change.


[0175] (v) a method for screening for and/or diagnosis of breast, bladder and/or tonsil cancer in a human subject, which method comprises the step of identifying the presence or absence of a polypeptide as defined herein, in a biological sample obtained from said human subject.


[0176] (vi) a method for monitoring and/or assessing breast, bladder and/or tonsil cancer treatment in a human subject, which comprises the step of identifying the presence or absence of a polypeptide as defined herein, in a biological sample obtained from said human subject.


[0177] (vii) a method for identifying the presence or absence of metastatic breast, bladder and/or tonsil cancer cells in a biological sample obtained from a human subject, which comprises the step of identifying the presence or absence of a polypeptide as defined herein;


[0178] (viii) a method for monitoring and/or assessing breast, bladder and/or tonsil cancer treatment in a human subject, which comprises the step of determining whether a polypeptide as defined herein is increased/decreased in a biological sample obtained from a patient.


[0179] The biological sample used can be from any source such as a serum sample or a tissue sample, e.g. breast, bladder or tonsil tissue. For instance, when looking for evidence of metastatic breast, bladder and/or tonsil cancer, one would look at major sites of metastasis, e.g. lymph nodes, liver, lung and/or bone.


[0180] The invention described in detail below encompasses methods and compositions for screening, diagnosis and prognosis of breast, bladder and/or tonsil cancer in a subject, for monitoring the results of breast, bladder and/or tonsil cancer therapy, and for drug development. The invention also encompasses the administration of therapeutic compositions to a mammalian subject to treat or prevent breast, bladder and/or tonsil cancer. Preferably, the mammalian subject is human, more preferably a human adult. For clarity of disclosure, and not by way of limitation, the invention will be described with respect to the analysis of breast tissue samples. However, as one skilled in the art will appreciate, the assays and techniques described below can be applied to other types of patient samples, including a body fluid (e.g. blood, serum, plasma or saliva), a tissue sample from a patient at risk of having breast, bladder and/or tonsil cancer (e.g. a biopsy such as a breast, bladder or tonsil biopsy) or homogenate thereof. The methods and compositions of the present invention are specially suited for screening, diagnosis and prognosis of a living subject, but may also be used for post mortem diagnosis in a subject, the information from which may be used to identify family members at risk of developing the same disease.


[0181] As used herein, breast tissue refers to the breast itself, as well as the tissue adjacent to and/or within the strata underlying the breast.


[0182] In one aspect of the invention, one-dimensional electrophoresis is used to analyze breast, bladder or tonsil tissue from a subject, preferably a living subject, in order to measure the expression of a polypeptide as defined herein for screening or diagnosis of breast, bladder or tonsil cancer, to determine the prognosis of a breast, bladder or tonsil cancer patient, to monitor the effectiveness of breast, bladder or tonsil cancer therapy, or for drug development.


[0183] As used herein, “one-dimensional electrophoresis” (1D-electrophoresis) means a technique comprising denaturing electrophoresis; this generates a one-dimensional gel (1 D-gel) containing a plurality of separated proteins. Preferably, the step of denaturing electrophoresis uses polyacrylamide electrophoresis in the presence of sodium dodecyl sulphate (SDS-PAGE). Especially preferred are the highly accurate and automatable methods and apparatus described in WO 98/23950, which is incorporated herein by reference in its entirety with particular reference to the preferred protocol at pages 19-29. Briefly, electrophoresis technology provides efficient, computer-assisted methods and apparatus for identifying, selecting and characterizing biomolecules in a biological sample. A one-dimensional array is generated by separating biomolecules on a one-dimensional gel according to their electrophoretic mobility. A computer-generated digital profile of the array is generated, representing the identity, apparent molecular weight of a plurality of biomolecules detected in the one-dimensional array, thereby permitting computer-mediated comparison of profiles from multiple biological samples, as well as computer aided excision of separated proteins of interest.


[0184] A preferred scanner for detecting fluorescently labeled proteins is described in WO 96/36882 and in the Ph.D. thesis of David A. Basiji, entitled “Development of a High-throughput Fluorescence Scanner Employing Internal Reflection Optics and Phase-sensitive Detection (Total Internal Reflection, Electrophoresis)”, University of Washington (1997), Volume 58/12-B of Dissertation Abstracts International, page 6686, the contents of each of which are incorporated herein by reference. These documents describe an image scanner designed specifically for automated, integrated operation at high speeds. The scanner can image gels that have been stained with fluorescent dyes or silver stains, as well as storage phosphor screens. The Basiji thesis provides a phase-sensitive detection system for discriminating modulated fluorescence from baseline noise due to laser scatter or homogeneous fluorescence, but the scanner can also be operated in a non-phase-sensitive mode. This phase-sensitive detection capability increases the sensitivity of the instrument by an order of magnitude or more compared to conventional fluorescence imaging systems. The increased sensitivity reduces the sample-preparation load on the upstream instruments while the enhanced image quality simplifies image analysis downstream in the process.


[0185] A more highly preferred scanner is the Apollo 3 scanner (Oxford Glycosciences, Oxford, UK), which is a modified version of the above-described scanner. In the Apollo 3 scanner, the gel is transported through the scanner on a precision lead-screw drive system. This is preferable to laying the glass plate on the belt-driven system that is defined in the Basiji thesis as it provides a reproducible means of accurately transporting the gel past the imaging optics.


[0186] In the Apollo 3 scanner, the gel is secured against three alignment stops that rigidly hold the glass plate in a known position. By doing this in conjunction with the above precision transport system, the absolute position of the gel can be predicted and recorded. This ensures that co-ordinates of each feature on the gel can be determined more accurately and communicated, if desired, to a cutting robot for excision of the feature. In the Apollo 3 scanner, the carrier that holds the gel has four integral fluorescent markers used to correct the image geometry. These markers are a quality control feature that confirms that the scanning has been performed correctly.


[0187] In comparison to the scanner described in the Basiji thesis, the optical components of the Apollo 3 scanner have been inverted. In the Apollo 3 scanner, the laser, mirror, waveguide and other optical components are above the glass plate being scanned. The scanner described in the Basiji thesis has these components underneath. In the Apollo 3 scanner, the glass plate is mounted onto the scanner gel side down, so that the optical path remains through the glass plate. By doing this, any particles of gel that may break away from the glass plate will fall onto the base of the instrument rather than into the optics. This does not affect the functionality of the system, but increases its reliability. Further and finally, in the Apollo3 scanner, the signal output is digitized to the full 16-bit data without any peak saturation or without square root encoding of the signal. A compensation algorithm has also been applied to correct for any variation in detection sensitivity along the path of the scanning beam. This variation is due to anomalies in the optics and differences in collection efficiency across the waveguide. The calibration is performed using a perspex plate with an even fluorescence throughout. The data received from a scan of this plate are used to determine the multiplication factors needed to increase the signal from each pixel level to a target level. These factors are then used in subsequent scans of gels to remove any internal optical variations.


[0188] A polypeptide as defined herein has been identified in membrane protein extracts of laboratory cultured human mammary cell lines through the methods and apparatus of the electrophoresis technology (generally 1D gel electrophoresis and tryptic digest of membrane protein extracts of laboratory cultured human mammary cell lines). Peptide sequences were compared to existing cDNA databases and corresponding genes identified. The polypeptide as defined herein finds utility as a marker for breast, bladder or tonsil cells.


[0189] For a polypeptide as defined herein, the detected level obtained upon analyzing breast, bladder or tonsil tissue from subjects having breast, bladder or tonsil cancer respectively relative to the detected level obtained upon analyzing breast, bladder or tonsil tissue from subjects free from breast, bladder or tonsil cancer will depend upon the particular analytical protocol and detection technique that is used, provided that such polypeptide is differentially expressed between normal and cancerous breast, bladder or tonsil tissue. Accordingly, the present invention contemplates that each laboratory will establish a reference range for the polypeptide of the present invention in subjects free from breast, bladder and/or tonsil cancer according to the analytical protocol and detection technique in use, as is conventional in the diagnostic art. Preferably, at least one control positive breast, bladder or tonsil tissue sample from a subject known to have breast, bladder or tonsil cancer or at least one control negative breast, bladder or tonsil tissue sample from a subject known to be free from breast, bladder or tonsil cancer (and more preferably both positive and negative control samples) are included in each batch of test samples analyzed.


[0190] In one embodiment, the level of expression of the polypeptide of the invention is determined relative to a background value, which is defined as the level of signal obtained from a proximal region of the image that (a) is equivalent in area to the particular feature in question; and (b) contains no discernable protein feature.


[0191] A polypeptide as defined herein can be used for detection, prognosis, diagnosis, or monitoring of breast, bladder or tonsil cancer or for drug development. In one embodiment of the invention, breast, bladder or tonsil tissue from a subject (e.g. a subject suspected of having breast, bladder or tonsil cancer) is analyzed by 1D electrophoresis for detection of a polypeptide as defined herein. An increased abundance of said polypeptide in the breast, bladder or tonsil tissue from the subject relative to breast, bladder or tonsil tissue from a subject or subjects free from breast, bladder or tonsil cancer (e.g. a control sample) or a previously determined reference range indicates the presence of breast, bladder or tonsil cancer.


[0192] In one embodiment, breast, bladder or tonsil tissue from a subject is analyzed for quantitative detection of a polypeptide as defined herein, wherein a change in abundance of the polypeptide in the breast, bladder or tonsil tissue from the subject relative to breast, bladder or tonsil tissue from a subject or subjects free from breast, bladder or tonsil cancer (e.g. a control sample or a previously determined reference range) indicates the presence of breast, bladder or tonsil cancer.


[0193] As used herein, a polypeptide is “isolated” when it is present in a preparation that is substantially free of contaminating proteins, i.e. a preparation in which less than 10% (preferably less than 5%, more preferably less than 1%) of the total protein present is contaminating protein(s). A contaminating protein is a protein having a different amino acid sequence from that of the isolated polypeptide, as determined by mass spectral analysis. As used herein, a “different” sequence is one that permits the contaminating protein to be resolved from the polypeptide by mass spectral analysis, performed according to the Reference Protocol.


[0194] A polypeptide as defined herein can be assayed by any method known to those skilled in the art, including but not limited to, the electrophoresis technology described herein, kinase assays, immunoassays, and western blotting. In one embodiment, the polypeptide is separated on a 1-D gel by virtue of its MW and visualized by staining the gel. In one embodiment, the polypeptide is are stained with a fluorescent dye and imaged with a fluorescence scanner. Sypro Red (Molecular Probes, Inc., Eugene, Oreg.) is a suitable dye for this purpose. A preferred fluorescent dye is disclosed in U.S. Pat. No. 6,335,446, which is incorporated herein by reference in its entirety.


[0195] Alternatively, a polypeptide as defined herein can be detected in an immunoassay. In one embodiment, an immunoassay is performed by contacting a sample from a subject to be tested with an anti-polypeptide antibody under conditions such that immunospecific binding can occur if the polypeptide is present, and detecting or measuring the amount of any immunospecific binding by the antibody. Anti-polypeptide antibodies can be produced by the methods and techniques taught herein.


[0196] In one embodiment, binding of antibody in tissue sections can be used to detect aberrant polypeptide localization or an aberrant level of polypeptide. In a specific embodiment, antibody to a polypeptide as defined herein can be used to assay a patient tissue (e.g. a breast, bladder or tonsil biopsy) for the level of the polypeptide where an aberrant level of polypeptide is indicative of breast, bladder or tonsil cancer. As used herein, an “aberrant level” means a level that is increased or decreased compared with the level in a subject free from breast, bladder and/or tonsil cancer or a reference level. If desired, the comparison can be performed with a matched sample from the same subject, taken from a portion of the body not affected by breast, bladder or tonsil cancer.


[0197] Suitable immunoassays include, without limitation, competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays and protein A immunoassays.


[0198] If desired, a polypeptide as defined herein can be detected by means of a two-step sandwich assay. In the first step, a capture reagent (e.g. an anti-polypeptide antibody) is used to capture the polypeptide. The capture reagent can optionally be immobilized on a solid phase. In the second step, a directly or indirectly labeled detection reagent is used to detect the captured polypeptide. In one embodiment, the detection reagent is a lectin. Any lectin can be used for this purpose that preferentially binds to the polypeptide rather than to other isoforms that have the same core protein as the polypeptide or to other proteins that share the antigenic determinant recognized by the antibody. In a preferred embodiment, the chosen lectin binds to the polypeptide with at least 2-fold greater affinity, more preferably at least 5-fold greater affinity, still more preferably at least 10-fold greater affinity, than to said other isoforms that have the same core protein as the polypeptide or to said other proteins that share the antigenic determinant recognized by the antibody. A lectin that is suitable for detecting a given polypeptide can readily be identified by methods well known in the art, for instance upon testing one or more lectins enumerated in Table I on pages 158-159 of Sumar et al., Lectins as Indicators of Disease-Associated Glycoforms, In: Gabius H-J & Gabius S (eds.), 1993, Lectins and Glycobiology, at pp.158-174 (which is incorporated herein by reference in its entirety). In an alternative embodiment, the detection reagent is an antibody, e.g. an antibody that immunospecifically detects post-translational modifications, such as an antibody that immunospecifically binds to phosphorylated amino acids. Examples of such antibodies include those that bind to phosphotyrosine (BD Transduction Laboratories, catalog nos.: P11230-050/P11230-150; P11120; P38820; P39020), those that bind to phosphoserine (Zymed Laboratories Inc., catalog no. 61-8100) and those that bind to phosphothreonine (Zymed Laboratories Inc., catalogue nos. 71-8200,13-9200).


[0199] If desired, a gene encoding a polypeptide as defined herein, a related gene, or related nucleic acid sequences or subsequences, including complementary sequences, can also be used in hybridization assays. A nucleotide encoding a polypeptide as defined herein, or subsequences thereof comprising at least 8 nucleotides, can be used as a hybridization probe. Hybridization assays can be used for detection, prognosis, diagnosis, or monitoring of conditions, disorders, or disease states, associated with aberrant expression of genes encoding a polypeptide as defined herein, or for differential diagnosis of patients with signs or symptoms suggestive of breast, bladder and/or tonsil cancer. In particular, such a hybridization assay can be carried out by a method comprising contacting a patient sample containing nucleic acid with a nucleic acid probe capable of hybridizing to a DNA or RNA that encodes a polypeptide as defined herein, under conditions such that hybridization can occur, and detecting or measuring any resulting hybridization. Nucleotides can be used for therapy of patients having breast, bladder and/or tonsil cancer, as described below.


[0200] The invention also provides diagnostic kits, comprising a capture reagent (e.g. an antibody) against a polypeptide as defined herein. In addition, such a kit may optionally comprise one or more of the following: (1) instructions for using the anti-polypeptide capture reagent for diagnosis, prognosis, therapeutic monitoring or any combination of these applications; (2) a labeled binding partner to the capture reagent; (3) a solid phase (such as a reagent strip) upon which the anti-polypeptide capture reagent is immobilized; and (4) a label or insert indicating regulatory approval for diagnostic, prognostic or therapeutic use or any combination thereof. If no labeled binding partner to the capture reagent is provided, the anti-polypeptide capture reagent itself can be labeled with a detectable marker, e.g. a chemiluminescent, enzymatic, fluorescent, or radioactive moiety.


