BET DEGRADER

Information

  • Patent Application
  • 20220378923
  • Publication Number
    20220378923
  • Date Filed
    September 30, 2020
    6 years ago
  • Date Published
    December 01, 2022
    3 years ago
  • CPC
    • A61K47/55
    • A61K47/545
    • A61K47/54
  • International Classifications
    • A61K47/55
    • A61K47/54
Abstract
The present invention provides a BET (protein) degrader, specifically a BET degrader containing a compound represented by formula (I) or a pharmaceutically acceptable salt thereof:
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

The present patent application claims priority to Japanese Patent Application No. 2019-180349 filed on Sep. 30, 2018, and the entire disclosure of which is incorporated herein by reference.


BACKGROUND OF THE INVENTION
Field of the Invention

The present invention relates to a BET degrader with a degrading action on BET protein.


Background Art

In humans, 46 bromodomain proteins that recognize the acetylated lysine in histone proteins are known. The BET (bromodomain and extra-terminal domain) family has been reported as one of the families, and a member of the BET family recognizes acetyllysine in histones H3 and H4. BRD (bromodomain containing protein) 2, BRD3, BRD4 and BRDT (bromodomain testis specific protein) are known as the BET family. BET family proteins have two bromo domains (BD1, BD2) at the N-terminus, and the sequences are strongly conserved between the members of the family. Further, it has been reported that the BET protein is involved in cancer growth [see non-patent documents 1 and 2] and progression of inflammation [see non-patent document 3].


BRD4 enhances expression of genes that promote growth by recruiting α-TEBb on mitotic chromosomes. In NUT-midline carcinoma (NMC), increased expression of c-MYC protein by the BRD4-NUT fusion protein has been confirmed [see non-patent document 4]. It has also been reported that the degree of decrease in expression of the MYC gene is the most significant level in the human multiple myeloma-derived MM1.S cells, among the genes whose expression is decreased by the BET inhibitor JQ-1 treatment [See non-patent document 5].


As typical BET inhibitors, clinical trials of RVX-208/Apabetalone [see non-patent document 6], I-BET762/GSK-525762A [see non-patent document 7], OTX-015/MK8628 [see non-patent document 8], CPI-0610 [see non-patent document 9], TEN-010 [see non-patent document 10], and ABBV-075 [see non-patent document 11] are in progress. Among these drugs, all but RVX-208 are being developed as cancer treatment drugs.


In addition, in recent years, a compound, as a bivalent BET inhibitor, having a more potent BET inhibitory activity by simultaneously inhibiting the BD1 and BD2 domains has also been reported (see non-patent document 12). As the bivalent BET inhibitor described above, for example, compounds represented by the following formulas (P1) to (P5) are known (see non-patent document 12, patent document s 1, 2 and 3).




embedded image


In recent years, as a new BET function regulator, a compound that degrades BET proteins in the ubiquitin-proteasome system have been reported. It is known that the compound induces apoptosis of cancer cells by the degradation of BET protein more efficiently than BET inhibitors (see non-patent document 13). Therefore, it can be expected that the BET degrader will be an anticancer drug superior to the inhibitor thereof. In addition, in clinical trials of BET inhibitors, hematological toxicity such as thrombocytopenia and the like has been reported as an adverse event (see non-patent document 14).


A typical example of the BET degrader is PROTAC, which is a chimeric molecule of a small molecular ligand for BET protein and a ligand for E3 ubiquitin ligase. Among them, as PROTAC using DCAF16, the compound represented by (P6) is known (see non-patent document 15).




embedded image


However, the degrading action on BET protein by these drugs is still insufficient, and there is a demand for a drug having a more potent degrading action of BET protein.


PRIOR ART DOCUMENTS
Patent Documents



  • Patent Document 1: WO 2013/033268

  • Patent Document 2: WO 2015/081284

  • Patent Document 3: WO 2017/091673



Non-Patent Documents



  • Non-Patent Document 1: Nature, 2011, Vol. 478, p. 524-528

  • Non-Patent Document 2: Cell, 2011, Vol. 146, p. 904-917

  • Non-Patent Document 3: Nature, 2010, Vol. 468, p. 1119-1123

  • Non-Patent Document 4: Cancer Research, 2003, Vol. 63, p. 304-307

  • Non-Patent Document 5: Cell, 2013, Vol. 153, p. 320-334

  • Non-Patent Document 6: Proceeding of the National Academy of Science, 2013, Vol. 110, p. 19754-19759

  • Non-Patent Document 7: Journal of Medicinal Chemistry, 2013, Vol. 56, p. 7501-7515

  • Non-Patent Document 8: Oncotarget, 2015, Vol. 6, p. 17698-17712

  • Non-Patent Document 9: Blood, 2015, Vol. 126, p. 4255-4255

  • Non-Patent Document 10: Molecular Cancer Therapeutech, 2015, Vol. 14, A49

  • Non-Patent Document 11: Cancer Research, 2016, Vol. 76, p. 4718-4718

  • Non-Patent Document 12: Nature Chemical Biology, 2016, Vol. 112, p. 1089-1096

  • Non-Patent Document 13: Science, 2015, Vol. 348, p. 1376-1381

  • Non-Patent Document 14: Lancet Haematology, 2016, Vol. 3, e196-204

  • Non-Patent Document 15: Nature Chemical Biology, 2018, Vol. 15, p. 737-746



SUMMARY OF THE INVENTION

The present invention provides a BET (protein) degrader or compound having a degrading action on BET protein or a pharmaceutically acceptable salt thereof.


In the present invention, it has been found that a compound containing two small molecular ligands for BET protein that are linked by a spacer having a specific structure or a pharmaceutically acceptable salt thereof can be used as a BET degrader. It has also been found that the BET degrader or compound of the present invention or a pharmaceutically acceptable salt thereof has a potent anticancer activity.


The present invention relates to the following (1) to (91).


(1) A BET degrader, containing as an active ingredient a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof:




embedded image


wherein


L1 and L2 are the same or different and each represents a small molecular ligand for BET protein, and


S represents a group represented by a formula selected from the group consisting of the following formulas (S1) to (S18):




embedded image


embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n1a and n1b are the same or different and each represents 0 or 1,


X1a and X1b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—,


R1a represents a hydrogen atom and R1b represents a hydrogen atom or lower alkyl, or R1a and R1b together represent carbonyl,


X2a represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—,


X2b represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH-502-, or —CH2—,


Z2 represents CH or N,


n3a and n3b are the same or different and each represents 1 or 2,


X3 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —NH—C(═O)—NH—, or —NH—CH2—,


Z3 represents CH or N,


X5a and X5b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—,


n6 represents 1 or 2,


Ar6 represents triazolediyl, oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl,


X6 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —CH2—NH—, —NH—CH2—, or —NH—C(═O)—NH—,


X7 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—C(═O)—NH—,


n7 represents 1, 2, or 3,


Z7 represents S, SO, or SO2,


X8a represents —C(═O)—, —CH2—, or —NH—C(═O)—,


X8b represents a bond, —C(═O)—, —CH2—, or —CH(OH)—,


Ar9 represents triazolediyl or oxazolediyl,


Z9 represents CH2 or NH,


Z10 represents O or NH,


X11a represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, or —NH—C(═O)—NH—,


X11b represents —C(═O)—NH—, —NH—C(═O)—, or —C(═O)—,


X12 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, or —NH—C(═O)—NH—,


Z12a represents CH2 or NH,


Z12b represents CH2 or O,


Z12c represents a bond, CH2, or O,


n13 represents 0, 1, or 2,


n16 represents 1 or 2,


Z16 represents a bond, CH2, or O,


X16 represents —CH2—O—, —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH—,


Ar16 represents triazolediyl, oxadiazolediyl, or pyrazolediyl,


n17 represents 1 or 2,


X17 represents —C(═O)—NH—, —NH—C(═O)—, —NH—SO2—, or —NH—C(═O)—NH—, and


n18a, n18b, and n18c are the same or different and each represents 1 or 2.


(2) A BET degrader, containing as an active ingredient a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof:




embedded image


wherein


L1 and L2 are the same or different and each represents a small molecular ligand for BET protein, and


S represents a group represented by a formula selected from the group consisting of the following formulas (S1) to (S18):




embedded image


embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n1a and n1b are the same or different and each represents 0 or 1,


X1a and X1b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, except for the cases where (i) X1a is —NH—SO2— and X1b is —SO2—NH—, (ii) n1a and n1b are 0, X1a is —C(═O)—NH—, —SO2—NH—, —O—C(═S)—NH—, —O—C(═O)—NH—, or —NH—C(═O)—NH— and X1b is —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and (iii) X1a is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— and X1b is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—,


R1a represents a hydrogen atom and R1b represents a hydrogen atom or lower alkyl, or R1a and R1b together represent carbonyl,


X2a represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—,


X2b represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, or —CH2—, except for the case where X2a is —NH—SO2— and X2b is —SO2—NH—,


Z2 represents CH or N, except for the cases where (i) Z2 is N and X2b is —NH—C(═O)—, —SO2—NH—, or —NH—SO2— and (ii) Z2 is CH and


X2b is —CH2—,


n3a and n3b are the same or different and each represents 1 or 2,


X3 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —NH—C(═O)—NH—, or —NH—CH2—,


Z3 represents CH or N, except for the cases where (i) Z3 is N and X3 is —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —NH—C(═O)—NH—, or —NH—CH2— and (ii) Z3 is N and n3a or n3b is 1,


X5a and X5b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—, except for the case where X5a is —NH—SO2— and X5b is —SO2—NH—,


n6 represents 1 or 2,


Ar6 represents triazolediyl, oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl,


X6 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —CH2—NH— or —NH—C(═O)—NH—, except for the cases where (i) Ar6 is oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl and X6 is —NH—SO2— and (ii) n6 is 1, Ar6 is pyrazolediyl or tetrahydropyridinediyl and X6 is —C(═O)—NH—, —SO2—NH—, —CH2—NH—, or —NH—C(═O)—NH—,


X7 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—C(═O)—NH—,


n7 represents 1, 2, or 3,


Z7 represents S, SO, or SO2,


X8a represents —C(═O)—, —CH2—, or —NH—C(═O)—,


X8b represents a bond, —C(═O)—, —CH2—, or —CH(OH)—,


Ar9 represents triazolediyl or oxazolediyl,


Z9 represents CH2 or NH, except for the cases where (i) Ar9 is triazolediyl and Z9 is NH and (ii) Ar9 is oxazolediyl and Z9 is CH2,


Z10 represents O or NH,


X11a represents —C(═O)—NH—, —SO2—NH—, or —NH—C(═O)—NH—,


X11b represents —C(═O)—NH— or —C(═O)—,


X12 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—C(═O)—NH—,


Z12a represents CH2 or NH, except for the case where X12 is —C(═O)—NH—, —SO2—NH—, or —NH—C(═O)—NH— and Z12a is NH,


Z12b represents CH2 or O, except for the case where Z12a is NH and Z12b is O,


Z12c represents a bond, CH2, or O, except for the cases where (i) Z12b is O and Z12c is O and (ii) Z12a is NH and Z12c is CH2 or O,


n13 represents 0, 1 or 2,


n16 represents 1 or 2,


Z16 represents a bond, CH2, or O,


X16 represents —CH2—O—, —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH—, except for the case where Z16 is O and X16 is —NH—C(═O)— or —NH—C(═O)—NH—,


Ar16 represents triazolediyl, oxadiazolediyl or pyrazolediyl, except for the cases where (i) X16 is —CH2—O— and Ar16 is oxadiazolediyl or pyrazolediyl and (ii) n16 is 1, X16 is —C(═O)—NH— or —NH—C(═O)—NH— and Ar16 is pyrazolediyl,


n17 represents 1 or 2,


X17 represents —C(═O)—NH—, —NH—C(═O)—, —NH—SO2—, or —NH—C(═O)—NH—, and


n18a, n18b, and n18c are the same or different and each represents 1 or 2.


(3) The BET degrader according to (1) or (2), wherein L1 and L2 are the same or different and each is a group represented by a formula selected from the group consisting of the following formulas (A) to (H), (J), (K), (M) and (N):




embedded image


embedded image


embedded image


wherein


the wavy lines each represents the bonding site to S,


RA1, RA2 and RA3 are the same or different and each represents a hydrogen atom or lower alkyl,


RA5 represents a hydrogen atom, a halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted tetrahydropyridinyl, optionally substituted dihydro-1H-pyrolyl, or optionally substituted tetrahydro-1H-azepinyl,


ring RA represents benzenediyl, cycloalkanediyl, pyridinediyl, piperidinediyl, azetidinediyl, pyrrolidinediyl, or homopiperidinediyl,


n1A represents 0 or 1,


RB1 represents a hydrogen atom, optionally substituted lower alkoxycarbonylmethyl, optionally substituted cycloalkyloxycarbonylmethyl, or —CH2CONRB5RB6, wherein RB5 and RB6 are the same or different and each represents a hydrogen atom or optionally substituted lower alkyl, or RB5 and RB6 together with the adjacent nitrogen atom represent an optionally substituted nitrogen-containing aliphatic heterocyclic group,


RB2 represents optionally substituted lower alkyl,


RB3 and RB4 are the same or different and each represents a halogen or optionally substituted lower alkyl,


RC1 represents a hydrogen atom, lower alkyl, or lower alkanoyl,


RC3 represents a hydrogen atom or hydroxy,


ring RC represents benzenediyl, piperidinediyl, azetidinediyl, pyrrolidinediyl, homopiperidinediyl, piperazinediyl, or azaspiro[3.3]heptanediyl,


RD1 represents optionally substituted lower alkyl or optionally substituted lower alkoxycarbonyl, ring RD represents benzenediyl or cycloalkanediyl,


RE1 and RF1 each has the same definition as RA1, and RE1 and RF1 may be the same or different,


RE2 and RF2 each has the same definition as RA2, and RE2 and RF2 may be the same or different,


RE3 and RF3 each has the same definition as RA3, and RE3 and RF3 may be the same or different,


RE5 and RF5 each has the same definition as RA5, and RE5 and RF5 may be the same or different,


RF7 represents a hydrogen atom or a halogen,


RG1 and RG2 are the same or different and each represents a hydrogen atom or lower alkyl,


RH1 represents a hydrogen atom or lower alkyl sulfonamide,


RH2 and RH3 are the same or different and each represents lower alkyl,


ZH represents CH2 or O,


ring RH represents benzenediyl, cycloalkanediyl, azetidinediyl, pyrrolidinediyl, piperidinediyl, or homopiperidinediyl,


ring RK represents benzenediyl or cycloalkanediyl,


RM1 represents a hydrogen atom or lower alkyl,


ring RM represents cycloalkanediyl, and


RN1 represents a hydrogen atom, a halogen, lower alkyl, or lower alkoxy.


(4) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), (B), (C), (D), (F), or (G), L2 represents a group represented by formula (A), (B), (C), (D), (H), (J), (K), or (M), and S is a group represented by formula (S1).


(5) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), L2 represents a group represented by formula (A), and S is a group represented by formula (S2).


(6) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), (B), (C), (G), or (N), L2 represents a group represented by formula (A) or (B), and S is a group represented by formula (S3).


(7) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), L2 represents a group represented by formula (A), and S is a group represented by formula (S4) or (S5).


(8) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), (B), (C), (D), (G), or (H), L2 represents a group represented by formula (A), (B), (C), or (D), and S is a group represented by formula (S6).


(9) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula (A), and S is a group represented by formula (S7).


(10) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula (A), and S is a group represented by formula (S8).


(11) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), L2 represents a group represented by formula (A), and S is a group represented by formula (S9).


(12) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula (A), and S represents a group represented by formula (S10).


(13) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula (A) or (B), and S represents a group represented by formula (S11).


(14) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), L2 represents a group represented by formula (A), and S represents a group represented by formula (S12), (S13), (S14), or (S15).


(15) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (E), L2 represents a group represented by formula (A), and S represents a group represented by formula (S16), (S17), or (S18).


(16) The BET degrader according to any one of (1) to (15), wherein formula (A) is the following formula (A)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RA1-1 represents a hydrogen atom,


RA2-1 and RA3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms,


RA5-1 represents a hydrogen atom, a fluorine atom, optionally substituted alkyl having 1 to 5 carbon atoms, optionally substituted alkenyl having 2 to 6 carbon atoms, or optionally substituted tetrahydropyridinyl,


ring RA-1 represents benzenediyl, cycloalkanediyl, pyridinediyl, or piperidinediyl, and


n1A-1 represents 0 or 1.


(17) The BET degrader according to any one of (1) to (4), (6), (8) to (10), (12) and (13), wherein formula (B) is the following formula (B)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RB1-1 represents a hydrogen atom, optionally substituted alkoxycarbonylmethyl having 1 to 5 carbon atoms, optionally substituted cycloalkyloxycarbonylmethyl, or —CH2CONRB5-1RB6-1, wherein, RB5-1 and RB6-1 are the same or different and each represents a hydrogen atom or alkyl having 1 to 5 carbon atoms, or RB5-1 and RB6-1 together with the adjacent nitrogen atom represent an optionally substituted nitrogen-containing aliphatic heterocyclic group,


RB2-1 represents optionally substituted alkyl having 1 to 5 carbon atoms, and


RB3-1 and RB4-1 each represents optionally substituted alkyl having 1 to 5 carbon atoms.


(18) The BET degrader according to any one of (1) to (4), (6) and (8), wherein formula (C) is the following formula (C)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RC1-1 represents a hydrogen atom,


RC3-1 represents a hydrogen atom or hydroxy, and


ring RC-1 represents benzenediyl, piperidinediyl, piperadinediyl, or azaspiro[3.3]heptanediyl.


(19) The BET degrader according to any one of (1) to (4) and (8), wherein formula (D) is the following formula (D)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RD1-1 represents optionally substituted alkyl having 1 to 5 carbon atoms or optionally substituted alkoxycarbonyl having 1 to 5 carbon atoms, and


ring RD-1 represents benzenediyl or cyclohexanediyl. (20) The BET degrader according to any one of (1) to (3) and (15), wherein formula (E) is the following formula (E)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RE1-1 represents a hydrogen atom,


RE2-1 and RE3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms, and


RE5-1 represents a hydrogen atom.


(21) The BET degrader according to any one of (1) to (4), wherein formula (F) is the following formula (F)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RF1-1 represents a hydrogen atom,


RF2-1 and RF3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms,


RF5-1 represents a hydrogen atom, and


RF7-1 represents a hydrogen atom or a fluorine atom.


(22) The BET degrader according to any one of (1) to (4), (6) and (8), wherein formula (G) is the following formula (G)-1:




embedded image


wherein


the wavy line represents the bonding site to S, and


RG1-1 and RG2-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms.


(23) The BET degrader according to any one of (1) to (4) and (8), wherein formula (H) is the following formula (H)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RH1-1 represents a hydrogen atom or alkylsulfonamide having 1 to 5 carbon atoms,


RH2-1 and RH3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms,


zH-1 represents CH2 or O, and


ring RH-1 represents benzenediyl, cyclohexanediyl, or piperidinediyl.


(24) The BET degrader according to any one of (1) to (4), wherein formula (K) is the following formula (K)-1:




embedded image


wherein


the wavy line represents the bonding site to S, and


ring RK-1 represents benzenediyl or cyclohexanediyl.


(25) The BET degrader according to any one of (1) to (4), wherein formula (M) is the following formula (M)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RM1-1 represents a hydrogen atom, and


ring RM-1 represents bicycloalkanediyl having 5 to 8 carbon atoms.


(26) The BET degrader according to any one of (1) to (3) and (6), wherein formula (N) is the following formula (N)-1:




embedded image


wherein


the wavy line represents the bonding site to S, and


RN-1 represents a halogen.


(27) The BET degrader according to any one of (1) to (4), wherein S is the following formula (S1)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n1a-1 and n1b-1 are the same or different and each represents 0 or 1,


X1a-1 and X1b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, except for the cases where (i) X1a-1 is —NH—SO2— and X1b-1 is —SO2—NH—, (ii) n1a-1 and n1b-1 are 0, X1a-1 is —C(═O)—NH—, —SO2—NH—, —O—C(═S)—NH—, —O—C(═O)—NH—, or —NH—C(═O)—NH— and X1b-1 is —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and (iii) X1a-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— and X1b-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and


R1a-1 represents a hydrogen atom and R1b-1 represents a hydrogen atom or alkyl having 1 to 5 carbon atoms, or R1a-1 and R1b-1 together represent carbonyl.


(28) The BET degrader according to any one of (1) to (3) and (5), wherein S is the following formula (S2)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X2a-1 represents —C(═O)—NH— or —NH—C(═O)—,


X2b-1 represents —C(═O)—NH—, —NH—C(═O)—, or —CH2—, and


Z2-1 represents CH or N, except for the cases where (i) Z2-1 is N and X2b-1 is —NH—C(═O)— and (ii) Z2-1 is CH and X2b-1 is —CH2—.


(29) The BET degrader according to any one of (1) to (3) and (6), wherein S is the following formula (S3)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n3a-1 and n3b-1 are the same or different and each represents 1 or 2,


X3-1 represents —C(═O)—NH—, —NH—C(═O)—, —NH—C(═O)—NH—, or —NH—CH2—, and


Z3-1 represents CH or N, except for the cases where (i) Z3-1 is N and X3-1 is —NH—C(═O)—, —NH—C(═O)—NH—, or —NH—CH2— and (ii) Z3-1 is N and n3a-1 or n3b-1 is 1.


(30) The BET degrader according to any one of (1) to (3) and (7), wherein S is the following formula (S5)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2 and


X5a-1 and X5b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, or —NH—SO2—.


(31) The BET degrader according to any one of (1) to (3) and (8), wherein S is the following formula (S6)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n6-1 represents 1 or 2,


Ar6-1 represents triazolediyl, oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl, and


X6-1 represents —C(═O)—NH—, —NH—C(═O)—, or —CH2—NH—, except for the case where n6-1 is 1, Ar6-1 is pyrazolediyl or tetrahydropyridinediyl and X6-1 is —C(═O)—NH— or —CH2—NH—.


(32) The BET degrader according to any one of (1) to (3) and (9), wherein S is the following formula (S7)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X7-1 represents —C(═O)—NH— or —NH—C(═O)—,


n7-1 represents 1, and


Z7-1 represents S, SO, or SO2.


(33) The BET degrader according to any one of (1) to (3) and (10), wherein S is the following formula (S8)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X8a-1 represents —C(═O)— or —CH2—, and


X8b-1 represents a bond, —C(═O)—, —CH2—, or —CH(OH)—.


(34) The BET degrader according to any one of (1) to (3) and (11), wherein S is the following formula (S9)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


Ar9-1 represents triazolediyl or oxazolediyl, and


Z9-1 represents CH2 or NH, except for the cases where (i) Ar9-1 is triazolediyl and Z9-1 is NH and (ii) Ar9-1 is oxazolediyl and Z9-1 is CH2.


(35) The BET degrader according to any one of (1) to (3) and (12), wherein S is the following formula (S10)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2 and


Z10-1 represents 0 or NH.


(36) The BET degrader according to any one of (1) to (3) and (13), wherein S is the following formula (S11)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X11a-1 represents —C(═O)—NH—, and


X11b-1 represents —C(═O)—NH— or —C(═O)—.


(37) The BET degrader according to any one of (1) to (3) and (14), wherein S is the following formula (S12)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X12-1 represents —C(═O)—NH— or —NH—C(═O)—,


Z12a-1 represents CH2 or NH, except for the case where X12-1 is —C(═O)—NH— and Z12a-1 is NH,


Z12b-1 represents CH2 or O, except for the case where Z12a-1 is NH and Z12b-1 is O, and


Z12c-1 represents a bond or O, except for the cases where (i)


Z12b-1 is O and Z12c-1 is O and (ii) Z12a-1 is NH and Z12c-1 is O.


(38) The BET degrader according to any one of (1) to (3) and (14), wherein S is the following formula (S13)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2 and


n13-1 represents 0 or 2.


(39) The BET degrader according to any one of (1) to (3) and (15), wherein S is the following formula (S16)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n16-1 represents 1 or 2,


Z16-1 represents a bond, CH2, or O,


X16-1 represents —CH2—O— or —C(═O)—NH—, and


Ar16-1 represents triazolediyl, oxadiazolediyl, or pyrazolediyl, except for the cases where (i) X16-1 is —CH2—O— and Ar16-1 is oxadiazolediyl or pyrazolediyl and (ii) n16-1 is 1, X16-1 is —C(═O)—NH— and Ar16-1 is pyrazolediyl.


(40) The BET degrader according to any one of (1) to (3) and (15), wherein S is the following formula (S17)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n17-1 represents 1 or 2, and


X17-1 represents —C(═O)—NH—.


(41) The BET degrader according to any one of (1) to (3) and (15), wherein S is the following formula (S18)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n18a-1 represents 2,


n18b-1 represents 2, and


n18c-1 represents 1.


(42) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S1), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0, and


in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


(43) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S1), and wherein, in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and


in formula (S1), n1a and n1b each represents 0, X1a and X1b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH—, except for the case where X1a is —C(═O)—NH— or —NH—C(═O)—NH— and X1b is —NH—C(═O)— or —NH—C(═O)—NH—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


(44) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S1), and wherein, in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl or pyridinediyl, and n1A represents 0, and in formula (S1), n1a and n1b represent 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


(45) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S3), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and in formula (S3), n3a and n3b each represents 2, X3 represents —C(═O)—NH—, and Z3 represents N.


(46) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S3), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and


in formula (S3), n3a and n3b each represents 1, X3 represents —C(═O)—NH—, and Z3 represents CH.


(47) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S6), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0, and


in formula (S6), n6 represents 1, Ar6 represents oxadiazolediyl, and X6 represents —CH2—NH—.


(48) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S6), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0, and


in formula (S6), n6 represents 1, Ar6 represents triazolediyl, and X6 represents —CH2—NH—.


(49) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S6), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and


in formula (S6), n6 represents 1, Ar6 represents oxadiazolediyl, and X6 represents —C(═O)—NH—.


(50) The BET degrader according to any one of (1) to (3), wherein L1 and L2 each represents a group represented by formula (A) and S is a group represented by formula (S6), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and in formula (S6), n6 represents 2, Ar6 represents triazolediyl, and X6 represents —C(═O)—NH—.


(51) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), L2 represents a group represented by formula (H), and S represents a group represented by formula (S1), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0,


in formula (H), RH1 represents alkyl sulfonamide having 1 to 5 carbon atoms, RH2 and RH3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, ZH represents O, and ring RH represents benzenediyl, and


in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


(52) The BET degrader according to any one of (1) to (3), wherein L1 represents a group represented by formula (A), L2 represents a group represented by formula (H), and S is a group represented by formula (S1), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0,


in formula (H), RH1 represents a hydrogen atom, RH2 and RH3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, ZH represents O, ring RH represents benzenediyl, and


in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


(53) A method for degrading BET, including administering to a subject the compound according to any one of (1) to (52) or a pharmaceutically acceptable salt thereof.


(54) A method for treating or preventing cancer, including administering to a subject the BET degrader according to any one of (1) to (52).


(55) The BET degrader according to any one of (1) to (52) for use as a medicament.


(56) A pharmaceutical composition, containing the BET degrader according to any one of (1) to (52).


(57) The pharmaceutical composition according to (56), further containing a carrier.


(58) The pharmaceutical composition according to (56) or (57) for use in the treatment or prevention of cancer.


(59) The BET degrader according to any one of (1) to (52) for use in the treatment or prevention of cancer.


(60) Use of the compound according to any one of (1) to (52) or a pharmaceutically acceptable salt thereof for the manufacture of a drug for degrading BET protein.


(61) Use of the BET degrader according to any one of (1) to (52) in the manufacture of a drug for the treatment or prevention of cancer.


(62) Use of the BET degrader according to any one of (1) to (52) in the treatment or prevention of cancer.


(63) A medicament, containing as an active ingredient the BET degrader according to any one of (1) to (52).


(64) A prophylactic or therapeutic agent, containing as an active ingredient the BET degrader according to any one of (1) to (52).


(65) A compound represented by the following formula (I)-1 or a pharmaceutically acceptable salt thereof:




embedded image


wherein one of L1-1 and L2-1 is a group represented by a formula selected from the group consisting of the following formulas (C)-2, (D)-2, (G)-2, (H)-2, (J)-2, (K)-2, (M)-2, and (N)-2, and the other of L1-1 and L2-1 is a group represented by a formula selected from the group consisting of formulas (A) to (H), (3), (K), (M), and (N) described in the above (3), and S is a group represented by a formula selected from the group consisting of formulas (S1) to (S18) described in the above (1) or (2):




text missing or illegible when filed


wherein


the wavy lines each represents the bonding site to S,


RC1-2 represents a hydrogen atom, lower alkyl or lower alkanoyl,


RC3-2 represents a hydrogen atom or hydroxy,


ring RC-2 represents piperazinediyl or azaspiro[3.3]heptanediyl,


RD1-2 represents optionally substituted lower alkyl or optionally substituted lower alkoxycarbonyl,


ring RD-2 represents cycloalkanediyl,


RG1-2 and RG2-2 are the same or different and each represents a hydrogen atom or lower alkyl,


RH1-2 represents a hydrogen atom or lower alkyl sulfonamide,


RH2-2 and RH3-2 are the same or different and each represents lower alkyl,


ZH-2 represents CH2 or O,


ring RH-2 represents benzenediyl, cycloalkanediyl, azetidinediyl, pyrrolidinediyl, piperidinediyl, or homopiperidinediyl,


ring RK-2 represents benzenediyl or cycloalkanediyl,


RM1-2 represents a hydrogen atom or lower alkyl,


ring RM-2 represents cycloalkanediyl, and


RN1-2 represents a hydrogen atom, a halogen, lower alkyl or lower alkoxy.


(66) The compound according to (65) or a pharmaceutically acceptable salt thereof, wherein L1-1 represents a group represented by formula (G)-2, L2-1 represents a group represented by formula (A), and S is a group represented by formula (S1).


(67) The compound according to (65) or a pharmaceutically acceptable salt thereof, wherein L1-1 represents a group represented by formula (A), L2-1 represents a group represented by formula (C)-2, (D)-2, (H)-2, (J)-2, (K)-2, or (M)-2, and S is a group represented by formula (S1).


(68) The compound according to (65) or a pharmaceutically acceptable salt thereof, wherein L1-1 represents a group represented by formula (G)-2 or (N)-2, L2-1 represents a group represented by formula (A), and S represents a group represented by formula (S3).


(69) The compound according to (65) or a pharmaceutically acceptable salt thereof, wherein L1-1 represents a group represented by formula (C)-2, (G)-2, or (H)-2, L2-1 represents a group represented by formula (A), and S is a group represented by formula (S6).


(70) The compound according to any one of (65) to (67) or a pharmaceutically acceptable salt thereof, wherein S is the following formula (S1)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1-1 or L2-1,


n1a-1 and n1b-1 are the same or different and each represents 0 or 1,


X1a-1 and X1b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, except for the cases where (i) X1a-1 is —NH—SO2— and X1b-1 is —SO2—NH—, (ii) n1a-1 and n1b-1 are 0, X1a-1 is —C(═O)—NH—, —SO2—NH—, —O—C(═S)—NH—, —O—C(═O)—NH—, or —NH—C(═O)—NH—, and X1b-1 is —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and (iii) X1a-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and X1b-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and


R1a-1 represents a hydrogen atom and R1b-1 represents a hydrogen atom or alkyl having 1 to 5 carbon atoms, or R1a-1 and R1b-1 together represent carbonyl.


(71) The compound according to (65) or (68) or a pharmaceutically acceptable salt thereof, wherein S is the following formula (S3)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1-1 or L2-1,


n3a-1 and n3b-1 are the same or different and each represents 1 or 2,


X3-1 represents —C(═O)—NH—, —NH—C(═O)—, —NH—C(═O)—NH—, or —NH—CH2—, and


Z3-1 represents CH or N, except for the cases where (i) Z3-1 is N and X3-1 is —NH—C(═O)—, —NH—C(═O)—NH—, or —NH—CH2—, and (ii) Z3-1 is N and n3a-1 or n3b-1 is 1.


(72) The compound according to (65) or (69) or a pharmaceutically acceptable salt thereof, wherein S is the following formula (S6)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1-1 or L2-1,


n6-1 represents 1 or 2,


Ar6-1 represents triazolediyl, oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl, and


X6-1 represents —C(═O)—NH—, —NH—C(═O)—, or —CH2—NH—, except for the case where (i) n6-1 is 1, Ar6-1 is pyrazolediyl or tetrahydropyridinediyl, and X6-1 is —C(═O)—NH— or —CH2—NH—.


(73) The compound according to (65) or a pharmaceutically acceptable salt thereof, wherein L1-1 represents a group represented by formula (A), L2-1 represents a group represented by formula (H)-2, and S represents a group represented by formula (S1), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0,


in formula (H)-2, RH1-2 represents alkyl sulfonamide having 1 to 5 carbon atoms, RH2-2 and RH3-2 are the same or different and each represents alkyl having 1 to 5 carbon atoms, ZH-2 represents O, and ring RH-2 represents benzenediyl, and


in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


(74) The compound according to (65) or a pharmaceutically acceptable salt thereof, wherein L1-1 represents a group represented by formula (A), L2-1 represents a group represented by formula (H)-2, and S represents a group represented by formula (S1), and wherein,


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0,


in formula (H)-2, RH1-2 represents a hydrogen atom, RH2-2 and RH3-2 are the same or different and each represents alkyl having 1 to 5 carbon atoms, ZH-2 represents O, and ring RH-2 represents benzenediyl, and


in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


(75) A method for degrading BET, including administering to a subject the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof.


(76) A method for treatment or prevention, including administering to a subject the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof.


(77) The method according to (76) for treating or preventing cancer.


(78) The compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof for use as a medicament.


(79) A pharmaceutical composition, containing the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof.


(80) The pharmaceutical composition according to (79), further containing a carrier.


(81) The pharmaceutical composition according to (79) or (80) for use for the degradation of BET protein.


(82) The pharmaceutical composition according to (79) or (80) for use in the treatment or prevention of cancer.


(83) The compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof for use for the degradation of BET protein.


(84) The compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof for use in the treatment or prevention of cancer.


(85) The compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof for use in the manufacture of a drug for degrading BET protein.


(86) Use of the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof for the manufacture of a drug for the treatment or prevention of cancer.


(87) Use of the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof for the degradation of BET protein.


(88) Use of the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof for the treatment or prevention of cancer.


(89) A medicament, containing as an active ingredient the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof.


(90) A BET degrader, containing as an active ingredient the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof.


(91) A prophylactic or therapeutic agent, containing as an active ingredient the compound according to any one of (65) to (74) or a pharmaceutically acceptable salt thereof.


The BET degrader of the present invention or the compound of the present invention or a pharmaceutically acceptable salt thereof includes two small molecular ligands for BET protein that are linked by a spacer having a specific structure as described in (1) to (91) above, and thus exhibits an action of degrading the target BET protein even at a low dose. The BET degrader of the present invention or the compound of the present invention or a pharmaceutically acceptable salt thereof exhibits a potent anticancer activity.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 shows the results of changes in BRD4, BRD2 and BRD3 protein levels by a test compound (compound 1b, compound 11 or compound P3) in cells of a SU-DHL-4 cell line, detected by Western blotting. In the figure, “Control” is a lane in which a DMSO solution was added so that the final concentration was 0.1 vol %, and the eluate obtained from the cells was electrophoresed. In the figure, “1b, 100 nM” is a lane in which a diluted solution of compound 1b was added so that the final concentration was 100 nmol/L, and the eluate obtained from the cells was electrophoresed. In the figure, “1b, 100 nM” is a lane in which a diluted solution of compound 1b was added so that the final concentration was 100 nmol/L, and the eluate obtained from the cells was electrophoresed. In the figure, “P3, 100 nM” is a lane in which a diluted solution of compound P3 was added so that the final concentration was 100 nmol/L, and the eluate obtained from the cells was electrophoresed. In the figure, BRD2, BRD3, BRD4 and beta actin show the protein amounts of BRD2, BRD3, BRD4 and beta actin, respectively. Compound P3 is a compound described as example 14 in Patent Document 2 (WO 2015/081284).



FIG. 2 shows the results of inhibition of BRD2, BRD3 and BRD4 degradation by a ubiquitination pathway inhibitor (MLN-4924), detected by Western blotting. In the figure, “Control” is a lane in which a DMSO solution was added so that the final concentration was 0.1 vol %, and the eluate obtained from the cells was electrophoresed. In the figure, “1b, 10 nM”, “1b, 100 nM” and “1b, 1000 nM” each is a lane in which a diluted solution of compound 1b was added so that the final concentration was 10 nmol/L, 100 nmol/L and 1000 nmol/L, respectively, and the eluate obtained from the cells was electrophoresed. In the figure, “1l, 10 nM”, “1, 100 nM” and “11000 nM” each is a lane in which a diluted solution of compound 1l was added so that the final concentration was 10 nmol/L, 100 nmol/L and 1000 nmol/L, respectively, and the eluate obtained from the cells was electrophoresed. For the item shown as “MLN-4924 100 nM” in the figure, the condition with the addition of MLN-4924 with a final concentration of 100 nmol/L is indicated by “+”, and the condition without the addition of MLN-4924 is indicated by “−”. In the figure, BRD2, BRD3, BRD4 and beta actin represent the protein amounts of BRD2, BRD3, BRD4 and beta actin, respectively.