[0201] The invention also provides a kit comprising a nucleic acid probe capable of hybridizing to RNA encoding a polypeptide as defined herein. In a specific embodiment, a kit comprises in one or more containers a pair of primers (e.g. each in the size range of 6-30 nucleotides, more preferably 10-30 nucleotides and still more preferably 10-20 nucleotides) that under appropriate reaction conditions can prime amplification of at least a portion of a nucleic acid encoding a polypeptide as defined herein, such as by polymerase chain reaction (see e.g. Innis et al., 1990, PCR Protocols, Academic Press, Inc., San Diego, Calif.), ligase chain reaction (see EP 320,308) use of Qβ replicase, cyclic probe reaction, or other methods known in the art.


[0202] The diagnostic methods and compositions of the present invention can assist in monitoring a clinical study, e.g. to evaluate drugs for therapy of breast, bladder and/or tonsil cancer.


[0203] In one embodiment, candidate molecules are tested for their ability to restore the levels of a polypeptide as defined herein in a patient having breast, bladder and/or tonsil cancer to levels found in subjects free from breast, bladder and/or tonsil cancer or, in a treated patient (e.g. after treatment with taxol or doxorubicin), to preserve levels at or near non-cancer values.


[0204] In another embodiment, the methods and compositions of the present invention are used to screen candidates for a clinical study to identify individuals having breast, bladder and/or tonsil cancer; such individuals can then be excluded from the study or can be placed in a separate cohort for treatment or analysis. If desired, the candidates can concurrently be screened to identify individuals with other diseases; procedures for these screens are well known in the art.


[0205] In particular aspects, the invention provides an isolated polypeptide as defined herein, and fragments and derivatives thereof which comprise an antigenic determinant (i.e. can be recognized by an antibody) or which are otherwise functionally active, as well as nucleic acid sequences encoding the foregoing. “Functionally active” as used herein refers to material displaying one or more functional activities associated with a full-length (wild-type) polypeptide, e.g. binding to a polypeptide substrate or polypeptide binding partner, antigenicity (binding to an anti-target antibody), immunogenicity, enzymatic activity etc.


[0206] The polypeptide as defined herein can be isolated and purified by standard methods including chromatography (e.g. ion exchange, affinity, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. Alternatively, because a recombinant nucleic acid that encodes the polypeptide has been identified, the protein can be synthesized by standard chemical methods known in the art (e.g. see Hunkapiller et al., 1984, Nature 310:105-111).


[0207] In another alternative embodiment, native polypeptide can be purified from natural sources, by standard methods such as those described above (e.g. immunoaffinity purification).


[0208] The nucleotide sequences of the present invention, including DNA and RNA, and comprising a sequence encoding a polypeptide as defined herein (or a fragment, or derivative thereof), may be synthesized using methods known in the art, such as using conventional chemical approaches or polymerase chain reaction (PCR) amplification. The nucleotide sequences of the present invention also permit the identification and cloning of the gene encoding BCMP84 from any species, for instance by screening cDNA libraries, genomic libraries or expression libraries.


[0209] For example, to clone a gene encoding a polypeptide as defined herein by PCR techniques, anchored degenerate oligonucleotides (or a set of most likely oligonucleotides) can be designed for all peptide fragments identified as part of the same protein. PCR reactions under a variety of conditions can be performed with relevant cDNA and genomic DNAs (e.g. from breast, bladder or tonsil tissue or from cells of the immune system) from one or more species. Also vectorette reactions can be performed on any available cDNA and genomic DNA using the oligonucleotides (which preferably are nested) as above. Vectorette PCR is a method that enables the amplification of specific DNA fragments in situations where the sequence of only one primer is known. Thus, it extends the application of PCR to stretches of DNA where the sequence information is only available at one end, (Arnold C, 1991, PCR Methods Appl. 1(1):39-42; Dyer K D, Biotechniques, 1995, 19(4):550-2). Vectorette PCR may be performed with probes that are anchored degenerate oligonucleotides (or most likely oligonucleotides) coding for peptide fragments, using as a template a genomic library or cDNA library pools.


[0210] Anchored degenerate and most likely oligonucleotides can be designed for all peptide fragments. These oligonucleotides may be labeled and hybridized to filters containing cDNA and genomic DNA libraries. Oligonucleotides to different peptides from the same protein will often identify the same members of the library. The cDNA and genomic DNA libraries may be obtained from multiple mammalian species, preferably human.


[0211] Nucleotide sequences comprising a nucleotide sequence encoding a polypeptide as defined herein or fragment thereof are useful for their ability to hybridize selectively with complementary stretches of genes encoding other proteins. Depending on the application, a variety of hybridization conditions may be employed to obtain nucleotide sequences at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the sequence of a nucleotide encoding a polypeptide as defined herein.


[0212] For a high degree of selectivity, relatively stringent conditions are used to form the duplexes, such as low salt or high temperature conditions. As used herein, “highly stringent conditions” means hybridization to filter-bound DNA in 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. (Ausubel F. M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3; incorporated herein by reference in its entirety). For some applications, less stringent conditions for duplex formation are required. As used herein “moderately stringent conditions” means washing in 0.2×SSC/0.1% SDS at 42° C. (Ausubel et al., 1989, supra). Hybridization conditions can also be rendered more stringent by the addition of increasing amounts of formamide, to destabilize the hybrid duplex. Thus, particular hybridization conditions can be readily manipulated, and will generally be chosen depending on the desired results. In general, convenient hybridization temperatures in the presence of 50% formamide are: 42° C. for a probe which is 95 to 100% identical to the fragment of a gene encoding a polypeptide as defined herein, 37° C. for 90 to 95% identity and 32° C. for 70 to 90% identity. In the preparation of genomic libraries, DNA fragments are generated, some of which will encode parts or the whole of a polypeptide as defined herein. The DNA may be cleaved at specific sites using various restriction enzymes. Alternatively, one may use DNAse in the presence of manganese to fragment the DNA, or the DNA can be physically sheared, as for example, by sonication. The DNA fragments can then be separated according to size by standard techniques, including but not limited to agarose and polyacrylamide gel electrophoresis, column chromatography and sucrose gradient centrifugation. The DNA fragments can then be inserted into suitable vectors, including but not limited to plasmids, cosmids, bacteriophages lambda or T4, and yeast artificial chromosomes (YACs, see, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 1 D Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Glover, D. M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II; Ausubel F. M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York). The genomic library may be screened by nucleic acid hybridization to labeled probe (Benton and Davis, 1977, Science 196:180; Grunstein and Hogness, 1975, Proc. Natl. Acad. Sci. U.S.A. 72:3961).


[0213] The genomic libraries may be screened with labeled degenerate oligonucleotide probes corresponding to the amino acid sequence of any peptide of the polypeptide as defined herein using optimal approaches well known in the art. Any probe used preferably is 10 nucleotides or longer, more preferably 15 nucleotides or longer.


[0214] When a library is screened, clones with insert DNA encoding the polypeptide or a fragment thereof will hybridize to one or more members of the corresponding set of degenerate oligonucleotide probes (or their complement). Hybridization of such oligonucleotide probes to genomic libraries is carried out using methods known in the art. For example, hybridization with one of the above-mentioned degenerate sets of oligonucleotide probes, or their complement (or with any member of such a set, or its complement) can be performed under highly stringent or moderately stringent conditions as defined above, or can be carried out in 2×SSC, 1.0% SDS at 50° C. and washed using the same conditions.


[0215] In yet another aspect of the invention, clones containing nucleotide sequences encoding the entire polypeptide as defined herein or a part thereof, or a derived polypeptide may also be obtained by screening expression libraries. For example, DNA from the relevant source is isolated and random fragments are prepared and ligated into an expression vector (e.g. a bacteriophage, plasmid, phagemid or cosmid) such that the inserted sequence in the vector is capable of being expressed by the host cell into which the vector is then introduced. Various screening assays can then be used to select for the expressed polypeptide. In one embodiment, the various anti-polypeptide antibodies can be used to identify the desired clones using methods known in the art, (see, for example, Harlow and Lane, 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., Appendix IV). Colonies or plaques from the library are brought into contact with the antibodies to identify those clones that bind antibody.


[0216] In an embodiment, colonies or plaques containing DNA that encodes a polypeptide as defined herein can be detected using DYNA Beads according to Olsvick et al., 29th ICAAC, Houston, Tex. 1989, incorporated herein by reference. Anti-polypeptide antibodies are crosslinked to tosylated DYNA Beads M280, and these antibody-containing beads are then contacted with colonies or plaques expressing recombinant polypeptides. Colonies or plaques expressing a target polypeptide are identified as any of those that bind the beads.


[0217] Alternatively, the anti-polypeptide antibodies can be nonspecifically immobilized to a suitable support, such as silica or Celite T resin. This material is then used to adsorb to bacterial colonies expressing a polypeptide as defined herein.


[0218] In another aspect, PCR amplification may be used to isolate from genomic DNA a substantially pure DNA (i.e. a DNA substantially free of contaminating nucleic acids) encoding the entire a polypeptide as defined herein or a part thereof. Preferably such a DNA is at least 95% pure, more preferably at least 99% pure. Oligonucleotide sequences, degenerate or otherwise, corresponding to known sequences can be used as primers.


[0219] PCR can be carried out, e.g. by use of a Perkin-Elmer Cetus thermal cycler and Taq polymerase (Gene Amp™ or AmpliTaq™ DNA polymerase). One can choose to synthesize several different degenerate primers, for use in the PCR reactions. It is also possible to vary the stringency of hybridization conditions used in priming the PCR reactions, to allow for greater or lesser degrees of nucleotide sequence similarity between the degenerate primers and the corresponding sequences in the DNA. After successful amplification of a segment of the sequence encoding a polypeptide as defined herein, that segment may be molecularly cloned and sequenced, and utilized as a probe to isolate a complete genomic clone. This, in turn, will permit the determination of the gene's complete nucleotide sequence, the analysis of its expression, and the production of its protein product for functional analysis, as described infra.


[0220] The gene encoding a polypeptide as defined herein can also be identified by mRNA selection by nucleic acid hybridization followed by in vitro translation. In this procedure, fragments are used to isolate complementary mRNAs by hybridization. Such DNA fragments may represent available, purified DNA encoding a polypeptide of another species (e.g. mouse, human). Immunoprecipitation analysis or functional assays (e.g. aggregation ability in vitro; binding to receptor) of the in vitro translation products of the isolated products of the isolated mRNAs identifies the mRNA and, therefore, the complementary DNA fragments that contain the desired sequences. In addition, specific mRNAs may be selected by adsorption of polysomes isolated from cells to immobilized antibodies that specifically recognize BCMP84. A radiolabelled cDNA encoding a polypeptide as defined herein can be synthesized using the selected mRNA (from the adsorbed polysomes) as a template. The radiolabelled mRNA or cDNA may then be used as a probe to identify the DNA fragments encoding a polypeptide as defined herein from among other genomic DNA fragments.


[0221] Alternatives to isolating genomic DNA encoding a polypeptide as defined herein include, but are not limited to, chemically synthesizing the gene sequence itself from a known sequence or making cDNA to the mRNA which encodes the polypeptide. For example, RNA for cDNA cloning of the gene can be isolated from cells which express the polypeptide. Other methods are possible and within the scope of the invention.


[0222] Any eukaryotic cell can serve as the nucleic acid source for the molecular cloning of the gene encoding a polypeptide as defined herein. The nucleic acid sequences encoding the polypeptide can be isolated from vertebrate, mammalian, primate, human, porcine, bovine, feline, avian, equine, canine or murine sources. The DNA may be obtained by standard procedures known in the art from cloned DNA (e.g. a DNA “library”), by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell, (see, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Glover, D. M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II.) Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; clones derived from cDNA will contain only exon sequences.


[0223] The identified and isolated gene or cDNA can then be inserted into an appropriate cloning vector. A large number of vector-host systems known in the art may be used. The only limitation is that the vector system chosen be compatible with the host cell used. Such vectors include, but are not limited to, bacteriophages such as lambda derivatives, plasmids such as pBR322 or pUC plasmid derivatives or the Bluescript™ vector (Stratagene) or modified viruses such as adenoviruses, adeno-associated viruses or retroviruses. The insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini. However, if the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules may be enzymatically modified. Alternatively, any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences. In an alternative method, the cleaved vector and the gene encoding a polypeptide as defined herein may be modified by homopolymeric tailing. Recombinant molecules can be introduced into host cells via transformation, transfection, infection, electroporation, etc., so that many copies of the gene sequence are generated.


[0224] In specific embodiments, transformation of host cells with recombinant DNA molecules that incorporate the isolated gene encoding a polypeptide as defined herein, cDNA, or synthesized DNA sequence enables generation of multiple copies of the gene. Thus, the gene may be obtained in large quantities by growing transformants, isolating the recombinant DNA molecules from the transformants and, when necessary, retrieving the inserted gene from the isolated recombinant DNA.


[0225] The nucleotide sequences of the present invention include nucleotide sequences encoding amino acid sequences with substantially the same amino acid sequences as the native polypeptide, and nucleotide sequences encoding amino acid sequences with functionally equivalent amino acids, as well as those encoding other target derivatives or analogues.


[0226] The nucleotide sequence coding for a polypeptide as defined herein or a functionally active derivative or fragment thereof can be inserted into an appropriate expression vector, i.e. a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. The necessary transcriptional and translational signals can also be supplied by the native gene or its flanking regions. A variety of host-vector systems may be utilized to express the protein-coding sequence. These include but are not limited to mammalian cell systems infected with virus (e.g. vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g. baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used. In specific embodiments, a nucleotide sequence encoding a human gene (or a nucleotide sequence encoding a functionally active portion of a human polypeptide as defined herein) is expressed. In yet another embodiment, a fragment of a polypeptide comprising a domain of a polypeptide as defined herein is expressed.


[0227] Any of the methods previously described for the insertion of DNA fragments into a vector may be used to construct expression vectors containing a chimeric gene consisting of appropriate transcriptional and translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of nucleic acid sequence encoding a polypeptide as defined herein or fragment thereof may be regulated by a second nucleic acid sequence so that the polypeptide or fragment is expressed in a host transformed with the recombinant DNA molecule. For example, expression of a polypeptide as defined herein may be controlled by any promoter or enhancer element known in the art. Promoters which may be used to control the expression of the gene encoding a polypeptide as defined herein include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39-42), the tetracycline (Tet) promoter (Gossen et al., 1995, Proc. Nat. Acad. Sci. USA 89:5547-5551); prokaryotic expression vectors such as the β-lactamase promoter (Villa-Kumaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25; see also “Useful proteins from recombinant bacteria” in Scientific American, 1980, 242:74-94); plant expression vectors comprising the nopaline synthetase promoter region (Herrera-Estrella et al., Nature 303:209-213) or the cauliflower mosaic virus 35S RNA promoter (Gardner, et al., 1981, Nucl. Acids Res. 9:2871), and the promoter of the photosynthetic enzyme ribulose biphosphate carboxylase (Herrera-Estrella et al., 1984, Nature 310:115-120); promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, and the following animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al., 1984, Cell 38:639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene control region which is active in pancreatic beta cells (Hanahan, 1985, Nature 315:115-122), immunoglobulin gene control region which is active in lymphoid cells (Grosschedl et al., 1984, Cell 38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et al., 1987, Genes and Devel. 1:268-276), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al., 1987, Science 235:53-58; alpha 1-antitrypsin gene control region which is active in the liver (Kelsey et al., 1987, Genes and Devel. 1:161-171), beta-globin gene control region which is active in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias et a., 1986, Cell 46:89-94; myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead et al., 1987, Cell 48:703-712); myosin light chain-2 gene control region which is active in skeletal muscle (Sani, 1985, Nature 314:283-286); neuronal-specific enolase (NSE) which is active in neuronal cells (Morelli et al., 1999, Gen. Virol. 80:571-83); brain-derived neurotrophic factor (BDNF) gene control region which is active in neuronal cells (Tabuchi et al., 1998, Biochem. Biophysic. Res. Com. 253:818-823); glial fibrillary acidic protein (GFAP) promoter which is active in astrocytes (Gomes et al., 1999, Braz J Med Biol Res 32(5):619-631; Morelli et al., 1999, Gen. Virol. 80:571-83) and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al., 1986, Science 234:1372-1378), the neuronal nicotinic receptor alpha5 subunit gene (Campos-Caro et al. 1999 J Biol Chem. 274, 4693-701); the neuronal nicotinic acetylcholine receptor alpha4 gene (Watanabe et al. 1998 Eur J Neurosci. 10, 2244-53), the neuronal nicotinic receptor alpha7 subunit gene (Carrasco-Serrano et al. 1998 J Biol Chem. 273, 20021-8), the GABA(A) receptor delta subunit gene promoter/upstream region (Luscher et al. 1997 Brain Res Mol Brain Res. 51, 197-211), the rat tyrosine hydroxylase promoter (Robert et al. 1997 J Neurochem. 68, 2152-60), rat aromatic L-amino acid decarboxylase gene (Aguanno et al. 1995 J Neurochem. 65, 1944-54), alpha-internexin promoter (Ching et al. 1991 J Biol Chem. 266, 19459-68), neuronal nicotinic acetylcholine receptor alpha 2 subunit gene (Milton et al. 1995 J Biol Chem. 270, 15143-7), DIA dopamine receptor gene promoter (Severynse et al. 1995 Brain Res Mol Brain Res. 30, 336-46).


[0228] In a specific embodiment, a vector is used that comprises a promoter operably linked to a nucleic acid encoding a polypeptide as defined herein, one or more origins of replication, and, optionally, one or more selectable markers (e.g. an antibiotic resistance gene).


[0229] In a specific embodiment, an expression construct is made by subcloning a polypeptide as defined herein coding sequence into the EcoRI restriction site of each of the three pGEX vectors (Glutathione S-Transferase expression vectors; Smith and Johnson, 1988, Gene 7:31-40). This allows for the expression of the product from the subclone in the correct reading frame.


[0230] In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the coding sequence for a polypeptide as defined herein may be ligated to an adenovirus transcription/translation control complex, e.g. the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g. region E1 or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts (e.g. see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81:355-359). Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol. 153:51-544).


[0231] Expression vectors containing inserts of a gene encoding a polypeptide as defined herein can be identified by three general approaches: (a) nucleic acid hybridization, (b) presence or absence of “marker” gene functions, and (c) expression of inserted sequences. In the first approach, the presence of a gene encoding a polypeptide as defined herein inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted gene encoding a polypeptide as defined herein. In the second approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain “marker” gene functions (e.g. thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of a gene encoding a polypeptide as defined herein in the vector. For example, if the gene is inserted within the marker gene sequence of the vector, recombinants containing the gene insert can be identified by the absence of the marker gene function. In the third approach, recombinant expression vectors can be identified by assaying the gene product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of a polypeptide as defined herein in in vitro assay systems, e.g. binding with an antibody.


[0232] In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Expression from certain promoters can be elevated in the presence of certain inducers; thus, expression of the genetically engineered polypeptide may be controlled. Furthermore, different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g. glycosylation, phosphorylation of proteins). Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system will produce an unglycosylated product and expression in yeast will produce a glycosylated product. Eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, HEK 293, 3T3, WI38, and in particular, neuronal cell lines such as, for example, SK-N-AS, SK-N-FI, SK-N-DZ human neuroblastomas (Sugimoto T et al. 1984 J. Natl. Cancer Inst 73, 51-57), SK-N-SH human neuroblastoma (Biochim. Biophys. Acta 1982 704, 450-460), Daoy human cerebellar medulloblastoma (He et al. 1992 Cancer Res. 52, 1144-1148) DBTRG-05MG glioblastoma cells (Kruse et al. 1992 In Vitro Cell. Dev. Biol. 28A, 609-614), IMR-32 human neuroblastoma (Cancer Res. 1970 30, 2110-2118), 1321N1 human astrocytoma (Proc Natl Acad Sci USA 1977 74, 4816), MOG-G-CCM human astrocytoma (Br J Cancer 1984 49, 269), U87MG human glioblastoma-astrocytoma (Acta Pathol Microbiol Scand 1968;74:465-486), A172 human glioblastoma (Olopade et al. 1992 Cancer Res. 52: 2523-2529), C6 rat glioma cells (Benda et a. 1968 Science 161, 370-371), Neuro-2a mouse neuroblastoma (Proc. Natl. Acad. Sci. USA 1970 65, 129-136), NB41A3 mouse neuroblastoma (Proc. Natl. Acad. Sci. USA 1962 48,1184-1190), SCP sheep choroid plexus (Bolin et al. 1994 J. Virol. Methods 48, 211-221), G355-5, PG-4 Cat normal astrocyte (Haapala et al. 1985 J. Virol. 53, 827-833), Mpf ferret brain (Trowbridge et al. 1982 In Vitro 18 952-960), and normal cell lines such as, for example, CTX TNA2 rat normal cortex brain (Radany et a. 1992 Proc. Natl. Acad. Sci. USA 89, 6467-6471). Furthermore, different vector/host expression systems may effect processing reactions to different extents. For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the differentially expressed or pathway gene protein may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g. promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched medium, and then are switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the differentially expressed or pathway gene protein. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the differentially expressed or, pathway gene protein.


[0233] A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817) genes can be employed in tk, hgprt or aprt cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150:1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30:147) genes.


[0234] In other specific embodiments, a polypeptide as defined herein, fragment, or derivative may be expressed as a fusion, or chimeric protein product (comprising the protein, fragment, or derivative joined via a peptide bond to a heterologous protein sequence). For example, the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CH1, CH2, CH3, or any combination thereof and portions thereof) resulting in chimeric polypeptides. Such fusion proteins may facilitate purification, increase half-life in vivo, and enhance the delivery of an antigen across an epithelial barrier to the immune system. An increase in the half-life in vivo and facilitated purification has been shown for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. See, e.g. EP 394,827; Traunecker et al., Nature, 331:84-86 (1988). Enhanced delivery of an antigen across the epithelial barrier to the immune system has been demonstrated for antigens (e.g. insulin) conjugated to an FcRn binding partner such as IgG or Fc fragments (see, e.g. WO 96/22024 and WO 99/04813).


[0235] Nucleic acids encoding a polypeptide as defined herein can be fused to an epitope tag (e.g. the hemagglutinin (“HA”) tag or flag tag) to aid in detection and purification of the expressed polypeptide. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-897).


[0236] Fusion proteins can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art. Alternatively, a fusion protein may be made by protein synthetic techniques, e.g. by use of a peptide synthesizer. Both cDNA and genomic sequences can be cloned and expressed.


[0237] In accordance with the invention, test samples of breast, bladder or tonsil tissue, serum, plasma or urine obtained from a subject suspected of having or known to have breast, bladder and/or tonsil cancer may be used for diagnosis or monitoring. In one embodiment, a change in the abundance of a polypeptide as defined herein in a test sample relative to a control sample (from a subject or subjects free from breast, bladder and/or tonsil cancer) or a previously determined reference range indicates the presence of breast, bladder and/or tonsil cancer respectively. In another embodiment, the relative abundance of a polypeptide as defined herein in a test sample compared to a control sample or a previously determined reference range indicates a subtype of breast, bladder and/or tonsil cancer (e.g. transitional cell bladder carcinomas or squamous cell bladder carcinoma). In yet another embodiment, the relative abundance of a polypeptide as defined herein in a test sample relative to a control sample or a previously determined reference range indicates the degree or severity of breast, bladder and/or tonsil cancer (e.g. the likelihood for metastasis). In any of the aforesaid methods, detection of a polypeptide as defined herein may optionally be combined with detection of one or more additional biomarkers for breast, bladder and/or tonsil cancer. Many methods standard in the art can be employed to measure the level of a polypeptide as defined herein, including but not limited to the electrophoresis technology described herein, kinase assays, immunoassays to detect and/or visualize the polypeptide (e.g. Western blot, immunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, immunocytochemistry, etc.). In a further embodiment, change in the abundance of mRNA including a polypeptide as defined herein in a test sample relative to a control sample or a previously determined reference range indicates the presence of breast, bladder and/or tonsil cancer. Hybridization assays can be used to detect expression of a polypeptide as defined herein by detecting and/or visualizing mRNA encoding a polypeptide as defined herein (e.g. Northern assays, dot blots, in situ hybridization, etc.).


[0238] In another embodiment of the invention, labeled antibodies, derivatives and analogs thereof, which specifically bind to a polypeptide as defined herein can be used for diagnostic purposes to detect, diagnose, or monitor breast, bladder and/or tonsil cancer. Preferably, breast, bladder and/or tonsil cancer is detected in a mammal and most preferably in a human.


[0239] The invention provides methods for identifying agents, that bind to a polypeptide as defined herein or have a stimulatory or inhibitory effect on the expression or activity of a polypeptide as defined herein. Examples of agents, include, but are not limited to, nucleic acids (e.g. DNA and RNA), carbohydrates, lipids, proteins, peptides, peptidomimetics, small molecules, compounds and other drugs. Agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the “one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des. 12:145; U.S. Pat. Nos. 5,738,996; and 5,807,683, each of which is incorporated herein in its entirety by reference).


[0240] Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al., 1993, Proc. Natl. Acad. Sci. USA 90:6909; Erb et a., 1994, Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al., 1994, J. Med. Chem. 37:2678; Cho et al., 1993, Science 261:1303; Carrell et al., 1994, Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al., 1994, Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al., 1994, J. Med. Chem. 37:1233, each of which is incorporated herein in its entirety by reference.


[0241] Libraries of agents may be presented in solution (e.g. Houghten, 1992, Bio/Techniques 13:412-421), oron beads (Lam, 1991, Nature 354:82-84), chips (Fodor, 1993, Nature 364:555-556), bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat. No. 5,571,698; U.S. Pat. Nos. 5,403,484; and 5,223,409), plasmids (Cull et al., 1992, Proc. Natl. Acad. Sci. USA 89:1865-1869) or phage (Scott and Smith, 1990, Science 249:386-390; Devin, 1990, Science 249:404-406; Cwirla et al., 1990, Proc. Natl. Acad. Sci. USA 87:6378-6382; and Felici, 1991, J. Mol. Biol. 222:301-310), each of which is incorporated herein in its entirety by reference.


[0242] In one embodiment, agents that interact with (i.e. bind to) a polypeptide as defined herein or a biologically active portion thereof are identified in a cell-based assay system. In accordance with this embodiment, cells expressing a polypeptide as defined herein, or other native isoforms of the polypeptide or family members of the polypeptide or related derivatives of such protein or a biological active portion thereof, can be incorporated within such cellular or recombinant expression system and assayed in a primary screen against large libraries of agents. The various forms of the polypeptide described above are contacted with a candidate agent or a control agent and the ability of the candidate agent to interact with the polypeptide is determined, as well as agents that inhibit or enhance the biological activity of the polypeptide. Agents emerging from such primary screen can then be re-assayed against a cellular or recombinantly expressed protein system incorporating the polypeptide of interest. The ability of the candidate agent to interact directly or indirectly with a polypeptide as defined herein in such a secondary assay can be determined by methods known to those of skill in the art. For example, the interaction between a candidate agent and a polypeptide as defined herein can be determined by flow cytometry, a scintillation assay, immunoprecipitation or western blot analysis.


[0243] In another embodiment, agents that interact with (i.e. bind to) a polypeptide as defined herein or a biologically active portion thereof are identified in a cell-based assay system. In accordance with this embodiment, cells expressing a polypeptide as defined herein are contacted with a candidate agent or a control agent and the ability of the candidate agent to interact with the polypeptide is determined. The cell, for example, can be of prokaryotic origin (e.g. E. coli) or eukaryotic origin (e.g. yeast or mammalian). Further, the cells can express the polypeptide endogenously or be genetically engineered to express the polypeptide. In certain instances, a polypeptide as defined herein or the candidate agent are labeled with a radioactive label (e.g. 32P, 35S, and 125I) or a fluorescent label (e.g. fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine) to enable detection of an interaction between the polypeptide and a candidate agent. The ability of the candidate agent to interact directly or indirectly with a polypeptide as defined herein can be determined by methods known to those of skill in the art. For example, the interaction can be determined by flow cytometry, a scintillation assay, immunoprecipitation or western blot analysis.


[0244] In another embodiment, agents that interact with (i.e. bind to) a polypeptide as defined herein or a biologically active portion thereof are identified in a cell-free assay system. In accordance with this embodiment, a native or recombinant polypeptide or biologically active portion thereof is contacted with a candidate agent and the ability of the candidate agent to interact with the polypeptide is determined. Preferably, the polypeptide or biologically active portion is first immobilized, by, for example, contacting the polypeptide with an immobilized antibody which specifically recognizes and binds the polypeptide, or by contacting a purified preparation of the polypeptide with a surface designed to bind proteins. The polypeptide or biologically active portion thereof may be partially or completely purified (e.g. partially or completely free of other polypeptides) or part of a cell lysate. Further, the polypeptide may be a fusion protein comprising the polypeptide or a biologically active portion thereof and a domain such as glutathionine-S-transferase. Alternatively, the polypeptide can be biotinylated using techniques well known to those of skill in the art (e.g. biotinylation kit, Pierce Chemicals; Rockford, Ill.). The ability of the candidate agent to interact with a polypeptide as defined herein can be determined by methods known to those of skill in the art.


[0245] In another embodiment, agents that preferentially interact with (i.e. bind to) a polypeptide as defined herein or a biologically active portion thereof are identified in a competitive binding assay. In accordance with this embodiment, cells expressing a polypeptide are contacted with a candidate agent and an agent known to interact with the polypeptide and the ability of the candidate agent to preferentially interact with the polypeptide is determined. Alternatively, agents that preferentially interact with (i.e. bind to) a polypeptide as defined herein or a biologically active portion thereof are identified in a cell-free assay system by contacting the polypeptide or biologically active portion thereof with a candidate agent and an agent known to interact with the polypeptide. As stated above, the ability of the candidate agent to interact with a polypeptide as defined herein can be determined by methods known to those of skill in the art.