DETAILED DESCRIPTION OF THE INVENTION

According to the present invention, there is provided a BET degrader containing as an active ingredient a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof:




embedded image


wherein, L1 and L2 are the same or different and each represents a small molecular ligand for BET protein, and S represents a group represented by a formula selected from the group consisting of the following formulas (S1) to (S18):




embedded image


embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n1a and n1b are the same or different and each represents 0 or 1,


X1a and X1b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—,


R1a represents a hydrogen atom and R1b represents a hydrogen atom or lower alkyl, or R1a and R1b together represent carbonyl,


X2a represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—,


X2b represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, or —CH2—,


Z2 represents CH or N,


n3a and n3b are the same or different and each represents 1 or 2,


X3 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —NH—C(═O)—NH—, or —NH—CH2—,


Z3 represents CH or N,


X5a and X5b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—,


n6 represents 1 or 2,


Ar6 represents triazolediyl, oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl,


X6 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —CH2—NH—, —NH—CH2—, or —NH—C(═O)—NH—,


X7 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—C(═O)—NH—,


n7 represents 1, 2, or 3,


Z7 represents S, SO, or SO2,


X8a represents —C(═O)—, —CH2—, or —NH—C(═O)—,


X8b represents a bond, —C(═O)—, —CH2—, or —CH(OH)—, Arg represents triazolediyl or oxazolediyl,


Z9 represents CH2 or NH,


Z10 represents O or NH,


X11a represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, or —NH—C(═O)—NH—,


X11b represents —C(═O)—NH—, —NH—C(═O)—, or —C(═O)—,


X12 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, or —NH—C(═O)—NH—,


Z12a represents CH2 or NH,


Z12b represents CH2 or O,


Z12c represents a bond, CH2, or O,


n13 represents 0, 1, or 2,


n16 represents 1 or 2,


Z16 represents a bond, CH2, or O,


X16 represents —CH2—O—, —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH—,


Ar16 represents triazolediyl, oxadiazolediyl, or pyrazolediyl,


n17 represents 1 or 2,


X17 represents —C(═O)—NH—, —NH—C(═O)—, —NH—SO2—, or —NH—C(═O)—NH—, and


n18a, n18b, and n18c are the same or different and each represents 1 or 2.


According to a preferred embodiment of the present invention, there is provided a BET degrader containing as an active ingredient a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof:




embedded image


wherein, L1 and L2 are the same or different and each represents a small molecular ligand for BET protein, and S represents a group represented by a formula selected from the group consisting of the following formulas (S1) to (S18):




embedded image


embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n1a and n1b are the same or different and each represents 0 or 1,


X1a and X1b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, except for the cases where (i) X1a is —NH—SO2— and X1b is —SO2—NH—, (ii) n1a and n1b are 0, X1a is —C(═O)—NH—, —SO2—NH—, —O—C(═S)—NH—, —O—C(═O)—NH—, or —NH—C(═O)—NH— and X1b is —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and (iii) X1a is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— and X1b is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, R1a represents a hydrogen atom and R1b represents a hydrogen atom or lower alkyl, or R1a and R1b together represent carbonyl,


X2a represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—,


X2b represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, or —CH2—, except for the case where X2a is —NH—SO2— and X2b is —SO2—NH—,


Z2 represents CH or N, except for the cases where (i) Z2 is N and X2b is —NH—C(═O)—, —SO2—NH—, or —NH—SO2— and (ii) Z2 is CH and X2b is —CH2—,


n3a and n3b are the same or different and each represents 1 or 2,

    • X3 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —NH—C(═O)—NH—, or —NH—CH2—,
    • Z3 represents CH or N, except for the cases where (i) Z3 is N and X3 is —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —NH—C(═O)—NH—, or —NH—CH2— and (ii) Z3 is N and n3a or n3b is 1,


X5a and X5b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—, except for the case where X5a is —NH—SO2— and X5b is —SO2—NH—,


n6 represents 1 or 2,


Ar6 represents triazolediyl, oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl,


X6 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —CH2—NH— or —NH—C(═O)—NH—, except for the cases where (i) Ar6 is oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl and X6 is —NH—SO2— and (ii) n6 is 1, Ar6 is pyrazolediyl or tetrahydropyridinediyl and X6 is —C(═O)—NH—, —SO2—NH—, —CH2—NH—, or —NH—C(═O)—NH—,


X7 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—C(═O)—NH—,


n7 represents 1, 2, or 3,


Z7 represents S, SO, or SO2,


X8a represents —C(═O)—, —CH2—, or —NH—C(═O)—,


X8b represents a bond, —C(═O)—, —CH2—, or —CH(OH)—,


Ar9 represents triazolediyl or oxazolediyl,


Z9 represents CH2 or NH, except for the cases where (i) Ar9 is triazolediyl and Z9 is NH and (ii) Ar9 is oxazolediyl and Z9 is CH2,


Z10 represents O or NH,


X11a represents —C(═O)—NH—, —SO2—NH—, or —NH—C(═O)—NH—,


X11b represents —C(═O)—NH—or—C(═O)—,


X12 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—C(═O)—NH—,


Z12a represents CH2 or NH, except for the case where X12 is —C(═O)—NH—, —SO2—NH—, or —NH—C(═O)—NH— and Z12a is NH,


Z12b represents CH2 or O, except for the case where Z12a is NH and Z12b is O,


Z12c represents a bond, CH2, or O, except for the cases where (i) Z12b is O and Z12c is O and (ii) Z12a is NH and Z12c is CH2 or O,


n13 represents 0, 1 or 2,


n16 represents 1 or 2,


Z16 represents a bond, CH2, or O,


X16 represents —CH2—O—, —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH—, except for the case where Z16 is O and X16 is —NH—C(═O)- or —NH—C(═O)—NH—,


Ar16 represents triazolediyl, oxadiazolediyl or pyrazolediyl, except for the cases where (i) X16 is —CH2—O— and Ar16 is oxadiazolediyl or pyrazolediyl and (ii) n16 is 1, X16 is —C(═O)—NH— or —NH—C(═O)—NH— and Ar16 is pyrazolediyl,


n17 represents 1 or 2,


X17 represents —C(═O)—NH—, —NH—C(═O)—, —NH—SO2—, or —NH—C(═O)—NH—, and


n18a, n18b, and n18c are the same or different and each represents 1 or 2. [0 0 20]


According to a preferred embodiment of the present invention, there is provided a BET degrader containing as an active ingredient the compound represented by formula (I) or a pharmaceutically acceptable salt thereof, wherein L1 and L2 are the same or different and each is a group represented by a formula selected from the group consisting of the following formulas (A) to (H), (J), (K), (M), and (N):




text missing or illegible when filed


text missing or illegible when filed


text missing or illegible when filed


wherein


the wavy lines each represents the bonding site to S,


RA1, RA2 and RA3 are the same or different and each represents a hydrogen atom or lower alkyl,


RA5 represents a hydrogen atom, a halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted tetrahydropyridinyl, optionally substituted dihydro-1H-pyrolyl, or optionally substituted tetrahydro-1H-azepinyl, ring RA represents benzenediyl, cycloalkanediyl, pyridinediyl, piperidinediyl, azetidinediyl, pyrrolidinediyl, or homopiperidinediyl,


n1A represents 0 or 1,


RB1 represents a hydrogen atom, optionally substituted lower alkoxycarbonylmethyl, optionally substituted cycloalkyloxycarbonylmethyl, or —CH2CONRB5RB6, wherein RB5 and RB6 are the same or different and each represents a hydrogen atom or optionally substituted lower alkyl, or RB5 and RB6 together with the adjacent nitrogen atom represent an optionally substituted nitrogen-containing aliphatic heterocyclic group,


RB2 represents optionally substituted lower alkyl,


RB3 and RB4 are the same or different and each represents a halogen or optionally substituted lower alkyl,


RC1 represents a hydrogen atom, lower alkyl, or lower alkanoyl,


RC3 represents a hydrogen atom or hydroxy,


ring RC represents benzenediyl, piperidinediyl, azetidinediyl, pyrrolidinediyl, homopiperidinediyl, piperazinediyl, or azaspiro[3.3]heptanediyl,


RD1 represents optionally substituted lower alkyl or optionally substituted lower alkoxycarbonyl,


ring RD represents benzenediyl or cycloalkanediyl,


RE1 and RF1 each has the same definition as RA1, and RE1 and RF1 may be the same or different,


RE2 and RF2 each has the same definition as RA2, and RE2 and RF2 may be the same or different,


RE3 and RF3 each has the same definition as RA3, and RE3 and RF3 may be the same or different,


RE5 and RF5 each has the same definition as RA5, and RE5 and RF5 may be the same or different,


RF7 represents a hydrogen atom or a halogen,


RG1 and RG2 are the same or different and each represents a hydrogen atom or lower alkyl,


RH1 represents a hydrogen atom or lower alkyl sulfonamide,


RH2 and RH3 are the same or different and each represents lower alkyl,


ZH represents CH2 or O,


ring RH represents benzenediyl, cycloalkanediyl, azetidinediyl, pyrrolidinediyl, piperidinediyl, or homopiperidinediyl,


ring RK represents benzenediyl or cycloalkanediyl,


RM1 represents a hydrogen atom or lower alkyl,


ring RM represents cycloalkanediyl, and


RN1 represents a hydrogen atom, a halogen, lower alkyl, or lower alkoxy.


According to another preferred embodiment of the present invention, there is provided a compound represented by the following formula (I)-1 or a pharmaceutically acceptable salt thereof:




embedded image


wherein one of L1-1 and L2-1 is a group represented by a formula selected from the group consisting of the following formulas (C)-2, (D)-2, (G)-2, (H)-2, (J)-2, (K)-2, (M)-2, and (N)-2, and the other of L1-1 and L2-1 is a group represented by a formula selected from the group consisting of formulas (A) to (H), (3), (K), (M), and (N) described in the above (3), and S is a group represented by a formula selected from the group consisting of formulas (S1) to (S18) described in the above (1) or (2):




text missing or illegible when filed


wherein


the wavy lines each represents the bonding site to S,


RC1-2 represents a hydrogen atom, lower alkyl or lower alkanoyl,


RC3-2 represents a hydrogen atom or hydroxy,


ring RC-2 represents piperazinediyl or azaspiro[3.3]heptanediyl,


RD1-2 represents optionally substituted lower alkyl or optionally substituted lower alkoxycarbonyl,


ring RD-2 represents cycloalkanediyl,


RG1-2 and RG2-2 are the same or different and each represents a hydrogen atom or lower alkyl,


RH1-2 represents a hydrogen atom or lower alkyl sulfonamide,


RH2-2 and RH3-2 are the same or different and each represents lower alkyl,


ZH-2 represents CH2 or O,


ring RH-2 represents benzenediyl, cycloalkanediyl, azetidinediyl, pyrrolidinediyl, piperidinediyl, or homopiperidinediyl,


ring RK-2 represents benzenediyl or cycloalkanediyl,


RM1-2 represents a hydrogen atom or lower alkyl,


ring RM-2 represents cycloalkanediyl, and


RN1-2 represents a hydrogen atom, a halogen, lower alkyl or lower alkoxy.


Hereinafter, the compound represented by the general formula (I) is referred to as compound (I), and the compound represented by the general formula (I)-1 is referred to as compound (I)-1. The same applies to the compounds having other formula numbers.


In the present description, the small molecular ligand for the BET protein is not particularly limited as long as it is a ligand that acts on the BET protein, and includes more specifically, for example, the ligands known in the followings: Journal of Medicinal Chemistry, 2013, vol. 56, p. 7501-7515 (Non-Patent Document 7), Proceedings of the National Academy of Sciences, 2013, vol. 110, p. 19754-19759 (Non-Patent Document 6), Oncotarget, 2015, vol. 6, p. 17698-17712 (Non-Patent Document 8), ACS Medicinal Chemistry Letters, 2013, vol. 4, p. 835-840, Journal of Medicinal Chemistry, 2016, vol. 59, p. 1330-1339, Bioorganic & Medicinal Chemistry, 2012, vol. 20, p. 1878-1886, US2014/0256710A1, WO2014/128067, European Journal of Medicinal Chemistry, 2016, vol. 121, p. 294-299, Journal of Medicinal Chemistry, 2011, vol. 54, p. 6761-6770, Journal of Medicinal Chemistry, 2013, vol. 56, p. 3217-3227, Journal of Medicinal Chemistry, 2012, vol. 55, p. 587-596, Bioorganic & Medicinal Chemistry, 2012, vol. 22, p. 2963-2967, Journal of Medicinal Chemistry, 2015, vol. 58, p. 4927-4939, WO2016/123709, WO2015/100282, WO2014/160873, WO2014/154760, WO2014/154762, US2015/0158873A1, WO2015/085925, WO2015/169962, WO2015/022332, WO2014/206150, US2016/0129001A1, US2014/0349990A1, WO2015/075665, WO2014/140076, Journal of Medicinal Chemistry, 2012, vol. 55, p. 576-586, WO2015/074064, WO2015/004075, Journal of Medicinal Chemistry, 2012, vol. 55, p. 9831-9837, Journal of Medicinal Chemistry, 2016, vol. 59, p. 1565-1579, Journal of Medicinal Chemistry, 2016, vol. 59, p. 1518-1530, Journal of Medicinal Chemistry, 2013, vol. 56, p. 3833-3851, Journal of Medicinal Chemistry, 2018, vol. 61, p. 3037-3058, Journal of Medicinal Chemistry, 2016, vol. 59, p. 1565-1579, Journal of Medicinal Chemistry, 2017, vol. 60, p. 4805-4817, Journal of Medicinal Chemistry, 2017, vol. 60, p. 9990-10012, ACS Medicinal Chemistry Letters, 2018, vol. 9, p. 262-267, Journal of Medicinal Chemistry, 2018, vol. 61, P. 462-481 and the like.


According to a preferred embodiment of the present invention, the BET degrader of the present invention or the compound of the present invention or a pharmaceutically acceptable salt thereof acts on the BET protein to promote interaction with DCAF16, which is one of E3 ubiquitin ligases, and thus to promote ubiquitination of the target BET protein, causing degradation by the proteasome to exhibit anticancer activity. According to a more preferred embodiment of the present invention, there is provided a BET degradation inducer containing as an active ingredient the compound represented by formula (I) or a pharmaceutically acceptable salt thereof.


In the present specification, examples of the lower alkyl include linear or branched alkyl having 1 to 10 carbon atoms, and more specifically include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, octyl, nonyl, decyl, and the like.


In the present specification, examples of the lower alkoxycarbonylmethyl include C1-10 alkoxycarbonylmethyl, and more specifically include methoxycarbonylmethyl, ethoxycarbonylmethyl, propoxycarbonylmethyl, isopropoxycarbonylmethyl, butoxycarbonylmethyl, isobutoxycarbonylmethyl, sec-butoxycarbonylmethyl, tert-butoxycarbonylmethyl, pentoxycarbonylmethyl, isopentoxycarbonylmethyl, neopentoxycarbonylmethyl, hexyloxycarbonylmethyl, heptoxycarbonylmethyl, octoxycarbonylmethyl, nonyloxycarbonylmethyl, decyloxycarbonylmethyl, and the like, wherein preferable is tert-butoxycarbonylmethyl.


In the present specification, the halogen means each atom of fluorine, chlorine, bromine, and iodine.


In the present specification, examples of the lower alkanoyl include C2-11 alkanoyl (alkanoyl having 2 to 11 carbon atoms).


The lower alkyl in RA1, RA2, and RA3 is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and further preferably methyl or ethyl.


The lower alkyl in RA5 is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and further preferably propyl.


The lower alkenyl in RA5 is preferably alkenyl having 2 to 6 carbon atoms, more preferably alkenyl having 2 to 4 carbon atoms, and further preferably propenyl.


The alkyl having 1 to 5 carbon atoms in RA2-1 and RA3-1 is preferably alkyl having 1 to 3 carbon atoms and more preferably methyl or ethyl.


The alkyl having 1 to 5 carbon atoms in RA5-1 is preferably alkyl having 1 to 3 carbon atoms and more preferably propyl.


The alkenyl having 2 to 6 carbon atoms in RA5-1 is preferably alkenyl having 2 to 4 carbon atoms and more preferably propenyl.


The cycloalkanediyl in ring RA and ring RA-1 is preferably cycloalkanediyl having 3 to 8 carbon atoms or bicycloalkanediyl having 3 to 8 carbon atoms, and more preferably cyclobutanediyl, cyclohexanediyl, bicyclo[1.1.1]pentanediyl, or bicyclo[2.2.2]octanediyl.


The lower alkoxycarbonylmethyl in RB1 is preferably alkoxycarbonylmethyl having 1 to 10 carbon atoms and more preferably ethoxycarbonylmethyl, propoxycarbonylmethyl, or butoxycarbonylmethyl (preferably tert-butoxycarbonylmethyl).


The cycloalkyloxycarbonylmethyl in RB1 and RB1-1 is preferably cycloalkyloxycarbonylmethyl having 3 to 8 carbon atoms and more preferably cyclohexyloxycarbonylmethyl.


The alkoxycarbonylmethyl having 1 to 5 carbon atoms in RB1-1 is preferably ethoxycarbonylmethyl, propoxycarbonylmethyl, or butoxycarbonylmethyl (preferably tert-butoxycarbonylmethyl).


The lower alkyl in RB5 and RB6 is preferably alkyl having 1 to 5 carbon atoms and more preferably ethyl.


The alkyl having 1 to 5 carbon atoms in RB5-1 and RB6-1 is preferably ethyl.


The nitrogen-containing aliphatic heterocyclic group in that RB5 and RB6 as well as RB5-1 and RB6-1 “together with the adjacent nitrogen atom representing an optionally substituted nitrogen-containing aliphatic heterocyclic group” is preferably a nitrogen-containing aliphatic heterocyclic group having 4 to 6 carbon atoms, more preferably azetidine, pyrrolidine, piperidine, piperazine, or morpholine, and further preferably piperazine.


The lower alkyl in RB2 is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and further preferably methyl.


The alkyl having 1 to 5 carbon atoms in RB2-1 is preferably alkyl having 1 to 3 carbon atoms and more preferably methyl.


The halogen in RB3 and RB4 is preferably a fluorine atom or a chlorine atom.


The lower alkyl in RB3 and RB4 is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and further preferably methyl.


The alkyl having 1 to 5 carbon atoms in RB3-1 and RB4-1 is preferably alkyl having 1 to 3 carbon atoms and more preferably methyl.


The lower alkyl in RC1 and RC1-2 is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and further preferably methyl or ethyl.


The lower alkanoyl in RC1 and RC1-2 is preferably alkanoyl having 2 to 11 carbon atoms, more preferably alkanoyl having 2 to 5 carbon atoms, and further preferably acetyl.


The lower alkyl in RD1 and RD1-2 is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and further preferably ethyl.


The alkyl having 1 to 5 carbon atoms in RD1-1 is more preferably alkyl having 1 to 3 carbon atoms and more preferably ethyl.


The lower alkoxycarbonyl in RD1 and RD1-2 is preferably alkoxycarbonyl having 1 to 5 carbon atoms, more preferably alkoxycarbonyl having 1 to 3 carbon atoms, and further preferably ethoxycarbonyl or methoxycarbonyl.


The alkoxycarbonyl having 1 to 5 carbon atoms in RD1-1 is preferably alkoxycarbonyl having 1 to 3 carbon atoms and more preferably ethoxycarbonyl or methoxycarbonyl.


The cycloalkanediyl in ring RD and ring RD-2 is preferably cycloalkanediyl having 3 to 8 carbon atoms, and more preferably cyclohexanediyl.


The halogen in RF7 is preferably a fluorine atom.


The lower alkyl in RG1 and RG2, and RG1-2 and RG2-2 is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and even more preferably methyl.


The lower alkyl sulfonamide in RH1, RH1-1 and RH1-2 is preferably alkyl sulfonamide having 1 to 3 carbon atoms, and more preferably ethyl sulfonamide.


The lower alkyl in RH2 and RH3, RH2-1 and RH3-1, and RH2-2 and RH3-2 is preferably alkyl having 1 to 3 carbon atoms, and more preferably methyl.


The cycloalkanediyl in ring RH and ring RH-2 is preferably cycloalkanediyl having 3 to 8 carbon atoms, and more preferably cyclohexanediyl.


The cycloalkanediyl in ring RK, ring RK-1, and ring RK-2 is preferably cycloalkanediyl having 3 to 8 carbon atoms, and more preferably cyclohexanediyl.


The lower alkyl in RM1 and RM1-2 is preferably alkyl having 1 to 3 carbon atoms, and more preferably methyl.


The cycloalkanediyl in ring RM and ring RM-2 is preferably cycloalkanediyl having 3 to 8 carbon atoms, more preferably bicycloalkanediyl having 5 to 8 carbon atoms, and even more preferably bicyclo[1.1.1]pentanediyl or bicyclo[2.2.2]octanediyl.


The bicycloalkanediyl having 5 to 8 carbon atoms in the ring RM-1 is preferably bicyclo[1.1.1]pentanediyl or bicyclo[2.2.2]octanediyl.


The halogen in RN1, RN1-1 and RN1-2 is preferably a chlorine atom.


The lower alkyl in RN1 and RN1-2 is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and even more preferably methyl.


The lower alkoxy in RN1 and RN1-2 is preferably alkoxy having 1 to 5 carbon atoms, more preferably alkoxy having 1 to 3 carbon atoms, and further preferably methoxy.


The lower alkyl in R1b is preferably alkyl having 1 to 5 carbon atoms, more preferably alkyl having 1 to 3 carbon atoms, and further preferably methyl or propyl (preferably isopropyl).


Examples of substituents in the “optionally substituted lower alkyl” and the “optionally substituted alkyl having 1 to 5 carbon atoms” of RA5 and RA5-1 include one or more substituents selected from the group consisting of a halogen, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furyl, thiophenyl, pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, and the like, wherein preferable is amino.


Examples of substituents in the “optionally substituted lower alkenyl” and the “optionally substituted alkenyl having 2 to 6 carbon atoms” of RA5 and RA5-1 include one or more substituents selected from the group consisting of a halogen, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furyl, thiophenyl, pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, and the like, wherein preferable is amino.


Examples of substituents in the “optionally substituted tetrahydropyridinyl” of RA5 and RA5-1 include a halogen, methyl, ethyl, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, and the like, but preferably the tetrahydropyridinyl is unsubstituted.


Examples of substituents in the “optionally substituted dihydro-1H-pyrrolyl” of RA5 include a halogen, methyl, ethyl, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, and the like, but preferably the dihydro-1H-pyrrolyl is unsubstituted.


Examples of substituents in the “optionally substituted tetrahydro-1H-azepinyl” of RA5 include a halogen, methyl, ethyl, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, and the like, but preferably the tetrahydro-1H-azepinyl is unsubstituted.


Examples of substituents in the “optionally substituted lower alkoxycarbonylmethyl” and the “optionally substituted alkoxycarbonylmethyl having 1 to 5 carbon atoms” of RB1 and RB1-1 include one or more substituents selected from the group consisting of a halogen, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furyl, thiophenyl, pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, and pyrazinyl, wherein preferable is hydroxy, methoxy, or dimethylamino, and unsubstituted cases are also preferable.


Examples of substituents in the “optionally substituted cycloalkyloxycarbonylmethyl” of RB1 and RB1-1 include one or more substituents selected from the group consisting of a halogen, methyl, ethyl, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, and the like, wherein preferable is hydroxy.


Examples of substituents in the “optionally substituted lower alkyl” of RB5 and RB6 include one or more substituents selected from the group consisting of a halogen, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furyl, thiophenyl, pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, and the like, and the unsubstituted case is also preferable.


Examples of substituents in RB5 and RB6 as well as RB5-1 and R136-1 “together with the adjacent nitrogen atom representing an optionally substituted nitrogen-containing aliphatic heterocyclic group” include one or more substituents selected from the group consisting of a halogen, methyl, ethyl, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, hydroxymethyl, hydroxyethyl, hydroxypropyl, and the like, wherein preferable is hydroxyethyl.


Examples of substituents in the “optionally substituted lower alkyl” and the “optionally substituted alkyl having 1 to 5 carbon atoms” of RB2 and RB2-1 include a halogen, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furyl, thiophenyl, pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, and the like, but preferably the lower alkyl and the alkyl having 1 to 5 carbon atoms are unsubstituted.


Examples of substituents in the “optionally substituted lower alkyl” and the “optionally substituted alkyl having 1 to 5 carbon atoms” of RB3 and RB4 as well as RB3-1 and RB4-1 include one or more substituents selected from the group consisting of a halogen, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furyl, thiophenyl, pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, and the like, wherein preferable is a fluorine atom or cyano. Examples of the “optionally substituted lower alkyl” and “optionally substituted alkyl having 1 to 5 carbon atoms” of RB3 and RB4 as well as RB3-1 and RB4-1 are particularly preferably unsubstituted lower alkyl and unsubstituted alkyl having 1 to 5 carbon atoms, respectively.


Examples of substituents in the “optionally substituted lower alkyl” and “optionally substituted alkyl having 1 to 5 carbon atoms” of RD1, RD1-1 and RD1-2 include a halogen, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furyl, thiophenyl, pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, and the like, but preferably the lower alkyl and the alkyl having 1 to 5 carbon atoms are unsubstituted.


Examples of substituents in the “optionally substituted lower alkoxycarbonyl” and “optionally substituted alkoxycarbonyl having 1 to 5 carbon atoms” of RD1, RD1-1 and RD1-2 include one or more substituents selected from the group consisting of a halogen, hydroxy, methoxy, ethoxy, nitro, cyano, carboxy, methoxycarbonyl, ethoxycarbonyl, amino, methylamino, ethylamino, dimethylamino, diethylamino, carbamoyl, methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, furyl, thiophenyl, pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, and the like, wherein preferable is hydroxy or dimethylamino, and unsubstituted cases are also preferable.


In formula (S1), X1a and X1b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, preferably except for the cases where (i) X1a is —NH—SO2— and X1b is —SO2—NH—, (ii) n1a and n1b are 0, X1a is —C(═O)—NH—, —SO2—NH—, —O—C(═S)—NH—, —O—C(═O)—NH—, or —NH—C(═O)—NH—, and X1b is —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and (iii) X1a is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— and X1b is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—.


Here, the left bonding hand of X1a bonds to L1 and the right bonding hand of X1b bonds to L2. For example, Compound No. 1a in the following Table 1 is a compound formed by bonding of L1 and the left bonding hand of X1a (—C(═O)—NH—) to become L1-C(═O)—NH— and bonding of L2 and the right bonding hand of X1b (—NH—C(═O)—) to become —NH—C(═O)-L2. The same applies to the following.


In formula (S2), X2a represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2— and X2b represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, or —CH2—, preferably except for the case where X2a is —NH—SO2— and X2b is —SO2—NH—. Similar to the above, the left bonding hand of X2a bonds to L1 and the right bonding hand of X2b bonds to L2.


In formula (S3), X3 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —NH—C(═O)—NH—, or —NH—CH2—. Similar to the above, the right bonding hand of X3 bonds to L2.


In formula (S5), X5a and X5b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—SO2—, preferably except for the case where X5a is —NH—SO2— and X5b is —SO2—NH—. Similar to the above, the left bonding hand of X5a bonds to L1 and the right bonding hand of X5b bonds to L2.


In formula (S6), X6 is —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —CH2—NH, or —NH—C(═O)—NH—, preferably except for the cases where (i) Ar6 is oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl and X6 is —NH—SO2— and (ii) n6 is 1, Ar6 is pyrazolediyl or tetrahydropyridinediyl, and X6 is —C(═O)—NH—, —SO2—NH—, —CH2—NH—, or —NH—C(═O)—NH—. Similar to the above, the left bonding hand of X6 bonds to L1.


In formula (S7), X7 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—C(═O)—NH—. Similar to the above, the left bonding hand of X7 bonds to L1.


In formula (S8), X8a represents —C(═O)—, —CH2—, or —NH—C(═O)— and X8b is a bond, —C(═O)—, —CH2—, or —CH(OH)—. Similar to the above, the left bonding hand of X8a bonds to L1 and the right bonding hand of X8b bonds to L2.


In formula (S11), X11a represents —C(═O)—NH—, —SO2—NH—, or —NH—C(═O)—NH— and X11b represents —C(═O)—NH— or —C(═O)—. Similar to the above, the left bonding hand of X11a bonds to L1 and the right bonding hand of X11b bonds to L2.


In the above formula (S12), X12 represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, or —NH—C(═O)—NH—. Similar to the above, the left bonding hand of X12 bonds to L1.


In formula (S16), X16 represents —CH2—O—, —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH—, preferably except for the case where Z16 is O and X16 is —NH—C(═O)— or —NH—C(═O)—NH—. Similar to the above, the left bonding hand of X16 bonds to L1 via Z16 or the like.


In formula (S17), X17 represents —C(═O)—NH—, —NH—C(═O)—, —NH—SO2—, or —NH—C(═O)—NH—. Similar to the above, the right bonding hand of X17 bonds to L2.


In general formula (I), L1 and L2 are the same or different and each represents small molecular ligand for BET protein, preferably


L1 and L2 are the same or different and each represents a group represented by a formula selected from the group consisting of formulas (A) to (H), (3), (K), (M) and (N), more preferably at least one of L1 and L2 is a group represented by formula (A) or (B), and further preferably at least one of L1 and L2 is a group represented by formula (A).


According to a preferred embodiment of the present invention, in general formula (I), when L1 and L2 are the same or different and each represents a group represented by formula (A), (B), (C), (D), (F), (G), (H), (J), (K), (M) or (N), S is preferably a group represented by a formula selected from the group consisting of formulas (S1) to (S15).


According to a preferred embodiment of the present invention, in general formula (I), when L1 or L2 is a group represented by formula (E), S is preferably a group represented by formula (S16), (S17), or (S18).


According to a preferred embodiment of the present invention, in general formula (I), when L1 is a group represented by formula (F), S is preferably a group represented by any of the following:


a group represented by formula (S1), wherein X1a is —C(═O)—NH—,


a group represented by formula (S2), wherein X2a is —C(═O)—NH—,


a group represented by formula (S3),


a group represented by formula (S4),


a group represented by formula (S5), wherein X5a is-C(═O)—NH—,


a group represented by formula (S6), wherein X6 is —C(═O)—NH—,


a group represented by formula (S7), wherein X7 is —C(═O)—NH—,


a group represented by formula (S8), wherein X8a is —C(═O)—


a group represented by formula (S11), wherein X11a is —C(═O)—NH—,


a group represented by formula (S12), wherein X12 is —C(═O)—NH—,


a group represented by formula (S14), or


a group represented by formula (S15).


According to another preferred embodiment of the present invention, in general formula (I), when L2 is a group represented by formula (F), S is a group represented by any of the following:


a group represented by formula (S1), wherein X1b is —NH—C(═O)—,


a group represented by formula (S2) wherein X2b is —NH—C(═O)—,


a group represented by formula (S3), wherein X3 is —NH—C(═O)—,


a group represented by formula (S4),


a group represented by formula (S5), wherein X5b is —NH—C(═O)—,


a group represented by formula (S13), wherein n13 is 0,


a group represented by formula (S15), or


a group represented by formula (S17), wherein X17 is —NH—C(═O)—.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), (B), (C), (D), (F) or (G), L2 represents a group represented by formula (A), (B), (C), (D), (H), (J), (K) or (M), and S is a group represented by formula (S1).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A) (preferably formula (A1), formula (A5), or formula (A15)), L2 represents a group represented by formula (A) (preferably formula (A1)), and S is a group represented by formula (S1).


According to a preferred embodiment of the present invention, there is provided a BET degrader containing as an active ingredient a compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), L2 represents a group represented by formula (A), and S is a group represented by formula (S2).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), (B), (C), (G) or (N), L2 represents a group represented by formula (A) or (B), and S is a group represented by formula (S3).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A) (preferably formula (A1) or formula (A5)), L2 represents a group represented by formula (A) (preferably formula (A1) or formula (A5)), and S is a group represented by formula (S3).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), L2 represents a group represented by formula (A), and S is a group represented by formula (S4) or (S5).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), (B), (C), (D), (G) or (H), L2 represents formula (A), (B), (C) or (D), and S is a group represented by formula (S6).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A) (preferably formula (A1) or formula (A5)), L2 represents a group represented by formula (A) (preferably a group represented by formula (A1) or formula (A5)), and S is a group represented by formula (S6).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula (A), and S is a group represented by formula (S7).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula


(A), and S is a group represented by formula (S8).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), L2 represents a group represented by formula (A), and S is a group represented by formula (S9).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula (A), and S is a group represented by formula (S10).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula (A) or (B), and S is a group represented by formula (S11). According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A) or (B), L2 represents a group represented by formula (A), and S is a group represented by formula (S11), wherein the group represented by formula (S11) is a group where X11b is —C(═O)—, and the group represented by formula (A) in L2 is a group where ring RA is piperidinediyl, azetidinediyl, pyrrolidinediyl, or homopiperidinediyl.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), L2 represents a group represented by formula (A), and S is a group represented by formula (S12), (S13), (S14) or (S15).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (E), L2 represents a group represented by formula (A), and S is a group represented by formula (S16), (S17) or (S18).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (A) is the following formula (A)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RA1-1 represents a hydrogen atom,


RA2-1 and RA3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2-1 represents methyl and RA3-1 represents ethyl),


RA5-1 represents a hydrogen atom, a fluorine atom, optionally substituted alkyl having 1 to 5 carbon atoms (preferably alkyl having 1 to 3 carbon atoms which may be substituted with amino and more preferably propyl substituted with amino), optionally substituted alkenyl having 2 to 6 carbon atoms (preferably propenyl optionally substituted with amino and more preferably, propenyl substituted with amino), or optionally substituted tetrahydropyridinyl (preferably tetrahydropyridinyl),


ring RA-1 represents benzenediyl, cycloalkanediyl (preferably cyclobutanediyl, cyclohexanediyl, bicyclo[1.1.1]pentanediyl or bicyclo[2.2.2]octanediyl), pyridinediyl, or piperidinediyl, and


n1A-1 represents 0 or 1 (preferably 0).


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (A) is formula (A)-1, and wherein in formula (A)-1,


the wavy line represents the bonding site to S,


RA1-1 represents a hydrogen atom,


RA2-1 and RA3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2-1 represents methyl and RA3-1 represents ethyl),


RA5-1 represents a hydrogen atom,


ring RA-1 represents benzenediyl, cyclohexanediyl, or pyridinediyl, and


n1A-1 represents 0 or 1 (preferably 0).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (B) is the following formula (B)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RB1-1 represents a hydrogen atom, optionally substituted alkoxycarbonylmethyl having 1 to 5 carbon atoms (preferably optionally substituted ethoxycarbonylmethyl (more preferably hydroxy-substituted ethoxycarbonylmethyl, methoxy-substituted ethoxycarbonylmethyl, or dimethylamino-substituted ethoxycarbonylmethyl), optionally substituted propoxycarbonylmethyl (more preferably methoxy-substituted propoxycarbonylmethyl), or butoxycarbonylmethyl (more preferably tert-butoxycarbonylmethyl)), optionally substituted cycloalkyloxycarbonylmethyl (preferably optionally substituted cyclohexyloxycarbonylmethyl (more preferably hydroxy-substituted cyclohexylmethyl), or —CH2CONRB5-1RB6-1, wherein RB5-1 and RB6-1 are the same or different and each represents a hydrogen atom or alkyl having 1 to 5 carbon atoms (preferably, RB5-1 represents a hydrogen atom and RB5-1 represents ethyl), or RB5-1 and RB6-1 together with the adjacent nitrogen atom represent an optionally substituted nitrogen-containing aliphatic heterocyclic group (preferably piperazine),


RB2-1 represents optionally substituted alkyl having 1 to 5 carbon atoms (preferably methyl), and


RB3-1 and RB4-1 represent optionally substituted alkyl having 1 to 5 carbon atoms (preferably methyl).