[0246] In another embodiment, agents that modulate (i.e. upregulate or downregulate) the expression or activity of a polypeptide as defined herein are identified by contacting cells (e.g. cells of prokaryotic origin or eukaryotic origin) expressing the polypeptide with a candidate agent or a control agent (e.g. phosphate buffered saline (PBS)) and determining the expression of the polypeptide or mRNA that encodes it. The level of expression of a selected polypeptide or mRNA in the presence of the candidate agent is compared to the level of expression of the polypeptide or mRNA in the absence of the candidate agent (e.g. in the presence of a control agent). The candidate agent can then be identified as a modulator of the expression of the polypeptide based on this comparison. For example, when expression of the polypeptide or mRNA is significantly greater in the presence of the candidate agent than in its absence, the candidate agent is identified as a stimulator of expression of the polypeptide or mRNA. Alternatively, when expression of the polypeptide or mRNA is significantly less in the presence of the candidate agent than in its absence, the candidate agent is identified as an inhibitor of the expression of the polypeptide or mRNA. The level of expression of a polypeptide as defined herein or the mRNA that encodes it can be determined by methods known to those of skill in the art. For example, mRNA expression can be assessed by Northern blot analysis or RT-PCR, and protein levels can be assessed by western blot analysis.


[0247] In another embodiment, agents that modulate the activity of a polypeptide as defined herein or biologically active portion thereof are identified by contacting a preparation containing the polypeptide or biologically active portion thereof or cells (e.g. prokaryotic or eukaryotic cells) expressing the polypeptide or biologically active portion thereof with a candidate agent or a control agent and determining the ability of the candidate agent to modulate (e.g. stimulate or inhibit) the activity of the polypeptide or a biologically active portion thereof. The activity of a polypeptide as defined herein can be assessed by detecting induction of a cellular second messenger or downstream effector of the polypeptide (e.g. intracellular Ca2+, diacylglycerol, IP3, etc.), detecting catalytic or enzymatic activity of the target on an appropriate substrate, detecting the induction of a reporter gene (e.g. a regulatory element that is responsive to the polypeptide and is operably linked to a nucleic acid encoding a detectable marker, e.g. luciferase), or detecting a cellular response, for example, cellular differentiation, or cell proliferation. Techniques known to those of skill in the art can be used for measuring these activities (see, e.g. U.S. Pat. No. 5,401,639, which is incorporated herein by reference). The candidate agent can then be identified as a modulator of the activity of a polypeptide as defined herein by comparing the effects of the candidate agent to the control agent. Suitable control agents include phosphate buffered saline (PBS) and normal saline (NS).


[0248] In another embodiment, agents that modulate (e.g. upregulate or downregulate) the expression, activity or both the expression and activity of a polypeptide as defined herein or biologically active portion thereof are identified in an animal model. Examples of suitable animals include, but are not limited to, mice, rats, rabbits, monkeys, guinea pigs, dogs and cats. Preferably, the animal used represents a model of breast, bladder and/or tonsil cancer. In accordance with this embodiment, the candidate agent or a control agent is administered (e.g. orally, rectally or parenterally such as intraperitoneally or intravenously) to a suitable animal and the effect on the expression, activity or both expression and activity of the polypeptide is determined. Changes in the expression of the polypeptide can be assessed by the methods outlined above. Alternatively, agents may be identified by monitoring the effect of their administration on symptoms associated with the disease or condition to be treated (e.g. to ameliorate symptoms or to delay onset or slow the progression of the disease). Therefore in a further embodiment, agents that reduce the severity of one or more symptoms associated with the disease or that slow the progression of the disease in a group of mammals treated with the candidate agent, compared to a untreated group of mammals are identified as potential active agents for the treatment of the disease. Techniques known to physicians familiar with breast, bladder and/or tonsil cancer can be used to determine whether a candidate agent has altered one or more symptoms associated with the disease. For example, a candidate agent that is able to shrink tumor size in an animal model of breast, bladder and/or tonsil cancer may be beneficial for treating subjects having breast, bladder and/or tonsil cancer.


[0249] In yet another embodiment, a polypeptide as defined herein or biologically active portion thereof is used as a “bait protein” in a two-hybrid assay or three hybrid assay to identify other proteins that bind to or interact with the polypeptide or biologically active portion thereof (see, e.g. U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054; Bartel et al. (1993) Bio/Techniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-1696; and WO 94/10300). Such binding proteins are also likely to be involved in the propagation of signals by the polypeptide as, for example, upstream or downstream elements of a signaling pathway involving the polypeptide.


[0250] This invention further provides agents identified by the above-described screening assays and uses thereof for treatments as described herein. In addition, the invention also provides the use of an agent which interacts with, or modulates the activity of a polypeptide as defined herein in the manufacture of a medicament for the treatment of breast, bladder and/or tonsil cancer.


[0251] The invention provides for treatment or prevention of various diseases and disorders by administration of a therapeutic agent. Such agents include but are not limited to: a polypeptide as defined herein and derivatives (including fragments) thereof; antibodies thereto; nucleic acids encoding a polypeptide as defined herein or derivatives; anti-sense nucleic acids to a gene encoding a polypeptide as defined herein, and agonists and antagonists of a gene encoding a polypeptide as defined herein or agonists and antagonists of a polypeptide as defined herein, and agents identified by the above-described screening assays as defined herein. Such agents are hereinafter referred to “active agents”. An important feature of the present invention is the identification of genes encoding a polypeptide as defined herein involved in cancer, e.g. breast, bladder and/or tonsil cancer. Cancer can be treated or prevented by administration of an active agent that reduces function or expression of a polypeptide as defined herein in the breast, bladder and/or tonsil tissue of breast, bladder and/or tonsil cancer patients.


[0252] In one embodiment, one or more antibodies each specifically binding to a polypeptide as defined herein are administered alone or in combination with one or more additional therapeutic compounds or treatments. Examples of such treatments include, but are not limited to, taxol, cyclophosphamide, tamoxifen, and doxorubicin.


[0253] Preferably, a biological product such as an antibody is allogeneic to the subject to which it is administered.


[0254] Breast, bladder and/or tonsil cancer can be treated or prevented by administration to a subject suspected of having or known to have breast, bladder and/or tonsil cancer or to be at risk of developing breast, bladder and/or tonsil cancer of an active agent that modulates (i.e. increases or decreases) the level or activity (i.e. function) of a polypeptide as defined herein. In one embodiment, an active agent is administered that upregulates (i.e. increases) the level or activity (i.e. function) of a polypeptide as defined herein. Examples of such an active agent include but are not limited to: a polypeptide as defined herein, derivatives or fragments thereof that are functionally active (e.g. in in vitro assays or in animal models as described above), nucleic acids encoding a polypeptide as defined herein or functionally active derivative or fragment thereof (e.g. for use in gene therapy). Other compounds that can be used, e.g. agonists, can be identified using in vitro assays see above.


[0255] Breast, bladder and/or tonsil cancer can also be treated or prevented by administration to a subject suspected of having or known to have breast, bladder and/or tonsil cancer or to be at risk of developing breast, bladder and/or tonsil cancer of an active agent that downregulates the level or activity of a polypeptide as defined herein. Examples of such an active agent include but are not limited to anti-sense oligonucleotides, ribozymes, or antibodies directed against polypeptides as defined herein. Other active agents that can be used, e.g. antagonists and small molecule antagonists, can be identified using in vitro assays, see above.


[0256] In a preferred embodiment, therapy or prophylaxis is tailored to the needs of an individual subject. In certain embodiments, active agents that decrease the level or function of a polypeptide as defined herein are therapeutically or prophylactically administered to a subject suspected of having or known to have breast, bladder and/or tonsil cancer.


[0257] The change in function or level of a polypeptide as defined herein due to the administration of such active agents can be readily detected, e.g. by obtaining a breast, bladder or tonsil tissue sample (e.g. from biopsy tissue) and assaying in vitro the levels of said polypeptide, or the level of mRNAs encoding said polypeptide, or any combination of the foregoing. Such assays can be performed before and after the administration of the active agent as described herein.


[0258] The active agents of the invention include but are not limited to any compound, e.g. a small organic molecule, protein, peptide, antibody, nucleic acid, etc. that restores the profile towards normal with the proviso that such compounds or treatments include, but are not limited to, taxol, cyclophosphamide, tamoxifen, and doxorubacin.


[0259] A polypeptide as defined herein may be useful as antigenic material, and may be used in the production of vaccines for treatment or prophylaxis of breast, bladder and/or tonsil cancer. Such material can be “antigenic” and/or “immunogenic”. Generally, “antigenic” is taken to mean that the protein is capable of being used to raise antibodies or indeed is capable of inducing an antibody response in a subject. “Immunogenic” is taken to mean that the protein is capable of eliciting an immune response in a subject. Thus, in the latter case, the protein may be capable of not only generating an antibody response but, in addition, non-antibody based immune responses.


[0260] It is well known that is possible to screen an antigenic protein or polypeptide to identify epitopic regions, i.e. those regions which are responsible for the protein or polypeptide's antigenicity or immunogenicity. Methods well known to the skilled person can be used to test fragments and/or derivatives for antigenicity. Thus, the fragments of the present invention should include one or more such epitopic regions or be sufficiently similar to such regions to retain their antigenic/immunogenic properties. Thus, for fragments according to the present invention the degree of identity is perhaps irrelevant, since they may be 100% identical to a particular part of a protein or polypeptide or derivative as described herein. The key issue, once again, is that the fragment retains the antigenic/immunogenic properties of the protein from which it is derived.


[0261] What is important for derivatives and fragments is that they possess at least a degree of the antigenicity/immunogenicity of the protein or polypeptide from which they are derived.


[0262] A polypeptide as defined herein, or antigenic fragments thereof, can be provided alone, as a purified or isolated preparation. It may be provided as part of a mixture with one or more other protein features of the invention, or antigenic fragments thereof. In a further aspect, therefore, the invention provides an antigen composition comprising a polypeptide as defined herein and/or one or more antigenic fragments thereof. Such a composition can be used for the detection and/or diagnosis of breast, bladder and/or tonsil cancer.


[0263] In a further aspect, the present invention provides a method of detecting and/or diagnosing breast, bladder and/or tonsil cancer which comprises:


[0264] i). bringing into contact with a sample to be tested an antigenic polypeptide as defined herein, or an antigenic fragment thereof, or an antigen composition of the invention; and


[0265] ii). detecting the presence of antibodies to breast, bladder and/or tonsil cancer.


[0266] In particular, the protein, antigenic fragment thereof or antigen composition of the present invention can be used to detect IgA, IgM or IgG antibodies. Suitably, the sample to be tested will be a biological sample, e.g. a sample of blood, saliva or breast, bladder and/or tonsil tissue.


[0267] In a further aspect, the invention provides the use of an antigenic polypeptide as defined herein, antigenic fragment thereof or an antigenic composition of the present invention in detecting and/or diagnosing breast, bladder and/or tonsil cancer. Preferably, the detecting and/or diagnosing is carried out in vitro.


[0268] The antigenic polypeptides, antigenic fragments thereof or antigenic composition of the present invention can be provided as a kit for use in the in vitro detection and/or diagnosis of breast, bladder and/or tonsil cancer. Thus, in a still further aspect, the present invention provides a kit for use in the detection and/or diagnosis of breast, bladder and/or tonsil cancer, which kit comprises an antigenic polypeptide, an antigenic fragment thereof or an antigenic composition of the present invention.


[0269] In addition, the antigenic polypeptide, antigenic fragment thereof or antigen composition of the invention can be used to induce an immune response against breast, bladder and/or tonsil cancer. Thus, in a yet further aspect, the invention provides the use of an antigenic polypeptide, an antigenic fragment thereof or an antigen composition of the invention in medicine.


[0270] In a further aspect, the present invention provides a composition capable of eliciting an immune response in a subject, which composition comprises a polypeptide, an antigenic fragment thereof, or an antigen composition of the invention. Suitably, the composition will be a vaccine composition, optionally comprising one or more suitable adjuvants. Such a vaccine composition may be either a prophylactic or therapeutic vaccine composition.


[0271] The vaccine compositions of the invention can include one or more adjuvants. Examples well-known in the art include inorganic gels, such as aluminium hydroxide, and water-in-oil emulsions, such as incomplete Freund's adjuvant. Other useful adjuvants will be well known to the skilled person.


[0272] In yet further aspects, the present invention provides:


[0273] (a) the use of a polypeptide as defined herein, an antigenic fragment thereof, or an antigen composition of the invention in the preparation of an immunogenic composition, preferably a vaccine;


[0274] (b) the use of such an immunogenic composition in inducing an immune response in a subject; and


[0275] (c) a method for the treatment or prophylaxis of breast, bladder and/or tonsil cancer in a subject, or of vaccinating a subject against breast, bladder and/or tonsil cancer which comprises the step of administering to the subject an effective amount of a polypeptide as defined herein, at least one antigenic fragment thereof or an antigen composition of the invention, preferably as a vaccine.


[0276] In a specific embodiment, a preparation of a polypeptide as defined herein or fragment thereof is used as a vaccine for the treatment of breast, bladder and/or tonsil cancer. Such preparations may include adjuvants or other vehicles.


[0277] In another embodiment, a preparation of oligonucleotides comprising 10 or more consecutive nucleotides complementary to a nucleotide sequence encoding a polypeptide as defined herein or fragment thereof for use as vaccines for the treatment of breast, bladder and/or tonsil cancer. Such preparations may include adjuvants or other vehicles.


[0278] In a specific embodiment, nucleic acids comprising a sequence encoding a polypeptide as defined herein or functional derivative thereof, are administered to promote polypeptide function by way of gene therapy. Gene therapy refers to administration to a subject of an expressed or expressible nucleic acid. In this embodiment, the nucleic acid produces its encoded protein that mediates a therapeutic effect by promoting polypeptide function.


[0279] Any of the methods for gene therapy available in the art can be used according to the present invention. Exemplary methods are described below.


[0280] For general reviews of the methods of gene therapy, see Goldspiel et al., 1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIBTECH 11 (5):155-215). Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; and Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY.


[0281] In a preferred aspect, the compound comprises a nucleic acid as defined herein, such as a nucleic acid encoding a polypeptide as defined herein or fragment or chimeric protein thereof, said nucleic acid being part of an expression vector that expresses a polypeptide as defined herein or fragment or chimeric protein thereof in a suitable host. In particular, such a nucleic acid has a promoter operably linked to the polypeptide coding region, said promoter being inducible or constitutive (and, optionally, tissue-specific). In another particular embodiment, a nucleic acid molecule is used in which the coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the nucleic acid (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijistra et al., 1989, Nature 342:435-438).


[0282] Delivery of the nucleic acid into a patient may be direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid-carrying vector; this approach is known as in vivo gene therapy. Alternatively, delivery of the nucleic acid into the patient may be indirect, in which case cells are first transformed with the nucleic acid in vitro and then transplanted into the patient; this approach is known as ex vivo gene therapy.


[0283] In a specific embodiment, the nucleic acid is directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by any of numerous methods known in the art, e.g. by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g. by infection using a defective or attenuated retroviral or other viral vector (see U.S. Pat. No. 4,980,286); by direct injection of naked DNA; by use of microparticle bombardment (e.g. a gene gun; Biolistic™, Dupont); by coating with lipids, cell-surface receptors or transfecting agents; by encapsulation in liposomes, microparticles or microcapsules; by administering it in linkage to a peptide which is known to enter the nucleus; or by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g. Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), which can be used to target cell types specifically expressing the receptors. In another embodiment, a nucleic acid-ligand complex can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g. WO 92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221). Alternatively, the nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al., 1989, Nature 342:435-438).


[0284] In a specific embodiment, a viral vector that contains a nucleic acid as defined herein is used. For example, a retroviral vector can be used (see Miller et al., 1993, Meth. Enzymol. 217:581-599). These retroviral vectors have been modified to delete retroviral sequences that are not necessary for packaging of the viral genome and integration into host cell DNA. The nucleic acid is cloned into the vector, which facilitates delivery of the gene into a patient. More detail about retroviral vectors can be found in Boesen et al., 1994, Biotherapy 6:291-302, which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., 1994, J. Clin. Invest. 93:644-651; Kiem et al., 1994, Blood 83:1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-141; and Grossman and Wilson, 1993, Curr. Opin. in Genetics and Devel. 3:110-114.


[0285] Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, 1993, Current Opinion in Genetics and Development 3:499-503 present a review of adenovirus-based gene therapy. Bout et al., 1994, Human Gene Therapy 5:3-10 demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., 1991, Science 252:431-434; Rosenfeld et al., 1992, Cell 68:143-155; Mastrangeli et al., 1993, J. Clin. Invest. 91:225-234; WO94/12649; and Wang, et al., 1995, Gene Therapy 2:775-783.


[0286] Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; U.S. Pat. No. 5,436,146).


[0287] Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a patient.


[0288] In this embodiment, the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell. Such introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc. Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g. Loeffler and Behr, 1993, Meth. Enzymol. 217:599-618; Cohen et al., 1993, Meth. Enzymol. 217:618-644; Cline, 1985, Pharmac. Ther. 29:69-92) and may be used in accordance with the present invention, provided that the necessary developmental and physiological functions of the recipient cells are not disrupted. The technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.


[0289] The resulting recombinant cells can be delivered to a patient by various methods known in the art. In a preferred embodiment, epithelial cells are injected, e.g. subcutaneously. In another embodiment, recombinant skin cells may be applied as a skin graft onto the patient. Recombinant blood cells (e.g. hematopoietic stem or progenitor cells) are preferably administered intravenously. The amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art.


[0290] Cells into which a nucleic acid can be introduced for purposes of gene therapy encompass any desired, available cell type, and include but are not limited to neuronal cells, glial cells (e.g. oligodendrocytes or astrocytes), epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g. as obtained from bone marrow, umbilical cord blood, peripheral blood or fetal liver.


[0291] In a preferred embodiment, the cell used for gene therapy is autologous to the patient.


[0292] In an embodiment in which recombinant cells are used in gene therapy, a nucleic acid encoding a polypeptide as defined herein is introduced into the cells such that it is expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect. In a specific embodiment, stem or progenitor cells are used. Any stem or progenitor cells which can be isolated and maintained in vitro can be used in accordance with this embodiment of the present invention (see e.g. WO 94/08598,; Stemple and Anderson, 1992, Cell 71:973-985; Rheinwald, 1980, Meth. Cell Bio. 21A:229; and Pittelkow and Scott, 1986, Mayo Clinic Proc. 61:771).


[0293] In a specific embodiment, the nucleic acid to be introduced for purposes of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the appropriate inducer of transcription.


[0294] Direct injection of a DNA coding for a polypeptide as defined herein may also be performed according to, for example, the techniques described in U.S. Pat. No. 5,589,466. These techniques involve the injection of “naked DNA”, i.e. isolated DNA molecules in the absence of liposomes, cells, or any other material besides a suitable carrier. The injection of DNA encoding a protein and operably linked to a suitable promoter results in the production of the protein in cells near the site of injection and the elicitation of an immune response in the subject to the protein encoded by the injected DNA. In a preferred embodiment, naked DNA comprising (a) DNA encoding a polypeptide as defined herein and (b) a promoter are injected into a subject to elicit an immune response to the polypeptide.


[0295] In one embodiment of the invention, breast, bladder and/or tonsil cancer is treated or prevented by administration of an active agent that modulates the level(s) and/or function(s) of a polypeptide as defined herein.


[0296] In another embodiment, breast, bladder and/or tonsil cancer is treated or prevented by administration of an active agent that modulates the level(s) and/or function(s) of enzymes acting on a polypeptide as defined herein.


[0297] Active agents useful for this purpose include but are not limited to anti-polypeptide antibodies (and fragments and derivatives containing the binding region thereof), a polypeptide as defined herein anti-sense or ribozyme nucleic acids, and nucleic acids encoding a dysfunctional polypeptide as defined herein that are used to “knockout” endogenous polypeptide function by homologous recombination (see, e.g. Capecchi, 1989, Science 244:1288-1292). Other agents that modulate function of a polypeptide as defined herein, or modulate the level(s) and/or function(s) of enzymes acting upon a polypeptide as defined herein can be identified by use of known in vitro assays, e.g. assays for the ability of a candidate agent to modulate binding of the polypeptide to another protein or a binding partner, or to modulate a known polypeptide function. Preferably such modulation is assayed in vitro or in cell culture, but genetic assays may also be employed. The electrophoresis technology can also be used to detect levels of the polypeptide before and after the administration of the agent. Preferably, suitable in vitro or in vivo assays are utilized to determine the effect of a specific agent and whether its administration is indicated for treatment of the affected tissue, as described in more detail herein.


[0298] In a specific embodiment, an active agent that modulates function of a polypeptide as defined herein is administered therapeutically or prophylactically to a subject in whom an increased breast, bladder and/or tonsil tissue level or functional activity of the polypeptide (e.g. greater than the normal level or desired level) is detected as compared with breast, bladder and/or tonsil tissue of subjects free from breast, bladder and/or tonsil cancer or a predetermined reference range. Methods standard in the art can be employed to measure the increase in level or function, as outlined above. Preferred inhibitor compositions include small molecules, i.e. molecules of 1000 Daltons or less. Such small molecules can be identified by the screening methods described herein.


[0299] In a specific embodiment, expression of a polypeptide as defined herein is inhibited by use of anti-sense nucleic acids. The present invention provides the therapeutic or prophylactic use of nucleic acids comprising at least six nucleotides that are anti-sense to a gene or cDNA encoding a polypeptide as defined herein or a portion thereof. As used herein, an “anti-sense” nucleic acid refers to a nucleic acid capable of hybridizing by virtue of some sequence complementarity to a portion of an RNA (preferably mRNA) encoding a polypeptide as defined herein. The anti-sense nucleic acid may be complementary to a coding and/or noncoding region of a mRNA encoding such a polypeptide. Such anti-sense nucleic acids have utility as agents that inhibit expression, and can be used in the treatment or prevention of breast, bladder and/or tonsil cancer.


[0300] The anti-sense nucleic acids of the invention are double-stranded or single-stranded oligonucleotides, RNA or DNA or a modification or derivative thereof, and can be directly administered to a cell or produced intracellularly by transcription of exogenous, introduced sequences.


[0301] The invention further provides pharmaceutical compositions comprising an effective amount of an anti-sense nucleic acid of the invention in a pharmaceutically acceptable carrier, as described infra.


[0302] In another embodiment, the invention provides methods for inhibiting the expression of a nucleic acid sequence encoding a polypeptide as defined herein in a prokaryotic or eukaryotic cell comprising providing the cell with an effective amount of a composition comprising an anti-sense nucleic acid of the invention.


[0303] Anti-sense nucleic acids and their uses are described in detail below.


[0304] The anti-sense nucleic acids of the present invention are of at least six nucleotides and are preferably oligonucleotides ranging from 6 to about 50 oligonucleotides. In specific aspects, the oligonucleotide is at least 10 nucleotides, at least 15 nucleotides, at least 100 nucleotides, or at least 200 nucleotides. The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof and can be single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone. The oligonucleotide may include other appended groups such as peptides; agents that facilitate transport across the cell membrane (see, e.g. Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; WO 88/09810,) or blood-brain barrier (see, e.g. WO 89/10134,); hybridization-triggered cleavage agents (see, e.g. Krol et al., 1988, BioTechniques 6:958-976) or intercalating agents (see, e.g. Zon, 1988, Pharm. Res. 5:539-549).


[0305] In a preferred aspect of the invention, an anti-sense oligonucleotide for a polypeptide as defined herein is provided, preferably of single-stranded DNA. The oligonucleotide may be modified at any position on its structure with substituents generally known in the art.


[0306] The anti-sense oligonucleotide may comprise at least one of the following modified base moieties: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methy(cytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, 2,6-diaminopurine, and other base analogs.


[0307] In another embodiment, the oligonucleotide comprises at least one modified sugar moiety, e.g. one of the following sugar moieties: arabinose, 2-fluoroarabinose, xylulose, and hexose.


[0308] In yet another embodiment, the oligonucleotide comprises at least one of the following modified phosphate backbones: a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, a formacetal, or an analog of formacetal.


[0309] In yet another embodiment, the oligonucleotide is an α-anomeric oligonucleotide. An α-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).


[0310] The oligonucleotide may be conjugated to another molecule, e.g. a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent.


[0311] Oligonucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), and methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. USA 85:7448-7451).


[0312] In a specific embodiment, the anti-sense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector can be introduced in vivo such that it is taken up by a cell, within which cell the vector or a portion thereof is transcribed, producing an anti-sense nucleic acid (RNA) of the invention. Such a vector would contain a sequence encoding the anti-sense nucleic acid. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired anti-sense RNA. Such vectors can be constructed by recombinant DNA technology standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells. Expression of the sequence encoding the anti-sense RNA can be by any promoter known in the art to act in mammalian, preferably human, cells. Such promoters can be inducible or constitutive. Examples of such promoters are outlined above.


[0313] The anti-sense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a gene encoding a polypeptide as defined herein, preferably a human gene. However, absolute complementarity, although preferred, is not required. A sequence “complementary to at least a portion of an RNA,” as referred to herein, means a sequence having sufficient complementarity to be able to hybridize under stringent conditions (e.g. highly stringent conditions comprising hybridization in 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C. and washing in 0.1×SSC/0.1% SDS at 68° C., or moderately stringent conditions comprising washing in 0.2×SSC/0.1% SDS at 42° C.) with the RNA, forming a stable duplex; in the case of double-stranded BCMP84 anti-sense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the anti-sense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA encoding a polypeptide as defined herein it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.


[0314] The anti-sense nucleic acids can be used to treat or prevent breast, bladder and/or tonsil cancer. In a preferred embodiment, a single-stranded DNA anti-sense oligonucleotide is used.


[0315] Cell types which express or overexpress RNA encoding a polypeptide as defined herein can be identified by various methods known in the art. Such cell types include but are not limited to leukocytes (e.g. neutrophils, macrophages, monocytes) and resident cells (e.g. astrocytes, glial cells, neuronal cells, and ependymal cells). Such methods include, but are not limited to, hybridization with a nucleic acid specific for a polypeptide as defined herein (e.g. by Northern hybridization, dot blot hybridization, in situ hybridization), observing the ability of RNA from the cell type to be translated in vitro into a polypeptide as defined herein, immunoassay, etc. In a preferred aspect, primary tissue from a patient can be assayed for expression prior to treatment, e.g. by immunocytochemistry or in situ hybridization.


[0316] Pharmaceutical compositions of the invention, comprising an effective amount of an anti-sense nucleic acid in a pharmaceutically acceptable carrier, can be administered to a patient having breast, bladder and/or tonsil cancer.


[0317] The amount of anti-sense nucleic acid which will be effective in the treatment of breast, bladder and/or tonsil cancer can be determined by standard clinical techniques.


[0318] In a specific embodiment, pharmaceutical compositions comprising one or more anti-sense nucleic acids are administered via liposomes, microparticle's, or microcapsules. In various embodiments of the invention, such compositions may be used to achieve sustained release of the anti-sense nucleic acids. In a specific embodiment, it may be desirable to use liposomes targeted via antibodies to specific identifiable tumor antigens (Leonetti et al., 1990, Proc. Natl. Acad. Sci. USA 87:2448-2451; Renneisen et al., 1990, J. Biol. Chem. 265:16337-16342).


[0319] In another embodiment, symptoms of breast, bladder and/or tonsil cancer may be ameliorated by decreasing the level or activity of a polypeptide as defined herein by using gene sequences encoding a polypeptide as defined herein in conjunction with well-known gene “knock-out,” ribozyme or triple helix methods to decrease gene expression of the polypeptide. In this approach, ribozyme or triple helix molecules are used to modulate the activity, expression or synthesis of the gene, and thus to ameliorate the symptoms of breast, bladder and/or tonsil cancer. Such molecules may be designed to reduce or inhibit expression of a mutant or non-mutant target gene. Techniques for the production and use of such molecules are well known to those of skill in the art. Ribozyme molecules designed to catalytically cleave gene mRNA transcripts encoding a polypeptide as defined herein can be used to prevent translation of target gene mRNA and, therefore, expression of the gene product, (see, e.g. WO90/11364; Sarver et al., 1990, Science 247:1222-1225).


[0320] Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA, (for a review, see Rossi, 1994, Current Biology 4, 469-471). The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage event. The composition of ribozyme molecules must include one or more sequences complementary to the target gene mRNA, and must include the well known catalytic sequence responsible for mRNA cleavage. For this sequence, see, e.g. U.S. Pat. No. 5,093,246, which is incorporated herein by reference in its entirety.


[0321] While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy mRNAs encoding a polypeptide as defined herein, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5′-UG-3′. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Myers, 1995, Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, New York, (see especially FIG. 4, page 833) and in Haseloff and Gerlach, 1988, Nature, 334, 585-591, each of which is incorporated herein by reference in its entirety.


[0322] Preferably the ribozyme is engineered so that the cleavage recognition site is located near the 5′ end of the mRNA encoding a polypeptide as defined herein, i.e. to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.


[0323] The ribozymes of the present invention also include RNA endoribonucleases (hereinafter “Cech-type ribozymes”) such as the one that occurs naturally in Tetrahymena thermophila (known as the IVS, or L-19 IVS RNA) and that has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224, 574-578; Zaug and Cech, 1986, Science, 231, 470-475; Zaug, et al., 1986, Nature, 324, 429-433; WO 88/04300; Been and Cech, 1986, Cell, 47, 207-216). The Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present in the gene encoding a polypeptide as defined herein.


[0324] As in the anti-sense approach, the ribozymes can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells that express a polypeptide as defined herein in vivo. A preferred method of delivery involves using a DNA construct “encoding” the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous mRNA encoding the polypeptide and inhibit translation. Because ribozymes, unlike anti-sense molecules, are catalytic, a lower intracellular concentration is required for efficacy.