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (B) is formula (B)-1, and wherein in formula (B)-1,


the wavy line represents the bonding site to S,


RB1-1 represents tert-butoxycarbonylmethyl,


RB2-1 represents optionally substituted alkyl having 1 to 5 carbon atoms (preferably methyl), and


RB3-1 and RB4-1 represent optionally substituted alkyl having 1 to 5 carbon atoms (preferably methyl).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (C) is the following formula (C)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RC1-1 represents a hydrogen atom,


RC3-1 represents a hydrogen atom or hydroxy, and


ring RC-1 represents benzenediyl, piperidinediyl, piperadinediyl, or azaspiro[3.3]heptanediyl (when RC3-1 is a hydrogen atom, ring RC-1 is preferably piperidinediyl, piperadinediyl, or azaspiro[3.3]heptanediyl, and when RC3-1 is hydroxy, ring RC-1 is preferably benzenediyl).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (D) is the following formula (D)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RD1-1 represents optionally substituted alkyl having 1 to 5 carbon atoms (preferably ethyl) or optionally substituted alkoxycarbonyl having 1 to 5 carbon atoms (preferably hydroxyl-substituted ethoxycarbonyl, diethylamino-substituted ethoxycarbonyl, or unsubstituted methoxycarbonyl), and


ring RD-1 represents benzenediyl or cyclohexanediyl.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (E) is the following formula (E)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RE1-1 represents a hydrogen atom,


RE2-1 and RE3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RE2-1 represents methyl and RE3-1 represents ethyl), and


RE5-1 represents a hydrogen atom.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (F) is the following formula (F)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RF1-1 represents a hydrogen atom,


RF2-1 and RF3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RF2-1 represents methyl and RF3-1 represents ethyl),


RF5-1 represents a hydrogen atom, and


RF7-1 represents a hydrogen atom or a fluorine atom.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (G) is the following formula (G)-1:




embedded image


wherein


the wavy line represents the bonding site to S, and


RG1-1 and RG2-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably methyl).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (H) is the following formula (H)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RH1-1 represents a hydrogen atom or alkyl sulfonamide having 1 to 5 carbon atoms (preferably ethyl sulfonamide),


RH2-1 and RH3-1 are the same or different and each represents alkyl having 1 to 5 carbon atoms,


ZH-1 represents CH2 or O, and


ring RH-1 represents benzenediyl or piperidinediyl.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (K) is the following formula (K)-1:




embedded image


wherein


the wavy line represents the bonding site to S, and


ring RK-1 represents benzenediyl or cyclohexanediyl.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (M) is the following formula (M)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RM1-1 represents a hydrogen atom, and


ring RM-1 represents bicycloalkanediyl having 5 to 8 carbon atoms.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (N) is the following formula (N)-1:




embedded image


wherein


the wavy line represents the bonding site to S,


RN-1 represents a halogen (preferably a chlorine atom).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), formula (S) is the following formula (S1)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n1a-1 and n1b-1 are the same or different and each represents 0 or 1,


X1a-1 and X1b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— (except for the cases where (i) X1a-1 is —NH—SO2— and X1b-1 is —SO2—NH—, (ii) n1a-1 and n1b-1 are 0, X1a-1 is —C(═O)—NH—, —SO2—NH—, —O—C(═S)—NH—, —O—C(═O)—NH—, or —NH—C(═O)—NH—, and X1b-1 is —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and (iii) X1a-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— and X1b-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—), wherein preferably X1a-1 and X1b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH— (except for the cases where (i) X1a-1 is —NH—C(═O)—NH— and X1b-1 is —NH—C(═O)—NH— and (ii) n1a-1 and n1b-1 are 0, X1a-1 is —C(═O)—NH— or —NH—C(═O)—NH—, and X1b-1 is —NH—C(═O)—), and more preferably X1a-1 represents —NH—C(═O)— or —NH—C(═O)—NH— and X1b-1 represents —C(═O)—NH—, and


R1a-1 represents a hydrogen atom, R1b-1 represents a hydrogen atom or alkyl having 1 to 5 carbon atoms (preferably methyl or isopropyl), or R1a-1 and R1b-1 together represent carbonyl.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is formula (S1)-1, wherein in formula (S1)-1,


the wavy lines each represents the bonding site to L1 or L2,


n1a-1 and n1b-1 are the same or different and each represents 0 or 1,


X1a-1 and X1b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— (except for the cases where (i) X1a-1 is —NH—SO2— and X1b-1 is —SO2—NH—, (ii) n1a-1 and n1b-1 are 0, X1a-1 is —C(═O)—NH—, —SO2—NH—, —O—C(═S)—NH—, —O—C(═O)—NH—, or —NH—C(═O)—NH—, and X1b-1 is —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and (iii) X1a-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— and X1b-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—), wherein preferably X1a-1 and X1b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH— (except for the cases where (i) X1a-1 is —NH—C(═O)—NH— and X1b-1 is —NH—C(═O)—NH— and (ii) n1a-1 and n1b-1 are 0, X1a-1 is —C(═O)—NH— or —NH—C(═O)—NH—, and X1b-1 is —NH—C(═O)—), and more preferably X1a-1 represents —NH—C(═O)— or —NH—C(═O)—NH— and X1b-1 represents —C(═O)—NH—, and


R1a-1 represents a hydrogen atom and R1b-1 represents a hydrogen atom.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S2)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X2a-1 represents —C(═O)—NH— or —NH—C(═O)—,


X2b-1 represents —C(═O)—NH—, —NH—C(═O)—, or —CH2—, and


Z2-1 represents CH or N (except for the cases where (i) Z2-1 is N and X2b-1 is —NH—C(═O)— and (ii) Z2-1 is CH and X2b-1 is —CH2—).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S3)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n3a-1 and n3b-1 are the same or different and each represents 1 or 2,


X3-1 represents —C(═O)—NH—, —NH—C(═O)—, —NH—C(═O)—NH—, or —NH—CH2— (preferably —C(═O)—NH—), and


Z3-1 represents CH or N (except for the cases where (i) Z3-1 is N and X3-1 is —NH—C(═O)—, —NH—C(═O)—NH—, or —NH—CH2— and (ii) Z3-1 is N and n3a-1 or n3b-1 is 1).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S5)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2, and


X5a-1 and X5b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, or —NH—SO2— (preferably, X5a-1 is —C(═O)—NH— or —NH—SO2— and X5b-1 represents —C(═O)—NH— or —NH—C(═O)—).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S6)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n6-1 represents 1 or 2,


Ar6-1 represents triazolediyl, oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl, and


X6-1 represents —C(═O)—NH—, —NH—C(═O)—, or —CH2—NH-(except for the case where (i) n6-1 is 1, Ar6-1 is pyrazolediyl or tetrahydropyridinediyl, and X6-1 is —C(═O)—NH— or —CH2—NH—).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S7)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X7-1 represents —C(═O)—NH— or —NH—C(═O)—,


n7-1 represents 1, and


Z7-1 represents S, SO, or SO2.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S8)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X8a-1 represents —C(═O)— or —CH2—, and


X8b-1 represents a bond, —C(═O)—, —CH2—, or —CH(OH)—.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S9)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


Ar9-1 represents triazolediyl or oxazolediyl, and


Z9-1 represents CH2 or NH (except for the cases where (i) Ar9-1 is triazolediyl and Z9-1 is NH and (ii) Ar9-1 is oxazolediyl and Z9-1 is CH2).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S10)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2, and


Z10-1 represents O or NH.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S11)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X11a-1 represents —C(═O)—NH—, and


X11b-1 represents —C(═O)—NH— or —C(═O)—.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S12)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


X12-1 represents —C(═O)—NH— or —NH—C(═O)—,


Z12a-1 represents CH2 or NH (except for the case where X12-1 is —C(═O)—NH— and Z12a-1 is NH),


Z12b-1 represents CH2 or O (except for the case where Z12a-1 is NH and Z12b-1 is O), and


Z12c-1 represents a bond or O (except for the cases where (i) Z12b-1 is O and Z12c-1 is O and (ii) Z12a-1 is NH and Z12c-1 is O).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S13)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2, and


n13-1 represents 0 or 2.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S16)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n16-1 represents 1 or 2,


Z16-1 represents a bond, CH2, or O,


X16-1 represents —CH2—O— or —C(═O)—NH—, and


Ar16-1 represents triazolediyl, oxadiazolediyl, or pyrazolediyl (except for the cases where (i) X16-1 is —CH2—O— and Ar16-1 is oxadiazolediyl or pyrazolediyl and (ii) n16-1 is 1, X16-1 is —C(═O)—NH—, and Ar16-1 is pyrazolediyl).


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S17)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2,


n17-1 represents 1 or 2, and


X17-1 represents —C(═O)—NH—.


According to a preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), S is the following formula (S18)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1 or L2, and


n18a-1 represents 2, n18b-1 represents 2, and n18c-1 represents 1.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1)) and S is a group represented by formula (S1), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0, and


in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1) or (A5)) and S is a group represented by formula (S1), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and


in formula (S1), n1a and n1b each represents 0, X1a and X1b are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, or —NH—C(═O)—NH— (preferably —NH—C(═O)— or —NH—C(═O)—NH—) (except for the case where X1a is —C(═O)—NH— or —NH—C(═O)—NH— and X1b is —NH—C(═O)— or —NH—C(═O)—NH—), R1a represents a hydrogen atom and R1b represents a hydrogen atom.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1) or (A15)) and S is a group represented by formula (S1), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl or pyridinediyl, and n1A represents 0, and in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom and R1b represents a hydrogen atom.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1) or (A5)) and S is a group represented by formula (S3), and wherein in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and in formula (S3), n3a and n3b each represents 2, X3 represents —C(═O)—NH—, and Z3 represents N.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1) or (A5)) and S is a group represented by formula (S3), and wherein in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and in formula (S3), n3a and n3b each represents 1, X3 represents —C(═O)—NH—, and Z3 represents CH.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1)) and S is a group represented by formula (S6), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0, and


in formula (S6), n6 represents 1, Ar6 represents oxadiazolediyl, and X6 represents —CH2—NH—.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1)) and S is a group represented by formula (S6), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0, and


in formula (S6), n6 represents 1, Ar6 represents triazolediyl, and X6 represents —CH2—NH—.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1) or (A5)) and S is a group represented by formula (S6), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1A represents 0, and


in formula (S6), n6 represents 1, Ar6 represents oxadiazolediyl, and X6 represents —C(═O)—NH—.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 and L2 each represents a group represented by formula (A) (preferably formula (A1) or (A5)) and S is a group represented by formula (S6), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms (preferably, RA2 represents methyl and RA3 represents ethyl), RA5 represents a hydrogen atom, ring RA represents benzenediyl or cycloalkanediyl, and n1-A represents 0, and


in formula (S6), n6 represents 2, Ar6 represents triazolediyl, and X6 represents —C(═O)—NH—.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), L2 represents a group represented by formula (H), and S represents a group represented by formula (S1), and wherein in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0, in formula (H), RH1 represents alkyl sulfonamide having 1 to 5 carbon atoms, RH2 and RH3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, ZH represents 0, and ring RH represents benzenediyl, and in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


According to a more preferred embodiment of the present invention, there is provided the BET degrader containing as an active ingredient the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I), L1 represents a group represented by formula (A), L2 represents a group represented by formula (H), and S represents a group represented by formula (S1), and wherein in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0, in formula (H), RH1 represents a hydrogen atom, RH2 and RH3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, ZH represents 0, ring RH represents benzenediyl, and in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


According to another aspect of the present invention, there is provided a compound represented by the following formula (I)-1 or a pharmaceutically acceptable salt thereof:




embedded image


wherein one of L1-1 and L2-1 is a group represented by a formula selected from the group consisting of the following formula (C)-2, (D)-2, (G)-2, (H)-2, (J)-2, (K)-2, (M)-2, and (N)-2, and the other of L1-1 and L2-1 is a group represented by a formula selected from the group consisting of the above formulas (A) to (H), (3), (K), (M), and (N) in formula (I), and S is a group represented by a formula selected from the group consisting of the above formulas (S1) to (S18) in formula (I):




text missing or illegible when filed


wherein


the wavy lines each represents the bonding site to S,


RC1-2 represents a hydrogen atom, lower alkyl or lower alkanoyl (preferably a hydrogen atom),


RC3-2 represents a hydrogen atom or hydroxy (preferably a hydrogen atom),


ring RC-2 represents piperazinediyl or azaspiro[3.3]heptanediyl,


RD1-2 represents optionally substituted lower alkyl (preferably ethyl) or optionally substituted lower alkoxycarbonyl,


ring RD-2 represents cycloalkanediyl (preferably cyclohexanediyl),


RG1-2 and RG2-2 are the same or different and each represents a hydrogen atom or lower alkyl (preferably methyl),


RH1-2 represents a hydrogen atom or lower alkyl sulfonamide (preferably ethyl sulfonamide),


RH2-2 and RH3-2 are the same or different and each represents lower alky (preferably methyl),


ZH-2 represents CH2 or O,


ring RH-2 represents benzenediyl, cycloalkanediyl, azetidinediyl, pyrrolidinediyl, piperidinediyl, or homopiperidinediyl (preferably benzenediyl, cyclohexanediyl, or piperidinediyl),


ring RK-2 represents benzenediyl or cycloalkanediyl (preferably cyclohexanediyl),


RM1-2 represents a hydrogen atom or lower alkyl,


ring RM-2 represents cycloalkanediyl (preferably bicycloalkanediyl having 5 to 8 carbon atoms, more preferably bicyclo[1.1.1]pentanediyl or bicyclo[2.2.2]octanediyl), and


RN1-2 represents a hydrogen atom, a halogen, lower alkyl, or lower alkoxy (preferably a halogen).


According to another preferred embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, L1-1 represents a group represented by formula (G)-2, L2-1 represents a group represented by formula (A), and S is a group represented by formula (S1).


According to another preferred embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, L1-1 represents a group represented by formula (A), L2-1 represents a group represented by formula (C)-2, (D)-2, (H)-2, (J)-2, (K)-2, or (M)-2, and S is a group represented by formula (S1).


According to another preferred embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, L1-1 represents a group represented by formula (G)-2 or (N)-2, L2-1 represents a group represented by formula (A), and S represents a group represented by formula (S3).


According to another preferred embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, L1-1 represents a group represented by formula (C)-2, (G)-2, or (H)-2, L2-1 represents a group represented by formula (A), and S is a group represented by formula (S6).


According to another preferred embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, S is the following formula (S1)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1-1 or L2-1,


n1a-1 and n1b-1 are the same or different and each represents 0 or 1,


X1a-1 and X1b-1 are the same or different and each represents —C(═O)—NH—, —NH—C(═O)—, —SO2—NH—, —NH—SO2—, —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH— (except for the cases where (i) X1a-1 is —NH—SO2— and X1b-1 is —SO2—NH—, (ii) n1a-1 and n1b-1 are 0, X1a-1 is —C(═O)—NH—, —SO2—NH—, —O—C(═S)—NH—, —O—C(═O)—NH—, or —NH—C(═O)—NH—, and X1b-1 is —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and (iii) X1a-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—, and X1b-1 is —O—C(═S)—NH—, —O—C(═O)—NH—, —NH—C(═O)—O—, or —NH—C(═O)—NH—), and


R1a-1 represents a hydrogen atom and R1b-1 represents a hydrogen atom or alkyl having 1 to 5 carbon atoms, or R1a-1 and R1b-1 together represent carbonyl.


When S is the above formula (S1)-1, preferred embodiments in formula (I)-1 may be the same as the above preferred embodiments in formula (I).


According to another preferred embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, S is the following formula (S3)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1-1 or L2-1,


n3a-1 and n3b-1 are the same or different and each represents 1 or 2,


X3-1 represents —C(═O)—NH—, —NH—C(═O)—, —NH—C(═O)—NH—, or —NH—CH2—, and


Z3-1 represents CH or N (except for the cases where (i) Z3-1 is N and X3-1 is —NH—C(═O)—, —NH—C(═O)—NH—, or —NH—CH2—, and (ii) Z3-1 is N and n3a-1 or n3b-1 is 1).


When S is the above formula (S3)-1, preferred embodiments in formula (I)-1 may be the same as the above preferred embodiments in formula (I).


According to another preferred embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, S is the following formula (S6)-1:




embedded image


wherein


the wavy lines each represents the bonding site to L1-1 or L2-1,


n6-1 represents 1 or 2,


Ar6-1 represents triazolediyl, oxadiazolediyl, pyrazolediyl, thiophenediyl, or tetrahydropyridinediyl, and


X6-1 represents —C(═O)—NH—, —NH—C(═O)— or —CH2—NH— (except for the cases where (i) n6-1 is 1, Ar6-1 is pyrazolediyl or tetrahydropyridinediyl, and X6-1 is —C(═O)—NH— or —CH2—NH—).


When S is the above formula (S6)-1, preferred embodiments in formula (I)-1 may be the same as the above preferred embodiments in formula (I).


According to a more preferable embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, L1-1 represents a group represented by formula (A), L2-1 represents a group represented by formula (H)-2, and S is a group represented by formula (S1), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0,


in formula (H)-2, RH1-2 represents alkyl sulfonamide having 1 to 5 carbon atoms, RH2-2 and RH3-2 are the same or different and each represents alkyl having 1 to 5 carbon atoms, ZH-2 represents O, and ring RH-2 represents benzenediyl, and


in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


According to a more preferable embodiment of the present invention, there is provided the compound or a pharmaceutically acceptable salt thereof, wherein in formula (I)-1, L1-1 represents a group represented by formula (A), L2-1 represents a group represented by formula (H)-2, and S is a group represented by formula (S1), and wherein


in formula (A), RA1 represents a hydrogen atom, RA2 and RA3 are the same or different and each represents alkyl having 1 to 5 carbon atoms, RA5 represents a hydrogen atom, ring RA represents benzenediyl, and n1A represents 0,


in formula (H)-2, RH1-2 represents a hydrogen atom, RH2-2 and RH3-2 are the same or different and each represents alkyl having 1 to 5 carbon atoms, ZH-2 represents O, and ring RH-2 represents benzenediyl, and


in formula (S1), n1a and n1b each represents 1, X1a and X1b are the same or different and each represents —C(═O)—NH— or —NH—C(═O)—, R1a represents a hydrogen atom, and R1b represents a hydrogen atom.


The pharmaceutically acceptable salt of compound (I) or compound (I)-1 includes, for example, pharmaceutically acceptable acid addition salt, metal salt, ammonium salt, organic amine addition salt, amino acid addition salt, and the like. Examples of the pharmaceutically acceptable acid addition salt of compound (I) or compound (I)-1 include inorganic acid salt such as hydrochloride, hydrobromide, nitrate, sulfate, phosphate, and the like; and organic acid salt such as acetate, oxalate, maleate, fumarate, citrate, benzoate, methanesulfonate, and the like; and the like. Examples of the pharmaceutically acceptable metal salt include alkali metal salt such as sodium salt, potassium salt, and the like; alkaline earth metal salt such as magnesium salt, calcium salt, and the like; aluminum salt; zinc salt; and the like. Examples of the pharmaceutically acceptable ammonium salt include salt of such as ammonium, tetramethylammonium, and the like. Examples of the pharmaceutically acceptable organic amine addition salt include addition salt of such as morpholine, piperidine, and the like, and examples of the pharmaceutically acceptable amino acid addition salts include addition salts of such as lysine, glycine, phenylalanine, aspartic acid, glutamic acid, and the like.


The compound of the present invention means a compound that has desirable properties for one or more of various evaluation items required of a pharmaceutical composition or a therapeutic or prophylactic agent for cancer, the properties including not only pharmacological activity but also physical stability, stability under physiological conditions, safety for living body, and the like.


Method for the Manufacture of Compound (I)

Next, the method for the manufacture of compound (I) or compound (I)-1 will be described.


Incidentally, in the manufacturing method described below, when the defined groups react under the conditions of the manufacturing method or are not appropriate to implement the manufacturing method, the target compounds can be manufactured by using a method of introducing and removing a protecting group commonly used in organic synthetic chemistry [e.g., a method described in Protective Groups in Organic Synthesis, 3rd Edition by T. W. Greene, John Wiley & Sons Inc. (1999) and the like]. Furthermore, as necessary, the order of reaction steps such as introduction of substituents and the like can also be changed.


First, the method for the manufacture of a compound having a chemical structure of L1 or L2 moiety corresponding to a ligand in compound (I) will be described. The same applied to L1-1 and L2-1 moieties in compound (I)-1.


[Manufacturing Method 1]

Among compounds having a chemical structure represented by formula (A), the following compounds in which ring RA is ring RA1 and n1A is 0: (i) compound (a-10) in which carboxy is bonded to the wavy line portion, (ii) compound (a-14) in which amino is bonded to the wavy line portion, and (iii) compound (a-12) in which a halogen is bonded to the wavy line portion can be manufactured according to the following steps:




embedded image


wherein RA1, RA2, RA3, and RA5 are as defined above, X represents a halogen, RA4 represents lower alkyl, ring RA1 represents benzenediyl or pyridinediyl, and P represents an amine protecting group such as, for example, tert-butoxycarbonyl (Boc), benzyloxycarbonyl (Cbz), p-methoxybenzyl (PMB), and the like.


(Step 1)

Compound (a-2) can be manufactured by reacting compound (a-1) and 0.001 equivalent to 0.5 equivalent of rhodium catalyst in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the rhodium catalyst include tris(triphenylphosphine)carbonyl rhodium hydride and the like.


Examples of the solvent include tetrahydrofuran (THF), acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (a-1) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 118, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (a-4) can be manufactured by reacting compound (a-a2), 1 equivalent to 5 equivalents of compound (a-2), and 1 equivalent to 5 equivalents of compound (a-3) in the presence of a catalytic amount of bismuth(III) chloride in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the solvent include THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (a-3) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Compound (a-a2) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (a-6) can be manufactured by reacting compound (a-4) and 1 equivalent to 5 equivalents of compound (a-5) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, lithium diisopropylamide (LDA), lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine, and the like.


Examples of the solvent include chloroform, dichloromethane, dimethylformamide (DMF), dimethylacetamide (DMA), N-methylpyrrolidone (NMP), dimethylsulfoxide (DMSO), THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (a-5) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 101, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

When P in compound (a-6) is, for example, Boc, compound (a-7) can be manufactured by reacting compound (a-6) in the presence of 1 equivalent to a large excess of acid in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the acid include hydrochloric acid, sulfuric acid, trifluoroacetic acid, trifluoromethanesulfonic acid, bis(trifluoromethanesulfonyl)imide, and the like.


Examples of the solvent include chloroform, dichloromethane, toluene, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Further, when P in compound (a-6) is, for example, Cbz, compound (a-7) can be manufactured by reacting compound (a-6) in the presence of 0.001 equivalent to 0.5 equivalent of palladium catalyst under a hydrogen atmosphere in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst include palladium on carbon, palladium hydroxide, and the like.


Examples of the solvent include methanol, ethanol, ethyl acetate, THF, 1,4-dioxane, and the like, and these can be used alone or as a mixture.


Further, when P in compound (a-6) is, for example, PMB, compound (a-7) can be manufactured by reacting compound (a-6) in the presence of 1 equivalent to 5 equivalents of an oxidizing agent in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours. Compound (a-7) can also be manufactured by the same method as when P is Boc or Cbz.


Examples of the oxidizing agent include 2,3-dichloro-5,6-dicyano-p-benzoquinone (DDQ), ammonium cerium(IV) nitrate (CAN), and the like.


Examples of the solvent include chloroform, dichloromethane, dichloroethane, and the like, and these can be used alone or as a mixture.


(Step 5)

Compound (a-9) can be manufactured by reacting compound (a-7), 1 equivalent to 5 equivalents of compound (a-8), and 0.001 equivalent to 2 equivalents of copper(II) catalyst in the presence of 1 equivalent to a large excess of base under an oxygen atmosphere in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the copper catalyst include copper(II) acetate, copper(II) chloride, copper(II) oxide, and copper sulfate pentahydrate, and the like.


Examples of the base include pyridine, 4-dimethylaminopyridine, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include chloroform, dichloromethane, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (a-8) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 97, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 6)

Compound (a-10) can be manufactured by reacting compound (a-9) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydroxide, potassium hydroxide, lithium hydroxide, sodium carbonate, potassium carbonate, cesium carbonate, potassium phosphate, and the like.


Examples of the solvent include methanol, ethanol, DMF, DMA, NMP, DMSO, THF, acetonitrile, water, and the like, and these can be used alone or as a mixture.


(Step 7)

Compound (a-13) can be manufactured by reacting compound (a-7) and 1 equivalent to 5 equivalents of compound (a-15) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, LDA, lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (a-15) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 17, p. 396, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 8)

Compound (a-14) can be manufactured by reacting compound (a-13) in the presence of 0.001 equivalent to 0.5 equivalent of palladium catalyst under a hydrogen atmosphere in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minute to 120 hours.


Examples of the palladium catalyst include palladium on carbon, palladium hydroxide, and the like.


Examples of the solvent include methanol, ethanol, ethyl acetate, THF, 1,4-dioxane, and the like, and these can be used alone or as a mixture.


(Step 9)

Compound (a-12) can be manufactured by using compound (a-7) and 1 equivalent to 5 equivalents of compound (a-11) in the same manner as in step 5 of manufacturing method 1.


Compound (a-11) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 97, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


[Manufacturing Method 1-2]

Among compounds having a chemical structure represented by formula (A), the following compounds in which ring RA is ring RA1 and n1A is 1: (i) compound (a-18) in which carboxy is bonded to the wavy line portion, (ii) compound (a-21) in which amino is bonded to the wavy line portion, and (iii) compound (a-23) in which a halogen is bonded to the wavy portion can be manufactured according to the following steps:




embedded image


wherein RA1, RA2 and RA5 are as defined above, RA4 represents lower alkyl, Xt1 represents a halogen, and ring RA1 represents benzenediyl or pyridinediyl.


(Step 1)

Compound (a-17) can be manufactured by reacting compound (a-7) and 1 equivalent to 5 equivalents of compound (a-16) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, LDA, lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, acetonitrile, dichloromethane, chloroform, and the like, and these can be used alone or as a mixture.


Compound (a-16) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 377, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (a-18) can be manufactured by using compound (a-17) in the same manner as in step 6 of manufacturing method 1.


(Step 3)

Compound (a-20) can be manufactured by using compound (a-7) and 1 equivalent to 5 equivalents of compound (a-19) in the same manner as in step 1 of manufacturing method 1-2.


Compound (a-19) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 377, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

Compound (a-21) can be manufactured by using compound (a-20) in the same manner as in step 8 of manufacturing method 1.


(Step 5)

Compound (a-23) can be manufactured by using compound (a-7) and 1 equivalent to 5 equivalents of compound (a-22) in the same manner as in step 1 of manufacturing method 1-2.


Compound (a-22) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 377, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


[Manufacturing Method 1-3]

Among compounds having a chemical structure represented by formula (A), the following compounds in which ring RA is ring RA2 and n1A is 0: (i) compound (a-26) in which carboxy is bonded to the wavy line portion and (ii) compound (a-29) in which amino is bonded to the wavy line portion; and among compounds having a chemical structure represented by formula (A), compound (a-32) in which ring RA is ring RA3 can be manufactured respectively according to the following steps:




embedded image


wherein RA1, RA2, RA3, RA5, and P are as defined above, RA4 represents lower alkyl, ring RA2 represents cycloalkanediyl, and ring RA3 represents piperidinediyl, azetidinediyl, pyrrolidinediyl, or homopiperidinediyl.


(Step 1)

Compound (a-25) can be manufactured by reacting compound (a-7) and 1 equivalent to 5 equivalents of compound (a-24) in the presence of 1 equivalent to 5 equivalents of reducing agent and 1 equivalent to 5 equivalents of acid in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the reducing agent include sodium borohydride, sodium cyanoborohydride, sodium triacetoxyborohydride, and the like.


Examples of the acid include hydrochloric acid, trifluoroacetic acid, acetic acid, and the like.


Examples of the solvent include methanol, ethanol, and the like, and these can be used alone or as a mixture.


Compound (a-24) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 153, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (a-26) can be manufactured by using compound (a-25) in the same manner as in step 6 of manufacturing method 1.


(Step 3)

Compound (a-28) can be manufactured by using compound (a-7) and 1 equivalent to 5 equivalents of compound (a-27) in the same manner as in step 1 of manufacturing method 1-3.


Compound (a-27) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 153, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

Compound (a-29) can be manufactured by using compound (a-28) in the same manner as in step 4 of manufacturing method 1.


(Step 5)

Compound (a-31) can be manufactured by using compound (a-7) and 1 equivalent to 5 equivalents of compound (a-30) in the same manner as in step 1 of manufacturing method 1-3.


Compound (a-30) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 153, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 6)

Compound (a-32) can be manufactured by using compound (a-31) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method 1-4]

Among compounds having a chemical structure represented by formula (A), the following compounds in which ring RA is ring RA2 and n1A is 1: (i) compound (a-35) in which carboxy is bonded to the wavy line portion and (ii) compound (a-38) in which amino is bonded to the wavy line portion; and among compounds having a chemical structure represented by formula (A), compound (a-41) in which n1A is 1 and ring RA is ring RA3 can be manufactured respectively according to the following steps:




embedded image


wherein RA1, RA2, RA3, RA5, and P are as defined above, RA4 represents lower alkyl, ring RA2 represents cycloalkanediyl, and ring RA3 represents piperidinediyl, azetidinediyl, pyrrolidinediyl, or homopiperidinediyl.


(Step 1)

Compound (a-34) can be manufactured by using compound (a-7) and 1 equivalent to 5 equivalents of compound (a-33) in the same manner as in step 1 of manufacturing method 1-3.


Compound (a-33) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (a-35) can be manufactured by using compound (a-34) in the same manner as in step 6 of manufacturing method 1.


(Step 3)

Compound (a-37) can be manufactured by using compound (a-7) and 1 equivalent to 5 equivalents of compound (a-36) in the same manner as in step 1 of manufacturing method 1-3.


Compound (a-36) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

Compound (a-38) can be manufactured by using compound (a-37) in the same manner as in step 4 of manufacturing method 1.


(Step 5)

Compound (a-40) can be manufactured by using compound (a-7) and 1 equivalent to 5 equivalents of compound (a-39) in the same manner as in step 1 of manufacturing method 1-3.


Compound (a-39) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 6)

Compound (a-41) can be manufactured by using compound (a-40) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing method 2]


Among compounds having a chemical structure represented by formula (B), the following compounds in which RB1 is RB7: (i) compound (b-9) in which bromine is bonded to the wavy portion, (ii) compound (b-10) in which carboxy is bonded to the wavy portion, and (iii) compound (b-11) in which amino is bonded to the wavy portion can be manufactured respectively according to the following steps:




embedded image


embedded image


wherein RB2, RB3, and RB4 are as defined above, RB7 represents a hydrogen atom and tert-butoxycarbonylmethyl, and Fmoc represents 9-fluorenylmethyloxycarbonyl.


(Step 1)

The compound (b-3) can be manufactured by reacting compound (b-1) and 1 equivalent to 5 equivalents of compound (b-2) in the presence of 1 equivalent to 5 equivalents of sulfur and 0.25 to 5 equivalents of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include pyrrolidine, piperidine, morpholine, and the like.


Examples of the solvent include methanol, ethanol, DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


The compound (b-1) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 517, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Compound (b-2) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 153, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (b-5) can be manufactured by reacting compound (b-3) and 1 equivalent to 5 equivalents of compound (b-4) in the presence of 1 equivalent to a large excess of condensing agent and, according to necessity, in the presence of 1 equivalent to a large excess of additive in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the condensing agent include dicyclohexylcarbodiimide (DCC), N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC), 0-(7-azabenzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate (HATU), (1-cyano-2-ethoxy-2-oxoethylideneaminooxy)dimethylamino-morpholino-carbenium hexafluorophosphate (COMU), and the like.


Examples of the additive include 1-hydroxybenzotriazole monohydrate (HOBt), triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include chloroform, dichloromethane, DMF, DMA, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (b-4) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 175, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (b-6) can be manufactured by reacting compound (b-5) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include pyrrolidine, piperidine, morpholine, and the like.


Examples of the solvent include methanol, ethanol, DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


(Step 4)

Compound (b-7) can be manufactured by reacting compound (b-6) in the presence of 1 equivalent to a large excess of acid in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the acid include acetic acid, formic acid, hydrochloric acid, magnesium sulfate, and the like.


Examples of the solvent include methanol, ethanol, toluene and the like, and these can be used alone or as a mixture.


(Step 5)

Compound (b-9) can be manufactured by reacting compound (b-7) and 1 equivalent to 5 equivalents of compound (b-8) in the presence of 1 equivalent to a large excess of base and 1 equivalent to 5 equivalents of phosphoric ester in a solvent at a temperature between −78° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, LDA, lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the phosphoric acid ester include diethyl chlorophosphate, dimethyl chlorophosphate, and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (b-8) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 406, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 6)

Compound (b-10) can be manufactured by reacting compound (b-9) in the presence of 0.001 equivalent to 0.5 equivalent of palladium catalyst, 0.001 equivalent to 0.5 equivalent of phosphorus ligand, and 1 equivalent to a large excess of base under a carbon monoxide atmosphere in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst include palladium acetate, palladium chloride, tetrakis(triphenylphosphine)palladium (Pd(PPh3)4), bis(triphenylphosphine)palladium dichloride, [1,1′-bis(diphenylphosphino)ferrocene]palladium dichloride (Pd(dppf)Cl2), tris(dibenzylideneacetone)dipalladium (Pd2(dba)3), and the like.


Examples of the phosphorus ligand include triphenylphosphine, tributylphosphine, bis(diphenylphosphino)propane, bis(diphenylphosphino)butane, bis(diphenylphosphino)ferrocene, and the like.


Examples of the base include sodium hydride, potassium hydride, LDA, lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, acetonitrile, 1,4-dioxane, toluene, water, and the like, and these can be used alone or as a mixture.


(Step 7)

Compound (b-11) can be manufactured by reacting compound (b-10) in the presence of 1 equivalent to 5 equivalents of diphenylphosphoryl azide and 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include potassium carbonate, sodium carbonate, cesium carbonate, potassium phosphate, sodium hydroxide, potassium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include THF, acetonitrile, 1,4-dioxane, toluene, water, and the like, and these can be used alone or as a mixture.


[Manufacturing Method T2]

Among compounds having a chemical structure represented by formula (B), the following compounds in which RB1 is RB9: (i) compound (b-16) in which bromine is bonded to the wavy portion, (ii) compound (b-20) in which carboxy is bonded to the wavy portion, and (iii) compound (b-24) in which amino is bonded to the wavy portion can be manufactured respectively according to the following steps.




embedded image


embedded image


embedded image


wherein RB2, RB3, RB4, RB5, and RB6 are as defined above, RB8 represents optionally substituted lower alkyl or optionally substituted cycloalkyl, RB9 represents optionally substituted lower alkoxycarbonylmethyl, optionally substituted cycloalkyloxycarbonylmethyl, or —CH2CONRB5RB6, tBu represents tert-butyl, Bn represents benzyl, and P represents an amine protecting group such as Cbz, Fmoc, and the like.


(Step 1)

Compound (b-13) can be manufactured by reacting compound (b-12) in the presence of 1 equivalent to a large excess of acid without solvent or in a solvent at a temperature between 0° C. and 150° C. for 5 minutes to 120 hours.


Compound (b-12) is, among compound (b-9) obtained in step 5 of manufacturing method 2, a compound in which RB7 is tert-butoxycarbonylmethyl.


Examples of the acid include hydrochloric acid, sulfuric acid, formic acid, acetic acid, trifluoroacetic acid, p-toluenesulfonic acid, methanesulfonic acid, titanium tetrachloride, boron trifluoride, and the like, and these are used alone or as a mixture.


Examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, 1,2-dimethoxyethane (DME), 1,4-dioxane, DMF, DMA, NMP, and the like, and these are used alone or as a mixture.


(Step 2)

Compound (b-16) can be manufactured by using compound (b-13) and 1 equivalent to 10 equivalents of compound (b-14) or compound (b-15) in the same manner as in step 2 of manufacturing method 2.


Compound (b-14) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Compound (b-15) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (b-18) can be manufactured by reacting compound (b-17) and 1 equivalent to 10 equivalents of benzyl bromide in the presence of 1 equivalent to 10 equivalents of base without solvent or in a solvent at a temperature between −20° C. and 150° C. for 5 minutes to 120 hours.


Compound (b-17) is, among compound (b-10) obtained in step 6 of manufacturing method 2, a compound in which RB7 is tert-butoxycarbonylmethyl.


Examples of the base include potassium carbonate, potassium hydroxide, sodium hydroxide, sodium methoxide, potassium tert-butoxide, triethylamine, N,N-diisopropylethylamine, N-methylmorpholine, pyridine, DBU, and the like.


Examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, THF, DME, 1,4-dioxane, DMF, DMA, NMP, pyridine, and the like, and these are used alone or as a mixture.


(Step 4) Compound (b-19) can be manufactured by using compound (b-18) and 1 equivalent to 10 equivalents of compound (b-14) or compound (b-15) in the same manner as in step 1 and step 2.


(Step 5)

Compound (b-20) can be manufactured by reacting compound (b-19) in the presence of 0.001 equivalent to 0.5 equivalent of palladium catalyst under a hydrogen atmosphere in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst include palladium on carbon, palladium hydroxide, and the like.


Examples of the solvent include methanol, ethanol, ethyl acetate, THF, 1,4-dioxane, and the like, and these can be used alone or as a mixture.


(Step 6)

Compound (b-22) can be manufactured by reacting compound (b-21) and 1 equivalent to 10 equivalents of compound (b-1t) in the presence of 1 equivalent to 10 equivalents of base without solvent or in a solvent at a temperature between −20° C. and 150° C. for 5 minutes to 120 hours.


Compound (b-1t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 3, p. 167 (1955) and the like] or methods based thereon.


Compound (b-21) is, among compound (b-11) obtained in step 7 of manufacturing method 2, a compound in which RB7 is tert-butoxycarbonylmethyl.


Examples of the base include potassium carbonate, potassium hydroxide, sodium hydroxide, potassium tert-butoxide, triethylamine, N,N-diisopropylethylamine, N-methylmorpholine, pyridine, DBU, 4-dimethylaminopyridine, and the like.


Examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, 1,4-dioxane, DMF, DMA, NMP, pyridine, water, and the like, and these are used alone or as a mixture.


(Step 7)

Compound (b-23) can be manufactured by using compound (b-22) and 1 equivalent to 10 equivalents of compound (b-14) or compound (b-15) in the same manner as in step 1 and step 2.


(Step 8)

Compound (b-24) can be manufactured in the same manner as in step 5 when P in compound (b-23) is, for example, Cbz, and can be manufactured in the same manner as in step 3 of manufacturing method 2 when P in compound (b-23) is, for example, Fmoc.


[Manufacturing Method 3]

Among compounds having a chemical structure represented by formula (C), compound (c-7) in which RD is hydroxy, ring RC is benzenediyl, and carboxy is bonded to the wavy portion can be manufactured according to the following steps:




embedded image


wherein RC1 is as defined above, X represents a halogen, and RC2 represents lower alkyl.


(Step 1)

Compound (c-3) can be manufactured by reacting compound (c-1) and 1 equivalent to 5 equivalents of compound (c-2) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, butyllithium, LDA, lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (c-2) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 341, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (c-5) can be manufactured by reacting compound (c-3) and 1 equivalent to 5 equivalents of compound (c-4) in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the solvent include THF, 1,4-dioxane, diethyl ether, toluene, and the like, and these can be used alone or as a mixture.


Compound (c-4) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 78, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

The compound (c-6) can be manufactured by reacting compound (c-5) and 1 equivalent to 5 equivalents of 3,5-dimethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-Aisoxazole in the presence of 0.001 equivalent to 0.5 equivalent of palladium catalyst and 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst include palladium acetate, palladium chloride, Pd(PPh3)4, bis(triphenylphosphine)palladiunn dichloride, Pd(dppf)Cl2, Pd2(dba)3, and the like.


Examples of the base include potassium carbonate, sodium carbonate, cesium carbonate, potassium phosphate, sodium hydroxide, potassium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, acetonitrile, 1,4-dioxane, toluene, water, and the like, and these can be used alone or as a mixture.


(Step 4)

Compound (c-7) can be manufactured by using compound (c-6) in the same manner as in step 6 of manufacturing method 1.


[Manufacturing Method Y4]

Among compounds having a chemical structure represented by formula (C), the following compounds in which RD is a hydrogen atom and ring RC is ring RC1: (i) compound (c-11) in which carboxy is bonded to the wavy portion and (ii) compound (c-14) in which amino is bonded to the wavy portion can be manufactured respectively according to the following steps:




embedded image


wherein RC1 and RC2 are as defined above, P represents an amine protecting group such as Boc, Cbz, PMB, and the like, and ring RC1 represents piperidinediyl, azetidinediyl, pyrrolidinediyl, homopiperidinediyl, piperazinediyl, or azaspiro[3.3]heptanediyl. Incidentally, one secondary amine constituting the ring RC1 becomes a reaction point with compound (c-8).


(Step 1)

Compound (c-8) can be manufactured by using compound (c-3) in the same manner as in step 3 of manufacturing method 3.


(Step 2)

Compound (c-10) can be manufactured by using compound (c-8) and 1 equivalent to 5 equivalents of (c-9) in the same manner as in step 1 of manufacturing method 1-3.


Compound (c-9) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (c-11) can be manufactured by using compound (c-10) in the same manner as in step 6 of manufacturing method 1.


(Step 4)

Compound (c-13) can be manufactured by using compound (c-8) and 1 equivalent to 5 equivalents of compound (c-12) in the same manner as in step 1 of manufacturing method 1-3.


Compound (c-12) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 5)

Compound (c-14) can be manufactured by using compound (c-13) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method 4]

Among compounds having a chemical structure represented by formula (D), (i) compound (d-6) in which carboxy is bonded to the wavy portion, (ii) compound (d-9) in which amino is bonded to the wavy portion, and (iii) compound (d-11) in which bromine is bonded to the wavy portion can be manufactured respectively according to the following steps:




embedded image


wherein RD1 and ring RD are as defined above, RD2 represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (d-3) can be manufactured by reacting cyclohexane-1,3-dione and 1 equivalent to 5 equivalents of compound (d-2) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, LDA, lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (d-2) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (d-5) can be manufactured by reacting compound (d-3) and 1 equivalent to 5 equivalents of compound (d-4) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, LDA, lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, and the like.


Examples of the solvent include toluene, DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (d-4) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (d-6) can be manufactured by using compound (d-5) in the same manner as in step 6 of manufacturing method 1.


(Step 4)

Compound (d-8) can be manufactured by using compound (d-3) and 1 equivalent to 5 equivalents of compound (d-7) in the same manner as in step 2.


Compound (d-7) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 5)

Compound (d-9) can be manufactured by using compound (d-8) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Compound (d-11) can be manufactured by using compound (d-3) and 1 equivalent to 5 equivalents of compound (d-10) in the same manner as in step 2.


Compound (d-10) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


[Manufacturing Method Y5]

Compound (e-1) having a chemical structure represented by formula (E) and having a hydrogen atom bonded to the wavy portion can be obtained in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method Y6]

Compound (f-5) having a chemical structure represented by formula (F) and having carboxy bonded to the wavy portion can be manufactured according to the following steps:




embedded image


wherein RF1, RF2, RF3, RF5, and RF7 are as defined above, and RF4 and RF8 each represent lower alkyl.


(Step 1)

Compound (f-1) can be manufactured by using compound (f-f1) and 1 equivalent to 10 equivalents of 4-hydroxycyclohexan-1-one in the same manner as in step 1 of manufacturing method 1-3.


Compound (f-f1) can be obtained in the same manner as in step 4 of manufacturing method 1.


(Step 2)

Compound (f-2) can be manufactured by reacting compound (f-1) in the presence of 1 equivalent to 5 equivalents of oxidizing agent in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the oxidizing agent include Dess-Martin periodinane (DMP), DMSO/oxalyl chloride, sulfur trioxide-pyridine, and the like.


Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DME, 1,4-dioxane, DMF, DMA, NMP, DMSO, and the like, and these can be used alone or as a mixture.


(Step 3)

Compound (f-4) can be manufactured by reacting 1 equivalent to 5 equivalents of compound (f-3) and 1 equivalent to 5 equivalents of base in a solvent at a temperature between −78° C. and the boiling point of the solvent used for 5 minutes to 30 minutes and, subsequently, by adding compound (f-2) to the reaction mixture and reacting the mixture at a temperature between −78° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium tert-butoxide, LDA, lithium bis[trimethylsilyl]amide, sodium bis[trimethylsilyl]amide, DBU, and the like.


Examples of the solvent include THF, DME, hexamethylphosphoric triamide (HMPA), and the like, and these can be used alone or as a mixture.


Compound (f-3) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 4th Edition, Volume 24, p. 243, Maruzen Co., Ltd. (1994) and the like] or methods based theron.


(Step 4)

Compound (f-5) can be manufactured by using compound (f-4) in the same manner as in step 6 of manufacturing method 1.


[Manufacturing Method Y7]

Among compounds having a chemical structure represented by formula (G), (i) compound (g-8) in which carboxy is bonded to the wavy line portion, (ii) compound (g-9) in which amino is bonded to the wavy line portion, and (iii) compound (g-7) in which a bromine atom is bonded to the wavy line portion can be manufactured according to the following steps:




text missing or illegible when filed


text missing or illegible when filed


wherein RG1 and RG2 are as defined above, RG3 represents a lower alkyl group, and P represents an amine protecting group such as Boc, Cbz, PMB and the like.


(Step 1)

Compound (g-5) can be manufactured by reacting compound (g-1) and 1 equivalent to 5 equivalents of compound (g-4) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, butyl lithium, LDA, lithium bis(trimethylsilyl)amide, sodium bis(trimethylsilyl)amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, acetonitrile and the like, and these can be used alone or as a mixture.


Compound (g-1) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Compound (g-4) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (g-6) can be manufactured by using compound (g-2) in the same manner as in step 1 of manufacturing method Y7.


Compound (g-2) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (g-7) can be manufactured by using compound (g-3) in the same manner as in step 1 of manufacturing method Y7.


Compound (g-3) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

Compound (g-8) can be manufactured by using compound (g-5) in the same manner as in step 6 of manufacturing method 1.


(Step 5) Compound (g-9) can be manufactured by using compound (g-6) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method Y8-1]

Among compounds having a chemical structure represented by formula (H), the following compounds in which RH1 is a hydrogen atom, ring RH is benzenediyl, and ZH is an oxygen atom: (i) compound (h-7) in which carboxy is bonded to the wavy line portion and (ii) compound (h-12) in which amino is bonded to the wavy line portion can be manufactured according to the following steps:




text missing or illegible when filed


text missing or illegible when filed


wherein RH2 and RH3 are as defined above, RH4 represents a lower alkyl group, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (h-3) can be manufactured in the same manner as in step 5 of manufacturing method 1 using 2-bromophenol (h-1) and 1 equivalent to 5 equivalents of compound (h-2).


Compound (h-2) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 95, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (h-4) can be manufactured by reacting compound (h-3) in the presence of 0.001 equivalent to 0.5 equivalent of palladium catalyst, 1 equivalent to 5 equivalents of bis(pinacolato)diboron, and 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst include palladium acetate, palladium chloride, Pd(PPh3)4, bis(triphenylphosphine)palladiunn dichloride, Pd(dppf)Cl2, Pd2(dba)3 and the like.


Examples of the base include potassium carbonate, potassium phosphate, potassium acetate, potassium phenoxide and the like.


Examples of the solvent include 1,2-dichloroethane, toluene, THF, DMF and the like, and these can be used alone or as a mixture.


(Step 3)

Compound (h-6) can be manufactured in the same manner as in step 3 of manufacturing method 3 by using compound (h-4) and 1 equivalent to 5 equivalents of compound (h-5).


Compound (h-5) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Journal of Medicinal Chemistry Vol. 60, p. 3828 (2017) and the like] or methods based thereon.


(Step 4)

Compound (h-7) can be manufactured by using compound (h-6) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Compound (h-9) can be manufactured in the same manner as in step 5 of manufacturing method 1 using 2-bromophenol (h-1) and 1 equivalent to 5 equivalents of compound (h-8).


Compound (h-8) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 95, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 6)

Compound (h-10) can be manufactured in the same manner as in step 2 of manufacturing method Y8-1 using compound (h-9) and 1 equivalent to 5 equivalents of bis(pinacolato)diboron.


(Step 7)

Compound (h-11) can be manufactured by using compound (h-10) in the same manner as in step 3 of manufacturing method Y8-1.


(Step 8)

Compound (h-12) can be manufactured by using compound (h-11) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method Y8-2]

Among compounds having a chemical structure represented by formula (H), the following compounds in which RH1 is lower alkyl sulfonamide, ring RH is ring RH1, and ZH is an oxygen atom: (i) compound (h-21) in which carboxy is bonded to the wavy line portion and (ii) compound (h-29) in which amino is bonded to the wavy line portion can be manufactured according to the following steps:




text missing or illegible when filed


text missing or illegible when filed


text missing or illegible when filed


text missing or illegible when filed


wherein RH2 and RH3 are as defined above, RH4 represents lower alkyl, RH5 represents a lower alkyl moiety in the lower alkyl sulfonamide of RH1, ring RH1 represents cycloalkanediyl or benzenediyl, P represents an amine protecting group such as Boc, Cbz, PMB and the like.


(Step 1)

Compound (h-15) can be manufactured by reacting 2-bromo-1-fluoro-4-nitrobenzene (h-13) and 1 equivalent to 5 equivalents of compound (h-14) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, LDA, lithium bis(trimethylsilyl)amide, sodium bis(trimethylsilyl)amide, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, cesium carbonate, DBU, triethylamine and the like.


Examples of the solvent include acetonitrile, THF, DME, dioxane, DMF, DMA, NMP and the like, and these can be used alone or as a mixture.


Compound (h-14) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (h-16) can be manufactured by using compound (h-15) in the same manner as in step 8 of manufacturing method 1.


(Step 3)

Compound (h-17) can be manufactured by using compound (h-16) in the same manner as in step 2 of manufacturing method Y8-1.


(Step 4)

Compound (h-18) can be manufactured by using compound (h-17) in the same manner as in step 3 of manufacturing method Y8-1.


(Step 5)

Compound (h-20) can be manufactured by reacting compound (h-18) and 1 equivalent to 5 equivalents of compound (h-19) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium hydride, sodium methoxide, potassium ethoxide, potassium tert-butoxide, potassium carbonate, sodium hydroxide, cesium carbonate, DBU, triethylamine, pyridine, 4-dimethylaminopyridine and the like.


Examples of the solvent include pyridine, THF, DME, dioxane, dichloromethane and the like, and these can be used alone or as a mixture.


Compound (h-19) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Synthesis Vol. 24, p. 4131 (2006) and the like] or methods based thereon.


(Step 6)

Compound (h-21) can be manufactured by using compound (h-20) in the same manner as in step 6 of manufacturing method 1.


(Step 7)

Compound (h-24) can be manufactured in the same manner as in step 1 of manufacturing method Y8-2 using 2-bromo-1-fluoro-4-nitrobenzene (h-13) and 1 equivalent to 5 equivalents of compound (h-23).


Compound (h-23) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 8)

Compound (h-25) can be manufactured by using compound (h-24) in the same manner as in step 2 of manufacturing method Y8-2.


(Step 9)

Compound (h-26) can be manufactured by using compound (h-25) in the same manner as in step 3 of manufacturing method Y8-2.


(Step 10)

Compound (h-27) can be manufactured by using compound (h-26) in the same manner as in step 4 of manufacturing method Y8-2.


(Step 11)

Compound (h-28) can be manufactured by using compound (h-27) in the same manner as in step 5 of manufacturing method Y8-2.


(Step 12)

Compound (h-29) can be manufactured by using compound (h-28) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method Y8-3]

Among compounds having a chemical structure represented by formula (H), the following compounds in which RH1 is lower alkyl sulfonamide, ring RH is ring RH2, and ZH is methylene: (i) compound (h-37) in which carboxy is bonded to the wavy line portion and (ii) compound (h-42) in which amino is bonded to the wavy line portion can be manufactured according to the following steps:




text missing or illegible when filed


text missing or illegible when filed


text missing or illegible when filed


wherein RH2 and RH3 are as defined above, RH4 represents lower alkyl, RH5 represents a lower alkyl moiety in the lower alkyl sulfonamide of RH1, P represents an amine protecting group such as Boc, Cbz, PMB and the like, ring RH2 represents azetidinediyl, pyrrolidinediyl, piperidinediyl or homopiperidinediyl.


(Step 1)

Compound (h-31) can be manufactured by using 2-bromo-4-nitrobenzaldehyde (h-30) in the same manner as in step 2 of manufacturing method Y8-1.


(Step 2)

Compound (h-32) can be manufactured by using compound (h-31) in the same manner as in step 3 of manufacturing method Y8-1.


(Step 3)

Compound (h-34) can be manufactured in the same manner as in step 1 of manufacturing method 1-3 using compound (h-32) and 1 equivalent to 5 equivalents of compound (h-33).


Compound (h-33) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon. Incidentally, one secondary amine constituting the ring RH2 becomes a reaction point with compound (h-32).


(Step 4)

Compound (h-35) can be manufactured by using compound (h-34) in the same manner as in step 8 of manufacturing method 1.


(Step 5)

Compound (h-36) can be manufactured by using compound (h-35) in the same manner as in step 5 of manufacturing method Y8-2.


(Step 6)

Compound (h-37) can be manufactured by using compound (h-36) in the same manner as in step 6 of manufacturing method 1.


(Step 7)

Compound (h-39) can be manufactured in the same manner as in step 1 of manufacturing method 1-3 using compound (h-32) and 1 equivalent to 5 equivalents of compound (h-38).


Compound (h-38) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon. Incidentally, one secondary amine constituting the ring RH2 becomes a reaction point with compound (h-32).


(Step 8)

Compound (h-40) can be manufactured by using compound (h-39) in the same manner as in step 8 of manufacturing method 1.


(Step 9)

Compound (h-41) can be manufactured by using compound (h-40) in the same manner as in step 5 of manufacturing method Y8-2.


(Step 10)

Compound (h-42) can be manufactured by using compound (h-41) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method Y8-4]

Among compounds having a chemical structure represented by formula (H), the following compounds in which RH1 is a hydrogen atom, ring RH is ring RH2, and ZH is methylene: (i) compound (h-47) in which carboxy is bonded to the wavy line portion and (ii) compound (h-49) in which amino is bonded to the wavy line portion can be manufactured according to the following steps:




embedded image


wherein RH2 and RH3 are as defined above, RH4 represents lower alkyl, ring RH2 represents azetidinediyl, pyrrolidinediyl, piperidinediyl, or homopiperidinediyl, P represents an amine protecting group such as Boc, Cbz, PMB and the like.


(Step 1)

Compound (h-44) can be manufactured by using 2-bromobenzaldehyde (h-43) in the same manner as in step 2 of manufacturing method Y8-1.


(Step 2)

Compound (h-45) can be manufactured by using compound (h-44) in the same manner as in step 3 of manufacturing method Y8-1.


(Step 3)

Compound (h-46) can be manufactured by using compound (h-45) and 1 equivalent to 5 equivalents of compound (h-33) in the same manner as in step 3 of manufacturing method Y8-3.


(Step 4)

Compound (h-47) can be manufactured by using compound (h-46) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Compound (h-48) can be manufactured by using compound (h-45) and 1 equivalent to 5 equivalents compound (h-38) in the same manner as in step 3 of manufacturing method Y8-3.


(Step 6)

Compound (h-49) can be manufactured by using compound (h-48) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method Y9]

Among compounds having a chemical structure represented by formula (3), (i) compound (j-4) in which carboxy is bonded to the wavy line portion, (ii) compound (j-7) in which amino is bonded to the wavy line portion, and (iii) compound (j-9) in which a bromine atom is bonded to the wavy line portion can be manufactured according to the following steps:




embedded image


wherein X represents a halogen, R31 represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB and the like.


(Step 1)

Compound (j-3) can be manufactured by reacting 1,3,4,5-tetrahydro-2H-benzo[b][1,4]diazepin-2-one (j-1) and 1 equivalent to 5 equivalents of compound (j-2) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include LDA, potassium carbonate, DBU, triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine and the like.


Examples of the solvent include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile and the like, and these can be used alone or as a mixture.


Compound (j-2) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 99, Maruzen Co., Ltd. (2014) and the like] or methods based thereon.


(Step 2)

Compound (j-4) can be manufactured by using compound (j-3) in the same manner as in step 6 of manufacturing method 1.


(Step 3) Compound (j-6) can be manufactured in the same manner as in step 1 of manufacturing method Y9 using 1,3,4,5-tetrahydro-2H-benzo[b][1,4]diazepin-2-one (j-1) and 1 equivalent to 5 equivalents of compound (j-5).


Compound (j-5) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 99, Maruzen Co., Ltd. (2014) and the like] or methods based thereon.


(Step 4)

Compound (j-7) can be manufactured by using compound (j-6) in the same manner as in step 4 of manufacturing method 1.


(Step 5) Compound (j-9) can be manufactured in the same manner as in step 1 of manufacturing method Y9 using 1,3,4,5-tetrahydro-2H-benzo[b][1,4]diazepin-2-one (j-1) and 1 equivalent to 5 equivalents of compound (j-8).


Compound (j-8) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 99, Maruzen Co., Ltd. (2014) and the like] or methods based thereon.


[Manufacturing Method Y10]

Among compounds having a chemical structure represented by formula (K), (i) compound (k-8) in which carboxy is bonded to the wavy line portion, (ii) compound (k-11) in which amino is bonded to the wavy line portion, as well as among compounds having a chemical structure represented by formula (K), compound (k-5) in which ring RK is benzenediyl and a bromine atom is bonded to the wavy line portion can be manufactured according to the following steps:




embedded image


wherein ring RK is as defined above, X represents a halogen, and P represents an amine protecting group such as Boc, Cbz, PMB and the like.


(Step 1)

4-(6-Methoxypyridin-3-yl)-3,5-dimethylisoxazole (k-2) can be manufactured in the same manner as in step 3 of manufacturing method 3 by using 5-bromo-2-methoxypyridine (k-1) and 1 equivalent to 5 equivalents of 3,5-dimethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)isoxazole.


(Step 2)

5-(3,5-Dimethylisoxazol-4-yl)pyridin-2(1H)-one (k-3) can be manufactured by reacting 4-(6-methoxypyridin-3-yl)-3,5-dimethylisoxazole (k-2) in the presence of 1 equivalent to a large excess of acid in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the acid include lithium chloride/sulfuric acid, hydrochloric acid, hydrobromic acid and the like.


Examples of the solvent include DMF, DMA, NMP, DMSO, THF, water and the like, and these can be used alone or as a mixture.


(Step 3)

Compound (k-7) can be manufactured in the same manner as in step 1 of manufacturing method Y7 using 5-(3,5-dimethylisoxazole-4-yl)pyridine-2(1H)-one (k-3) and 1 equivalent to 5 equivalents of compound (k-6).


Compound (k-6) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

Compound (k-8) can be manufactured by using compound (k-7) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Compound (k-10) can be manufactured in the same manner as in step 1 of manufacturing method Y7 using compound (k-3) and 1 equivalent to 5 equivalents of compound (k-9).


Compound (k-9) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 6)

Compound (k-11) can be manufactured by using compound (k-10) in the same manner as in step 4 of manufacturing method 1.


(Step 7)

1-(4-Bromobenzyl)-5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one (k-5) can be manufactured in the same manner as in step 1 of manufacturing method Y7 using 5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one (k-3) and 1 equivalent to 5 equivalents of compound (k-4).


Compound (k-4) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


[Manufacturing Method Y11]

Among compounds having a chemical structure represented by formula (M), (i) compound (m-5) in which carboxy is bonded to the wavy line portion, and (ii) compound (m-8) in which amino is bonded to the wavy line portion can be manufactured according to the following steps:




embedded image


wherein RM1 and ring RM are as defined above, and P represents an amine protecting group such as Boc, Cbz, PMB and the like.


(Step 1)

Compound (m-2) can be manufactured in the same manner as in step 3 of manufacturing method 3 using compound (m-1) and equivalent to 5 equivalents of 3,5-dimethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)isoxazole.


(Step 2)

Compound (m-4) can be manufactured in the same manner as in step 1 of manufacturing method 1-3 by using compound (m-2) and 1 equivalent to 5 equivalents of compound (m-3).


Compound (m-3) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (m-5) can be manufactured by using compound (m-4) in the same manner as in step 6 of manufacturing method 1.


(Step 4)

Compound (m-7) can be manufactured in the same manner as in step 1 of manufacturing method 1-3 using compound (m-2) and 1 equivalent to 5 equivalents of compound (m-6).


Compound (m-6) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 5)

Compound (m-8) can be manufactured by using compound (m-7) in the same manner as in step 4 of manufacturing method 1.


[Manufacturing Method Y12]

Among compounds having a chemical structure represented by formula (N), (i) compound (n-4) in which carboxy is bonded to the wavy line portion, (ii) compound (n-7) in which amino is bonded to the wavy line portion, and (iii) compound (n-8) in which a bromine atom is bonded to the wavy line portion can be manufactured according to the following steps:




embedded image


wherein RN1 is as defined above, RN2 represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB and the like.


(Step 1)

Compound (n-3) can be manufactured by reacting compound (n-1) and 1 equivalent to 5 equivalents of compound (n-2) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include potassium carbonate, DBU, triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine and the like.


Examples of the solvent include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile and the like, and these can be used alone or as a mixture.


Compound (n-1) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Nature Chemical Biology, 2016, Vol. 12, p. 1097-1104 and the like] or methods based thereon.


Compound (n-2) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (n-4) can be manufactured by using compound (n-3) in the same manner as in step 6 of manufacturing method 1.


(Step 3)

Compound (n-6) can be manufactured in the same manner as in step 1 of manufacturing method Y12 using compound (n-1) and 1 equivalent to 5 equivalents of compound (n-5).


Compound (n-5) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

Compound (n-7) can be manufactured by using compound (n-6) in the same manner as in step 4 of manufacturing method 1.


(Step 5)

Compound (n-8) can be manufactured in the same manner as in step 1 of manufacturing method Y12 using compound (n-1) and 1 equivalent to 5 equivalents of 4-(4-bromophenyl)piperidine.


Next, there will be described a manufacturing method of compound (I) by using compounds (a-10), (a-12), (a-14), (a-18), (a-21), (a-23), (a-26), (a-29), (a-32), (a-35), (a-38), (a-41), (b-9), (b-10), (b-11), (b-16), (b-20), (b-24), (c-7), (c-11), (c-14), (d-6), (d-9), (d-11), (e-1), (f-1), (f-5), (g-8), (g-9), (g-7), (h-7), (h-12), (h-21), (h-29), (h-37), (h-42), (h-47), (h-49), (j-4), (j-7), (j-9), (k-8), (k-11), (k-5), (m-5), (m-8), (n-4), (n-7) and/or (n-8), which are obtained by the above-mentioned manufacturing method 1, manufacturing method 1-2, manufacturing method 1-3, Manufacturing method 1-4, manufacturing method 2, manufacturing method T2, manufacturing method 3, Manufacturing method Y4, manufacturing method 4, manufacturing method Y5, manufacturing method Y6, manufacturing method Y7, manufacturing method Y8-1, manufacturing method Y8-2, manufacturing method Y8-3, manufacturing method Y8-4, manufacturing method Y9, manufacturing method Y10, manufacturing method Y11, or manufacturing method Y12.


Compounds (a-10), (a-18), (a-26), (a-35), (b-10), (b-20), (c-7), (c-11), (d-6), (f-5), (g-8), (h-7), (h-21), (h-37), (h-47), (j-4), (k-8), (m-5) and (n-4) shall be collectively represented as L-CO2H (I-1). Similarly, compounds (a-14), (a-21), (a-29), (a-38), (b-11), (b-24), (c-14), (d-9), (g-9), (h-12), (h-29), (h-42), (h-49), (j-7), (k-11), (m-8) and (n-7) shall be represented as L-NH2 (I-2), and compounds in which X represents bromo among compounds (a-12) and (a-23), and compounds (b-9), (b-16), (d-11), (g-7), (j-9), (k-5) and (n-8) shall be represented as L-Br (I-3).


[Manufacturing Method 5]

Among compound (I) in which S is formula (S1), (i) compound (I-13) in which X1b is —NH—C(═O)— and (ii) compound (I-14) in which X1b is —NH—SO2— can be manufactured respectively according to the following steps:




embedded image


wherein R1a, R1b, n1a, n1b, and X1a are as defined above, L represents L1 or L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-5) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-4) in the same manner as in step 2 of manufacturing method 2.


Compound (I-4) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-7) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-6) in the same manner as in step 2 of manufacturing method 2.


Compound (I-6) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

The compound (I-9) can be manufactured by reacting compound (I-2) and 1 equivalent to 5 equivalents of compound (I-8) in the presence of 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine, and the like.


Examples of the solvent include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (I-8) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 4)

Compound (I-11) can be manufactured by (i) reacting compound (I-3) in the presence of 1 equivalent to 5 equivalents of 4-methoxyphenylmethanethiol, 0.001 equivalent to 3 equivalents of palladium catalyst, 0.001 equivalent to 3 equivalents of phosphorus ligand, and 1 equivalent to a large excess of base in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours, and then, (ii) reacting the obtained compound in the presence of 1 equivalent to 5 equivalents of trichloroisocyanuric acid and 1 equivalent to a large excess of compound (I-4) in a solvent at a temperature between −20° C. and room temperature for 5 minutes to 120 hours.


Examples of the palladium catalyst used in (i) include Pd2(dba)3 and the like.


Examples of the phosphorus ligand used in (i) include xantphos and the like.


Examples of the base used in (i) include triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine, potassium tert-butoxide, sodium carbonate, potassium carbonate, and the like.


Examples of the solvent used in (i) include DMF, DMA, NMP, DMSO, THF, acetonitrile, 1,4-dioxane, and the like, and these can be used alone or as a mixture.


Examples of the solvent used in (ii) include acetonitrile, water, and the like, and these can be used alone or as a mixture.


(Step 5)

Compound (I-12) can be manufactured by using compound (I-5), (I-7), (I-9), (I-11), (I-2t), (I-3t), (I-5t), or (I-6t) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Compound (I-13) can be manufactured by using compound (I-12) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 7)

Compound (I-14) can be manufactured by using compound (I-12) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 8)

Compound (I-2t) can be manufactured by reacting compound (I-1t), 1 equivalent to 10 equivalents of compound (I-4), and 1 equivalent to 10 equivalents of thiocarbonyl reagent in the presence of 1 equivalent to 10 equivalents of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the thiocarbonyl reagent include thiophosgene, 1,1-thiocarbonyldiimidazole, and the like.


Examples of the base include triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine, and the like.


Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DMF, NMP, pyridine, and the like, and these are used alone or as a mixture.


As for compound (I-1t), compound (ly-58) obtained in step 1 of manufacturing method YS12-1 and compound (f-1) obtained in step 1 of manufacturing method Y6 are collectively represented as compound (I-1t).


(Step 9)

Compound (I-3t) can be manufactured by reacting compound (I-1t), 1 equivalent to 10 equivalents of compound (I-4), and 1 equivalent to 10 equivalents of carbonyl reagent in the presence of 1 equivalent to 10 equivalents of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the carbonyl reagent include phosgene, 1,1-carbonyldiimidazole (CDI), and the like.


Examples of the base include triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine, and the like.


Examples of the solvent include dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, THF, DMF, NMP, pyridine, and the like, and these are used alone or as a mixture.


(Step 10)

Compound (I-5t) can be manufactured by using compound (I-2) and 1 equivalent to 10 equivalents of compound (I-4t) in the same manner as in step 9.


Compound (I-4t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 11)

Compound (I-6t) can be manufactured by using compound (I-2) and 1 equivalent to 10 equivalents of compound (I-4) in the same manner as in step 9.


[Manufacturing Method 6]

Among compound (I) in which S is formula (S1), compound (I-24) in which X1b is —C(═O)—NH— can be manufactured according to the following steps:




embedded image


wherein R1a, R1b, n1a, n1b, and X1a are as defined above, L represents L1 or L2, and Re represents lower alkyl.


(Step 1)

Compound (I-19) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-15) in the same manner as in step 2 of manufacturing method 2.


Compound (I-15) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-20) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-16) in the same manner as in step 2 of manufacturing method 2.


Compound (I-16) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (I-21) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-17) in the same manner as in step 3 of manufacturing method 5.


Compound (I-17) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 4)

Compound (I-22) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (I-15) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Compound (I-23) can be manufactured by using compound (I-19), (I-20), (I-21), (1-22), (I-9t), (I-10t), (I-12t), or (I-13t) in the same manner as in step 6 of manufacturing method 1.


(Step 6)

Compound (I-24) can be manufactured by using compound (I-23) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


(Step 7)

Compound (I-9t) can be manufactured by using compound (I-1t) and 1 equivalent to 10 equivalents of compound (I-15) in the same manner as in step 8 of manufacturing method 5.


(Step 8)

Compound (I-10t) can be manufactured by using compound (I-1t) and 1 equivalent to 10 equivalents of compound (I-15) in the same manner as in step 9 of manufacturing method 5.


(Step 9)

Compound (I-12t) can be manufactured by using compound (I-2) and 1 equivalent to 10 equivalents of compound (I-11t) in the same manner as in step 9 of manufacturing method 5.


Compound (I-11t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 10)

Compound (I-13t) can be manufactured by using compound (I-2) and 1 equivalent to 10 equivalents of compound (I-15) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method 7]

Among compound (I) in which S is formula (S1), the following compounds in which X1b is —SO2—NH—: (i) compound (I-16t) in which X1a is —C(═O)—NH—, (ii) compound (I-17t) in which X1a is —SO2—NH—, (iii) compound (I-18t) in which X1a is —O—C(═S)—NH—, (iv) compound (I-19t) in which X1a is —O—C(═O)—NH—, (v) compound (I-20t) in which X1a is —NH—C(═O)—NH—, (vi) compound (I-21t) in which X1a is —NH—C(═O)—, and (vii) compound (I-22t) in which X1a is —NH—C(═O)—O— can be manufactured respectively according to the following steps:




embedded image


wherein R1a, R1b, n1a, and n1b are as defined above, L represents L1 or L2, Re represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-27) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-25) in the same manner as in step 3 of manufacturing method 5.


Compound (I-25) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 2)

Compound (I-28) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-26) in the same manner as in step 3 of manufacturing method 5.


Compound (I-26) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 3)

Compound (I-29) can be manufactured by using compound (I-27) in the same manner as in step 4 of manufacturing method 1.


(Step 4)

Compound (I-30) can be manufactured by using compound (I-28) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Compound (I-16t) can be manufactured by using compound (I-29) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 6)

Compound (I-17t) can be manufactured by using compound (I-29) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 7)

Compound (I-21t) can be manufactured by using compound (I-30) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


(Step 8)

Compound (I-18t) can be manufactured by using compound (I-29) and 1 equivalent to 5 equivalents of compound (I-1t) in the same manner as in step 8 of manufacturing method 5.


(Step 9)

Compound (I-19t) can be manufactured by using compound (I-29) and 1 equivalent to 5 equivalents of compound (I-1t) in the same manner as in step 9 of manufacturing method 5.


(Step 10)

Compound (I-20t) can be manufactured by using compound (I-29) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


(Step 11)

Compound (I-15t) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-14t) in the same manner as in step 3 of manufacturing method 5.


Compound (I-14t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 12)

Compound (I-22t) can be manufactured by using compound (I-15t) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method 8]

Among compound (I) in which S is formula (S2), the following compounds in which Z2 is CH: (i) compound (I-41) in which X2b is —NH—C(═O)— and (ii) compound (I-42) in which X2b is —NH—SO2— can be manufactured respectively according to the following steps:




embedded image


wherein X2a is as defined above, L represents L1 or L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-36) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-32) in the same manner as in step 2 of manufacturing method 2.


Compound (I-32) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-37) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-33) in the same manner as in step 2 of manufacturing method 2.


Compound (I-33) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (I-38) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-34) in the same manner as in step 3 of manufacturing method 5.


Compound (I-34) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 4)

Compound (I-39) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (I-32) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Compound (I-40) can be manufactured by using compound (1-36), (I-37), (1-38), or (1-39) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Compound (I-41) can be manufactured by using compound (I-40) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 7)

Compound (I-42) can be manufactured by using compound (I-40) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


[Manufacturing Method 9]

Among compound (I) in which S is formula (S2), compound (I-52) in which Z2 is CH and X2b is —C(═O)—NH— can be manufactured according to the following steps:




embedded image


wherein X2a is as defined above, L represents L1 or L2, and Re represents lower alkyl.


(Step 1)

Compound (I-47) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-43) in the same manner as in step 2 of manufacturing method 2.


Compound (I-43) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-48) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-44) in the same manner as in step 2 of manufacturing method 2.


Compound (I-44) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (I-49) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-45) in the same manner as in step 3 of manufacturing method 5.


Compound (I-45) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 4)

Compound (I-50) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (I-43) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Compound (I-51) can be manufactured by using compound (I-47), (1-48), (1-49), or (I-50) in the same manner as in step 6 of manufacturing method 1.


(Step 6)

Compound (I-52) can be manufactured by using compound (I-51) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method 10]

Among compound (I) in which S is formula (S2), compound (I-59) in which Z2 is CH and X2b is —SO2—NH— can be manufactured according to the following steps:




embedded image


wherein X2a is as defined above, L represents L1 or L2, Re represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-55) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-53) in the same manner as in step 3 of manufacturing method 5.


Compound (I-53) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 2)

Compound (I-56) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-54) in the same manner as in step 3 of manufacturing method 5.


Compound (I-54) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 3)

Compound (I-57) can be manufactured by using compound (I-55) in the same manner as in step 4 of manufacturing method 1.


(Step 4)

Compound (I-58) can be manufactured by using compound (I-56) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Among compound (I-59), a compound in which X2a is —C(═O)—NH— can be manufactured by using compound (I-57) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 6)

Among compound (I-59), a compound in which X2a is —SO2—NH— can be manufactured by using compound (I-57) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 7)

Among compound (I-59), a compound in which X2a is —NH—C(═O)— can be manufactured by using compound (I-58) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method YS2]

In compound (I) in which S is formula (S2), the following compounds in which Z2 is N: (i) compound (I-31t) in which X2b is —C(═O)—NH— and (ii) compound (I-32t) in which X213 is —CH2— can be manufactured according to the following steps:




embedded image


wherein X2a is as defined above, L represents L1 or L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-26t) can be manufactured by using compound (I-1) and 1 equivalent to 10 equivalents of compound (I-23t) in the same manner as in step 2 of manufacturing method 2.


Compound (I-23t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-27t) can be manufactured by using compound (I-2) and 1 equivalent to 10 equivalents of compound (I-24t) in the same manner as in step 2 of manufacturing method 2.


Compound (I-24t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (I-28t) can be manufactured by using compound (I-2) and 1 equivalent to 10 equivalents of compound (I-25t) in the same manner as in step 3 of manufacturing method 5.


Compound (I-25t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 4)

Compound (I-29t) can be manufactured by using compound (I-3) and 1 equivalent to 10 equivalents of compound (I-23t) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Compound (I-30t) can be manufactured using compound (I-26t), compound (I-27t), compound (I-28t), or compound (I-29t) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Compound (I-31t) can be manufactured by using compound (I-30t) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5. (Step 7)


Compound (I-32t) can be manufactured by using compound (I-30t) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


Compound (I-40t) can be obtained according to step 10 of manufacturing method 17.


[Manufacturing Method 11]

Among compound (I) in which S is formula (S3), compound (I-63) in which Z3 is CH and X3 is X3a can be manufactured according to the following steps:




embedded image


wherein n3a and nab are as defined above, L represents L1 or L2, X3a represents —NH—C(═O)—, —NH—SO2—, —NH—C(═O)—NH—, or —NHCH2—, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-61) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-60) in the same manner as in step 2 of manufacturing method 2.


Compound (I-60) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-62) can be manufactured by using compound (I-61) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Among compound (I-63), a compound in which X3a is —NH—C(═O)— can be manufactured by using compound (I-62) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 4)

Among compound (I-63), a compound in which X3a is —NH—SO2— can be manufactured by using compound (I-62) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Among compound (I-63), a compound in which X3a is —NH—C(═O)—NH— can be manufactured by using compound (I-62) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


(Step 6)

Among compound (I-63), a compound in which X3a is —NHCH2— can be manufactured by using compound (I-62) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


[Manufacturing Method 12]

Among compound (I) in which S is formula (S3), compound (I-68) in which Z3 is CH and X3 is X3b can be manufactured according to the following steps:




embedded image


wherein n3a and n3b are as defined above, L represents L1 or L2, X3b represents —C(═O)—NH— or —SO2—NH—, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Among compound (I-66), a compound in which X3b is —C(═O)—NH— can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-64) in the same manner as in step 2 of manufacturing method 2.


Compound (I-64) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Among compound (I-66), a compound in which X3b is —SO2—NH— can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-65) in the same manner as in step 3 of manufacturing method 5.


Compound (I-65) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 3)

Compound (I-67) can be manufactured by using compound (I-66) in the same manner as in step 4 of manufacturing method 1.