[0325] Endogenous polypeptide expression can also be reduced by inactivating or “knocking out” the gene encoding the polypeptide, or the promoter of such a gene, using targeted homologous recombination (e.g. see Smithies, et al., 1985, Nature 317:230-234; Thomas and Capecchi, 1987, Cell 51:503-512; Thompson et al., 1989, Cell 5:313-321; and Zijlstra et al., 1989, Nature 342:435-438, each of which is incorporated by reference herein in its entirety). For example, a mutant gene encoding a non-functional polypeptide (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous gene (either the coding regions or regulatory regions of the gene encoding the polypeptide) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express the target gene in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the target gene. Such approaches are particularly suited in the agricultural field where modifications to ES (embryonic stem) cells can be used to generate animal offspring with an inactive target gene (e.g. see Thomas and Capecchi, 1987 and Thompson, 1989, supra). However this approach can be adapted for use in humans provided the recombinant DNA constructs are directly administered or targeted to the required site in vivo using appropriate viral vectors.


[0326] Alternatively, the endogenous expression of a gene encoding a polypeptide as defined herein can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the gene (i.e. the gene promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells in the body. (See generally, Helene, 1991, Anticancer Drug Des., 6(6), 569-584; Helene, et al., 1992, Ann. N.Y. Acad. Sci., 660, 27-36; and Maher, 1992, Bioassays 14(12), 807-815).


[0327] Nucleic acid molecules to be used in triplex helix formation for the inhibition of transcription should be single stranded and composed of deoxynucleotides. The base composition of these oligonucleotides must be designed to promote triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of either purines or pyrimidines to be present on one strand of a duplex. Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC+ triplets across the three associated strands of the resulting triple helix. The pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand. In addition, nucleic acid molecules may be chosen that are purine-rich, for example, contain a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in GGC triplets across the three strands in the triplex.


[0328] Alternatively, the potential sequences that can be targeted for triple helix formation may be increased by creating a so called “switchback” nucleic acid molecule. Switchback molecules are synthesized in an alternating 5′-3′, 3′-5′ manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex.


[0329] Anti-sense RNA and DNA, ribozyme, and triple helix molecules of the invention may be prepared by any method known in the art for the synthesis of DNA and RNA molecules, as discussed above. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the anti-sense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, anti-sense cDNA constructs that synthesize anti-sense RNA constitutively or inducible, depending on the promoter used, can be introduced stably into cell lines.


[0330] The present invention also provides assays for use in drug discovery in order to identify or verify the efficacy of compounds for treatment or prevention of breast, bladder and/or tonsil cancer. Candidate agents can be assayed for their ability to modulate levels of a polypeptide as defined herein in a subject having breast, bladder and/or tonsil cancer.


[0331] Agents able to modulate levels of a polypeptide as defined herein in a subject having breast, bladder and/or tonsil cancer towards levels found in subjects free from breast, bladder and/or tonsil cancer or to produce similar changes in experimental animal models of breast, bladder and/or tonsil cancer can be used as lead agents for further drug discovery, or used therapeutically. Expression of a polypeptide as defined herein can be assayed by electrophoresis technology, immunoassays, gel electrophoresis followed by visualization, detection of activity, or any other method taught herein or known to those skilled in the art. Such assays can be used to screen candidate agents, in clinical monitoring or in drug development, where abundance of a polypeptide as defined herein can serve as a surrogate marker for clinical disease.


[0332] In various specific embodiments, in vitro assays can be carried out with cells representative of cell types involved in a patient's disorder, to determine if an agent has a desired effect upon such cell types.


[0333] Agents for use in therapy can be tested in suitable animal model systems prior to testing in humans, including but not limited to rats, mice, chicken, cows, monkeys, rabbits, etc. For in vivo testing, prior to administration to humans, any animal model system known in the art may be used. Examples of animal models of breast cancer include, but are not limited to xenografts of human breast cancer cell lines such as MDA-MB-435 in estrogen-deprived Severe Combined Immunodeficient (SCID) mice (Eccles et al., 1994 Cell Biophysics 24/25, 279). These can be utilized to test agents that modulate a polypeptide as defined herein levels, since the pathology exhibited in these models is similar to that of breast cancer, corresponding models may be used for bladder and tonsil cancer.


[0334] In one embodiment, candidate agents that modulate the expression of a polypeptide as defined herein are identified in non-human animals (e.g. mice, rats, monkeys, rabbits, and guinea pigs), preferably non-human animal models for breast, bladder and/or tonsil cancer cancer, expressing BCMP84. In accordance with this embodiment, a candidate agent or a control agent is administered to the animals, and the effect of the candidate agent on expression of the polypeptide is determined.


[0335] A candidate agent that alters the expression of a polypeptide as defined herein can be identified by comparing the level of the polypeptide (or mRNA(s) encoding the same) in an animal or group of animals treated with a candidate agent with the level of the polypeptide or mRNA(s) in an animal or group of animals treated with a control agent. Techniques known to those of skill in the art can be used to determine the mRNA and protein levels, for example, in situ hybridization. The animals may or may not be sacrificed to assay the effects of a candidate agent.


[0336] In another embodiment, candidate agents that modulate the activity of a polypeptide as defined herein or a biologically active portion thereof are identified in non-human animals (e.g. mice, rats, monkeys, rabbits, and guinea pigs), preferably non-human animal models for breast, bladder and/or tonsil cancer, expressing the polypeptide. In accordance with this embodiment, a candidate agent or a control agent is administered to the animals, and the effect of the candidate agent on the activity of the polypeptide is determined. A candidate agent that alters the activity of the polypeptide can be identified by assaying animals treated with a control agent and animals treated with the candidate agent. The activity of the polypeptide can be assessed by detecting induction of a cellular second messenger or downstream effector of the polypeptide (e.g. intracellular Ca2+, diacylglycerol, IP3, etc.), detecting catalytic or enzymatic activity of the polypeptide or binding partner thereof, detecting the induction of a reporter gene (e.g. a regulatory element that is responsive to the polypeptide operably linked to a nucleic acid encoding a detectable marker, such as luciferase or green fluorescent protein), or detecting a cellular response (e.g. cellular differentiation or cell proliferation). Techniques known to those of skill in the art can be utilized to detect changes in the activity of a polypeptide (see, e.g. U.S. Pat. No. 5,401,639, which is incorporated herein by reference).


[0337] In yet another embodiment, candidate agents that modulate the level or expression of a polypeptide as defined herein are identified in human subjects having breast, bladder and/or tonsil cancer, preferably those having severe breast, bladder and/or tonsil cancer. In accordance with this embodiment, a candidate agent or a control agent is administered to the human subject, and the effect of a candidate agent on expression is determined by analyzing the expression of the polypeptide or the mRNA encoding the same in a biological sample (e.g. breast, bladder or tonsil tissue, serum, plasma, or urine). A candidate agent that alters the expression of a polypeptide can be identified by comparing the level of the polypeptide or mRNA encoding the same in a subject or group of subjects treated with a control agent to that in a subject or group of subjects treated with a candidate agent. Alternatively, alterations in the expression of a polypeptide can be identified by comparing the level of the polypeptide or mRNA encoding the same in a subject or group of subjects before and after the administration of a candidate agent. Techniques known to those of skill in the art can be used to obtain the biological sample and analyze the mRNA or protein expression. For example, the electrophoresis technology described herein can be used to assess changes in the level of a polypeptide as defined herein.


[0338] In another embodiment, candidate agents that modulate the activity of a polypeptide as defined herein are identified in human subjects having breast, bladder and/or tonsil cancer, (preferably those having severe breast, bladder and/or tonsil cancer). In this embodiment, a candidate agent or a control agent is administered to the human subject, and the effect of a candidate agent on the activity of the polypeptide is determined. A candidate agent that alters the activity of the polypeptide can be identified by comparing biological samples from subjects treated with a control agent to samples from subjects treated with the candidate agent. Alternatively, alterations in the activity of the polypeptide can be identified by comparing the activity of the polypeptide in a subject or group of subjects before and after the administration of a test compound. The activity of the polypeptide can be assessed by detecting in a biological sample (e.g. breast, bladder and/or tonsil tissue, serum, plasma, or urine) induction of a cellular second messenger or downstream effector of the polypeptide (e.g. intracellular Ca2+, diacylglycerol, IP3, etc.), catalytic or enzymatic activity of the polypeptide or a binding partner thereof, or a cellular response, for example, cellular differentiation, or cell proliferation. Techniques known to those of skill in the art can be used to detect changes in the induction of a second messenger of a polypeptide or changes in a cellular response. For example, RT-PCR can be used to detect changes in the induction of a cellular second messenger or downstream effector.


[0339] In a preferred embodiment, a candidate agent that changes the level or expression of a polypeptide as defined herein towards levels detected in control subjects (e.g. humans free from breast, bladder and/or tonsil cancer) is selected for further testing or therapeutic use. In another preferred embodiment, a candidate agent that changes the activity of a polypeptide as defined herein towards the activity found in control subjects (e.g. humans free from breast, bladder and/or tonsil cancer) is selected for further testing or therapeutic use.


[0340] In another embodiment, candidate agents that reduce the severity of one or more symptoms associated with breast, bladder and/or tonsil cancer are identified in human subjects having breast, bladder and/or tonsil cancer, preferably subjects having severe breast, bladder and/or tonsil cancer. In accordance with this embodiment, a candidate agent or a control agent is administered to the subjects, and the effect of a candidate agent on one or more symptoms of breast, bladder and/or tonsil cancer is determined. A candidate agent that reduces one or more symptoms can be identified by comparing the subjects treated with a control agent to the subjects treated with the candidate agent. Techniques known to physicians familiar with breast, bladder and/or tonsil cancer can be used to determine whether a candidate agent reduces one or more symptoms associated with breast, bladder and/or tonsil cancer. For example, a candidate agent that reduces tumor burden in a subject having breast, bladder and/or tonsil cancer may be beneficial for treating breast, bladder and/or tonsil cancer patients.


[0341] In a preferred embodiment, a candidate agent that reduces the severity of one or more symptoms associated with breast, bladder and/or tonsil cancer in a human having breast, bladder and/or tonsil cancer is selected for further testing or therapeutic use.


[0342] The invention provides methods of treatment (and prophylaxis) comprising administering to a subject an effective amount of an active agent of the invention. In a preferred aspect, the agent is substantially purified (e.g. substantially free from substances that limit its effect or produce undesired side-effects). The subject is preferably a mammal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc., and most preferably human. In a specific embodiment, a non-human mammal is the subject.


[0343] Compositions and methods of administration that can be employed when the active agent comprises a nucleic acid are described above; additional appropriate compositions and routes of administration are described below.


[0344] Various delivery systems are known and can be used to administer an active agent of the invention, e.g. encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (see, e.g. Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of a nucleic acid as part of a retroviral or other vector, etc. Methods of introduction can be enteral or parenteral and include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g. oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the pharmaceutical compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g. by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.


[0345] In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g. in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. In one embodiment, administration can be by direct injection at the site (or former site) of a malignant tumor or neoplastic or pre-neoplastic tissue.


[0346] In another embodiment, the active agent can be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp.353-365 (1989); Lopez-Berestein, ibid., pp.317-327; see generally ibid.)


[0347] In yet another embodiment, the active agent can be delivered in a controlled release system. In one embodiment, a pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., 1983, Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled release system can be placed in proximity of the therapeutic target, i.e. the breast, bladder or tonsil, thus requiring only a fraction of the systemic dose (see, e.g. Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).


[0348] Other controlled release systems are discussed in the review by Langer (1990, Science 249:1527-1533).


[0349] In a specific embodiment where the active agent of the invention is a nucleic acid encoding a protein, the nucleic acid can be administered in vivo to promote expression of its encoded protein, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g. by use of a retroviral vector (see U.S. Pat. No. 4,980,286), or by direct injection, or by use of microparticle bombardment (e.g. a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox-like peptide which is known to enter the nucleus (see e.g. Joliot et al., 1991, Proc. Natl. Acad. Sci. USA 88:1864-1868), etc. Alternatively, a nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination.


[0350] The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of an active agent, and a pharmaceutically acceptable carrier. In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release compositions and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral compositions can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin. Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The composition should suit the mode of administration.


[0351] In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lidocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.


[0352] The active agents of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc


[0353] The amount of the active agent of the invention which will be effective in the treatment of breast, bladder and/or tonsil cancer can be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the composition will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. However, suitable dosage ranges for intravenous administration are generally about 20-500 micrograms of active compound per kilogram body weight. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight to 1 mg/kg body weight. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.


[0354] Suppositories generally contain active ingredient in the range of 0.5% to 10% by weight; oral compositions preferably contain 10% to 95% active ingredient.


[0355] The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects (a) approval by the agency of manufacture, use or sale for human administration, (b) directions for use, or both.


[0356] Preferred features of each aspect of the invention are as for each of the other aspects mutatis mutandis. The prior art documents mentioned herein are incorporated to the fullest extent permitted by law.


[0357] The invention will now be described with reference to the following examples, which should not in any way be construed as limiting the scope of the present invention.



EXAMPLE 1


Identification and Cloning of BCMP84

[0358] Protein BCMP84 was Isolated from MDA-MB-468 Cell Membranes.


[0359] The breast carcinoma cell line MDA-MB-468 (ATCC:HTB-132) was cultured in DMF12 media, supplemented with 10% fetal calf serum, 2 mM glutamine, 1% penicillin and 1% streptomycin. The cells were grown at 37° C. in a humidified atmosphere of 95% air and 5% carbon dioxide.


[0360] 108 cells were harvested by trypsinisation and centrifugation, and used to prepare membrane proteins for separation by 1D PAGE (Bennett, J. P. Techniques in lipid and membrane biochemistry. Holland: Elsevier. (1982); Fujiki, Y., Fowler, S., Shio, H., Hubbard A. L. & Lazarow, P. B. Polypeptide and phospholipid composition of the membrane of rat liver peroxisomes: comparison with endoplasmic reticulum and mitochondrial membranes. J. Cell Biol. 93, 103-110 (1982).). Following sonication of the harvested cells, the cell homogenate was centrifuged at 4° C. and 1000×g for 10 min. Cell membranes were pelleted by centrifuging the supernatant at 4° C. and 100,000×g for 1 h, and the pellet washed by centrifugation in 1M NaCl. The cell membrane pellet was then solubilized by homogenization in 0.2M NaCO3 (pH 11), incubated on ice for 30 min, and re-centrifuged. The membrane protein was solubilized by homogenization in T×114 detergent (50 mM Tris HCl, 0.2 mM EDTA, 1.5% T×114) (pH 7.4), and the protein mixture centrifuged at 13,000×g for 3 min, followed by extraction of the soluble fraction with a mixture of methanol and chloroform (Boyd, R. S., Duggan, M. J., Shone, C. C. & Foster, K. A. The effect of botulinum neurotoxins on the release of insulin from the insulinoma cell lines HIT-15 and RINm5F. J. Biol. Chem. 270, 18216-18218 (1995)). The extracted protein sample was finally solubilized in 1D lysis buffer and the proteins separated by 1 D PAGE.