(Step 4)

Compound (I-68) can be manufactured by using compound (I-67) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method YS3]

Among compound (I) in which S is formula (S3), compound (I-35t) in which Z3 is N, X3 is —C(═O)—NH—, and n3a and n3b are 2 can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-33t) can be manufactured by using compound (I-1) and 1 equivalent to 10 equivalents of compound (I-36t) in the same manner as in step 2 of manufacturing method 2.


Compound (I-36t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-34t) can be manufactured by using compound (I-33t) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Compound (I-35t) can be manufactured by using compound (I-34t) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method 13]

Compound (I) in which S is formula (S4) can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-70) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-69) in the same manner as in step 2 of manufacturing method 2.


Compound (I-69) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-71) can be manufactured by using compound (I-70) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Compound (I-72) can be manufactured by using compound (I-71) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method 14]

Among compound (I) in which S is formula (S5), (i) compound (I-82) in which X5b is —NH—C(═O)— and (ii) compound (I-83) in which X5b is —NH—SO2— can be manufactured respectively according to the following steps:




embedded image


wherein X5a is as defined above, L represents L1 or L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-77) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-73) in the same manner as in step 2 of manufacturing method 2.


Compound (I-73) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-78) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-74) in the same manner as in step 2 of manufacturing method 2.


Compound (I-74) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (I-79) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-75) in the same manner as in step 3 of manufacturing method 5.


Compound (I-75) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 4)

Compound (I-80) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (I-73) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Among compound (I-81), a compound in which X5a is —C(═O)—NH— can be manufactured by using compound (I-77) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Among compound (I-81), a compound in which X5a is —NH—C(═O)— can be manufactured by using compound (I-78) in the same manner as in step 4 of manufacturing method 1.


(Step 7)

Among compound (I-81), a compound in which X5a is —NH—SO2— can be manufactured by using compound (I-79) in the same manner as in step 8 of manufacturing method 1.


(Step 8)

Among compound (I-81), a compound in which X5a is —SO2—NH— can be manufactured by using compound (I-80) in the same manner as in step 4 of manufacturing method 1.


(Step 9)

Compound (I-82) can be manufactured by using compound (I-81) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 10)

Compound (I-83) can be manufactured by using compound (I-81) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


[Manufacturing Method 15]

Among compound (I) in which S is formula (S5), compound (I-93) in which X5b is —C(═O)—NH— can be manufactured according to the following steps:




embedded image


wherein X5a is as defined above, L represents L1 or L2, and Re represents lower alkyl.


(Step 1)

Compound (I-88) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-84) in the same manner as in step 2 of manufacturing method 2.


Compound (I-84) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-89) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-85) in the same manner as in step 2 of manufacturing method 2.


Compound (I-85) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (I-90) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-86) in the same manner as in step 3 of manufacturing method 5.


Compound (I-86) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 4)

Compound (I-91) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (I-84) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Compound (I-92) can be manufactured by using compound (I-88), (1-89), (I-90), or (I-91) in the same manner as in step 6 of manufacturing method 1.


(Step 6)

Compound (I-93) can be manufactured by using compound (I-92) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method 16]

Among compound (I) in which S is formula (S5), compound (I-100) in which X5b is —SO2—NH— can be manufactured according to the following steps:




embedded image


wherein X5a is as defined above, L represents L1 or L2, and Re represents lower alkyl.


(Step 1)

Compound (I-96) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-94) in the same manner as in step 3 of manufacturing method 5.


Compound (I-94) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 2)

Compound (I-97) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-95) in the same manner as in step 3 of manufacturing method 5.


Compound (I-95) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 3)

Compound (I-98) can be manufactured by using compound (I-96) in the same manner as in step 8 of manufacturing method 1.


(Step 4)

Compound (I-99) can be manufactured by using compound (I-97) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Among compound (I-100), a compound in which X5a is —C(═O)—NH— can be manufactured by using compound (I-98) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 6)

Among compound (I-100), a compound in which X5a is —SO2—NH— can be manufactured by using compound (I-98) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 7)

Among compound (I-100), a compound in which X5a is —NH—C(═O)— can be manufactured by using compound (I-99) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method 17]

Among compound (I) in which S is formula (S6), compound (I-103) in which Ar6 is triazole can be manufactured according to the following steps:




embedded image


wherein X6 and n6 are as defined above, and L represents L1 or L2.


(Step 1)

Among Compound (I-101), a compound in which X6 is —C(═O)—NH— can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-37t) in the same manner as in step 2 of manufacturing method 2.


Compound (I-37t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Among compound (I-101), a compound in which X6 is —NH—C(═O)— can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-38t) in the same manner as in step 2 of manufacturing method 2.


Compound (I-38t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Among compound (I-101), a compound in which X6 is —NH—SO2— can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-39t) in the same manner as in step 3 of manufacturing method 5.


Compound (I-39t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 4, p. 571 (1963) and the like] or methods based thereon.


(Step 4)

Among compound (I-101), a compound in which X6 is —SO2—NH— can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (I-37t) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Compound (I-102) can be manufactured by reacting compound (I-2) and 1 equivalent to 5 equivalents of an azidation agent in the presence of, according to necessity, 1 equivalent to 5 equivalents of an additive in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the azidation agent include 2-azido-1,3-dimethylimidazolinium hexafluorophosphate (ADMP) and the like.


Examples of the additive include 4-dimethylaminopyridine (DMAP), triethylamine, and the like.


Examples of the solvent include dichloromethane, acetonitrile, THF, and the like, and these can be used alone or as a mixture.


(Step 6)

Compound (I-103) can be manufactured by reacting compound (I-101) and 1 equivalent to 5 equivalents of compound (I-102) in the presence of 0.001 equivalent to 2 equivalents of copper catalyst and 0.001 equivalent to 2 equivalents of sodium L-ascorbate in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the copper catalyst include copper sulfate pentahydrate and the like.


Examples of the solvent include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile, water, 1,4-dioxane, s-butanol, and the like, and these can be used alone or as a mixture.


(Step 7)

Among compound (I-101), a compound in which X6 is —CH2—NH— can be manufactured by using compound (I-40t) and 1 equivalent to 5 equivalents of compound (I-37t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 8)

Among compound (I-101), a compound in which X6 is —NH—C(═O)—NH— can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-37t) in the same manner as in step 9 of manufacturing method 5.


(Step 9)

Compound (I-41t) can be manufactured by reacting compound (I-1) in the presence of 1 equivalent to 10 equivalents of reducing agent in a solvent at a temperature between −78° C. and the boiling point of the solvent used for 5 minutes to 120 minutes.


Examples of the reducing agent include lithium aluminum hydride, diisobutylaluminum hydride, sodium bis(2-methoxyethoxy)aluminum hydride, borane dimethyl sulfide complex, lithium borohydride, sodium borohydride, and the like.


Examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, acetonitrile, diethyl ether, THF, DME, 1,4-dioxane, DMF, DMA, NMP, and the like, and these are used alone or as a mixture.


(Step 10)

Compound (I-40t) can be manufactured by reacting compound (I-41t) in the presence of 1 equivalent to 10 equivalents of oxidizing agent in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 minutes.


Examples of the oxidizing agent include manganese dioxide, DMP, sulfur trioxide-pyridine, DMSO/oxalyl chloride, and the like.


Examples of the solvent include dichloromethane, THF, DME, 1,4-dioxane, DMF, DMA, NMP, DMSO, and the like, and these are used alone or as a mixture.


[Manufacturing Method 18]

Among compound (I) in which S is formula (S6), compound (I-112) in which Ar6 is 1,3,4-oxadiazolediyl can be manufactured according to the following steps:




embedded image


wherein X6 and n6 are as defined above, L represents L1 or L2, Re represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-106) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-104) in the same manner as in step 2 of manufacturing method 2.


Compound (I-104) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 406, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-107) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-105) in the same manner as in step 2 of manufacturing method 2.


Compound (I-105) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 406, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (I-108) can be manufactured by reacting compound (I-106) in the presence of 1 equivalent to 5 equivalents of triphenylphosphine, 1 equivalent to 5 equivalents of carbon tetrachloride, and 1 equivalent to a large excess of base in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include triethylamine, N,N-diisopropylethylamine, DBU, pyridine, and the like.


Examples of the solvent include chloroform, dichloromethane, DMF, DMA, NMP, THF, acetonitrile, 1,4-dioxane, and the like, and these can be used alone or as a mixture.


(Step 4)

Compound (I-109) can be manufactured by using compound (I-107) in the same manner as in step 3 of manufacturing method 18.


(Step 5)

Compound (I-110) can be manufactured by using compound (I-108) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Compound (I-111) can be manufactured by using compound (I-109) in the same manner as in step 6 of manufacturing method 1.


(Step 7)

Among compound (I-112), a compound in which X6 is —C(═O)—NH— can be manufactured by using compound (I-110) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 8)

Among compound (I-112), a compound in which X6 is —SO2—NH— can be manufactured by using compound (I-110) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 9)

Among compound (I-112), a compound in which X6 is —NH—C(═O)— can be manufactured by using compound (I-111) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


(Step 10)

Among compound (I-112), a compound in which X6 is —CH2—NH— can be manufactured by using compound (I-110) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 11)

Among compound (I-112), a compound in which X6 is —NH—C(═O)—NH— can be manufactured by using compound (I-110) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method 19]

Among compound (I) in which S is formula (S6), compound (I-119) in which Ar6 is 1,2,4-oxadiazolediyl can be manufactured according to the following steps:




embedded image


wherein X6 and n6 are as defined above, L represents L1 or L2, Re represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-115) can be manufactured by reacting compound (I-1) and 1 equivalent to 5 equivalents of compound (I-113) in the presence of 1 equivalent to a large excess of condensing agent and 1 equivalent to a large excess of base in a solvent at a temperature between 60° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the condensing agent include DCC, EDC, HATU, COMU, and the like.


Examples of the base include triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine, and the like.


Examples of the solvent include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile, and the like, and these can be used alone or as a mixture.


Compound (I-113) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Chemical Reviews, Volume 62, Issue 2, p. 155 (1962) and the like] or methods based thereon.


(Step 2)

Compound (I-116) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (I-114) in the same manner as in step 1 of manufacturing method 19.


Compound (I-114) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Chemical Reviews, Volume 62, Issue 2, p. 155 (1962) and the like] or methods based thereon.


(Step 3)

Compound (I-117) can be manufactured by using compound (I-115) in the same manner as in step 4 of manufacturing method 1.


(Step 4)

Compound (I-118) can be manufactured by using compound (I-116) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Among compound (I-119), a compound in which X6 is —C(═O)—NH— can be manufactured by using compound (I-117) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 6)

Among compound (I-119), a compound in which X6 is —SO2—NH— can be manufactured by using compound (I-117) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 7)

Among compound (I-119), a compound in which X6 is —NH—C(═O)— can be manufactured by using compound (I-118) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


(Step 8)

Among compound (I-119), a compound in which X6 is —CH2—NH— can be manufactured by using compound (I-117) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 9)

Among compound (I-119), a compound in which X6 is —NH—C(═O)—NH— can be manufactured by using compound (I-117) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method YS6-1]

Among compound (I) in which S is formula (S6), the following compounds in which Ar6 is pyrazolediyl: (i) compound (Iy-119) in which X6 is —C(═O)—NH—, (ii) compound (Iy-120) in which X6 is —SO2—NH—, (iii) compound (Iy-121) in which X6 is —CH2—NH—, (iv) compound (Iy-122) in which X6 is —NH—C(═O)—NH—, and (v) compound (Iy-123) in which X6 is —NH—C(═O)— can be manufactured respectively according to the following steps:




embedded image


wherein n6 is as defined above, L represents L1 or L2, Re represents lower alkyl, R6a represents a hydrogen atom or lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (Iy-115) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (Iy-113) in the same manner as in step 3 of manufacturing method 3.


Compound (Iy-113) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 95, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-116) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (Iy-114) in the same manner as in step 3 of manufacturing method 3.


Compound (Iy-114) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 95, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (Iy-117) can be manufactured by using compound (Iy-115) in the same manner as in step 4 of manufacturing method 1.


(Step 4)

Compound (Iy-118) can be manufactured by using compound (Iy-116) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Compound (Iy-119) can be manufactured by using compound (Iy-117) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 6)

Compound (Iy-120) can be manufactured by using compound (Iy-117) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 7)

Compound (Iy-121) can be manufactured by using compound (Iy-117) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 8)

Compound (Iy-122) can be manufactured by using compound (Iy-117) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


(Step 9)

Compound (Iy-123) can be manufactured by using compound (Iy-118) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method YS6-2]

Among compound (I) in which S is formula (S6), the following compounds in which Ar6 is tetrahydropyridinediyl: (i) compound (Iy-102a) in which X6 is —C(═O)—NH—, (ii) compound (Iy-102b) in which X6 is —SO2—NH—, (iii) compound (Iy-102c) in which X6 is —CH2—NH—, (iv) compound (Iy-102d) in which X6 is —NH—C(═O)—NH—, and (v) compound (Iy-102e) in which X6 is —NH—C(═O)— can be manufactured respectively according to the following steps:




embedded image


wherein n6 is as defined above, L represents L1 or L2, Re represents lower alkyl, R6a represents a hydrogen atom or lower alkyl, X represents a halogen, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (Iy-94) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (Iy-93) in the same manner as in step 3 of manufacturing method 3.


Compound (Iy-93) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 95, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-95) can be manufactured by using compound (Iy-94) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Compound (Iy-98) can be manufactured by using compound (Iy-95) and 1 equivalent to 5 equivalents of compound (Iy-96) in the same manner as in step 1 of manufacturing method 1-2.


Compound (Iy-96) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

Compound (Iy-99) can be manufactured by using compound (Iy-95) and 1 equivalent to 5 equivalents of compound (Iy-97) in the same manner as in step 1 of manufacturing method 1-2.


Compound (Iy-97) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 5)

Compound (Iy-100) can be manufactured by using compound (Iy-98) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Compound (Iy-101) can be manufactured by using compound (Iy-99) in the same manner as in step 6 of manufacturing method 1.


(Step 7)

Compound (Iy-102a) can be manufactured by using compound (Iy-100) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 8)

Compound (Iy-102b) can be manufactured by using compound (Iy-100) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 9)

Compound (Iy-102c) can be manufactured by using compound (Iy-100) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 10)

Compound (Iy-102d) can be manufactured by using compound (Iy-100) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


(Step 11)

Compound (Iy-102e) can be manufactured by using compound (Iy-101) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method YS6-3]

In compound (I) in which S is formula (S6), the following compounds in which Ar6 is thiophenediyl: (i) compound (Iy-109) in which X6 is —C(═O)—NH—, (ii) compound (Iy-110) in which X6 is —SO2—NH—, (iii) compound (Iy-111) in which X6 is —CH2—NH—, (iv) compound (Iy-112) in which X6 is —NH—C(═O)—NH—, and (v) compound (Iy-112a) in which X6 is-NH—C(═O)— can be manufactured respectively according to the following steps:




embedded image


wherein n6 is as defined above, L represents L1 or L2, Re represents lower alkyl, R6a represents a hydrogen atom or lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (Iy-105) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (Iy-103) in the same manner as in step 3 of manufacturing method 3.


Compound (Iy-103) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 95, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-106) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (Iy-104) in the same manner as in step 3 of manufacturing method 3.


Compound (Iy-104) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 95, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 3)

Compound (Iy-107) can be manufactured by using compound (Iy-105) in the same manner as in step 4 of manufacturing method 1.


(Step 4)

Compound (Iy-108) can be manufactured by using compound (Iy-106) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Compound (Iy-109) can be manufactured by using compound (Iy-107) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 6)

Compound (Iy-110) can be manufactured by using compound (Iy-107) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 7)

Compound (Iy-111) can be manufactured by using compound (Iy-107) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 8)

Compound (Iy-112) can be manufactured by using compound (Iy-107) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


(Step 9)

Compound (Iy-112a) can be manufactured by using compound (Iy-108) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method 20]

Among compound (I), compound (I-126), compound (I-126a), and compound (I-126b), in which S is formula (S7), can be manufactured respectively according to the following steps:




embedded image


wherein X7 and n7 are as defined above, L represents L1 or L2, Re represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-122) can be manufactured by reacting compound (I-3) and 1 equivalent to 5 equivalents of compound (I-120) in the presence of 0.001 equivalent to 3 equivalents of palladium catalyst, 0.001 equivalent to 3 equivalents of phosphorus ligand, and 1 equivalent to a large excess of base in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst include Pd2(dba)3 and the like.


Examples of the phosphorus ligand include xantphos and the like.


Examples of the base include triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine, potassium tert-butoxide, sodium carbonate, potassium carbonate, and the like.


Examples of the solvent include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile, 1,4-dioxane, and the like, and these can be used alone or as a mixture.


Compound (I-120) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 3, p. 363 (1955) and the like] or methods based thereon.


(Step 2)

Compound (I-123) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (I-121) in the same manner as in step 1 of manufacturing method 20.


Compound (I-121) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Organic Syntheses, Coll. Vol. 3, p. 363 (1955) and the like] or methods based thereon.


(Step 3)

Compound (I-124) can be manufactured by using compound (I-122) in the same manner as in step 6 of manufacturing method 1.


(Step 4)

Compound (I-125) can be manufactured by using compound (I-123) in the same manner as in step 4 of manufacturing method 1.


(Step 5)

Among compound (I-126), a compound in which X7 is —NH—C(═O)— can be manufactured by using compound (I-124) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


(Step 6)

Among compound (I-126), a compound in which X7 is —C(═O)—NH— can be manufactured by using compound (I-125) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 7)

Among compound (I-126), a compound in which X7 is —SO2—NH— can be manufactured by using compound (I-125) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 8)

Among compound (I-126), a compound in which X7 is —NH—C(═O)—NH— can be manufactured by using compound (I-125) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


(Step 9)

Compounds (I-126a) and (I-126b) can be manufactured by reacting compound (I-126) in the presence of 1 equivalent to 10 equivalents of oxidizing agent in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the oxidizing agent include meta-chloroperbenzoic acid (m-CPBA), benzoyl peroxide, peracetic acid, aqueous hydrogen peroxide, sodium periodate, and the like.


Examples of the solvent include dichloromethane, 1,2-dichloroethane, toluene, and the like, and these are used alone or as a mixture.


In addition, either of compounds (I-126a) and (I-126b) can be obtained selectively or they are obtained as a mixture by adjusting the reaction conditions such as, for example, the number of equivalents of the oxidizing agent, temperature, and the like.


[Manufacturing Method YS-8-1]

Among compound (I) in which S is formula (S8), compound (Iy-85) in which X8b is a bond can be manufactured according to the following steps:




embedded image


wherein X8a is as defined above, L represents L1 or L2, X represents a halogen, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (Iy-83) can be manufactured by (i) reacting compound (I-3) in the presence of 1 equivalent to 5 equivalents of bis(pinacolato)diboron, 0.001 equivalent to 3 equivalents of palladium catalyst, 0.001 equivalent to 3 equivalents of phosphorus ligand as necessary, and 1 equivalent to a large excess of base in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours, and then (ii) reacting the obtained compound in the presence of 1 equivalent to 5 equivalents of compound (I-127), 0.001 equivalent to 3 equivalents of palladium catalyst, 0.001 equivalent to 3 equivalents of phosphorus ligand as necessary, and 1 equivalent to a large excess of base in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst used in (i) include Pd(dppf)Cl2, Pd2(dba)3, Pd(PPh3)4, and the like.


Examples of the phosphorus ligand used in (i) include tricyclohexylphosphine and the like.


Examples of the base used in (i) include potassium acetate, potassium carbonate, sodium carbonate, cesium carbonate, potassium phosphate, and the like.


Examples of the solvent used in (i) include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile, 1,4-dioxane, water, and the like, and these can be used alone or as a mixture.


Examples of the palladium catalyst used in (ii) include Pd(dppf)Cl2, Pd2(dba)3, Pd(PPh3)4, and the like.


Examples of the phosphorus ligand used in (ii) include triphenylphosphine, tricyclohexylphosphine, and the like.


Examples of the base used in (ii) include potassium acetate, potassium carbonate, sodium carbonate, cesium carbonate, potassium phosphate, and the like.


Examples of the solvent used in (ii) include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile, 1,4-dioxane, water, and the like, and these can be used alone or as a mixture.


Compound (I-127) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 341, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-84) can be manufactured by using compound (Iy-83) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Among compound (Iy-85), a compound in which X8a is —C(═O)— can be manufactured by using compound (Iy-84) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 4)

Among compound (Iy-85), a compound in which X8a is —CH2— can be manufactured by using compound (Iy-84) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 5)

Among compound (Iy-85), a compound in which X8a is —NH—C(═O)— can be manufactured by using compound (Iy-84) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method YS-8-2]

Among compound (I) in which S is formula (S8), (i) compound (Iy-92) in which X8b is —C(═O)—, (ii) compound (Iy-91) in which X8b is —CH2—, and (iii) compound (Iy-90) in which X8b is —CH(OH)— can be manufactured respectively according to the following steps:




embedded image


wherein X8a is as defined above, L represents L1 or L2, X represents a halogen, and P represents an amine protecting group such as Boc, Cbz, and the like.


(Step 1)

Compound (Iy-87) can be manufactured by reacting 1 equivalent to 10 equivalents of compound (I-127) and 1 equivalent to 10 equivalents of organometallic reagent in a solvent at a temperature between −78° C. and the boiling point of the solvent used for 5 minutes to 24 hours, and by subsequently adding compound (I-40t) to the reaction mixture and reacting the mixture at a temperature between −78° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the organometallic reagent include n-butyllithium, s-butyllithium, t-butyllithium, isopropylmagnesium chloride-lithium chloride, and the like. These organometallic reagents can be obtained as commercial products, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 7 (Li) and p. 59 (Mg), Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Examples of the solvent include toluene, diethyl ether, THF, DME, 1,4-dioxane, hexane, and the like, and these are used alone or as a mixture.


(Step 2)

Compound (Iy-88) can be manufactured by using compound (Iy-87) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

When P in compound (Iy-87) is, for example, Boc, compound (Iy-89) can be manufactured by reacting compound (Iy-87) in the presence of 1 equivalent to a large excess of acid and 1 equivalent to a large excess of reducing agent without a solvent or in a solvent at a temperature between room temperature and 150° C. for 5 minutes to 120 hours.


Examples of the acid include hydrochloric acid, sulfuric acid, formic acid, acetic acid, trifluoroacetic acid, p-toluenesulfonic acid, methanesulfonic acid, titanium tetrachloride, boron trifluoride, and the like.


Examples of the reducing agent include triethylsilane, diethylsilane, triphenylsilane, and the like.


Examples of the solvent include toluene, dichloromethane, THF, DME, 1,4-dioxane, dichloroethane, and the like, and these are used alone or as a mixture.


Further, when P in compound (Iy-87) is, for example, Cbz, compound (Iy-89) can be manufactured by reacting compound (Iy-87) in the presence of 0.001 equivalent to 0.5 equivalent of palladium catalyst and 1 equivalent to a large excess of acid under a hydrogen atmosphere in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst include palladium on carbon, palladium hydroxide, and the like.


Examples of the acid include hydrochloric acid, sulfuric acid, formic acid, acetic acid, trifluoroacetic acid, p-toluenesulfonic acid, methanesulfonic acid, and the like.


Examples of the solvent include methanol, ethanol, ethyl acetate, THF, 1,4-dioxane, and the like, and these can be used alone or as a mixture.


(Step 4)

Among compound (Iy-90), a compound in which X8a is —C(═O)— can be manufactured by using compound (Iy-88) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 5)

Among compound (Iy-90), a compound in which X8a is —CH2− can be manufactured by using compound (Iy-88) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 6)

Among compound (Iy-90), a compound in which X8a is —NH—C(═O)— can be manufactured by using compound (Iy-88) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


(Step 7)

Among compound (Iy-91), a compound in which X8a is —C(═O)— can be manufactured by using compound (Iy-89) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 8)

Among compound (Iy-91), a compound in which X8a is —CH2− can be manufactured by using compound (Iy-89) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


(Step 9)

Among compound (Iy-91), a compound in which X8a is —NH—C(═O)— can be manufactured by using compound (Iy-89) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


(Step 10)

Compound (Iy-92) can be manufactured by using compound (Iy-90) in the same manner as in step 2 of manufacturing method Y6.


[Manufacturing Method YS9-1]

Among compound (I) in which S is formula (S9), compound (Iy-75) in which Arg is triazolediyl and Z9 is —CH2— can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2.


(Step 1)

Compound (Iy-72) can be manufactured by reacting compound (I-41t) in the presence of 1 equivalent to 10 equivalents of diphenylphosphoryl azide and a large excess of base in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include potassium tert-butoxide, potassium carbonate, sodium hydroxide, DBU, triethylamine, N,N-diisopropylethylamine, pyridine, 4-dimethylaminopyridine, and the like.


Examples of the solvent include toluene, dichloroethane, THF, 1,4-dioxane, and the like, and these can be used alone or as a mixture.


(Step 2)

Compound (Iy-74) can be manufactured by using compound (I-2) and 1 equivalent to 10 equivalents of propiolic acid in the same manner as in step 2 of manufacturing method 2.


(Step 3)

Compound (Iy-75) can be manufactured by using compound (Iy-74) and 1 equivalent to 5 equivalents of compound (Iy-72) in the same manner as in step 6 of manufacturing method 17.


[Manufacturing Method YS9-2]

Among compound (I) in which S is formula (S9), compound (Iy-81) in which Arg is oxazolediyl and Z9 is —NH— can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2, X represents a halogen, Re represents lower alkyl, and P represents an amine protecting group such as trimethylsilyl, —C(═O)—CCI3, and the like.


(Step 1)

Compound (Iy-77) can be manufactured by reacting compound (I-2) and 1 equivalent to 10 equivalents of compound (Iy-76) in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Compound (Iy-76) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 4th Edition, Volume 20, p. 473, Maruzen Co., Ltd. (2001) and the like] or methods based thereon.


Examples of the solvent include dichloromethane, toluene, acetonitrile, THF, 1,4-dioxane, and the like, and these are used alone or as a mixture.


(Step 2)

Compound (Iy-79) can be manufactured by reacting compound (Iy-77) and 1 equivalent to 10 equivalents of compound (Iy-78) in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Compound (Iy-78) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 15, p. 153, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Examples of the solvent include toluene, acetonitrile, ethanol, 1,4-dioxane, DMF, DMA, NMP, and the like, and these are used alone or as a mixture.


(Step 3)

Compound (Iy-80) can be manufactured by using compound (Iy-79) in the same manner as in step 6 of manufacturing method 1.


(Step 4)

Compound (Iy-81) can be manufactured by using compound (Iy-80) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method YS10-1]

Among compound (I) in which S is formula (S10), compound (Iy-71) in which Z10 is —O— can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2 and Re represents lower alkyl.


(Step 1)

Compound (Iy-69) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (Iy-68) in the same manner as in step 2 of manufacturing method 2.


Compound (Iy-68) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-70) can be manufactured by using compound (Iy-69) in the same manner as in step 6 of manufacturing method 1.


(Step 3)

Compound (Iy-71) can be manufactured by using compound (Iy-70) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method YS10-2]

Among compound (I) in which S is formula (S10), compound (I-46t) in which Z10 is —NH— can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2, Re represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, Fmoc, and the like.


(Step 1)

Compound (I-43t) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-42t) in the same manner as in step 2 of manufacturing method 2.


Compound (I-42t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-44t) can be manufactured by using compound (I-43t) in the same manner as in step 6 of manufacturing method 1.


(Step 3)

Compound (I-45t) can be manufactured by using compound (I-44t) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


(Step 4)

Compound (I-46t) can be manufactured by using compound (I-45t) in the same manner as in step 4 of manufacturing method 1 when P in compound (I-45t) is, for example, Boc, Cbz, or PMB, and can be manufactured by using compound (I-45t) in the same manner as in step 3 of manufacturing method 2 when P in compound (I-45t) is, for example, Fmoc.


[Manufacturing Method YS11-1]

Among compound (I) in which S is formula (S11), compound (Iy-116a) in which X11b is —C(═O)—NH— can be manufactured according to the following steps:




embedded image


wherein X11a is as defined above, L represents L1 or L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (Iy-114a) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (Iy-113a) in the same manner as in step 2 of manufacturing method 2.


Compound (Iy-113a) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-115a) can be manufactured by using compound (Iy-114a) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Among compound (Iy-116a), a compound in which X11a is —C(═O)—NH— can be manufactured by using compound (Iy-115a) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 4)

Among compound (Iy-116a), a compound in which X11a is —SO2—NH— can be manufactured by using compound (Iy-115a) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Among compound (Iy-116a), a compound in which X11a is —NH—C(═O)—NH— can be manufactured by using compound (Iy-115a) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[manufacturing method YS11-2]


Among compound (I) in which L1 is (A) and S is formula (S11), the following compounds in which ring RA is ring RA3 and Xlib is —C(═O)—: (i) compound (Iy-118a) in which X11a is —C(═O)—NH—, (ii) compound (Iy-118b) in which X11a is —SO2—NH—, and (iii) compound (Iy-118c) in which X11a is —NH—C(═O)—NH— can be manufactured respectively according to the following steps:




embedded image


embedded image


wherein RA1, RA2, RA3, RA5, n1A, and ring RA3 are as defined above, L represents L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like. Incidentally, one secondary amine constituting the ring RA3 becomes a reaction point with compound (Iy-113a).


(Step 1)

Compound (Iy-117a) can be manufactured by using compound (I-47t) and 1 equivalent to 5 equivalents of compound (Iy-113a) in the same manner as in step 2 of manufacturing method 2.


As for compound (I-47t), compound (a-32) obtained in step 6 of manufacturing method 1-3 and compound (a-41) obtained in step 6 of manufacturing method 1-4 shall be collectively represented as compound (I-47t).


Compound (Iy-113a) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-117b) can be manufactured by using compound (I-117a) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Compound (Iy-118a) can be manufactured by using compound (Iy-117b) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 4)

Compound (Iy-118b) can be manufactured by using compound (Iy-117b) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 5)

Compound (Iy-118c) can be manufactured by using compound (Iy-117b) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method YS12-1]

Among compound (I) in which S is formula (S12), the following compounds in which Z12a is CH2, (i) compound (Iy-67) in which X12 is —C(═O)—NH—, (ii) compound (I-48t) in which X12 is —SO2—NH—, and (iii) compound (I-49t) in which X12 is —NH—C(═O)—NH— can be manufactured respectively according to the following steps:




embedded image


wherein Z12b and Z12c are as defined above, n12a and n12b are the same or different and each represents 0 or 1, L represents L1 or L2, X represents a halogen, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (Iy-58) can be manufactured by (i) reacting compound (I-3) in the presence of 1 equivalent to 5 equivalents of bis(pinacolato)diboron, 0.001 equivalent to 3 equivalents of palladium catalyst, and 0.001 equivalent to 3 equivalents of phosphorus ligand as necessary, and 1 equivalent to a large excess of base in a solvent at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 120 hours, and then (ii) reacting the obtained compound in the presence of 1 equivalent to a large excess of oxidizing agent in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the palladium catalyst used in (i) include Pd(dppf)Cl2, Pd2(dba)3, Pd(PPh3)4, and the like.


Examples of the phosphorus ligand used in (i) include tricyclohexylphosphine and the like.


Examples of the base used in (i) include potassium acetate, potassium carbonate, sodium carbonate, cesium carbonate, potassium phosphate, and the like.


Examples of the solvent used in (i) include chloroform, dichloromethane, DMF, DMA, NMP, DMSO, THF, acetonitrile, 1,4-dioxane, water, and the like, and these can be used alone or as a mixture.


Examples of the oxidizing agent used in (ii) include a hydrogen peroxide solution, sodium perborate, and the like.


Examples of the solvent used in (ii) include THF, 1,4-dioxane, water, and the like, and these can be used alone or as a mixture.


(Step 2)

Compound (Iy-63) can be manufactured by reacting compound (I-3) and 1 equivalent to 10 equivalents of compound (Iy-60) in the presence of 0.001 equivalent to 3 equivalents of palladium catalyst and, as necessary, 0.001 equivalent to 3 equivalents of phosphorus ligand in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Compound (Iy-60) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 77, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Examples of the palladium catalyst include Pd(dppf)Cl2, Pd2(dba)3, Pd(PPh3)4, and the like.


Examples of the phosphorus ligand include tricyclohexylphosphine, 2-dicyclohexylphosphino-2′,6′-dimethoxybiphenyl (SPhos), and the like.


Examples of the solvent include THF, DMF, DMA, NMP, and the like, and these are used alone or as a mixture.


(Step 3)

Compound (Iy-64) can be manufactured by reacting compound (I-1t) in the presence of 1 equivalent to 5 equivalents of compound (Iy-61) and 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the base include sodium hydride, potassium tert-butoxide, triethylamine, N,N-diisopropylethylamine, N-methylmorpholine, DBU, potassium carbonate, cesium carbonate, and the like.


Examples of the solvent include toluene, diethyl ether, THF, DME, 1,4-dioxane, DMF, DMA, NMP, pyridine, acetonitrile, and the like, and these are used alone or as a mixture.


Compound (Iy-61) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


As for compound (I-1t), compound (Iy-58) obtained in step 1 and compound (f-1) obtained in step 1 of manufacturing method Y6 shall be collectively represented as compound (I-1t).


(Step 4)

Compound (Iy-65) can be manufactured by reacting compound (I-41t) and 1 equivalent to 10 equivalents of compound (Iy-62) in the presence of 1 equivalent to 10 equivalents of base in a solvent at a temperature between −20° C. and 150° C. for 5 minutes to 120 hours.


Compound (Iy-62) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Examples of the base include sodium hydride, potassium tert-butoxide, triethylamine, N,N-diisopropylethylamine, N-methylmorpholine, DBU, and the like.


Examples of the solvent include toluene, diethyl ether, THF, DME, 1,4-dioxane, DMF, DMA, NMP, pyridine, and the like, and these are used alone or as a mixture.


Compound (I-41t) can be obtained according to step 9 of manufacturing method 17.


(Step 5)

Compound (Iy-66) can be manufactured by using compound (Iy-63), compound (Iy-64), or compound (Iy-65) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Compound (Iy-67) can be manufactured by using compound (Iy-66) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 7)

Compound (I-48t) can be manufactured by using compound (Iy-66) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 8)

Compound (I-49t) can be manufactured by using compound (Iy-66) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method Y512-2]

Among compound (I) in which S is formula (S12), compound (Iy-67a) in which Z12a is CH2 and X12 is —NH—C(═O)— can be manufactured according to the following steps:




embedded image


wherein Z12b and Z12c are as defined above, n12a and n12b are the same or different and each represents 0 or 1, L represents L1 or L2, X represents a halogen, and Re represents lower alkyl.


(Step 1)

Compound (Iy-63a) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (Iy-60a) in the same manner as in step 2 of manufacturing method YS12-1.


Compound (Iy-60a) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 77, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-64a) can be manufactured by using compound (I-1t) and 1 equivalent to 5 equivalents of compound (Iy-61a) in the same manner as in step 3 of manufacturing method YS12-1.


Compound (Iy-61a) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


As for compound (I-1t), compound (ly-58) obtained in step 1 of manufacturing method YS12-1 and compound (f-1) obtained in step 1 of manufacturing method Y6 shall be collectively represented as compound (I-1t).


(Step 3)

Compound (Iy-65a) can be manufactured by using compound (I-41t) and 1 equivalent to 5 equivalents of compound (Iy-62a) in the same manner as in step 4 of manufacturing method YS12-1.


Compound (Iy-62a) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


Compound (I-41t) can be obtained according to step 9 of manufacturing method 17.


(Step 4)

Compound (Iy-66a) can be manufactured by using compound (Iy-63a), compound (Iy-64a), or compound (Iy-65a) in the same manner as in step 6 of manufacturing method 1.


(Step 5)

Compound (Iy-67a) can be manufactured by using compound (Iy-66a) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method YS12-3]

Among compound (I) in which S is formula (S12), compound (I-53t) in which Z12a is NH can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-51t) can be manufactured by using compound (I-2) and 1 equivalent to 5 equivalents of compound (I-50t) in the same manner as in step 2 of manufacturing method 2.


Compound (I-50t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 175, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-52t) can be manufactured by using compound (I-51t) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Compound (I-53t) can be manufactured by using compound (I-52t) and 1 equivalent to 5 equivalents of compound (I-40t) in the same manner as in step 1 of manufacturing method 1-3.


[Manufacturing Method Y513]

Among compound (I) in which S is formula (S13), (i) compound (Iy-53) in which n13 is 0 and (ii) compound (Iy-57) in which n13 is n13a can be manufactured respectively according to the following steps:




embedded image


wherein n13a represents 1 or 2, L represents L1 or L2, X represents a halogen, and Re represents lower alkyl.


(Step 1)

Compound (Iy-51) can be manufactured by reacting compound (I-2) and 1 equivalent to 10 equivalents of 3-(nitromethylene)oxetane in the presence of a large excess of base in a solvent at a temperature between −20° C. and 150° C. for 5 minutes to 120 hours.


Examples of the base include triethylamine, N,N-diisopropylethylamine, N-methylmorpholine, DBU, and the like.


Examples of the solvent include toluene, diethyl ether, THF, DME, 1,4-dioxane, and the like, and these are used alone or as a mixture.


(Step 2)

Compound (Iy-52) can be manufactured by using compound (Iy-51) in the same manner as in step 8 of manufacturing method 1.


(Step 3)

Compound (Iy-53) can be manufactured by using compound (Iy-52) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 4)

Compound (Iy-55) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (Iy-54) in the same manner as in step 2 of manufacturing method YS12-1.


Compound (Iy-54) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 77, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 5)

Compound (Iy-56) can be manufactured by using compound (Iy-55) in the same manner as in step 6 of manufacturing method 1.


(Step 6)

Compound (Iy-57) can be manufactured by using compound (Iy-52) and 1 equivalent to 5 equivalents of compound (Iy-56) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method Y514]

Among compound (I), compound (Iy-49) in which S is formula (S14) can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2, R14a represents a hydrogen atom or lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (Iy-47) can be manufactured by using compound (I-3) and 1 equivalent to 5 equivalents of compound (Iy-47a) in the same manner as in step 3 of manufacturing method 3.


Compound (Iy-47a) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 18, p. 95, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-48) can be manufactured by using compound (Iy-47) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Compound (Iy-49) can be manufactured by using compound (Iy-48) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method Y515]

Among compound (I), compound (Iy-46c) in which S is represented by formula (S15) can be manufactured according to the following steps:




embedded image


wherein L represents L1 or L2 and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (Iy-46a) can be manufactured by using compound (I-1) and 1 equivalent to 5 equivalents of compound (Iy-45) in the same manner as in step 2 of manufacturing method 2.


Compound (Iy-45) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-46b) can be manufactured by using compound (Iy-46a) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Compound (Iy-46c) can be manufactured by using compound (Iy-46b) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


[Manufacturing Method Y516-1-2]

Among compound (I) in which L1 is LE and S is formula (S16), the following compounds in which Ar16 is triazolediyl: (i) compound (Iy-14) in which X16 is —C(═O)—NH—, (ii) compound (Iy-20) in which X16 is —NH—C(═O)—, (iii) compound (Iy-17b) in which X16 is —NH—C(═O)—NH—, and (iv) compound (I-60t) in which X16 is —CH2—O— can be manufactured respectively according to the following steps:




embedded image


embedded image


embedded image


embedded image


wherein RE1, RE2, RE3, RE5, n16, and Z16 are as defined above, LE is a group represented by formula (E), L represents L2, X represents a halogen, Re represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, 2-nitrobenzenesulfonyl (Ns), and the like.


(Step 1)

Compound (Iy-10) can be manufactured by using compound (e-1) and 1 equivalent to 5 equivalents of compound (Iy-9) in the same manner as in step 1 of manufacturing method 1-2.


Compound (e-1) can be obtained in the same manner as in step 4 of manufacturing method 1.


Compound (Iy-9) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (Iy-11) can be manufactured by using compound (Iy-10) in the same manner as in step 6 of manufacturing method 1.


(Step 3)

Compound (Iy-13) can be manufactured by using compound (Iy-11) and 1 equivalent to 5 equivalents of compound (Iy-12) in the same manner as in step 2 of manufacturing method 2.


Compound (Iy-12) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 14, p. 351, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 4)

Compound (Iy-14) can be manufactured by using compound (Iy-13) and 1 equivalent to 5 equivalents of compound (I-102) in the same manner as in step 6 of manufacturing method 17.


(Step 5)

Compound (Iy-16) can be manufactured by using compound (e-1) and 1 equivalent to 5 equivalents of compound (Iy-15) in the same manner as in step 1 of manufacturing method 1-2.


Compound (Iy-15) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 6)

Compound (Iy-17) can be manufactured by using compound (Iy-16) in the same manner as in step 4 of manufacturing method 1.


(Step 7)

Compound (Iy-19) can be manufactured by using compound (Iy-17) and 1 equivalent to 5 equivalents of compound (Iy-18) in the same manner as in step 2 of manufacturing method 2.


Compound (Iy-18) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 16, p. 1, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 8)

Compound (Iy-20) can be manufactured by using compound (Iy-19) and 1 equivalent to 5 equivalents of compound (I-102) in the same manner as in step 6 of manufacturing method 17.


(Step 9)

Compound (Iy-17a) can be manufactured by using compound (Iy-17) and 1 equivalent to 5 equivalents of compound (Iy-12) in the same manner as in step 9 of manufacturing method 5.


(Step 10)

Compound (Iy-17b) can be manufactured by using compound (Iy-17a) and 1 equivalent to 5 equivalents of compound (I-102) in the same manner as in step 6 of manufacturing method 17.


(Step 11)

Compound (I-54t) can be manufactured by using compound (e-1) and 1 equivalent to 5 equivalents of compound (b-1t) in the same manner as in step 6 of manufacturing method T2.


(Step 12)

Compound (I-56t) can be manufactured by using compound (I-54t) and 1 equivalent to 10 equivalents of compound (I-55t) in the same manner as in step 1 of manufacturing method 1-2.


Compound (I-55t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 13)

Compound (I-58t) can be manufactured by using compound (I-56t) and 1 equivalent to 10 equivalents of compound (I-57t) in the same manner as in step 4 of manufacturing method YS12-1.


Compound (I-57t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 14)

Compound (I-59t) can be manufactured by using compound (I-58t) and 1 equivalent to 5 equivalents of compound (I-102) in the same manner as in step 6 of manufacturing method 17.


(Step 15)

When P in compound (I-59t) is, for example, Ns, compound (I-60t) can be manufactured by reacting compound (I-59t) in the presence of 1 equivalent to 10 equivalents of thiol and 1 equivalent to a large excess of base in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 120 hours.


Examples of the thiol include thiophenol, mercaptoacetic acid, 2-mercaptoethanol, and the like.


Examples of the base include cesium carbonate, potassium carbonate, sodium carbonate, and the like.


Examples of the solvent include acetonitrile, DMF, DMSO, and the like, and these can be used alone or as a mixture.


[Manufacturing Method YS16-2-2]

Among compound (I) in which S is formula (S16), the following compounds in which Ar16 is pyrazolediyl: (i) compound (Iy-7) in which X16 is —C(═O)—NH—, (ii) compound (Iy-27) in which X16 is —NH—C(═O)—, and (iii) compound (Iy-7a) in which X16 is —NH—C(═O)—NH—; and the following compounds in which Ar16 is oxadiazolediyl: (i) compound (Iy-8) in which X16 is —C(═O)—NH—, (ii) compound (Iy-28) in which X16 is —NH—C(═O)—, and (iii) compound (Iy-8a) in which X16 is —NH—C(═O)—NH— can be manufactured respectively according to the following steps:




embedded image


wherein n16 and Z16 are as defined above, LE is a group represented by formula (E), and L represents L2.


(Step 1)

Compound (Iy-7) can be manufactured by using compound (Iy-11) and 1 equivalent to 5 equivalents of compound (Iy-117d) in the same manner as in step 2 of manufacturing method 2.


Compound (Iy-117d) can be obtained in the same manner as in step 3 of manufacturing method YS6-1.


(Step 2)

Compound (Iy-8) can be manufactured by using compound (Iy-11) and 1 equivalent to 5 equivalents of compound (I-110a) in the same manner as in step 2 of manufacturing method 2.


Compound (I-110a) can be obtained in the same manner as in step 5 of manufacturing method 18.


(Step 3)

Compound (Iy-27) can be manufactured by using compound (Iy-17) and 1 equivalent to 5 equivalents of compound (Iy-118d) in the same manner as in step 2 of manufacturing method 2.


Compound (Iy-118d) can be obtained in the same manner as in step 4 of manufacturing method YS6-1.


(Step 4)

Compound (Iy-28) can be manufactured by using compound (Iy-17) and 1 equivalent to 5 equivalents of compound (I-111a) in the same manner as in step 2 of manufacturing method 2.


Compound (I-111a) can be obtained in the same manner as in step 6 of manufacturing method 18.


(Step 5)

Compound (Iy-7a) can be manufactured by using compound (Iy-17) and 1 equivalent to 5 equivalents of compound (Iy-117d) in the same manner as in step 9 of manufacturing method 5.


(Step 6)

Compound (Iy-8a) can be manufactured by using compound (Iy-17) and 1 equivalent to 5 equivalents of compound (I-110a) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method Y517]

Among compound (I) in which L1 is LE and S is formula (S17), (i) compound (I-64t) in which X17 is —C(═O)—NH—, (ii) compound (I-68t) in which X17 is —NH—C(═O)—, (iii) compound (I-69t) in which X17 is —NH—SO2—, and (iv) compound (I-70t) in which X17 is —NH—C(═O)—NH— can be manufactured respectively according to the following steps:




embedded image


wherein RE1, RE2, RE3, RE5, and n17 are as defined above, LE is a group represented by formula (E), L represents L2, X represents a halogen, Re represents lower alkyl, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-62t) can be manufactured by using compound (e-1) and 1 equivalent to 10 equivalents of compound (I-61t) in the same manner as in step 1 of manufacturing method 1-2.


Compound (I-61t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-63t) can be manufactured by using compound (I-62t) in the same manner as in step 6 of manufacturing method 1.


(Step 3)

Compound (I-64t) can be manufactured by using compound (I-63t) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 2 of manufacturing method 2.


(Step 4)

Compound (I-66t) can be manufactured by using compound (e-1) and 1 equivalent to 10 equivalents of compound (I-65t) in the same manner as in step 1 of manufacturing method 1-2.


Compound (I-65t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 5)

Compound (I-67t) can be manufactured by using compound (I-66t) in the same manner as in step 4 of manufacturing method 1.


(Step 6)

Compound (I-68t) can be manufactured by using compound (I-67t) and 1 equivalent to 5 equivalents of compound (I-1) in the same manner as in step 2 of manufacturing method 2.


(Step 7)

Compound (I-69t) can be manufactured by using compound (I-67t) and 1 equivalent to 5 equivalents of compound (I-3) in the same manner as in step 4 of manufacturing method 5.


(Step 8)

Compound (I-70t) can be manufactured by using compound


(I-67t) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


[Manufacturing Method YS18]

Compound (I) in which L1 is LE and S is formula (S18) can be manufactured according to the following steps:




embedded image


wherein RE1, RE2, RE3, RE5, n18a, n18b, and n18c are as defined above, LE is a group represented by formula (E), L represents L2, X represents a halogen, and P represents an amine protecting group such as Boc, Cbz, PMB, and the like.


(Step 1)

Compound (I-72t) can be manufactured by using compound (e-1) and 1 equivalent to 10 equivalents of compound (I-71t) in the same manner as in step 1 of manufacturing method 1-2.


Compound (I-71t) can be obtained as a commercially available product, or can be obtained by known methods [e.g., Experimental Chemistry Lecture, 5th Edition, Volume 13, p. 374, Maruzen Co., Ltd. (2004) and the like] or methods based thereon.


(Step 2)

Compound (I-73t) can be manufactured by using compound (I-72t) in the same manner as in step 4 of manufacturing method 1.


(Step 3)

Compound (I-74t) can be manufactured by using compound (I-73t) and 1 equivalent to 5 equivalents of compound (I-2) in the same manner as in step 9 of manufacturing method 5.


Conversion of various functional groups in the manufacturing methods of compound (I) and compound (I)-1 can be conducted by known methods [e.g., methods described in Comprehensive Organic Transformations, 2nd Edition, R. C. Larock, Vch. Verlagsgesellschaft Mbh (1999) and the like] or methods based thereon.


The intermediates and target compounds in each of the above-mentioned manufacturing methods can be isolated and purified by subjecting them to isolation/purification methods commonly used in synthetic organic chemistry, for example, filtration, extraction, washing, drying, concentration, recrystallization, various chromatography, and the like. Furthermore, the intermediates can be supplied to the next reactions without any particular purification.


Among compound (I) and compound (I)-1, there are compounds for which there can be stereoisomers such as geometrical isomers, optical isomers, and the like, tautomers, and the like, but the present invention includes all possible isomers including these and mixtures thereof. For example, compound numbers 2c and 2d in Table 2 below are optical isomers, and both of these are included in the scope of compound (I) and compound (I)-1 of the present invention.


A part or all of atoms in each of compound (I) and compound (I)-1 may be substituted with corresponding isotope atoms, and the present invention also includes the compounds substituted with these isotope atoms. For example, a part or all of hydrogen atoms in each of compound (I) and compound (I)-1 may be hydrogen atoms having an atomic weight of 2 (deuterium atoms).


A compound obtained by substituting a part or all of atoms in each of compound (I) and compound (I)-1 with the corresponding isotope atom can be manufactured by a method similar to each of the above-mentioned manufacturing methods by using commercially available building blocks. Furthermore, a compound obtained by substituting a part or all of hydrogen atoms in each of compound (I) and compound (I)-1 with deuterium atoms can also be synthesized, for example, by 1) a method of deuterating a carboxylic acid and the like by using deuterium peroxide under a basic condition (see the description of U.S. Pat. No. 3,849,458), 2) a method of deutarating an alcohol, a carboxylic acid, and the like by using an iridium complex as a catalyst and heavy water as a deuterium source [see J. Am. Chem. Soc., Vol. 124, No. 10, 2092 (2002)], 3) a method of deutarating an aliphatic acid by using palladium on carbon as a catalyst and using only deuterium gas as a deuterium source [see LIPIDS, Vol. 9, No. 11, 913 (1974)], 4) a method of deutarating acrylic acid, methyl acrylate, methacrylic acid, methyl methacrylate, and the like by using a metal such as platinum, palladium, rhodium, ruthenium, iridium, and the like as a catalyst and using heavy water or heavy water and deuterium gas as a deuterium source (see Japanese Examined Patent Application Publication No. H5-19536, Japanese Unexamined Patent Application Publication No. 561-277648, and Japanese Unexamined Patent Application Publication No. S61-275241), 5) a method of deuterating acrylic acid, methyl methacrylate, and the like by using a catalyst such as palladium, nickel, copper, copper chromite, and the like, and heavy water as a deuterium source (see Japanese Unexamined Patent Application Publication No. S63-198638), and the like.


When a salt of compound (I) or compound (I)-1 is desired, in the case where compound (I) or compound (I)-1 is obtained in the form of a salt, it should be purified as it is, or in the case where compound (I) or compound (I)-1 is obtained in a free form, it should be dissolved or suspended in a suitable solvent and an acid or a base should be added to form a salt thereof, followed by isolation and purification.


Furthermore, compound (I), compound (I)-1 and a pharmaceutically acceptable salt thereof may sometimes be present in the form of an adduct with water or various solvents, but these adducts are also included in the present invention.


Compound (I) and compound (I)-1 preferably includes compounds described in the following Tables 1 to 17. In addition, in the Tables, A1, A2, A5, A6, A9, A10, A11, A12, A14, A15, A16, A17, A18, A19, A20, A21, A22, A23, B1, B2, B3, B4, B5, B6, B7, B8, B9, C1, C2, C3, C4, D1, D2, D3, D4, D5, E1, F1, F2, G1, H1, H2, H3, H4, H5, H6, J1, K1, K2, M1, M2 and N1, which are described as L1 or L2, have the following structures, respectively:




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image












TABLE 1





Compound No
L1
L2
S







1a
A1
A1


embedded image







1b
B1
B1


embedded image







1c
A2
A2


embedded image







1d
A2
C1


embedded image







1e
A2
D1


embedded image







1f
A2
B2


embedded image







1g
A2
A2


embedded image







1h
A1
B1


embedded image







1i
B1
B1


embedded image







1j
A1
A1


embedded image







1k
A1
A1


embedded image







1l
A1
A1


embedded image







1m
B2
A1


embedded image







1n
A1
B1


embedded image







1o
A1
B1


embedded image





















TABLE 2





Compound No
L1
L2
S







2a
A2
A2


embedded image







2b
B1
B1


embedded image







2c
A2
A1


embedded image







2d
A2
A1


embedded image







2e
A2
A1


embedded image







2f
A2
A1


embedded image







2g
A1
A2


embedded image







2h
A1
A2


embedded image







2i
A1
A2


embedded image







2j
A1
A2


embedded image





















TABLE 3





Compound No
L1
L2
S







3a
A1
A1


embedded image







3b
B1
B1


embedded image







3c
A1
A1


embedded image







3d
A1
A1


embedded image







3e
A1
A1


embedded image







3f
A1
A1


embedded image





















TABLE 4





Compound No
L1
L2
S







4a
A2
A2


embedded image







4b
A2
A2


embedded image







4c
A2
A1


embedded image







4d
A1
A1


embedded image







4e
A2
A1


embedded image







4f
A1
A1


embedded image





















TABLE 5





Compound No
L1
L2
S







5a
A1
A1


embedded image







5b
A1
A1


embedded image







5c
A1
A1


embedded image







5d
A1
A1


embedded image







5e
A1
A1


embedded image







5f
A1
A1


embedded image







5g
A1
A1


embedded image







5h
A1
A1


embedded image







5i
A1
A1


embedded image







5j
A1
A1


embedded image







5k
A1
A1


embedded image







5l
A1
A1


embedded image







5m
A1
A1


embedded image







5n
A1
A1


embedded image







5o
A1
A1


embedded image







5p
A1
A1


embedded image







5q
A1
A1


embedded image







5r
A1
A1


embedded image





















TABLE 6





Compound





No
L1
L2
S







6a
A1
A1


embedded image







6b
A1
A1


embedded image







6c
A1
A1


embedded image







6d
A1
A1


embedded image







6e
A1
A1


embedded image







6f
A1
A1


embedded image







6g
A1
A1


embedded image







6h
A1
A1


embedded image







6i
A2
A2


embedded image







6j
A2
A2


embedded image







6k
A1
A1


embedded image







6l
A1
A2


embedded image







6m
A1
A2


embedded image







6n
A2
A1


embedded image







6o
A1
A1


embedded image







6p
A1
A1


embedded image







6q
A1
A1


embedded image





















TABLE 7





Compound





No
L1
L2
S







7a
A1
A5


embedded image







7b
A6
A1


embedded image







7c
A5
A1


embedded image







7d
A6
A1


embedded image







7e
A6
A1


embedded image







7f
A5
A1


embedded image







7g
A1
A5


embedded image







7h
A5
A1


embedded image







7i
A6
A1


embedded image







7j
A5
A1


embedded image







7k
A6
A1


embedded image







7l
A6
A1


embedded image







7m
A6
A1


embedded image







7n
A6
A1


embedded image







7o
A5
A1


embedded image







7p
A5
A1


embedded image







7q
A5
A1


embedded image







7r
A6
A1


embedded image





















TABLE 8





Compound





No
L1
L2
S







8a
A5
A1


embedded image







8b
A5
A1


embedded image







8c
A5
A1


embedded image







8d
A6
A1


embedded image







8e
A6
A1


embedded image







8f
A6
A1


embedded image







8g
A1
A6


embedded image







8h
A6
A1


embedded image







8i
A6
A1


embedded image







8j
A5
A1


embedded image







8k
A6
A1


embedded image







8l
A6
A1


embedded image







8m
A5
A1


embedded image







8n
A6
A1


embedded image







8o
A6
A1


embedded image







8p
A5
A1


embedded image







8q
A6
A1


embedded image







8r
A1
A5


embedded image





















TABLE 9





Compound





No
L1
L2
S







9a
A6
A1


embedded image







9b
A6
A1


embedded image







9c
A6
A1


embedded image







9d
A5
A6


embedded image







9h
A5
A1


embedded image





















TABLE 10





Compound





No
L1
L2
S







10a
A9
A1


embedded image







10b
A10
A1


embedded image







10c
A9
A1


embedded image







10d
A10
A1


embedded image







10e
A10
A1


embedded image







10f
A11
A1


embedded image







10g
A12
A1


embedded image







10h
A12
A1


embedded image







10j
A1
A16


embedded image







10k
A15
A1


embedded image







10l
A14
A1


embedded image







10m
A1
A16


embedded image







10n
A16
A1


embedded image







10o
A16
A1


embedded image







10p
A17
A1


embedded image







10q
A18
A18


embedded image







10r
A18
A18


embedded image







10s
A19
A1


embedded image







10t
A20
A1


embedded image







10u
A21
A1


embedded image





















TABLE 11





Compound





No
L1
L2
S







12a
C2
A1


embedded image







12b
C2
A1


embedded image







12c
C2
A1


embedded image







12d
E1
A1


embedded image





















TABLE 12





Com-





pound





No
L1
L2
S







12e
E1
A1


embedded image







12f
E1
A1


embedded image







12g
E1
A1


embedded image







12h
E1
A1


embedded image







12i
E1
A1


embedded image







12j
E1
A1


embedded image





















TABLE 13





Compound





No
L1
L2
S







13a
B3
A1


embedded image







13b
B3
A1


embedded image







13c
B3
A1


embedded image







13d
B4
A1


embedded image







13e
B5
A1


embedded image







13f
B6
A1


embedded image







13g
B7
A1


embedded image







13h
B8
A1


embedded image







13i
B1
A1


embedded image







13j
B1
A1


embedded image





















TABLE 14





Compound





No
L1
L2
S







14a
B2
A1


embedded image







14b
B2
A1


embedded image







14c
A6
B2


embedded image







14d
B2
A1


embedded image







14e
B2
B2


embedded image







14f
A1
B2


embedded image







14g
B2
A1


embedded image







14h
B2
A1


embedded image







14i
A1
B2


embedded image







14j
A1
B2


embedded image







14k
B2
A1


embedded image







14l
B2
A1


embedded image







14m
B2
A1


embedded image







14n
B2
A1


embedded image







14o
B2
B2


embedded image







14p
B2
B1


embedded image







14q
A1
B2


embedded image







14r
B2
A1


embedded image







14s
B2
A1


embedded image







14t
B2
A2


embedded image





















TABLE 15





Compound





No
L1
L2
S







15a
D2
A1


embedded image







15b
D2
A1


embedded image







15c
D2
A1


embedded image







15d
D2
A1


embedded image







15e
D2
A1


embedded image







15f
D1
A1


embedded image







15g
D4
A1


embedded image







15h
A1
D1


embedded image







15i
D1
A2


embedded image







15j
F1
A1


embedded image







15k
F2
A1


embedded image





















TABLE 16





Compound





No
L1
L2
S







16a
G1
A1


embedded image







16b
G1
A1


embedded image







16c
C3
A1


embedded image







16d
C2
A1


embedded image







16e
G1
A1


embedded image







16f
A1
H2


embedded image







16g
A1
C4


embedded image







16h
A1
H1


embedded image







16i
A1
M1


embedded image







16j
A1
H4


embedded image







16k
A1
H5


embedded image







16l
A1
H5


embedded image







16m
A1
H3


embedded image







16n
H4
A1


embedded image







16o
A1
J1


embedded image







16p
A1
K2


embedded image





















TABLE 17





Compound





No
L1
L2
S







17a
A1
K1


embedded image







17b
A1
D5


embedded image







17c
A1
M2


embedded image







17d
H3
A1


embedded image







17e
A1
A15


embedded image







17g
A1
A16


embedded image







17h
A5
A16


embedded image







17i
C2
A1


embedded image







17j
A1
C2


embedded image







17k
C2
A1


embedded image







17l
C2
A1


embedded image







17m
A1
C2


embedded image







17n
A22
A1


embedded image







17o
A23
A1


embedded image







17p
N1
A1


embedded image











The BET degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof can be administered alone, but generally it is desirable to provide it as various pharmaceutical preparations. In addition, these pharmaceutical preparations are used for animals or humans, preferably humans.


The pharmaceutical preparation related to the present invention can contain as an active ingredient the BET degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof by itself, or as a mixture with any other active ingredients used for the treatment.


Furthermore, those pharmaceutical preparations are manufactured by a well-known method in the technical field of pharmaceutics by mixing the active ingredient with one kind or more pharmaceutically acceptable carriers (e.g., an attenuant, a solvent, a diluent and the like).


The most effective administration route is desirably used for the treatment. For example, it includes an oral or parental administration route such as intravenous injection and the like.


Administration forms include, for example, tablets, injection and the like.


Suitable formulation for the oral administration, for example, such as tablets, can be manufactured using a diluent such as lactose, a disintegrant such as starch, a lubricant such as magnesium stearate, a binder such as hydroxypropylcellulose, and the like.


Suitable formulation for the parenteral administration, for example, such as injection, can be manufactured using an attenuant such as a salt solution, glucose solution or mixed solution of saline and glucose solutions; a solvent or the like.


Dose and frequency of administration of the BET degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof differ depending on administration form, age of the patient, body weight or the nature of the symptoms to be treated or severity of them or the like. Generally, they are administered for oral administration at a dosage of 0.01 to 1000 mg per adult, preferably at a dosage of 0.05 to 100 mg once daily or several times a day. In the case of parenteral administrations such as intravenous administration, they are administered at a dosage of 0.001 to 1000 mg per adult, preferably at a dosage of 0.01 to 100 mg once daily or several times a day. However, the dose and frequency of the administration vary depending on the above-mentioned conditions.


According to another embodiment of the present invention, provided is a pharmaceutical composition containing the BET degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof, which pharmaceutical composition may contain a carrier. The pharmaceutical composition of the present invention is used in administration routes and dosage forms and the like similar to the pharmaceutical preparation mentioned above. Furthermore, the carrier that may be contained in the pharmaceutical composition of the present invention may be an attenuant, solvent, diluent, and the like that are similar to the case of the pharmaceutical preparation mentioned above. Furthermore, the pharmaceutical composition of the present invention is used preferably for degrading BET protein, or for the treatment or prevention of cancer, more preferably for the treatment or prevention of cancer. Here, prevention means that the clinical condition of a disease, the outcome of biological symptoms or the severity of the disease is substantially reduced, or that development of such condition or the biological symptoms is delayed, and the like. The situation is similar to the following prevention.


According to another embodiment of the present invention, there is provided a method for degrading BET (protein) (preferably a method for inducing BET (protein) degradation), including administering compound (I) or compound (I)-1 or a pharmaceutically acceptable salt thereof (preferably a prophylactically or therapeutically safe and effective amount of compound (I) or compound (I)-1 or a pharmaceutically acceptable salt thereof) to a subject (preferably a subject in need thereof). The subject includes an animal other than a human, but is preferably a human. This is also the same in the following subjects.


According to another embodiment of the present invention, there is provided a method for treatment or prevention, including administering the degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof (preferably a prophylactically or therapeutically safe and effective amount of the degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof) to a subject (preferably a subject in need thereof). The method for treatment or prevention of the present invention is preferably used for degrading BET protein or for the treatment or prevention of cancer, and more preferably for the treatment or prevention of cancer.


According to another embodiment of the present invention, there is provided the degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof for use as a medicament.


According to another embodiment of the present invention, there is provided the degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof for use for the degradation of BET protein (preferably for use for inducing degradation of BET protein), or for use in the treatment or prevention of cancer (preferably for use in the treatment or prevention of cancer).


According to another embodiment of the present invention, there is provided use of the degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof for the manufacture of a drug for degradation of BET protein (preferably for inducing degradation of BET protein), or for the treatment or prevention of cancer (preferably for the treatment or prevention of cancer).


According to another embodiment of the present invention, there is provided use of the degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof for the degradation of BET protein (preferably for inducing degradation of BET protein), or for the treatment or prevention of cancer (preferably for the treatment or prevention of cancer).


According to another embodiment of the present invention, there is provided a medicament containing as an active ingredient the degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof.


According to another embodiment of the present invention, there is provided a BET degrader or a prophylactic or therapeutic agent for cancer (preferably a prophylactic or therapeutic agent for cancer) containing as an active ingredient the degrader of the present invention or compound (I), compound (I)-1 or a pharmaceutically acceptable salt thereof.


EXAMPLES

The present invention will be explained by examples more specifically below, but the scope of the present invention is not limited to these examples.


Among compounds (I) and compounds (I)-1, the pharmacological action of typical compounds will be specifically described with reference to test examples.


Test Example 1
Inhibitory Effect on Cell Viability in SU-DHL-4 Cell Line

SU-DHL-4 cells (Code No. ACC 495, Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH; DSMZ) were cultured at 37° C. using a carbon dioxide incubator (95% air, 5% CO2) in RPMI1640 medium (Code No. 11875-093, Thermo Fisher Scientific) in which inactivated fetal bovine serum (FBS: Code No. 10099-148, Thermo Fisher Scientific) in an amount to give a final concentration of 10 vol % and penicillin/streptomycin solution (PS: Code No. 15140-122, Thermo Fisher Scientific) in an amount to give a final concentration of 1 vol % were added. The cells were passaged twice a week at a volume of 20-40 mL so as to maintain a cell concentration of 1×106 cells/mL or less.


The cultured SU-DHL-4 cells were seeded at 2000 cells/well in a transparent 384-well plate (Code No. 781182, Greiner bio-one). After seeding, the cells were precultured at 37° C. in a carbon dioxide gas incubator for 18 to 25 hours. Next, 1, 0.1 or 0.01 mmol/L DMSO solution of the test compound was prepared and a 9-step dilution series were prepared so that the concentration will be 200 times the final concentration in the RPMI1640 medium containing the above FBS and PS, and 1/200 volume of the dilution series were added to each well. At this time, the final concentration of DMSO was adjusted to be 0.1 vol %. After adding the test compound, the cells were cultured at 37° C. in a carbon dioxide gas incubator for 72 hours. Next, 0.020 mL of Cell Counting Kit-8 (Code No. CK04, DOJINDO) solution diluted 2-fold or 4-fold with phosphate buffered saline (PBS) was added to each well. Color reaction was carried out in a carbon dioxide gas incubator at 37° C. for 2 to 3 hours, and the absorbance at a wavelength of 450 nm was measured using SpectraMax 340PC (Molecular Devices). The inhibition rate of cell viability was calculated by the following formula, and the concentration of the test compound (IC90 value) showing a 90% inhibition rate of cell viability was calculated.





Inhibition rate of cell viability(%)=100−(A−B)/(C−B)×100

    • A: Absorbance of a well containing test compound
    • B: Absorbance of a well without addition of cells
    • C: Absorbance of a well without addition of test compound


The results are shown in Table 18.












TABLE 1








SU-DHL-4 Cell Viability Inhibition



Compound No.
Rate IC90 (nmol/L)



















 1a
5.21



 1b
1.78



 1c
7.85



 1d
38.0



 1e
39.8



 1f
4.78



 1g
10.6



 1h
0.27



 1i
0.54



 1j
33.1



 1k
0.55



 1l
0.04



 1m
0.53



 1n
0.49



 1o
3.18



 2a
2.12



 2b
1.52



 2c
29.1



 2d
26.6



 2e
16.3



 2f
0.23



 2g
0.63



 2h
0.03



 2i
1.84



 2j
0.36



 3a
0.04



 3b
0.18



 3c
0.11



 3d
0.11



 3e
0.12



 3f
0.33



 4a
0.45



 4b
5.87



 4c
4.03



 4d
13.0



 4e
0.34



 4f
1.19



 5a
2.15



 5b
39.56



 5c
63.60



 5d
0.67



 5e
5.93



 5f
24.73



 5g
2.53



 5h
0.12



 5i
4.49



 5j
0.08



 5k
7.48



 5l
36.95



 5m
0.59



 5n
8.83



 5o
0.14



 5p
2.68



 5q
0.11



 5r
1.78



 6a
0.89



 6b
0.10



 6c
0.83



 6d
5.08



 6e
4.31



 6f
0.11



 6g
0.31



 6h
0.003



 6i
0.11



 6j
0.13



 6k
0.15



 6l
0.35



 6m
0.12



 6n
0.13



 6o
0.14



 6p
41.54



 6q
0.45



 7a
10.83



 7b
1.51



 7c
7.00



 7d
25.87



 7e
20.42



 7f
3.20



 7g
7.56



 7h
5.47



 7i
0.33



 7j
63.96



 7k
0.62



 7l
0.28



 7m
20.30



 7n
13.86



 7o
1.15



 7p
0.79



 7q
0.24



 7r
0.38



 8a
0.87



 8b
13.90



 8c
0.26



 8d
0.14



 8e
0.20



 8f
1.14



 8g
0.01



 8h
1.14



 8i
2.69



 8j
0.50



 8k
0.26



 8l
0.04



 8m
0.11



 8n
1.17



 8o
0.49



 8p
14.99



 8q
19.01



 8r
0.47



 9a
1.68



 9b
3.18



 9c
12.36



 9d
0.93



 9h
7.16



10a
2.40



10b
0.60



10c
0.13



10d
3.42



10e
3.59



10f
0.92



10g
1.15



10h
0.35



10j
1.73



10k
0.93



10l
1.08



10m
30.87



10n
0.01



10o
1.48



10p
47.49



10q
9.88



10r
9.16



10s
21.69



10t
26.33



10u
15.92



12a
1.01



12b
4.35



12c
0.56



12d
34.92



12e
73.65



12f
0.42



12g
31.08



12h
3.92



12i
3.68



12j
17.40



13a
0.49



13b
3.50



13c
7.36



13d
1.19



13e
3.33



13f
11.62



13g
1.70



13h
0.34



13i
3.37



13j
0.31



14a
0.04



14b
0.12



14c
0.34



14d
0.16



14e
0.26



14f
0.31



14g
0.03



14h
0.34



14i
0.03



14j
0.74



14k
1.80



14l
0.60



14m
1.45



14n
0.05



14o
30.87



14p
1.27



14q
0.17



14r
1.47



14s
2.20



14t
1.17



15a
0.34



15b
1.07



15c
0.30



15d
0.16



15e
33.97



15f
0.04



15g
5.03



15h
2.32



15i
0.88



15j
0.52



15k
0.32



16a
11.14



16b
2.05



16c
0.28



16d
0.17



16e
5.97



16f
24.56



16g
14.93



16h
68.44



16i
7.84



16j
3.09



16k
0.90



16l
89.83



16m
1.85



16n
0.48



16o
80.35



16p
0.63



17a
0.16



17b
1.74



17c
2.05



17d
0.13



17e
1.82



17g
32.68



17h
0.20



17i
1.45



17j
28.98



17k
43.66



17l
1.89



17m
74.08



17n
5.14



17o
2.18



17p
0.35



Comparative
2557.75



Compound 1



Comparative
>10000



Compound 2










As described above, compound (I) and compound (I)-1 of the present invention represented by the test compound showed a strong inhibitory effect on cell viability in SU-DHL-4 cells. In addition, the inhibition rate was far stronger than that of the known comparative compounds 1 and 2. Therefore, compound (I) and compound (I)-1 of the present invention were found to be useful for preventing or treating cancer.


The comparative compound 1 is described as example 14 (2,2′-((4S,4'S)-6,6′-((butane-1,4-diylbis(sulfanediyl))bis(4,1-phenylene))bis(8-methoxy-1-methyl-4H-benzo[f][1,2,4]triazolo[4,3-a][1,4]diazepine-6,4-diyl))bis(N-ethylacetamide)) (corresponding to the compound represented by formula (P3) (compound P3)) in Patent Document 2 (WO 2015/081284). The comparative compound 2 is a compound described as MT1 (corresponding to the compound represented by formula (P5)) in Patent Document 3 (WO 2017/091673). The comparative compounds were synthesized according to the methods described in Patent Documents 2 and 3, respectively, and used in this test.


Test Example 2

Suppressive Effect on MYC mRNA Expression


SU-DHL-4 cells were cultured at 37° C. using a carbon dioxide gas incubator (95% air, 5% CO2) in RPMI1640 medium in which FBS in an amount to give a final concentration of 10 vol % and PS in an amount to give a final concentration of 1 vol % were added. The cells were passaged twice a week at a volume of 20-40 mL so as to maintain a cell concentration of 1×106 cells/mL or less.


The cultured SU-DHL-4 cells were seeded at 6×105 cells/well in a transparent 6-well plate (Code No. 140675, Thermo Fisher Scientific). After seeding, the cells were precultured at 37° C. in a carbon dioxide gas incubator for 18 to 25 hours. Next, a 0.1 mmol/L DMSO solution of the test compound was prepared, diluted so that the concentration will be 200 times the final concentration in the RPMI1640 medium containing the above FBS and PS, and 1/200 volume of the diluted solution was added to each well. At this time, the final concentration of DMSO was adjusted to be 0.1 vol %. After adding the test compound, the cells were cultured at 37° C. in a carbon dioxide gas incubator for 6 hours.


Then, the cells were collected by centrifugation and used for extraction of mRNA. mRNA extraction from cells was performed using Maxwell® 16 LEV simplyRNA Purification Kits (Code No. AS1270, Promega). The mRNA recovery protocol was performed according to the manufacturer's recommended protocol attached to the kit.


0.001 mg of the recovered mRNA was converted to cDNA by SuperScript IV VILO Master Mix with ezDNase Enzyme (Code No. 11766050, Thermo Fisher Scientific). The cDNA conversion was performed, according to the manufacturer's recommended protocol attached to the kit, in 0.020 mL of the reaction solution, and GeneAmp® PCR System 9700 (Applied Biosystems) was used. The cDNA-converted sample was diluted 10-fold by adding 0.180 mL of RNase Free Water (Code No. 10977-023, Thermo Fisher Scientific) and used for quantitative real-time polymerase chain reaction (qRT-PCR). For the calibration curve of qRT-PCR, 0.08 mL of RNase Free Water was added to a cDNA sample using DMSO as a test compound for 5-fold dilution. Further, two 5-fold dilutions were prepared stepwise, and these three samples were used as the calibration curve samples.


The following reagents were used for qRT-PCR: TaqMan Gene Expression Assays, Inventoried (Primer probe: Code No. 4331182, Thermo Fisher Scientific, Assay ID: (i) MYC: Hs00153408_m1, (ii) ACTB: Hs01060665_g1, (iii) GAPDH: Hs04420697_g1, (iv) HPRT1: Hs02800695_m1); 2X TaqManR Fast Universal PCR Master Mix, no AmpEraseR UNG (Master Mix: Code No. 4367846, Thermo Fisher Scientific).


Primer probe (0.001 mL), Master Mix (0.010 mL), water (0.004 mL) and the diluted cDNA sample (0.005 mL) were mixed, and qRT-PCR analysis was performed. For qRT-PCR analysis, QuantStudio 7 Flex (Thermo Fisher Scientific) or 7500 Fast Real-Time PCR (Applied Biosystems) was used to measure in Fast mode and analyze. The expression level of the MYC gene was determined by quantifying ACTB, GAPDH, and HPRT1 as housekeeping genes and correcting by the following formula to calculate the suppression rate of (%) of MYC mRNA expression when the test compound was allowed to act at a concentration of 100 nmol/L.