[0361] Mass Spectrometry


[0362] Proteins excised from the 1D gel were digested with trypsin and analysed by MALDI-TOF-MS (Voyager STR, Applied Biosystems) using a 337 nm wavelength laser for desorption and the reflectron mode of analysis. A selected mass for BCMP84 ([M+H]=1667.73) was further characterized by tandem mass spectrometry using a OTOF-MS equipped with a nanospray ion source, (Micromass UK Ltd.). Prior to MALDI analysis the samples were desalted and concentrated using C18 Zip Tips™ (Millipore). Samples for tandem MS were purified using a nano LC system (LC Packings) incorporating C18 SPE material.


[0363] The tandem spectra was analyzed manually (Biemann K, Sequencing of peptides by Tandem Mass Spectrometry and high energy collision induced dissociation, Methods Enzymol 1990;193:455-79) to determine partial positional amino acid sequence along with the masses remaining to the N and C termini of the peptide fragments (Table 1).
1TABLE 1Amino Acid Sequence Information Derived from Tandem MassSpectrometry Analysis of BCMP84Peptide PrecursorCore SequenceaN-terminalC-terminalIon m/z(SEQ ID NO: 3)massbmassc1667.73AEDAQEFSDVER272.190.00aThe ‘core sequence’ is a partial amino acid sequence of a peptide elucidated from the interpretation of the fragment mass spectrum of the peptide. bThe N-terminal mass of the peptide is the mass between the start of the core sequence and the N-terminus of the peptide. cThe C-terminal mass is the mass between the end of the core sequence and the C-terminus of the peptide.


[0364] The tandem amino acid sequence and three MALDI-mass spectra were found to match a translation of an EST from a human colon carcinoma cell line (accession number AA315020) (FIG. 1, SEQ ID NOs: 1 and 2). Overlapping ESTs were identified which established a complete ORF of 104 amino acids.


[0365] A Full Length Clone was Amplified by PCR from MDA-MB-468 cDNA


[0366] Preparation of Total RNA and cDNA Synthesis


[0367] Total RNA was prepared from cultured cells and tissue samples using Trizol reagent (Life Technologies), according to the manufacturer's instructions, and resuspended in RNAse-free water at a concentration of 1 μg/μl. 1 to 5 μg total RNA were used as a template for cDNA synthesis using an oligo dT primer and the Superscript II reverse transcription kit (Life Technologies). cDNAs were column purified (Qiagen) and eluted at a concentration of 10 ng/μl.


[0368] Cloning of BCMP84 cDNA


[0369] The predicted full length BCMP84 ORF was amplified by PCR from MDA-MB-468 cDNAs, using the following primers: F, 5′ ataggacaacagaactctcacc 3′ (SEQ ID NO: 4); R, 5′ gcttcaacggaactttgcagag 3′(SEQ ID NO: 5). Reactions contained 10 ng cDNA and reagents for PCR (Qiagen), and used the following cycling parameters: 40 cycles of 94° C. for 30 sec, 60° C. for 30 sec. The PCR products were column purified (Qiagen), cloned into a T/A vector (Invitrogen) and the nucleotide sequence subsequently verified (University of Oxford, Sequencing Facility, UK).


[0370] The predicted BCMP84 protein shows similarity to the S100 family of calcium binding proteins (e.g. S100A13, accession number 099584 has 36% identity and 67% homology with BCMP84) and a recently identified cDNA (AY007220), which is identical to BCMP84 over most of its length, has been named S100A14 and annotated as a novel member of the S100 family of calcium binding proteins. However, there has been no demonstration that AY007220/S100A14 binds calcium and this gene and BCMP84 lack the calcium binding motifs that are conserved between members of this protein family. The 2 amino acid differences between BCMP84 and S100A14 are likely to be polymorphisms and match inter-individual variations that we have found in BCMP84. Analysis of the protein sequence reveals no protein motifs that might indicate a particular function or cellular location for BCMP84.



EXAMPLE 2


Expression of BCMP84 mRNA in Human Tissues

[0371] We used real time quantitative RT-PCR (Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. Real time quantitative PCR. Genome Res. 6, 986-994 (1996); Morrison, T. B., Weis, J. J. & Wittwer, C. T. Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques 24, 954-958 (1998)) to analyze the distribution of BCMP84 mRNA in normal human tissues and breast cancer cell lines (FIG. 2).


[0372] Quantification of BCMP84 mRNA by RT-PCR


[0373] Real time RT-PCR was used to quantitatively measure BCMP84 expression in normal human tissue mRNAs (Clontech), breast cancer cell lines, breast cancer tissues removed during surgery, and normal breast tissue removed during breast reduction mammoplasty. Ethical approval for the normal and tumour breast samples was obtained at surgery (University of Oxford, UK). The primers used for PCR were as follows: sense, 5′ tctgtgcactctgtcttgga 3′ (SEQ ID NO: 6), anti-sense, 5′ tagccagctcctctctgtt 3′ (SEQ ID NO: 7). Reactions containing 10 ng cDNA, prepared as described above, SYBR green sequence detection reagents (PE Biosystems) and sense and anti-sense primers were assayed on an ABI7700 sequence detection system (PE Biosystems). The PCR conditions were 1 cycle at 50° C. for 2 min, 1 cycle at 95° C. for 10 min, and 40 cycles of 95° C. for 15 sec, 65° C. for 1 min. The accumulation of PCR product was measured in real time as the increase in SYBR green fluorescence, and the data were analyzed using the Sequence Detector program v1.6.3 (PE Biosystems). Standard curves relating initial template copy number to fluorescence and amplification cycle were generated using the amplified PCR product as a template, and were used to calculate BCMP84 copy number in each sample.


[0374] The distribution of BCMP84 mRNA was restricted to a few tissues, with the highest levels of expression in colon, thyroid and thymus (260-930 copies ng−1 cDNA), and only low levels of BCMP84 message detected in other normal tissues, including mammary gland. BCMP84 mRNA was detected in BT-20 and MDA-MB-468 cells (300 and 1600 copies ng−1 cDNA respectively), but not in T-47D or CAL51 breast carcinoma lines.


[0375] To examine whether the observed elevation in BCMP84 expression in some breast carcinoma lines is reiterated in clinical samples, we also measured the expression of mRNA in matched normal and tumor tissue samples from seven breast cancer patients (FIG. 3). BCMP84 expression was increased in five of the tumor samples, relative to their matched normal tissues, with three of the samples showing a 2- to 3-fold elevation in expression, and two samples, 13019 and 4090, showing 20- and 26-fold increases in BCMP84 mRNA respectively. Thus, BCMP84 shows a restricted pattern of expression in normal human tissues, and is elevated in some breast tumors, suggesting that this protein has potential as a therapeutic target.


[0376] To further examine the expression of this gene in breast cancer tissues, we extended the quantification of BCMP84 mRNA levels to a further 43 tumor samples, and analyzed the data with respect to other biological markers, like estrogen receptor status, age, epidermal growth factor status, tumor grade, tumor size and metastasis to the lymph nodes. Statistical significance was calculated using the Mann Whitney U-test. BCMP84 expression showed a significant association with EGFR negative status only (Table 2).
2TABLE 2Expression of BCMP84 in 50 breast cancer samplesBiologicalmRNA copy numberStatisticalMarkermedian (range)significanceEGFR−59 (11-544)P = 0.04EGFR+21 (4-280) 



EXAMPLE 3


Chromosomal Localisation

[0377] Radiation Hybrid Mapping


[0378] Chromosomal localisation of the BCMP84 gene was achieved by screening the Genebridge 4 Radiation Hybrid panel (Research Genetics Inc.) using the following pair of primers derived from the 3′ untranslated region:


[0379] sense, 5′ tcagcttccttccccaggtc 3′ (SEQ ID NO: 8); anti-sense, 5′ cccagctccattattca 3′ (SEQ ID NO: 9).


[0380] The PCR conditions for amplification of BCMP84 sequences were denaturation at 94° C. for 30s, followed by annealing and extension at 55° C. for 30 s (40 cycles), using Taq DNA polymerase (Qiagen) and 25 ng DNA per reaction. The primers amplified the expected 215 bp fragment from the positive hybrid cell line DNAs and human genomic DNA, and failed to amplify product from hamster genomic DNA (control).


[0381] The radiation hybrid mapping data were submitted to the Whitehead Institute/MIT Centre for Genome research STS mapping server (http://carbon.wi.mit.edu:8000/cgi-bin/contig/rhmapper.pl) for analysis.


[0382] Radiation Hybrid mapping localized the BCMP84 gene to chromosome 1 q21 between the STS markers AFM291xh1 and AFM220xf8 within the S100 calcium binding protein gene cluster. Thus, although BCMP84 shows only limited homology to the other S100 family members and lacks obvious calcium binding domains, it is clearly related to this large family of proteins.



EXAMPLE 4


Cellular Localisation of BCMP84 Protein in Breast Cancer Cell Lines

[0383] For fluorescent tagging, the BCMP84 full length ORF was PCR cloned into the pQBI25/50-fN1 vector (Obiogene) resulting in an in-frame addition of the SuperGlo™(Sg)GFP protein to the C-terminus of the expressed protein. Transient transfection of sgGFP-tagged BCMP84 cDNAs into MDA-MB-468 and T-47D cell lines was achieved using Superfect™ transfection reagent (Qiagen) according to the manufacturers instructions. Transfected cells were washed in phosphate buffered saline (PBS), fixed in 4% paraformaldehyde for 30 min, then washed again in PBS before being mounted in an aqueous-based fluorescent mounting medium (Dako Ltd.). Fluorescence images were captured using a DC300F digital camera attached to a DMIRE2 fluorescence microscope (Leica Microsystems (UK) Ltd.).


[0384] Immunocytochemical analysis was carried out on MDA-MB-468 cells fixed in 4% paraformaldehyde/PBS and permeablised on 0.3% triton-X100. Following a 1 h incubation in blocking buffer (10 donkey serum/PBS). BCMP84 antibodies (1:50 dilution in blocking buffer) were incubated on the cells for a further 1 h. Cells were washed three times in PBS and incubated for 1 h in biotinylated anti-rabbit secondary antibody (Jackson Laboratories) followed by addition of streptavidin-Alexa 488 (Molecular Probes).


[0385] C-terminal tagging with SuperGlo™ green fluorescent protein (GFP) and immunocytochemistry were used to determine the cellular localization of BCMP84 in MDA-MB-468 and T-47D cell lines. Transient transfection analysis of a GFP-tagged BCMP84 cDNA construct demonstrated that the translated GFP-fusion protein was localized to the plasma membrane in both MDA-MB-468 and T-47D cancer cells. In addition, immunocytochemical and confocal laser scanning microscopy analysis with an anti-BCMP84 antibody also showed clear plasma membrane localization of BCMP84 protein in MDA-MB-468 cells. Although in general the majority of cells showed strongest localization of BCMP84 to the plasma-membrane, those cells that showed weak plasma-membrane BCMP84 immunoreactivity often demonstrated reactivity in the cytoplasm and in some cases strong reactivity in the nucleus. Interestingly, Stradal et al., 1999, J. Biol Chem. 274, 31593-6) have demonstrated that another S100 family member, S100A6 (Calcyclin), exhibits a calcium-dependent association with the plasma-membrane and nuclear envelope in porcine smooth muscle and human CaKi-2 cells. Moreover, they noted that during cell division S100A6 was only found in the cytoplasm. These data suggest that the cellular localization of BCMP84 (S100A14), like S100A6, may be regulated in a calcium dependent manner.



EXAMPLE 5


BCMP84 is Expressed in Carcinoma Tissues

[0386] Immunohistochemical analysis was carried out on formalin-fixed paraffin-embedded tissue microarrays containing 1 mm sections of breast carcinoma tissue from 50 donors as well as 20 sections of various normal tissues (Clinomics Laboratories Inc., 165 Tor Court, Pittsfield, Mass. 01201). A variety of other ethically approved formalin-fixed paraffin-embedded normal and carcinoma tissues were provided by the University of Oxford, UK. Slides were deparafinised by two 5 min washes in xylene then rehydrated through successive graded ethanol solutions and washed for 5 mins in PBS. Antigen retrieval was achieved by immersing the slides in 0.01 M citrate buffer (pH 6) and microwaving for 10 min at full power (950W). In addition, detection with the BCMP84 antibody required that the tissue be treated with pepsin (1 mg/ml) for 1.5 min at room temperature. Endogenous hydrogen peroxidase activity was quenched by treating the slides in 3% hydrogen peroxidase/PBS for 10 min followed by 2 washes in PBS. The tissue was blocked in 10% donkey serum/PBS for 1 hour before addition of 2 μg/ml primary polyclonal antibody (in 2.5% donkey serum). The BCMP84 polyclonal antibody was raised in rabbits immunised with 2 specific peptides (Abcam Ltd., Cambridge, UK). Peptide sequences were chosen for synthesis based on plots of hydrophobicity, antigenicity, surface probability, and weak homology to other known protein family members. Peptides were synthesised using Fmoc chemistry with a cysteine residue added to the end of each to, enable specific thiol reactive coupling of Keyhole Limpet Haemocyanin prior to immunisation. The BCMP84 peptides used were; CEGGKETLTPSELRDLV (SEQ ID NO: 10) and CEAAKSVKLERPVRGH (SEQ ID NO: 11). Western blot analysis of MDA-MB-468 cell lysates was used to confirm that the antibody cross-reacted with a single band of the predicted size. Following 3 washes in PBS the tissue sections were incubated with biotin conjugated secondary antibodies (Biotin-SP-conjugated AffiniPure Donkey anti-rabbit, Jackson ImmunoResearch) diluted at 1:200 (2.5 □g/ml in 2.5% donkey serum/PBS) for 1 h. Slides were washed 3 times in PBS and the tissue incubated with Streptavidin-HRP (Jackson ImmunoResearch) diluted 1:100 (5 μg/ml in 2.5% donkey serum/PBS), followed by three 5 min washes in PBS. Antibody signal was detected using DAB substrate solution (Dako Ltd.) according to the manufacturers instructions.


[0387] Immunohistochemical analysis was used to determine the expression of BCMP 84 protein in sections of normal and breast cancer tissues. We examined BCMP84 protein expression on a micro-array of breast cancer tissues from 60 donors (48 ductal, 6 lobular, 2 cribriform, 1 mucinous, 1 tubular, 1 metaplastic adenosquamous, and 1 medullary carcinomas)


[0388] The distribution of BCMP84 protein in normal tissues was restricted to the stratified squamous epithelium of the skin, cervix and tonsil. Of the 60 breast cancer tissues examined, 10 showed strong immunoreactivity to the BCMP84 antibody. In each case BCMP84 staining was restricted to the cancerous epithelial cells of the tissue and, as with the immunocytochemical analysis in the MDA-MB-468 cell line, showed a clear localisation to the plasma membrane. However, of the 10 breast cancer micro-array tissues expressing BCMP 84 only one was shown to be expressing the oestrogen receptor.