Corrected MYC expression=A/B

    • A: MYC expression level
    • B: Geometric mean of expression levels of ACTB, GAPDH and HPRT1


Using the corrected values, the suppression rate of MYC expression for the wells to which the test compound was not added was calculated by the following formula.


Suppression rate of MYC expression (%)=100-C/D x 100

    • C: Corrected MYC expression level in a well containing test compound
    • D: Corrected MYC expression level in a well to which test compound was not added


The results are shown in Table 19.












TABLE 1








Suppression Rate of



Compound No.
MYC mRNA Expression (%)



















 1a
96.7



 1b
98.4



 1c
97.3



 1k
98.6



 1l
98.5



 2d
80.0



 2f
98.6



 2h
98.2



 3a
98.1



 3e
98.3



 4a
98.4



 4d
98.3



 4e
98.4



 5d
97.5



 5h
97.3



 5j
96.8



 5q
97.2



 5r
96.7



 6h
97.2



 6k
97.0



 6m
97.0



 7h
97.5



 7o
97.4



 7p
97.9



 7q
97.4



 8g
96.6



 8j
97.2



 8r
96.7



 9d
98.0



10b
96.6



10g
97.2



10k
97.0



12a
98.5



12b
97.8



12c
97.8



12f
97.9



12h
96.5



13a
97.6



13d
97.2



13h
97.4



14a
97.1



14d
97.4



14e
96.7



14f
97.3



14p
97.6



15a
97.6



15d
96.9



15f
97.2



15k
97.4



16j
92.4



16m
97.1



16o
79.1



16p
96.2



17a
96.2



17o
97.1



Comparative
61.7



Compound 1



Comparative
57.7



Compound 2










As described above, compound (I) and compound (I)-1 of the present invention represented by the test compound strongly suppressed the expression of MYC mRNA. Further, the suppression rate was far stronger than that of the known comparative compounds 1 and 2. Therefore, the compound (I) and compound (I)-1 of the present invention were found to be useful for preventing or treating cancer.


Comparative compound 1 is a compound described as example 14 in Patent Document 2 (WO 2015/081284), and comparative compound 2 is a compound described as MT1 in Patent Document 3 (WO 2017/091673). Each of comparative compounds was synthesized according to the method described in Patent Document 2 or 3, and used in this test.


Test Example 3

Antitumor effect on subcutaneous transplant model in SCID mouse DLBCL strain SU-DHL-4


1×10′ cells of DLBCL strain SU-DHL-4 (Code No. ACC 495, Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH) suspended in a 1:1 mixed solution of PBS and matrigel (CORNING Code No. 354234) were transplanted subcutaneously to the ventral side of a male SCID mouse. Eighteen days after the transplantation, the body weight and the tumor diameter were measured, the tumor volume was calculated by the following formula, and the mice were divided into two groups (n=5) so that the average tumor volume of each group was equal.





[Tumor volume (mm3)]=[Tumor long diameter (mm)]×[Tumor short diameter (mm)]2×0.5


The test was conducted in two groups, a vehicle administration group and a compound 1a administration group (compound administration group). To the compound 1a administration group, a solution of compound 1a dissolved in 30% DMSO/3% Tween 80/physiological saline so as to give a final concentration of 0.6 mg/mL was administered intravenously (tail vein) at 5 mL/kg (3 mg/kg) 5 times a week for 2 weeks. To the vehicle administration group, 30% DMSO/3% Tween 80/physiological saline was administered intravenously (tail vein) at 5 mL/kg on the same schedule as the compound 1a administration group. After the start of the test, body weight and tumor diameter were measured twice a week. The tumor volume on each measurement day was calculated by the above formula. The tumor growth rate (hereinafter referred to as V/VO) was calculated by dividing the tumor volume V on each measurement day by the tumor volume VO on the test start day (Day 0). The T/C was calculated by dividing the average value (T) of V/VO of each group by the average value (C) of the vehicle administration group.


The results are shown in Table 20 below (mean values of n=5 are shown).












TABLE 20









Tumor Volume (mm3)
V/V0












Vehicle
Compound
Vehicle
Compound



Adminis-
Adminis-
Adminis-
Adminis-


Measurement
tration
tration
tration
tration


Day
Group
Group
Group
Group





Day 0
245.49
246.14
1.00
1.00


Day 3
396.59
284.29
1.62
1.15


Day 7
654.80
326.25
2.68
1.29


Day 10
923.83
214.74
3.80
0.85


Day 14
1288.10
224.55
5.30
0.89


Day 18
1951.98
325.61
8.00
1.30













T/C
Body Weight (g)












Vehicle
Compound
Vehicle
Compound



Adminis-
Adminis-
Adminis-
Adminis-


Measurement
tration
tration
tration
tration


Day
Group
Group
Group
Group





Day 0
1.00
1.00
24.14
24.56


Day 3
1.00
0.71
23.87
25.36


Day 7
1.00
0.48
23.98
25.44


Day 10
1.00
0.22
23.66
25.14


Day 14
1.00
0.17
23.71
25.74


Day 18
1.00
0.16
23.53
26.23









As described above, the tumor volume, tumor growth rate and T/C of the compound 1a administration group were smaller than those of the vehicle administration group. On the other hand, no weight loss was observed by the compound 1a administration group. That is, compound 1a showed a potent antitumor effect on SU-DHL-4 subcutaneously transplanted tumor. Therefore, the compound (I) and compound (I)-1 of the present invention represented by the test compound were found to be useful as a therapeutic drug for cancer.


Test Example 4
Evaluation of BET Proteolysis in SU-DHL-4 Cell Line by Western Blotting (WB)

(1) Reagents and media


The human DLBCL cell line SU-DHL-4 was purchased from DSMZ. SU-DHL-4 was passaged using RPMI1640 medium containing 10 vol % FBS. The culture conditions were 37° C. and 5% CO2.


(2) The following antibodies were used for protein detection.


Primary Antibody

Anti-BRD4 antibody: BRD4 (E2A7X) Rabbit mAb (Cell Signaling Technology, Cat No. #13440S)


Anti-BRD2 antibody: Brd2 (D8964) Rabbit mAb (Cell Signaling Technology, Cat No. #5848S)


Anti-BRD3 antibody: Anti-BRD3 antibody (2088C3a) (Santa Cruz Biotechnology, Cat No. sc-81202)


Anti-beta actin antibody: Monoclonal Anti-(3 Actin antibody produced in mouse (SIGMA, Cat No. A5441) Secondary antibody


Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (GE Healthcare, Cat No. NA931-1ML)


Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (GE Healthcare, Cat No. NA934-1ML)

    • (3) Evaluation of BET protein


Changes in the amount of BRD4, BRD2 and BRD3 proteins in the SU-DHL-4 cell line by the test compound (compound 1b, compound 1l or compound P3) were detected by WB. The compound P3 is a compound described as example 14 in the known Patent Document 2 (WO 2015/081284), which was synthesized according to the method described in Patent Document 2 and used in this test.


The cultured SU-DHL-4 cells were seeded at 6×105 cells/well in a transparent 6-well plate (Code No. 140675, Thermo Fisher Scientific). After seeding, the cells were pre-cultured at 37° C. in a carbon dioxide gas incubator for 18 to 25 hours. Next, a 0.1 mmol/L DMSO solution of the test compound was prepared, diluted so that the concentration was 200-fold of the final concentration in RPMI1640 medium containing the above FBS and PS, and 1/200 volume of the diluted solution was added to each well. At this time, the final concentration of DMSO was adjusted to be 0.1 vol %. After adding the test compound, the cells were cultured at 37° C. in a carbon dioxide gas incubator for 24 hours.


After collecting the cells, the supernatant was aspirated, and Lysis buffer 6 (R&D systems, Cat No. 895561) was added to the pellet at 0.1 mL/sample. After incubating on ice for 60 minutes, the supernatant was collected by centrifugation at 15000 rpm for 10 minutes at 4° C.


Using Pierce BCA Protein Assay Kit (Thermo Fisher, Cat No. 23225), the protein concentration of each sample was quantified according to the manual attached to the kit, and then was diluted and prepared with Lane Marker Reducing Sample Buffer (5×) (Thermo Fisher, Cat No. 39000) and Lysis buffer 6 to 1 mg/mL. The cells were incubated at 95° C. for 5 minutes to prepare WB samples. WB samples were stored at −30° C. until electrophoresis.


The WB sample was thawed and used after vortex mixing and spin down. As a gel for electrophoresis, SuperSep Ace, 5-20% 17 well (Wako, Cat No. 194-15021) was used. Samples were added at 0.010 mL/well (protein content 0.01 mg/well) and proteins were separated by SDS-PAGE.


Proteins were transferred from the electrophoresed gel to an Immobilon-P Transfer membrane (Merck Millipore, Cat No. IPVH304F0) using a semi-dry transfer device (ATTO, Cat No. WSE-4020) (100 mA/gel, 60 minutes).


The transfer membrane was soaked for blocking in 1× TBS TweenTM-20 (TBS-T, Thermo Scientific, Cat No. 28360) containing 5 w/v % skim milk (nakarai, Cat No. 31149-75) (hereinafter, referred to as 5% skim milk-TBS-T) for 1 hour.


As a primary antibody reaction, BRD4 and BRD2 antibodies were diluted 1000-fold with 5% skim milk-TBS-T and reacted overnight at 4° C. Beta actin antibody was diluted 2000-fold with 5% skim milk-TBS-T and reacted overnight at 4° C. BRD3 antibody was diluted 200-fold with Can Get Signal Solution 1 (TOYOBO, Cat No. NKB-201) and reacted at 4° C. overnight.


As a secondary antibody reaction for BRD4 and BRD2 antibodies, Anti-Rabbit IgG and HRP-Linked Whole Ab Donkey antibodies were diluted 5000-fold with 5% skim milk-TBS-T and reacted for 1 hour. As a secondary antibody reaction for BRD3 and beta actin antibodies, Anti-Mouse IgG, HRP-Linked Whole Ab Sheep antibodies were diluted 5000-fold with 5% skim milk-TBS-T and reacted for 1 hour.


As a luminescent agent, SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher, Cat No. #34096) was used to detect BRD4, BRD2 and BRD3, and SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher, Cat No. #34080) was used to detect beta actin, and the detection was performed using Amersham imager 600 imagers (AI600, GE Healthcare Life Sciences). The results are shown in FIG. 1.


As shown in FIG. 1, in the group to which compound 1b or compound 1l was added, the band became faint compared with that of control, and thus the compound of the present invention represented by the test compound was shown to induce degradation of BET proteins such as BRD2, BRD3 and BRD4 and the like. On the other hand, in the group to which compound P3 was added, the band was not faint compared with that of control, and known divalent BET inhibitors represented by compound P3 was shown not to degrade


BET proteins such as BRD2, BRD3 and BRD4 and the like.


Test Example 5

Evaluation of Inhibition of BRD2, BRD3 and BRD4 Degradation by Ubiquitination Pathway Inhibitors (MLN-4924)


SU-DHL-4 cells were cultured in the same manner as in test example 4 and seeded in a 6-well plate, and MLN-4924 (Funakoshi Co., Ltd., Cat No. 15217) and the test compound (Compound 1b or Compound 1l) was diluted to 200-fold of the final concentration and 1/200 volume of the diluted solution was added to each well. MLN-4924 was added 1 hour before the addition of the test compound. At this time, the final concentration of DMSO was adjusted to be 0.1 vol %. After adding the test compound, the cells were cultured in a carbon dioxide gas incubator at 37° C. for 16 hours. After collecting the cells, changes in the amount of BRD4, BRD2 and BRD3 proteins were detected by WB in the same manner as in test example 4. The results are shown in FIG. 2.


As shown in FIG. 2, in the group to which MLN-4924 was added, the band became stronger, and thus the degradation of BET proteins such as BRD2, BRD3 and BRD4 by the compound of the present invention represented by the test compound was shown to be attenuated by the ubiquitin pathway inhibitor. That is, it was found that the degrading action of BET proteins such as BRD2, BRD3 and BRD4 by the compound of the present invention depends on the ubiquitin pathway.


Test Example 6
Inhibitory Effect on Cell Viability Using SU-DHL-4 DCAF16 Knock Out (KO) Cell Line

(1) Reagents and media


The human DLBCL cell line SU-DHL-4 was purchased from DSMZ. SU-DHL-4 was passaged using RPMI1640 medium containing 10 vol % FBS. After the Cas9 gene was introduced, the cells were cultured in the above medium containing 0.01 mg/mL blasticidin (InvivoGen, Cat No. ant-bl-1). After introduction of sgRNA, the cells were cultured in the above medium containing 0.0001 mg/mL puromycin dihydrochloride (SIGMA, Cat No. P9020-10 ML). The culture conditions were 37° C. and 5% CO2.


(2) Lentivirus

Edit-R Lentiviral hEF1α-Blast-Cas9 Nuclease Particles (Cat No. VCAS10126) was used as a lentivirus for expressing Cas9 in human cell lines. Three types of Edit-R Human DCAF16 Lentiviral sgRNA (Cat No. VSGH10142-246568260; DNA target sequence CGCCTCTTGAGAGTCTTGCC (SEQ ID NO: 1), Cat No. VSGH10142-246568262; DNA target sequence GTTGTATCATGCTAAACTGT (SEQ ID NO: 2) and Cat No. VSGH10142-246568263; DNA target sequence AGAGATCATGCCACTCTAAA (SEQ ID NO: 3)) were used as lentiviruses for introducing DCAF16 sgRNA. As a control, Edit-R Lentiviral sgRNA Non-targeting Control #1 (Cat No. VSGC10215) was used. All lentiviruses were purchased from Dharmacon and stored at −80° C. until use.


(3) The following antibodies were used to detect DCAF16.


(i) Primary antibody: Anti-DCAF16 antibody (in-house monoclonal antibody produced by immunizing mice with DCAF16 full-length protein denatured by SDS and heat)


(ii) Secondary antibody: Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (GE Healthcare, Cat No. NA931-1ML)


(4) The following antibodies were used to detect beta actin.


(i) Primary antibody: Monoclonal Anti-8 Actin antibody produced in mouse (SIGMA, Cat No. A5441)


(ii) Secondary antibody: Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (GE Healthcare, Cat No. NA931-1ML)


(5) Introduction of Cas9 gene


SU-DHL-4 was suspended at 4×105 cells/mL in RPMI 1640 without FBS, 0.25 mL of the suspension was added to a 24-well plate, and the cells were cultured overnight. The next day, 0.003 mL of virus particles of Edit-R Lentiviral hEF1α-Blast-Cas9 Nuclease Particles was added. After culturing in a CO2 incubator for 4 hours, RPMI 1640 containing 0.75 mL of 10 vol % FBS was added. After culturing in a CO2 incubator for about 48 hours, the medium was replaced with RPMI1640 containing 10 vol % FBS, and the cells were cultured in a CO2 incubator. Four days after infection, the medium was replaced with a medium containing 0.01 mg/mL blasticidin (InvivoGen, Cat No. ant-bl-1). Then, the cells were passaged once every 2 to 3 days and thus twice in total (that is, cultured for 1 week) to obtain SU-DHL-4/Cas9, which is a Cas9-introduced SU-DHL-4 cell line.


(6) sgRNA infection SU-DHL-4/Cas9 was suspended at 4×105 cells/mL in RPMI 1640 without FBS, 0.25 mL of the suspension was added to a 24-well plate, and the cells were cultured overnight. The next day, a total of 4 types of sgRNA virus particles, 1 type of Control and 3 types targeting DCAF16 were added to the respective wells by 0.03 mL. After culturing in a CO2 incubator for 5 hours, RPMI 1640 containing 0.75 mL of 10 vol % FBS was added.


After culturing in a CO2 incubator for about 48 hours, the medium was replaced with RPMI1640 containing 10 vol % FBS, and the cells were cultured in a CO2 incubator. Four days after infection, the medium was replaced with a medium supplemented with 0.01 mg/mL puromycin dihydrochloride (SIGMA, Cat No. P9020-10 ML). Then, the cells were passaged once or twice a week for 2 weeks, and a cell stock was prepared using CELLBANKER I plus (Takara Bio, Cat No. CB-021). Cell line stock was stored at −80° C. Using Edit-R Lentiviral sgRNA Non-targeting Control #1, the Negative Control sequence was introduced into the SU-DHL-4 cell line, which was referred to as SU-DHL-4 NC strain, and using Edit-R Human DCAF16 Lentiviral sgRNA, CGCCTCTTGAGAGTCTTGCC sequence (SEQ ID NO: 1) was introduced into the SU-DHL-4 cell line, which was referred to as SU-DHL-4 DCAF16 KO1 strain, GTTGTATCATGCTAAACTGT sequence (SEQ ID NO: 2) was introduced into the SU-DHL-4 cell line, which was referred to as SU-DHL-4 DCAF16 KO2 strain, and AGAGATCATGCCACTCTAAA sequence (SEQ ID NO: 3) was introduced into the SU-DHL-4 cell line, which was referred to as SU-DHL-4 DCAF16 KO 3 strain.


(7) Confirmation of DCAF16 KO

The DCAF16 protein and beta actin protein of the cells obtained by the above method were detected by Western blotting (WB).


The cells were seeded at 6×105 cells/well in each well on a 6-well plate and incubated for 24 hours. After collecting the cells, the supernatant was aspirated, and 0.1 mL/sample of Lysis buffer 6 (R&D systems, Cat No. 895561) was added to the pellet. After incubating on ice for 60 minutes, the supernatant was collected by centrifugation at 15000 rpm for 10 minutes at 4° C.


Using Pierce BCA Protein Assay Kit (Thermo Fisher, Cat No. 23225), the protein concentration of each sample was quantified according to the manual attached to the kit, and then was diluted and prepared with Lane Marker Reducing Sample Buffer (5×) (Thermo Fisher, Cat No. 39000) and Lysis buffer 6 to 1 mg/mL. The cells were incubated at 95° C. for 5 minutes to prepare WB samples. WB samples were stored at −30° C. until electrophoresis.


The WB sample was thawed and used after vortex mixing and spin down. As a gel for electrophoresis, SuperSep Ace, 5-20% 17 well (Wako, Cat No. 194-15021) was used. Samples were added at 0.010 mL/well (protein content 0.01 mg/well) and proteins were separated by SDS-PAGE.


Proteins were transferred from the electrophoresed gel to an Immobilon-P Transfer membrane (Merck Millipore, Cat No. IPVH304F0) using a semi-dry transfer device (ATTO, Cat No. WSE-4020) (100 mA/gel, 60 minutes).


The transfer membrane was soaked for blocking for 1 hour in PVDF Blocking Reagent for Can Get signal (TOYOBO, Cat No. NYPBRO1) when detecting DCAF16, and in 1× TBS TweenTM-20 (TBS-T, Thermo Scientific, Cat No. 28360) containing 5 w/v % skim milk (nakarai, Cat No. 31149-75) (hereinafter, referred to as 5% skim milk-TBS-T) when detecting beta actin.


As a primary antibody reaction, the DCAF16 antibody was diluted 30-fold with Can Get Signal Solution 1 (TOYOBO, Cat No. NKB-201) and reacted at 4° C. overnight. Subsequently, beta actin antibody was diluted 2000-fold with 5% skim milk-TBS-T and reacted overnight at 4° C.


As a secondary antibody reaction for DCAF16 antibody, Anti-Mouse IgG, HRP-Linked Whole Ab Sheep antibody was diluted 5000-fold with Can Get Signal Solution 2 (TOYOBO, Cat No. NKB-301) and reacted for 1 hour. As a secondary antibody reaction for beta actin antibody, Anti-Mouse IgG, HRP-Linked Whole Ab Sheep antibody was diluted 5000-fold with 5% skim milk-TBS-T and reacted for 1 hour.


Detection was performed using Amersham imager 600 imagers (AI600, GE Healthcare Life Sciences), and luminescent reagents of Supersignal West Femto Maximum Sensitivity Substrate (Thermo Fisher, Cat No. #34096) for detection of DCAF16, and SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher, Cat No. #34080) for detection of beta actin.


DCAF16 and beta actin protein were detected by WB in cell strains (SU-DHL-4 DCAF16 KO1, 2, 3) into which three types of sgRNA targeting DCAF16 genes were introduced and cell strains (SU-DHL-4 NC) into which control sgRNA was introduced. As a result, the DCAF16 band was detected in the parent strain of SU-DHL-4 and the SU-DHL-4 NC strain, but not detected in DCAF16 KO1, DCAF16 KO2 and DCAF16 KO3. Therefore, it was concluded that the DCAF16 gene was knocked out (KO) in DCAF16 KO1, DCAF16 KO2 and DCAF16 K03.


(8) Inhibitory effect on cell viability of DCAF16 KO Cell


The cultured DCAF16 KO SU-DHL-4 cells were seeded at 2000 cells/well in a transparent 384-well plate (Code No. 781182, Greiner bio-one). After seeding, the cells were pre-cultured at 37° C. in a carbon dioxide gas incubator for 18 to 25 hours. Next, a 1, 0.1 or 0.01 mmol/L DMSO solution of the test compound was prepared, and a 9-step dilution series were prepared so that the concentration was 200-fold of the final concentration in the RPMI1640 medium containing the above FBS and PS, and 1/200 volume of the dilution series were added to each well. At this time, the final concentration of DMSO was adjusted to be 0.1 vol %. After adding the test compound, the cells were cultured at 37° C. in a carbon dioxide gas incubator for 72 hours. Next, 0.020 mL of Cell Counting Kit-8 (Code No. CK04, DOJINDO) solution diluted 2- or 4-fold with phosphate buffered saline (PBS) was added to each well. Color reaction was carried out in a carbon dioxide gas incubator at 37° C. for 2 to 3 hours, and the absorbance at a wavelength of 450 nm was measured using SpectraMax 340PC (Molecular Devices).


The inhibition rate of cell viability was calculated by the following formula, and the concentration of the test compound (SU-DHL-4 DCAF16 KO IC50) showing a 50% inhibition rate of cell viability was calculated.





Inhibition rate of cell viability(%)=100−(A−B)/(C−B)×100

    • A: Absorbance of a well containing test compound
    • B: Absorbance of a well without addition of cells
    • C: Absorbance of a well without addition of test compound


Next, using the measurement results of test example 1, the concentration of the test compound (SU-DHL-4 WT IC50) showing 50% inhibition rate of cell viability was calculated by the same method.


Using these, the activity attenuation ratio (ratio of SU-DHL-4 DCAF16 KO IC50 to SU-DHL-4 WT IC50) for inhibitory activity of cell viability by DCAF16 KO in SU-DHL-4 was calculated by the following formula. The results are shown in Table 21 below.





Activity attenuation ratio=(SU-DHL-4 DCAF16 KO IC50)/(SU-DHL-4 WT IC50)












TABLE 21








Activity


Compound
SU-DHL-4 DCAF16 KO
SU-DHL-4 WT
Attenuation


No.
IC50 (nmol/L)
IC50 (nmol/L)
Ratio


















 1a
68.70
1.13
61


 1b
36.70
0.65
56


 1c
384.93
2.93
131


 1k
7.42
0.22
34


 1l
100.71
0.03
3357


 2f
99.98
0.09
1111


 2h
12.23
0.03
408


 3a
6.58
0.025
263


 3e
951.47
0.10
9515


 4a
75.84
0.21
361


 4d
1526.03
4.18
365


 4e
75.00
0.30
250


 5d
166.93
0.31
546


 5h
58.39
0.06
942


 5j
37.29
0.04
941


 5q
621.66
0.09
7078


 5r
15.73
0.53
30


 6h
6.8
0.003
2250


 6k
31.17
0.06
520


 6m
90.32
0.08
1164


 6r
74.42
0.45
164


 7o
397
0.53
750


 7p
293
0.38
766


 7q
79.74
0.09
850


 8g
26.00
0.008
3174


 8j
228.23
0.29
767


 8r
67.37
0.30
224


 9d
262.55
0.75
348


10b
180.44
0.34
524


10g
141.87
0.91
154


10k
143.34
0.21
672


12a
354.14
0.51
693


12b
>10000
2.83
>3526


12c
>10000
0.22
>44436


12f
>10000
0.24
>40284


12h
595
3.11
191


13a
9.31
0.26
35


13d
27.76
0.53
52


13h
22.83
0.30
76


14a
4.00
0.017
228


14d
9.61
0.10
96


14e
68.32
0.21
332


14f
2.95
0.14
22


14p
407
1.00
408


15a
63.03
0.28
225


15d
858.20
0.11
7994


15f
28.31
0.03
902


16j
106.01
0.50
213


16m
208.31
0.62
338


16o
2396.16
24.84
96


16p
925.34
0.27
3390


17a
181.92
0.10
1895


17o
522.29
0.78
670


Comparative
49.24
220.84
0.23


Compound 1


Comparative
75.67
234.72
0.32


Compound 2









As described above, the inhibitory action of cell viability by the compound of the present invention represented by the test compound in wild-type DCAF16 cells was 22 to 44436 times more potent than that in DCAF16 KO cells. That is, it was found that the inhibitory action of cell viability by the compound of the present invention potently depends on DCAF16. Comparative compound 1 is a compound described as example 14 in Patent Document 2 (WO 2015/081284), and comparative compound 2 is a compound described as MT1 in Patent Document 3 (WO 2017/091673). Each of the comparative compounds was synthesized according to the method described in Patent Document 2 or 3, and used in this test.


Test Example 7
Verification of BET-DCAF16 Interaction

HEK293 cells (ATCC® CRL-1573™) were cultured using a carbon dioxide gas incubator (95% air, 5% CO2) at 37° C. in DMEM, High Glucose, Pyruvate (DMEM: Code No. 11995073, Thermo Fisher Scientific) in which inactivated fetal bovine serum (FBS: Code No. 10099-148 (Thermo Fisher Scientific) was added in an amount to give a final concentration of 10 vol %. A Falcon® 100 mm×20 mm cell culture dish (Code No. 353003, CORNING) was used for cell culture.


A sequence encoding BRD2 was cleaved from pFN21AB3863 (Code No. FHC01342, Kazusa Genome Technologies) using Flexi Enzyme Blend (SgfI and PmeI) (Code No. R1852, Promega) and recombined with pFN31A Nluc CMV-Hygro Flexi® Vector (Code No. N131A, Promega) similarly cleaved using Flexi Enzyme Blend (SgfI and PmeI) to prepare a plasmid pFN31A_BRD2 expressing BRD2 with an Nluc tag added to the N-terminal. A sequence encoding DCAF16 having sgfI and pmeI restriction enzyme sites at both ends was amplified and purified by polymerase chain reaction using two primers, AAAGCGATCGCCATGGGTCCTAGAAATCCC (SEQ ID NO: 4) and AAAGTTAAACCAGTGATGCAGTTAGGAG (SEQ ID NO: 5) from cDNA derived from HEK293 cells. Cleavage was performed using Flexi Enzyme Blend (SgfI and PmeI), and pFC27K HaloTag® CMV-neo Flexi® Vector (Code No. G8431, Promega) cleaved using Carboxy Flexi Enzyme Blend (Sgf I and EcoICR I) (Code No. R1901, Promega) was recombined to prepare a plasmid pFC27K_DCAF16 expressing DCAF16 with HaloTag added to the C-terminal. Sequencing was performed and confirmed that the sequence encoding DCAF16 matched NM_001345880.


Cultured HEK293 cells were washed with DPBS, no calcium, no magnesium (DPBS: Code No. 14190144, Thermo Fisher Scientific) and harvested using TrypLE™ Express Enzyme (1×), phenol red (TrypLE: Code No. 12605036, Thermo Fisher Scientific), and prepared to be 4.0×105 cells/mL in DMEM. A volume of 12 mL of the cell suspension was seeded in a Falcon® 100 mm×20 mm cell culture dish and cultured in a carbon dioxide gas incubator at 37° C. for 6 hours. For one dish, 12 μg of pFC27K_DCAF16, 0.12 μg of p FN31A_BRD2, 48 μL of FuGENE® HD Transfection Reagent (Code No. E2312, Promega) were added to 600 μL of Opti-MEM™ I Reduced Serum Medium, no phenol red (Opti-MEM: Code No. 11058021, Thermo Fisher Scientific) and mixed. The mixture was allowed to stand for 15 minutes and added to HEK293 cells. After 20 hours, the cells were washed with DPBS, no calcium, no magnesium, harvested from the dish using TrypLE, and then neutralized in DMEM. After centrifugation, the supernatant was discarded, and the cells were prepared to be 2.2×105 cells/mL using Opti-MEM containing 4% FBS. HaloTag® NanoBRET™ 618 Ligand contained in NanoBRET™ Nano-Glo® Detection System (Code No. N1662, Promega) and bortezomib as a proteasome inhibitor were added to be a 1000-fold dilution. In addition, a group was prepared to which DMSO was added instead of HaloTag® NanoBRET™ 618 Ligand. 90 μL of the cell suspension was seeded in CulturPlate-96 (Code No. 6005688, PerkinElmer), and allowed to stand in a carbon dioxide gas incubator at 37° C. for 30 minutes. A volume of 10 mmol/L of a solution of the test compound in DMSO was adjusted to be 100 μmol/L with Opti-MEM, 10 μL of the solution was added to each well, and then the mixture was allowed to stand in a carbon dioxide gas incubator at 37° C. for 2 hours. At this time, all the groups were prepared so that the final concentration of DMSO was 0.1 vol % including the group to which the test compound was not added. NanoBRET™ Nano-Glo® Substrate included in the NanoBRET™ Nano-Glo® Detection System was diluted 100-fold with Opti-MEM. After adding 25 μL of the dilution each and stirring for 30 seconds, measurement was performed with an Emission Filter of 460 nm and 620 nm using EnVision (PerkinElmer). The BRET ratio of 10 μmol/L for each test compound was calculated using the following formula. The experiment was performed by n=3 and the average value was calculated.





BRET ratio={(A/B)−(C/D)}×1000

    • A: value at 620 nm filter of the well with addition of test compound and 618 Ligand
    • B: value at 460 nm filter of the well with addition of test compound and 618 Ligand
    • C: value at 620 nm filter of the well without addition of test compound or 618 Ligand
    • D: value at 460 nm filter of the well without addition of test compound or 618 Ligand


The results are shown in Table 22 below.












TABLE 22







Compound No.
BRET Ratio



















DMSO
1.51



 1h
6.84



 1l
8.03



 3a
8.51



 3b
6.06



 3e
5.96



 6k
7.07



 7o
6.69



 7p
6.8



 8a
7.27



 8j
7.07



12c
7.6



15a
5.88



15f
5.99










As described above, it was found that the compound of the present invention represented by the test compound induced a proximity state because the chemiluminescence catalyzed by Nluc caused an energy transfer to 618 Ligand bonded to HaloTag. In this test, since Nluc was added to BRD2 and HaloTag was added to DCAF16, it was found that the compound of the present invention strongly promoted the interaction between the BET protein BRD2 and the E3 ligase DCAF16.


Test Example 8

Verification of BET-DCAF16 Interaction (Comparative Test with Known Compounds)


For comparison with the known comparative compound 1, the enhancement of the BET-DCAF16 interaction was verified by the same method as in test example 7. However, for the purpose of system optimization, bortezomib was changed to Neddylation inhibitor MLN4924 (Code No. HY-10484, MedChem Express), and the dilution ratio of NanoBRET™ Nano-Glo® Substrate was set to 200-fold. The BRET ratio of 1.0 μmol/L of each test compound was calculated, and the results are shown as in Table 23 below.












TABLE 23







Compound No.
BRET Ratio



















DMSO
0.99



 1h
10.95



 1l
14.93



 3a
14.46



 3b
9.69



 3e
9.58



 6k
12.62



 7o
13.00



 7p
11.57



 8a
12.45



 8j
11.91



12c
13.16



15a
9.59



15f
12.43



Comparative
1.93



Compound 1










As described above, it was found that the compound of the present invention represented by the test compound strongly promotes the interaction between BRD2 and E3 ligase DCAF16 as compared with comparative compound 1.


The comparative compound 1 is a compound described as example 14 in Patent Document 2 (WO 2015/081284), which was synthesized according to the method described in Patent Document 2, and used in this test.


Test Example 9
Antitumor Effect on Subcutaneous Transplant Model in SCID Mouse DLBCL Strain SU-DHL-4

1×107 cells of DLBCL strain SU-DHL-4 (Code No. ACC 495, Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH) suspended in a 1:1 mixed solution of PBS and matrigel (CORNING Code No. 354234) were transplanted subcutaneously on the ventral side of male SCID mouse. 14 days after the transplantation, the body weight and tumor diameter were measured, the tumor volume was calculated by the following formula, and the mice were divided into two groups (n=5) so that the average tumor volume of each group was equal. E-workbook software (ID Business Solutions) was used for grouping and measurement.





[Tumor volume (mm3)]=[Tumor long diameter (mm)]×[Tumor short diameter (mm)]2×0.5


As shown in Table 24 below, the test was conducted in two groups, a vehicle administration group and a compound 1b administration group (compound administration group). To the compound 1b administration group, a solution of compound 1b dissolved in 30% DMSO/3% Tween 80/physiological saline so as to give a final concentration of 2 mg/mL was administered intravenously (tail vein) at 5 mL/kg (10 mg/kg) once on the test start day. To the vehicle administration group, 30% DMSO/3% Tween 80/physiological saline was administered intravenously (tail vein) at 5 mL/kg in the same schedule as in the compound 1b administration group. After the start of the test, body weight and tumor diameter were measured twice a week. The tumor volume on each measurement day was calculated by the above formula. The tumor growth rate (hereinafter referred to as V/VO) was calculated by dividing the tumor volume V on each measurement day by the tumor volume VO on the test start date (Day 0). The T/C was calculated by dividing the average value (T) of V/VO of each group by the average value (C) of the vehicle administration group.


The results are shown in Table 24 below (the average values of n=5 are shown).












TABLE 24









Tumor Volume (mm3)
V/V0












Vehicle
Compound
Vehicle
Compound



Adminis-
Adminis-
Adminis-
Adminis-


Measurement
tration
tration
tration
tration


Day
Group
Group
Group
Group





Day 0
210
208
1.00
1.00


Day 4
333
101
1.60
0.49


Day 7
416
49
2.00
0.24


Day 10
589
66
2.85
0.32


Day 14
736
87
3.60
0.42


Day 17
943
122
4.59
0.59













T/C
Body Weight (g)












Vehicle
Compound
Vehicle
Compound



Adminis-
Adminis-
Adminis-
Adminis-


Measurement
tration
tration
tration
tration


Day
Group
Group
Group
Group





Day 0
1.00
1.00
26
25


Day 4
1.00
0.31
26
25


Day 7
1.00
0.12
26
25


Day 10
1.00
0.11
26
26


Day 14
1.00
0.12
26
26


Day 17
1.00
0.13
27
27









As described above, the tumor volume, tumor growth rate and T/C of the compound 1b administration group were smaller than those of the vehicle administration group. On the other hand, no weight loss was observed due to the administration of compound 1b. That is, compound 1b showed a potent antitumor effect on SU-DHL-4 subcutaneously transplanted tumor. Therefore, compound (I) and compound (I)-1 of the present invention represented by the test compound were found to be useful as a therapeutic drug for cancer.


The proton nuclear magnetic resonance spectra (1H NMR) used in the following reference examples and examples were measured at 300 MHz or 400 MHz, and exchangeable protons could not be clearly observed depending on the compound and the measurement conditions. Incidentally, the multiplicity of a signal was indicated with common term, while br indicated that the signal is apparently wide. In addition, ChemBioDraw Ultra version 14.0 was used as necessary for naming each compound synthesized.


Reference Example 1
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (Step 1)

Aniline (25.0 g, 268.82 mmol) was dissolved in acetonitrile (200 mL), then acetaldehyde (15 mL, 268.8 mmol), bismuth(III) chloride (8.5 g, 26.9 mmol) and N-vinylformamide (22.67 mL, 322.6 mmol) were added to the solution, and the mixture was stirred at room temperature for 36 hours. A saturated aqueous sodium carbonate solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate) to give N-[(2S*,4R*)-2-methyl-1,2,3,4-tetrahydroquinolin-4-yl]formamide (18.0 g).


(Step 2)

N-[(2S*,4R*)-2-Methyl-1,2,3,4-tetrahydroquinolin-4-yl]formamide (18.0 g, 94.7 mmol) obtained in step 1 was dissolved in dichloromethane (100 mL), then pyridine (30.5 mL, 379.0 mmol) and propionyl chloride (8.3 mL, 94.7 mmol) were added to the solution, and the mixture was stirred at 0° C. for 1 hour. Water was added to the reaction mixture, and the mixture was extracted twice with dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (dichloromethane/methanol=19/1) to give N-[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]formamide (15.0 g).


(Step 3)

N-[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]formamide (15.0 g, 61.0 mmol) obtained in step 2 was dissolved in methanol (100 mL), then hydrochloric acid (5 mol/L, 18 mL) was added to the solution under ice cooling, and the mixture was stirred at 70° C. for 3 hours. Water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (dichloromethane/methanol=19/1) to give 1-[(2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (9.0 g, total yield of 3 steps 15%).


(Step 4)

1-[(2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (5.0 g, 22.9 mmol) obtained in step 3 was dissolved in dichloromethane (100 mL), then [4-(methoxycarbonyl)phenyl]boronic acid (12.3 g, 68.8 mmol), triethylamine (12.9 mL, 91.7 mmol) and copper(II) acetate (6.2 g, 34.4 mmol) were added to the solution, and the mixture was stirred at room temperature for 24 hours under an oxygen atmosphere. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=7/3) to give Methyl 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (2.1 g, 18%).