[0389] Other members of the S100 family of calcium-binding proteins are known to be expressed in cancer tissues (Ilg, E. C., Schafer, B. W. & Heizmann, 1996, Int. J. Cancer68, 325-332). In particular, S100A4 (p9Ka), whose expression has been shown to induce metastasis in rodent models of breast cancer (Davies, M. P., et al., 1996, Oncogene 13, 1631-1637 and Ambartsumian, N. S., et al., 1996, Oncogene 13,1621-1630) is expressed in human breast cancers and tightly correlates with poor prognosis (Platt-Higgins, A. M., et al., 2000, Int. J. Cancer 89, 198-208 and Rudland, P. S., et al., 2000, Cancer Res. 60,1595-1603). S100A4 expression was also found to show a poor correlation with oestrogen receptor expression (Platt-Higgins, A. M., et al., 2000, Int. J. Cancer 89, 198-208). However, in addition to the fact that BCMP84 and S100A4 show weak protein homology, S100A4 was found to positively stain 56% (Platt-Higgins, A. M., et al., 2000, Int. J. Cancer 89, 198-208) and 41% (Rudland, P. S., et al., 2000, Cancer Res. 60, 1595-1603) of breast carcinomas whilst in our study only 17% were positive for BCMP84. Furthermore, unlike BCMP84, which is associated almost exclusively with the plasma membrane in malignant cells, S100A4 is found in the cytoplasm (Rudland, P. S., et al., 2000, Cancer Res. 60, 1595-1603). These data suggest that it is highly unlikely that the BCMP84 antibody used in this study is cross-reacting with S100A4 in breast cancer tissues, or indeed any other members of this large family of distantly related proteins.


[0390] In addition to its expression in breast carcinoma tissues we have also demonstrated that BCMP84 is highly expressed in lung, squamous tonsil, and bladder carcinoma tissues. Strong membrane labeling of BCMP84 was seen in the malignant cancer cells. However, in sections of tonsil squamous cell carcinoma and bladder papillary transitional cell carcinoma it is clear that less differentiated basal cells exhibit cytoplasmic staining of BCMP84 that becomes distinctly plasma-membrane associated as the cell become more differentiated. The distribution of BCMP84 was investigated further in multiple sections of breast and tonsil carcinoma tissues. We consistently observed an association between the level of tumor cell differentiation and plasma membrane associated BCMP84 in squamous tonsil carcinomas. Where neoplastic breast cancer cells showed very strong plasma membrane associated staining for BCMP84, adjacent normal ductal breast tissue showed weak cytoplasmic staining (this was clearly demonstrated in a grade 3 breast cancer tissue section). The mechanism underlying the translocation of BCMP84 from the cytoplasm of normal cells to the plasma-membrane in well differentiated tumor cells remains unclear, however, since cellular translocation of S100A6 in cultured cells has been shown to be calcium dependent (Stradal, T. B. & Gimona, M., 1999, J. Biol Chem. 274, 31593-6), it is possible that calcium may be involved in the process. The finding that BCMP84 translocates to the plasma membrane in carcinoma cells further validates our proteomic approach. For example, disease associated cellular translocation of a protein would not be detected at the level of the transcriptome in a differential cDNA array experiment.



EXAMPLE 6


Yeast Two-Hybrid Cloning of BCMP84 and Interacting Factors

[0391] Most biological processes involve specific protein-protein interactions. Protein-protein interactions which may be transient or otherwise, enable two or more proteins or subunits to associate. Protein-protein interactions can have a number of measurable effects: they can alter kinetic properties of proteins, they are a common mechanism for allowing substrate channeling; they can result in the formation of new binding sites, they can alter the activity of a protein and protein-protein interactions can alter the specificity of a protein for its substrate (Phizicky and Fields, 1995, Microbiological Reviews, 59: 94-123; Pawson and Nash, 2000, Gene Dev. 14:1027-1047).


[0392] General methodologies to identify interacting proteins or to study these interactions have been developed. Among these methods is the two-hybrid system originally developed by Fields and co-workers and described, for example, in U.S. Pat. Nos. 5,283,173; 5,468,614 and 5,667,973. A summary of the available methodologies for detecting protein-protein interactions is described in Vidal and Legrain, Nucleic Acids Research Vol. 27, No. 4 pgs. 919-929 (1999) and Legrain and Selig, FEBS Letters 480 pgs. 32-36 (2000) which references are incorporated herein by reference.


[0393] One method to overcome the difficulties encountered with the methods in the prior art is described in WO99/42612, incorporated herein by reference. This method is similar to the two-hybrid system described in the prior art in that it also uses bait and prey polypeptides.


[0394] The method described in WO99/42612 permits the screening of more prey polynucleotides with a given bait polynucleotide in a single step than in the prior art systems due to the cell to cell mating strategy between haploid yeast cells. Furthermore, this method is more thorough and reproducible, as well as sensitive. Thus, the presence of false negatives and/or false positives is extremely minimal as compared to the conventional prior art methods.


[0395] Construction of Prey Plasmids


[0396] Random-primed cDNA was prepared, ligated into an appropriate vector using methods known in the art, and transformed into electrocompetent cells as described in WO 00/66722 and WO 02/12290.


[0397] cDNA was collected from the cells (above) and transformed into yeast strain YHGX13 (MATα Gal4Δ Gal80Δ ade2-101::KANR, his3, leu2-3, -112, trp1-901, ura3-52 URA3::UASGAL1-LacZ, Met) as described in the above patent applications.


[0398] Construction of Bait Plasmids


[0399] Bait fragments were cloned into appropriate vectors using methods known in the art. Amplification, PCR and screening the collection with the two-hybrid system in yeast was as described in WO 00/66722. Where the number of His+ cell clones <285 the process stamp overlay protocol below is used on all colonies. If the number of His+ cell clones >285 and <5000: then process via the overlay and then the stamp overlay protocols on all blue colonies (see WO 00/66722 sections 2.B and 2.C).


[0400] The Stamp Overlay Assay


[0401] His+ colonies were grown overnight at 30° C. in microtiter plates containing DO-Leu-Trp-His+Tetracyclin medium with shaking. The day after the overnight culture, the 96 colonies were stamped on a 15 cm plate of DO-Leu-Trp-His. 4 control yeast colonies were spotted on the same plate. After 2 days of growing at 30° C., an overlay assay was performed on this plate with 80 ml of overlay mixture (see WO 00/66722 section 2.B.). After 2 h of incubation, the plate was photographed with a CCD camera. The blue intensity was quantified by Genetools® software (SYNGENE) and normalized to the control spots.


[0402] Positive clones were identified and plasmids rescued and transformed into electrocompetent cells as described in WO 02/12290 and WO 00/66722.


[0403] Protein-Protein Interactions


[0404] Identification of prey nucleotide sequences was as described (WO 02/12290 and WO 00/66722) or alternatively, prey nucleotide sequences can be compared with one another and those which share identity over a significant region (60 nt) can be grouped together to form a contiguous sequence (Contig) whose identity can be ascertained in the same manner as for individual prey fragments (WO 02/12290 and WO 00/66722). Selected Interacting Domains can be determined also as described in the latter applications.


[0405] Major BCMP84 Interacting Factors


[0406] BCMP84 was found to interact with multiple clones that represent Nucleobindin 1 (Swiss-Prot accession 002818). Nucleobindin is found in both cytosolic and membrane fractions and has been strongly associated with the luminal surface of Golgi membranes where it is thought to act as a major calcium binding protein (Lin, P., et al., 1998, J. Cell Biol. 141,1515-1527). It has been shown that Nucleobindin interacts with several different subfamilies of G-alpha proteins, including G-alpha-i and G-alpha-s, according to yeast two-hybrid analysis (Lin et al.,1998). Indeed, the interaction of nucleobindin with the C-terminal alpha5-helix of G-alpha-i3 localized on the plasma- and Golgi membranes was shown to be calcium dependent, indicating a possible role for nucleobindin in G protein- and calcium regulated signal transduction (Lin, P., et al., 2000, Proc. Natl. Acad. Sci. USA, 97, 674-679).


[0407] This provides a mechanism by which BCMP84 can associate with the plasma membrane in cancer cells, and thus play a role in G protein coupled signal transduction events. In support of this both nucleobindin and G-alpha-i3 (and multiple other G proteins) were identified in a proteomic analysis of the MDA-MB-468 breast cancer cell line in which BCMP84 was first discovered (see WO 01/62914).


[0408] BCMP84 was also found to interact with independent clones encoding the sorcin protein (Swiss-Prot accession P30626). Sorcin is a 22 kD calcium-binding protein that belongs to the penta-EF-hand (PEF) protein family. Sorcin was initially identified as a gene co-amplified and overexpressed in multi-drug resistant cells (Van der Bliek AM, et al., 1986, EMBO J. 5,3201-3208). Sorcin has been shown to undergo a translocation from the cytosol to the membrane in a calcium-dependent manner and to inhibit the release of calcium from sarcoplasmic reticulum, possibly through a direct interaction with the ryanodine receptor intracellular calcium channel (Zamparelli C, et al., 1997, FEBS Lett. 409,1-6 and Lokuta A J, et al., 1997, J Biol Chem. 272,25333-25338). Sorcin has also been shown to interact with Presenilin 2 and annexin VII although the biological role of these intercations are not known (Pack-Chung E, et al., 2000, J Biol Chem. 275,14440-14445 and Brownawell A M & Creutz C E., 1997, J Biol Chem. 272,22182-22190). This interaction indicates a model mechanism by which BCMP84 is co-translocated together with sorcin, from the cytosol to the plasma membrane, as observed in various types of cancer cells. It also indicates a possible role for BCMP84 in regulating the sorcin-modulated calcium release and related signal transduction events. In support of this latter hypothesis, the interaction domains of sorcin with BCMP84 and with the ryanodine receptor are both located in the C-terminal half of sorcin (Zamparelli C, et al., 2000, Biochemistry 39,658-666).


[0409] Various publications in addition to the immediately foregoing are cited herein, the disclosures of which are incorporated by reference in their entireties. The citation of any reference herein should not be deemed as an admission that such reference is available as prior art to the instant invention.


[0410] While the invention has been described and illustrated herein by references to the specific embodiments, various specific material, procedures and examples, it is understood that the invention is not restricted to the particular material combinations of material, and procedures selected for that purpose. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.


[0411] It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description.


Claims
  • 1. A substantially pure, isolated or recombinant polypeptide which is selected from the group consisting of: a) the amino acid sequence comprising or consisting of the sequence as shown in FIG. 1 (SEQ ID NO: 2); b) a derivative having one or more amino acid substitutions, modification, deletions or insertions relative to the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2); and c) a fragment of a polypeptide as defined in a) or b) above, which is at least ten amino acids long.
  • 2. A polypeptide as claimed in claim 1 which is provided as part of a fusion polypeptide.
  • 3. A polypeptide as claimed in claim 2, wherein the fusion polypeptide is Selected from the group consisting of Green Fluorescent Protein and DsRed Fluorescent Protein.
  • 4. An isolated or recombinant nucleic acid molecule which is selected from the group consisting of: d) a DNA sequence comprising or consisting of the sequence as shown in FIG. 1 (SEQ ID NO: 1) or its RNA equivalent; e) a sequence which is complementary to the sequences of d); f) a sequence which codes for the same polypeptide, as the sequences of d) or e); g) a sequence which shows substantial identity with any of those of d), e) and f); h) a sequence which codes for a derivative or fragment of an amino acid molecule shown in FIG. 1 (SEQ ID NO: 2); and i) a fragment of d), e), f), g) or h) which is at least 5 nucleotides in length.
  • 5. A vector comprising a nucleic acid molecule as defined in claim 4.
  • 6. A host cell transformed or transfected with a vector as defined in claim 5.
  • 7. A method of screening for and/or diagnosis of breast, bladder and/or tonsil cancer and/or monitoring the effectiveness of breast, bladder and/or tonsil therapy in a subject which comprises the step of detecting and/or quantifying the amount of a polypeptide as defined in claim 1, in a biological sample obtained from said subject.
  • 8. An antibody, which binds to a polypeptide as defined in claim 1, or to a fragment of such a polypeptide.
  • 9. An antibody as claimed in claim 8 which binds specifically to said polypeptide.
  • 10. An antibody as claimed in claim 9 which is conjugated to a diagnostic or therapeutic moiety.
  • 11. An antibody as claimed in claim 10 wherein the diagnostic or therapeutic moiety is selected from: a detectable substance, a second antibody, a fragment thereof, a derivative thereof, a cytotoxic agent and a cytokine.
  • 12. A pharmaceutical composition comprising a polypeptide as defined in claim 1, optionally together with one or more pharmaceutically acceptable excipients, carriers or diluents.
  • 13. A pharmaceutical composition comprising a nucleic acid molecule as defined in claim 4, optionally together with one or more pharmaceutically acceptable excipients, carriers or diluents.
  • 14. A pharmaceutical composition comprising an antibody as defined in claim 9, optionally together with one or more pharmaceutically acceptable excipients, carriers or diluents.
  • 15. A pharmaceutical composition as claimed in claim 12 comprising a vaccine.
  • 16. A pharmaceutical composition as claimed in claim 15 wherein said vaccine includes one or more suitable adjuvants.
  • 17. A method for the prophylaxis and/or treatment of breast, bladder and/or tonsil cancer in a subject, which comprises administering to said subject a therapeutically effective amount of pharmaceutical composition as defined in claim 12.
  • 18. A method for the prophylaxis and/or treatment of breast, bladder and/or tonsil cancer in a subject, which comprises administering to said subject a therapeutically effective amount of a pharmaceutical composition as defined in claim 13.
  • 19. A method for the prophylaxis and/or treatment of breast, bladder and/or tonsil cancer in a subject, which comprises administering to said subject a therapeutically effective amount of a pharmaceutical composition as defined in claim 14.
  • 20. A method of screening for agents that modulate the expression or activity of a polypeptide as defined in claim 1, said method comprising: (i) comparing the expression or activity of said polypeptide in the presence of a candidate agent, with the expression or activity of said polypeptide in the absence of the candidate agent or in the presence of a control agent; and (ii) determining whether the candidate agent causes the expression or activity of said polypeptide, to change.
  • 21. A method for monitoring and/or assessing breast, bladder and/or tonsil cancer treatment in a patient, which comprises the step of determining the presence or absence and/or quantifying at least one polypeptide as defined in claim 1 in a biological sample obtained from said patient.
  • 22. A method for the identification of metastatic breast, bladder and/or tonsil cancer cells in a biological sample obtained from a subject, which comprises the step of determining the presence or absence and/or quantifying at least one polypeptide as defined in claim 1.
Priority Claims (3)
Number Date Country Kind
0004576.5 Feb 2000 GB
0031341.1 Dec 2000 GB
0205268.6 Mar 2002 GB
Parent Case Info

[0001] This is a continuation-in-part of co-pending application Ser. No. 09/791,392, filed Feb. 23, 2001. Applicants claim the benefit of this application under 35 U.S.C. §120, and the entire disclosure thereof is incorporated herein by reference in its entirety. Priority is also claimed under 35 U.S.C. §119 from United Kingdom Application GB 0205268.6 filed Mar. 6, 2002, and the disclosure thereof is also incorporated herein by reference in its entirety.

Continuation in Parts (1)
Number Date Country
Parent 09791392 Feb 2001 US
Child 10382478 Mar 2003 US