(Step 5)

Methyl 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (2.1 g, 5.84 mmol) obtained in step 4 was purified by supercritical fluid chromatography (SFC) (Chiralcel OX—H (250×30 mm, 5μ), CO2/methanol=60/40, flow rate 90.0 g/min, retention time (rt)=7.5 min) to give Methyl 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (750 mg, 36%).


SFC (Chiralpak AD-H (250×4.6 mm, 5μ), methanol/CO2=25/75, flow rate 3.0 ml/min): rt=5.38 min


(Step 6)

Methyl 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (410 mg, 1.16 mmol) obtained in step 4 was dissolved in methanol (6.0 mL), then aqueous sodium hydroxide solution (4 mol/L, 1.45 mL) was added to the solution, and the mixture was stirred at 50° C. overnight. Hydrochloric acid (1 mol/L) was added to the reaction mixture, and the mixture was extracted twice with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure to obtain 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (390 mg, 99%).


(Step 7)

4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (1.92 g, 100%) was obtained from methyl 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (2.0 g, 5.67 mmol) obtained in step 5 in the same manner as in step 6.


ESI-MS m/z: 337 (M−H)−, 1H-NMR (CDCl3, δ): 1.08-1.23 (m, 6H), 1.23-1.40 (m, 1H), 2.32-2.46 (m, 1H), 2.52-2.77 (m, 2H), 4.21-4.46 (m, 2H), 4.87-5.03 (m, 1H), 6.56-6.66 (m, 2H), 7.09-7.34 (m, 4H), 7.88-7.99 (m, 2H).


Reference Example 2
1-{(2S,4R)-4-[(4-Bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one

1-{(2S*,4R*)-4-[(4-bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (15.0 g) was obtained from 1-[(2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (15.0 g, 68.8 mmol) obtained in step 3 of reference example 1 and (4-bromophenyl) boronic acid (13.76 g, 68.81 mmol) in the same manner as in step 4 of reference example 1. The obtained 1-{(2S*,4R*)-4-[(4-bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (15.0 g) was purified by SFC ((R, R) Whelk-01 (250×30 mm, 5μ), CO2/methanol=80/20, flow rate 100 g/min, rt=10.63 min) to give 1-{(2S,4R)-4-[(4-Bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (5.4 g, 21%).


ESI-MS (M+H)+: 373, 1H NMR (DMSO-d6, δ): 0.99-1.04 (m, 6H), 1.13-1.20 (m, 1H), 2.20-2.25 (m, 1H), 2.55-2.61 (m, 2H), 4.14 (ddd, J=11.98, 7.71, 4.12 Hz, 1H), 4.70-4.75 (m, 1H), 6.28 (d, J=7.63 Hz, 1H), 6.59-6.62 (m, 2H), 7.10 (d, J=7.50 Hz, 1H), 7.16-7.23 (m, 3H), 7.25-7.30 (m, 2H).


SFC ((R, R) Whelk-01 (250×4.6 mm, 5μ), methanol/CO2=25/75, flow rate 3.0 ml/min): rt=7.29 min


Reference Example 3
(S)-4-{6-[2-(tert-Butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid

tert-Butyl 2-[4-(4-bromophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (5.0 g, 10.0 mmol) synthesized according to the method described in WO2017/030814 was dissolved in a mixed solvent (70 mL) of DMF and water (5:2), then potassium carbonate (2.1 g, 15.0 mmol), palladium acetate (0.67 g, 1.0 mmol) and Bis(diphenylphosphino)propane (0.82 g, 2.0 mmol) were added to the solution, and the mixture was stirred at 100° C. for 16 hours under a carbon monoxide atmosphere. The reaction mixture was filtered through Celite, water was added to the filtrate, and the aqueous layer was washed with ethyl acetate. Citric acid was added to the aqueous layer, and the aqueous layer was extracted twice with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% formic acid aqueous solution=1/1) to give 4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (2.75 g). The resulting 4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (2.75 g) was purified by SFC (Chiralpak AD-H (250×30 mm, 5μ), CO2/methanol=70/30, flow rate 90 g/min, rt=3.89 min) to give (S)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (1.68 g, 36%).


ESI-MS (M+H)+: 467, 1H NMR (DMSO-d6, δ): 1.43 (s, 9H), 1.60 (d, J=0.61 Hz, 3H), 2.42 (d, J=0.61 Hz, 3H), 2.61 (s, 3H), 3.34-3.40 (m, 2H), 4.46 (dd, J=8.24, 6.41 Hz, 1H), 7.52 (d, J=8.54 Hz, 2H), 7.97 (d, J=8.85 Hz, 2H), 13.14 (brs, 1H).


SFC (Chiralpak AD-H (250×4.6 mm, 5μ), methanol/CO2=25/75, flow rate 3.0 ml/min): rt=3.62 min


Reference Example 4
4-(2,3,9-Trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid
(Step 1)

(tert-Butoxycarbonyl)glycine (79 mg, 0.451 mmol) was dissolved in DMF (1.6 mL), then HATU (184 mg, 0.484 mmol) and N,N-diisopropylethylamine (0.11 mL, 0.645 mmol) were added to the solution and the mixture was stirred at room temperature for 10 minutes. (2-Amino-4,5-dimethylthiophen-3-yl)(4-bromophenyl)methanone (100 mg, 0.322 mmol) synthesized by the method described in WO2017030814 was added to the reaction mixture, and the mixture was stirred at room temperature overnight. A saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=100/0-80/20) to give tert-butyl (2-{[3-(4-bromobenzoyl)-4,5-dimethylthiophen-2-yl]amino}-2-oxoethyl)carbamate (110 mg, 73%).


(Step 2)

tert-Butyl (2-{[3-(4-bromobenzoyl)-4,5-dimethylthiophen-2-yl]amino}-2-oxoethyl)carbamate (110 mg, 0.235 mmol) obtained in step 1 was dissolved in dichloromethane (0.79 mL), then trifluoroacetic acid (0.54 mL) was added to the solution, and the mixture was stirred at room temperature overnight. The reaction mixture was concentrated under reduced pressure, the obtained residue (110 mg) was dissolved in toluene (2.0 mL), then pyridine (0.36 mL, 4.49 mmol) and molecular sieves 4A (300 mg) were added to the solution, and the mixture was refluxed overnight. The reaction mixture was suction filtered, and water was added to the obtained filtrate, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=100/0 to 90/10) to give 5-(4-bromophenyl)-6,7-dimethyl-1,3-dihydro-2H-thieno[2,3-e][1,4]diazepin-2-one (56 mg, 68%).


(Step 3)

5-(4-Bromophenyl)-6,7-dimethyl-1,3-dihydro-2H-thieno[2,3-e][1,4]diazepin-2-one (55 mg, 0.157 mmol) obtained in step 2 was dissolved in THF (1.0 mL), the solution was refrigerated to −78° C., then potassium tert-butoxide (21 mg, 0.189 mmol) was added to the solution, and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was refrigerated to −78° C. and diethylphosphoryl chloride (0.027 mL, 0.189 mmol) was added to the mixture, and the mixture was stirred at −10° C. for 45 minutes. Acetohydrazine (18 mg, 0.236 mmol) and 1-butanol (1.0 mL) were added to the reaction mixture, and the mixture was stirred at 90° C. for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (chloroform/methanol=100/0 to 90/10) to give 4-(4-bromophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine (24 mg, 39%).


(Step 4)

4-(4-Bromophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine (160 mg, 0.413 mmol) obtained in step 3 was dissolved in a mixed solvent (2.2 mL) of DMF and water (10:1), then palladium acetate (9.3 mg, 0.041 mmol), 1,3-bis(diphenylphosphino)propane (34 mg, 0.083 mmol) and potassium carbonate (120 mg, 0.868 mmol) were added to the solution, and the mixture was stirred at 80° C. overnight under a carbon monoxide atmosphere. Hydrochloric acid (1 mol/L) was added to the reaction mixture, and the mixture was extracted twice with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was slurried with ethyl acetate to give 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (170 mg, 100%).


ESI-MS m/z: 351 (M−H)−: 1H-NMR (DMSO-d6, δ): 2.40 (s, 3H), 2.63 (s, 3H), 2.90 (s, 3H), 4.17-4.20 (m, 1H), 5.26-5.33 (m, 1H), 7.53-7.59 (m, 2H), 7.94-8.02 (m, 2H).


Reference Example 5
4-[(2-Ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl]benzoic acid
(Step 1)

2-(2-Oxobutyl)cyclohexane-1,3-dione (150 mg, 0.823 mmol) synthesized according to the method described in the literature (Eur. J. of Org. Chem. 2016, 5169-5179) was dissolved in toluene (1.2 ml), then methyl 4-(aminomethyl)benzoate hydrochloride (174 mg, 0.864 mmol) and triethylamine (0.23 ml, 1.65 mmol) were added to the solution, and the mixture was stirred at room temperature for 15 minutes and then refluxed for 7 hours. Water was added to the reaction mixture, and the mixture was extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=100/0 to 90/10) to give methyl 4-[(2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl]benzoate (120 mg, 47%).


(Step 2)

4-[(2-Ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl]benzoic acid (170 mg, 77%) was obtained from methyl 4-[(2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl]benzoate (230 mg, 0.739 mmol) obtained in step 1 in the same manner as in step 6 of reference example 1.


ESI-MS m/z: 296 (M−H)−; 1H-NMR (CDCl3, δ): 1.20 (t, J=7.4 Hz, 3H), 2.06-2.18 (m, 2H), 2.41 (q, J=7.4 Hz, 2H), 2.45-2.52 (m, 2H), 2.58-2.64 (m, 2H), 5.11 (s, 2H), 6.42 (s, 1H), 6.99 (d, J=8.2 Hz, 2H), 8.06 (d, J=8.2 Hz, 2H).


Reference Example 6
4-{[3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxyphenyl](hydroxy)methyl}benzoic acid
(Step 1)

3-Bromo-5-hydroxybenzaldehyde (3.7 g, 18.41 mmol) was dissolved in DMF (100 mL), then tert-butyldimethylchlorosilane (3.33 g, 22.09 mmol) and imidazole (1.38 g, 20.25 mmol) were added to the solution, and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=100/0 to 90/10) to give 3-bromo-5-[(tert-butyldimethylsilyl)oxy]benzaldehyde (4.6 g, 79%).


(Step 2)

3-Bromo-5-[(tert-butyldimethylsilyl)oxy]benzaldehyde (800 mg, 2.54 mmol) obtained in step 1 were mixed with [4-(ethoxycarbonyl)phenyl](iodo)zinc (0.5 mol/L in THF, 30.4 mL, 15.20 mmol), and the mixture was stirred at room temperature for 24 hours. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure.


The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=95/5 to 50/50) to give ethyl 4-({3-bromo-5-[(tert-butyldimethylsilyl)oxy]phenyl}(hydroxy)methyl)benzoate (570 mg, 45%).


(Step 3)

Ethyl 4-({3-bromo-5-[(tert-butyldimethylsilyl)oxy]phenyl}(hydroxy)methyl)benzoate (550 mg, 1.18 mmol) obtained in step 2 was dissolved in a mixed solvent (24 mL) of 1,4-dioxane and water (5:1), then 3,5-dimethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-yl)isoxazole (343 mg, 1.54 mmol), potassium carbonate (490 mg, 3.54 mmol) and Pd(dppf)Cl2 (87 mg, 0.12 mmol) were added to the solution, and the mixture was stirred at 80° C. for 16 hours. Ethyl acetate was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by thin layer chromatography (petroleum ether/ethyl acetate=67/33) to give ethyl 4-({3-[(tert-butyldimethylsilyl)oxy]-5-(3,5-dimethylisoxazol-4-yl)phenyl}(hydroxy)methyl)benzoate (570 mg, 95%).


(Step 4)

4-{[3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxyphenyl](hydroxy)methyl}benzoic acid (400 mg, 98%) was obtained from ethyl 4-({3-[(tert-butyldimethylsilyl)oxy]-5-(3,5-dimethylisoxazol-4-yl)phenyl}(hydroxy)methyl)benzoate (570 mg, 1.18 mmol) obtained in step 3 in the same manner as in step 6 of reference example 1.


ESI-MS (M+H)+: 340, 1H NMR (CD3OD, δ): 2.20 (s, 3H), 2.36 (s, 3H), 5.80 (s, 1H), 6.65-6.61 (t, J=1.6 Hz, 1H), 6.80 (d, J=1.2 Hz, 1H), 6.84 (t, J=1.6 Hz, 1H), 7.51 (d, J=8.4 Hz, 2H), 7.99 (d, J=8.4 Hz, 2H).


Reference Example 7
1-{(2S,4R)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one
(Step 1)

1-[(2S*,4R*)-4-Amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (10.0 g, 45.87 mmol) obtained in step 3 of reference example 1 was dissolved in DMF (150 mL), then 1-fluoro-4-nitrobenzene (9.7 mL, 91.74 mmol), N,N-diisopropylethylamine (8.0 mL, 45.87 mmol) and potassium carbonate (19 g, 137.61 mmol) were added to the solution, and the mixture was stirred at 100° C. for 48 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=92/8 to 90/10) to give 1-{(2S*,4R*)-2-methyl-4-[(4-nitrophenyl)amino]-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (4.7 g, 30%).


ESI-MS (M+H)+: 340.


(Step 2)

1-{(2S*,4R*)-2-Methyl-4-[(4-nitrophenyl)amino]-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (2.6 g, 7.66 mmol) obtained in step 1 was dissolved in a mixed solvent (45 mL) of ethanol, water and THF (1:1:1), then iron (2.13 g, 38.3 mmol) and ammonium chloride (0.6 g, 11.50 mmol) were added to the solution, and the mixture was stirred at 70° C. for 2 hours. The reaction mixture was filtered, and water was added to the filtrate, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=60/40 to 50/50) to give 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (1.65 g, 70%). ESI-MS (M+H)+: 310: 1H-NMR (DMSO-d6, δ): 0.97-1.03 (m, 6H), 1.06-1.08 (m, 1H), 2.18-2.24 (m, 1H), 2.57-2.60 (m, 2H), 3.95-3.99 (m, 1H), 4.29 (brs, 2H), 4.68-4.70 (m, 1H), 5.17 (d, J=8.4 Hz, 1H), 6.41-6.46 (m, 4H), 7.14-7.18 (m, 1H), 7.22-7.28 (m, 3H)


(Step 3)

1-{(2S*,4R*)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (530 mg) obtained in step 2 was purified by SFC (Chiralcel 03-H (250×21 mm, 5μ), CO2/methanol=85/15, flow rate 70 g/min, rt=6.36 min) to give 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (180 mg, 34%).


ESI-MS (M+H)+: 310: 1H-NMR (DMSO-d6, δ): 1.12-1.19 (m, 7H), 2.32-2.37 (m, 1H), 2.52-2.67 (m, 2H), 3.49 (brs, 2H), 4.08 (dd, 3=12.0, 3.5 Hz, 1H), 4.89-4.90 (m, 1H), 6.53 (d, J=8.5 Hz, 2H), 6.64 (d, J=8.5 Hz, 2H), 7.13 (d, J=7.5 Hz, 1H), 7.18-7.21 (m, 1H), 7.24-7.25 (m, 1H), 7.36 (d, J=7.5 Hz, 1H).


SFC (Chiralcel OJ-H (250×4.6 mm, 5μ), methanol/CO2=20/80, flow rate 3.0 ml/min): rt=6.51 min


Reference Example 8
tert-Butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate
(Step 1)

Methyl 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (0.5 g, 1.42 mmol) obtained in step 5 of reference example 1 was dissolved in tetrahydrofuran (10 mL), then DMAP (0.693 g, 5.68 mmol) and di-tert-butyl dicarbonate (1.24 g, 5.68 mmol) were added to the solution, and the mixture was stirred at 70° C. for 16 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=4/1) to give methyl 4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoate (0.5 g, 77%).


ESI-MS m/z: 453 (M+H)+


(Step 2)

Methyl 4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoate (0.50 g, 1.1 mmol) obtained in step 1 was dissolved in methanol (10 mL), then 4 mol/L sodium hydroxide aqueous solution (10 mL) was added to the solution, and the mixture was stirred at 80° C. for 4 hours. The reaction mixture was concentrated under reduced pressure, and an aqueous citric acid solution was added to the obtained aqueous solution until pH approximately 5. The resulting solid was suction filtered to give 4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.4 g, 83%).


ESI-MS m/z: 439 (M+H)+


(Step 3)

4-((tert-Butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.40 g, 0.91 mmol) obtained in step 2 was dissolved in dichloromethane (5 mL), then ethyl chloroformate (0.10 mL, 1.1 mmol) and triethylamine (0.38 mL, 2.74 mmol) were added to the solution, and the mixture was stirred at room temperature for 5 hours. Water was added to the reaction mixture, and the mixture was extracted with dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was dissolved in methanol (5 mL), then sodium borohydride (0.069 g, 1.83 mmol) was added to the solution at 0° C., and the mixture was stirred at room temperature for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=7/3) to give tert-butyl (4-(hydroxymethyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.28 g, 72%).


ESI-MS m/z: 425 (M+H)+


(Step 4)

tert-Butyl (4-(hydroxymethyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.400 g, 0.94 mmol) obtained in step 3 was dissolved in dichloromethane (5 mL), then DMP (0.480 g, 1.13 mmol) was added to the solution at 0° C., and the mixture was stirred at room temperature for 3 hours. The reaction mixture was diluted with dichloromethane and filtered through Celite. The obtained filtrate was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=9/1) to give tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.26 g, 65%).


ESI-MS m/z: 423 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.92-0.99 (m, 6H), 1.34 (s, 9H), 2.10-2.18 (m, 1H), 2.36 (brs, 1H), 2.47-2.48 (m, 1H), 2.51-2.52 (m, 1H), 4.63-4.68 (m, 1H), 4.86 (brs, 1H), 7.34 (brs, 4H), 7.44 (d, J=8.0 Hz, 2H), 7.88-7.90 (m, 2H), 9.97 (s, 1H).


Reference Example 9
1-((2S,4R)-4-(((1r,4R)-4-Aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride
(Step 1)

1-[(2S*,4R*)-4-Amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (50.0 g, 230 mmol) obtained in step 3 of reference example 1 was dissolved in methanol (600 mL), then acetic acid (68.80 mL, 1147 mmol), tert-butyl (4-oxocyclohexyl)carbamate (68.4 g, 344 mmol) and sodium borohydride (26.0 g, 689 mmol) were added to the solution, and the mixture was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure, and water was added to the obtained residue, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=3/7) to give a crude product of tert-butyl (4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamate (17 g). The resulting crude product was purified by SFC (Chiralpak IA (250×30 mm, 5μ), CO2/methanol=85/15, flow rate 90.0 g/min, retention time (rt)=6.7 min) to give tert-butyl ((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamate (6.0 g, 6.2%).


SFC (Chiralpak AD-H (250×4.6 mm, 5μ), methanol/CO2=15/85, flow rate 3.0 ml/min): rt=6.7 min


ESI-MS m/z: 416.3 (M+H)+


(Step 2)

1-((2S,4R)-4-(((1r,4R)-4-Aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (5.0 g, 89%) was obtained from tert-butyl ((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamate (6.0 g, 14 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 316.41. 1H NMR (DMSO-d6, δ): 0.97 (t, J=7.2 Hz, 3H), 1.04 (d, J=6.4 Hz, 3H), 1.17-1.28 (m, 1H), 1.38-1.54 (m, 1H), 1.58-1.69 (m, 1H), 1.74-1.88 (m, 1H), 2.00-2.17 (m, 3H), 2.21-2.37 (m, 2H), 2.54-2.64 (m, 1H), 2.92-2.97 (m, 2H), 3.21-3.22 (m, 1H), 4.22-4.24 (m, 1H), 4.62-4.74 (m, 1H), 6.52 (brs, 1H), 7.31-7.41 (m, 3H), 7.56 (d, J=7.67 Hz, 1H), 8.18 (brs, 3H), 9.63-9.93 (m, 2H).


Reference Example 10
1-((2S*,4R*)-4-(((1r,4R)-4-Aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride
(Step 1)

The crude product (8.0 g) of tert-butyl (4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamate obtained in step 1 of reference example 9 was purified by SFC (Chiralpak IA (250×30 mm, 5μ), CO2/methanol=85/15, flow rate 90.0 g/min, retention time (rt)=7.62, 11.0 min) to give tert-butyl ((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamate (3.0 g, total yield of 2 steps 6.7%).


SFC (Chiralpak AD-H (250×4.6 mm, 5μ), Methanol/CO2=15/85, Flow rate 3.0 ml/min): rt=7.62, 11.0 min



1H NMR (CDCl3, δ): 0.88-0.91 (m, 1H), 1.07-1.12 (m, 6H), 1.16-1.40 (m, 4H), 1.44 (s, 9H), 2.01-2.06 (m, 4H), 2.24-2.28 (m, 1H), 2.48-2.61 (m, 2H), 2.63-2.66 (m, 1H), 3.46-3.60 (m, 2H), 4.36 (brs, 1H), 4.85 (brs, 1H), 7.09 (d, J=7.0 Hz, 1H), 7.22-7.25 (m, 2H), 7.45-7.47 (m, 1H).


(Step 2)

1-((2S*,4R*)-4-(((1r,4R)-4-Aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (2.5 g, 90%) was obtained from tert-butyl ((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamate (3.0 g, 7.23 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 316.3. 1H NMR (DMSO-d6, δ): 0.98 (t, J=7.6 Hz, 3H), 1.04 (d, J=6.4 Hz, 3H), 1.23-1.25 (m, 2H), 1.44-1.51 (m, 2H), 1.61-1.69 (m, 1H), 1.81-1.89 (m, 1H), 2.05-2.14 (m, 3H), 2.25-2.33 (m, 2H), 2.51-2.62 (m, 1H), 2.93-2.98 (m, 2H), 4.18-4.28 (m, 1H), 4.68-4.70 (m, 1H), 7.30-7.41 (m, 3H), 7.57 (d, J=7.6 Hz, 1H), 8.21 (brs, 3H), 9.82-9.88 (m, 2H).


Reference Example 11
(1R,4r)-4-(((2 S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid
(Step 1)

A crude product of methyl 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylate was obtained from 1-[(2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (2.0 g, 9.2 mmol) obtained in step 3 of reference example 1 and methyl 4-oxocyclohexane-1-carboxylate (2.86 g, 18.35 mmol) in the same manner as in step 1 of reference example 9. The crude product was purified by SFC (Chiralpak IA (250×30 mm, 5 μm), CO2/methanol=90/10, flow rate 90.0 g/min) to give methyl (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylate (0.240 g, 7.3%).


SFC (Chiralpak IA (250×4.6 mm, 5 μm), CO2/methanol=90/10, flow rate 3 mL/min, retention time (rt)=8.0 min)



1H NMR (CD3OD, δ): 0.89-1.01 (m, 1H), 1.03-1.10 (m, 6H), 1.21-1.36 (m, 2H), 1.39-1.57 (m, 2H), 1.93-2.14 (m, 4H), 2.15-2.22 (m, 1H), 2.24-2.38 (m, 2H), 2.49-2.60 (m, 1H), 2.62-2.70 (m, 1H), 2.72-2.83 (m, 1H), 3.63-3.70 (m, 3H), 4.76-4.79 (m, 1H), 7.21-7.46 (m, 4H).


(Step 2)

(1R,4r)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.040 g, 83%) was obtained from methyl (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylate (0.05 g, 0.14 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 345.60.


(Step 3)

(1R,4r)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (250 mg, 0.725 mmol) obtained in step 2 was purified by SFC (Lux Cellulose-2 (250×30 mm, 5 μm), CO2/methanol=75/25, flow rate 90.0 g/min, retention time (rt)=2.3 min) to give (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (65 mg, 26%).


SFC (Lux Cellulose-2 (250×4.6 mm, 5 μm), CO2/methanol=55/45, flow rate 3.0 mL/min, retention time (rt)=2.3 min)


ESIMS, (M+H)+, m/z: 345.35. 1H NMR (DMSO-d6, δ): 0.81-0.84 (m, 1H), 0.92-1.01 (m, 6H), 1.03-1.26 (m, 2H), 1.34 (qd, 3=12.72, 2.75 Hz, 2H), 1.85-2.02 (m, 4H), 2.09-2.19 (m, 2H), 2.53 (brs, 1H), 2.54-2.62 (m, 2H), 3.45 (dd, J=11.90, 3.97 Hz, 1H), 4.56-4.68 (m, 1H), 7.19-7.25 (m, 3H), 7.47-7.51 (m, 1H).


Reference Example 12
1-((2S,4R)-2-Methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride
(Step 1)

tert-Butyl 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidine-1-carboxylate (2.4 g, 87%) was obtained from 1-[(2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (1.5 g, 6.9 mmol) obtained in step 3 of reference example 1 and tert-butyl 4-oxopiperidine-1-carboxylate (2.73 g, 13.76 mmol) in the same manner as in step 1 of reference example 9.


ESI-MS m/z: 402 (M+H)+


(Step 2)

1-((2S,4R)-2-Methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (1.9 g, 86%) was obtained from tert-butyl 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidine-1-carboxylate (2.4 g, 5.98 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 302.23 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.99 (t, J=7.34 Hz, 3H), 1.05 (d, J=6.36 Hz, 3H), 1.20-1.32 (m, 1H), 2.01-2.23 (m, 3H), 2.39 (t, J=15.16 Hz, 2H), 2.55-2.62 (m, 1H), 2.82-3.02 (m, 3H), 3.37-3.39 (m, 2H), 3.64-3.68 (m, 1H), 4.28-4.32 (m, 1H), 4.67-4.70 (m, 1H), 7.30-7.41 (m, 3H), 7.57 (d, J=7.83 Hz, 1H), 9.07-9.09 (m, 1H), 9.30 (d, J=9.29 Hz, 1H), 10.16-10.21 (m, 2H).


Reference Example 13
1-((2S,4R)-2-Methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride
(Step 1)

tert-butyl 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidine-1-carboxylate (3.0 g, 7.47 mmol) obtained in step 1 of reference example 12 was purified by SFC (Chiralpak IG (30×250 mm), 5μ, CO2/methanol=75/25, flow rate 90 g/min, rt=2.4) to give tert-butyl 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidine-1-carboxylate (0.900 g, 30%).


SFC (Chiralpak IC-3 (150×4.6 mm, 3 μm), methanol/CO2=35/65, flow rate 3.0 ml/min): rt=2.4 min


ESI-MS m/z: 402.35 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98 (t, J=7.3 Hz, 3H), 1.05 (d, J=6.4 Hz, 3H), 1.17-1.25 (m, 1H), 1.38 (s, 9H), 1.52-1.60 (m, 1H), 1.70-1.75 (m, 1H), 2.09-2.23 (m, 3H), 2.54-2.67 (m, 1H), 2.79-2.95 (m, 3H), 3.55-3.61 (m, 1H), 4.03 (d, J=8.8 Hz, 2H), 4.27-4.31 (m, 1H), 4.64-4.72 (m, 1H), 7.35-7.39 (m, 3H), 7.50 (d, J=7.6 Hz, 1H), 9.58 (brs, 1H).


(Step 2)

1-((2S,4R)-2-Methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.4 g, 53%) was obtained from tert-butyl 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidine-1-carboxylate (0.800 g, 1.99 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 302 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.99 (t, J=7.34 Hz, 3H), 1.05 (d, J=6.14 Hz, 3H), 1.20-1.35 (m, 1H), 1.96-2.25 (m, 3H), 2.39 (t, J=15.13 Hz, 2H), 2.54-2.67 (m, 1H), 2.85-3.04 (m, 3H), 3.32-3.34 (m, 2H), 3.66-3.69 (m, 1H), 4.26-4.32 (m, 1H), 4.68-4.72 (m, 1H), 7.26-7.43 (m, 3H), 7.58 (d, J=7.45 Hz, 1H), 9.08 (d, J=8.99 Hz, 1H), 9.27 (d, J=8.4 Hz, 1H), 10.13-10.18 (m, 2H).


Reference Example 14
1-((2S*,4R*)-4-(((1r,3R)-3-Aminocyclobutyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride
(Step 1)

The crude product of tert-butyl (3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclobutyl)carbamate was obtained from 1-[(2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (0.5 g, 2.29 mmol) obtained in step 3 of reference example 1 and tert-butyl (3-oxocyclobutyl)carbamate (0.678 g, 3.66 mmol) in the same manner as in step 1 of reference example 9. The resulting crude product was purified by SFC (Chiralpak IG (30×250 mm), 5 μm, CO2/ethanol=75/25, flow rate 90 g/min) to give tert-butyl ((1R,3r)-3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclobutyl)carbamate (120 mg, 13%).


ESI-MS m/z: 388 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.79-0.84 (m, 1H), 0.92-0.99 (m, 6H), 1.37 (s, 9H), 1.99-2.04 (m, 3H), 2.06-2.33 (m, 3H), 2.54-2.61 (m, 2H), 3.23-3.25 (m, 1H), 3.46-3.49 (m, 1H), 4.02-4.05 (m, 1H), 4.57-4.63 (m, 1H), 7.14 (d, J=7.2 Hz, 1H), 7.23-7.25 (m, 3H), 7.42-7.47 (m, 1H).


(Step 2)

1-((2S*,4R*)-4-(((1r,3R)-3-Aminocyclobutyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.21 g, 90%) was obtained from tert-butyl ((1R,3r)-3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclobutyl)carbamate (0.25 g, 0.64 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 288 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98 (t, J=7.5 Hz, 3H), 1.03 (d, J=6.5 Hz, 3H), 1.10-1.23 (m, 1H), 2.10-2.14 (m, 1H), 2.51-2.60 (m, 3H), 2.74-2.79 (m, 1H), 2.84-2.88 (m, 1H), 2.91-2.99 (m, 1H), 3.91-3.98 (m, 1H), 4.11-4.19 (m, 1H), 4.29-4.34 (m, 1H), 4.62-4.72 (m, 1H), 7.32-7.41 (m, 3H), 7.57 (d, J=8.0 Hz, 1H), 8.42 (brs, 3H), 10.36 (brs, 1H), 10.44 (brs, 1H).


Reference Example 15
4-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoic acid
(Step 1)

1-[(2S*,4R*)-4-Amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (1.0 g, 4.6 mmol) obtained in step 3 of reference example 1 was dissolved in DMF (3 mL), then methyl 4-(bromomethyl)benzoate (1.56 g, 6.88 mmol) and potassium carbonate (1.89 g, 13.8 mmol) were added to the solution, and the mixture was stirred at 80° C. for 16 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/water=1/1) to give methyl 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoate (1.0 g, 60%).


ESI-MS m/z: 367 (M+H)+


(Step 2)

4-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoic acid (0.6 g, 62%) was obtained from methyl 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoate (1.0 g, 2.73 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESI-MS m/z: 353.34 (M+H)+


Reference Example 16
1-((2S*,4R*)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one
(Step 1)

1-[(2S*,4R*)-4-Amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (1.0 g, 4.6 mmol) obtained in step 3 of reference example 1 was dissolved in DMF (5 mL), then 2-fluoro-5-nitropyridine (0.488 g, 3.44 mmol) and potassium carbonate (0.94 g, 6.88 mmol) were added to the solution, and the mixture was stirred at 70° C. for 1 hour. Water was added to the reaction mixture, and the resulting solid was suction filtered to give 1-((2S*,4R*)-2-methyl-4-((5-nitropyridin-2-yl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.55 g, 71%).


ESI-MS m/z: 341 (M+H)+


(Step 2)

1-((2S*,4R*)-2-Methyl-4-((5-nitropyridin-2-yl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.55 g, 1.61 mmol) obtained in step 1 was dissolved in a mixed solvent of THF (3 mL), ethanol (3 mL) and water (3 mL), then iron powder (0.452 g, 8.08 mmol) and ammonium chloride (0.128 g, 2.42 mmol) were added to the solution, and the mixture was stirred at 60° C. for 1 hour. The reaction mixture was concentrated under reduced pressure, water was added to the obtained residue, and the mixture was extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give 1-((2S*,4R*)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.45 g, 90%).


ESI-MS m/z: 311 (M+H)+


Reference Example 17
1-((2S,4R)-4-((5-Aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one
(Step 1)

1-((2S*,4R*)-2-Methyl-4-((5-nitropyridin-2-yl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (940 mg, 2.76 mmol) obtained in step 1 of reference example 16 was purified by SFC (CHIRALPAK IB, CO2/methanol=94/6, 30 mL/min, rt=12.38 min) to give 1-((2S,4R)-2-methyl-4-((5-nitropyridin-2-yl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (230 mg, 24%).


ESI-MS, (M+H)+, m/z: 341. 1H-NMR (CDCl3, δ): 1.10-1.20 (m, 6H), 1.33-1.44 (m, 1H), 2.29-2.43 (m, 1H), 2.53-2.64 (m, 1H), 2.66-2.76 (m, 1H), 4.90-5.04 (m, 1H), 5.69-5.96 (m, 1H), 6.48-6.59 (m, 1H), 7.16-7.25 (m, 3H), 7.29-7.36 (m, 1H), 8.21-8.27 (m, 1H), 9.00-9.04 (m, 1H).


(Step 2)

1-((2S,4R)-2-Methyl-4-((5-nitropyridin-2-yl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (90 mg, 0.264 mmol) obtained in step 1 was dissolved in a mixed solvent of ethanol (2 mL) and water (2 mL), then zinc powder (173 mg, 2.64 mmol) and sodium chloride (141 mg, 2.64 mmol) were added to the solution, and the mixture was stirred for 1 hour under reflux. The reaction mixture was cooled to room temperature, filtered through diatomaceous earth, and the filtrate was extracted twice with ethyl acetate. The organic layer was dried over magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=4/6 to 0/10) to give 1-((2S,4R)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (52 mg, 63%).


ESI-MS, (M+H)+, m/z: 311. 1H-NMR (CDCl3, δ): 1.12-1.17 (m, 6H), 2.27-2.39 (m, 1H), 2.51-2.61 (m, 1H), 2.62-2.71 (m, 1H), 3.27 (brs, 2H), 4.26 (d, J=9.1 Hz, 1H), 4.46-4.54 (m, 1H), 4.87-4.95 (m, 1H), 6.35 (d, J=8.6 Hz, 1H), 6.98 (dd, J=8.6, 2.7 Hz, 1H), 7.14 (d, J=8.2 Hz, 1H), 7.17-7.22 (m, 1H), 7.24-7.29 (m, 1H), 7.32 (d, J=7.2 Hz, 1H), 7.72 (d, J=3.2 Hz, 1H).


Reference Example 18
1-((2S*,4R*)-2-Methyl-4-((piperidin-4-ylmethyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride
(Step 1)

1-[(2S*,4R*)-4-Amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (0.26 g, 1.0 mmol) obtained in step 3 of reference example 1 was dissolved in dichloroethane (5 mL), then tert-butyl 4-formylpiperidine-1-carboxylate (0.239 g, 1.12 mmol), acetic acid (0.029 mL, 0.510 mmol) and sodium triacetoxyborohydride (0.433 g, 2.04 mmol) were added to the solution, and the mixture was stirred at room temperature overnight. Water was added to the reaction mixture, and the mixture was extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=7/3) to give tert-butyl 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)piperidine-1-carboxylate (0.41 g, 98%).


ESI-MS m/z: 416 (M+H)+


(Step 2)

tert-Butyl 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)piperidine-1-carboxylate (0.41 g, 0.98 mmol) obtained in step 1 was dissolved in ethyl acetate (5 mL), then hydrogen chloride/ethyl acetate solution (4 mol/L, 2.5 mL, 9.9 mmol) was added to the solution, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was suction filtered, and the obtained solid was dissolved in methanol and concentrated under reduced pressure to give 1-((2S*,4R*)-2-methyl-4-((piperidin-4-ylmethyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.43 g, quantitative).


ESI-MS m/z: 316 (M+H)+


Reference Example 19
4-(((2S*,4R*)-6-Fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid
(Step 1)

N-((2S*,4R*)-6-Fluoro-2-methyl-1,2,3,4-tetrahydroquinolin-4-yl)formamide (0.3 g, 16%) was obtained from 4-fluoroaniline (1.0 g, 9.0 mmol) in the same manner as in step 1 of reference example 1.


ESI-MS m/z: 209 (M+H)+


(Step 2)

N-((2S*,4R*)-6-Fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)formamide (1.0 g, 79%) was obtained from N-((2S*,4R*)-6-fluoro-2-methyl-1,2,3,4-tetrahydroquinolin-4-yl)formamide (1.0 g, 4.81 mmol) obtained in step 1 in the same manner as in step 2 of reference example 1.


ESI-MS m/z: 265 (M+H)+


(Step 3)

1-((2S*,4R*)-4-Amino-6-fluoro-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.5 g, 56%) was obtained from N-((2S*,4R*)-6-fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)formamide (1.0 g, 3.79 mmol) obtained in step 2 in the same manner as in step 3 of reference example 1.


ESI-MS m/z: 237 (M+H)+


(Step 4)

Methyl 4-(((2S*,4R*)-6-fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoate (0.08 g, 10%) was obtained from 1-((2S*,4R*)-4-amino-6-fluoro-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.3 g, 1.3 mmol) obtained in step 3 in the same manner as in step 4 of reference example 1.


ESI-MS m/z: 371 (M+H)+


(Step 5)

4-(((2S*,4R*)-6-Fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.65 g, 75%) was obtained from methyl 4-(((2S*,4R*)-6-fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoate (0.9 g, 2.4 mmol) obtained in step 4 in the same manner as in step 6 of reference example 1.


ESI-MS m/z: 357 (M+H)+: 1H-NMR (CDCl3, δ): 1.14-1.22 (m, 6H), 1.25-1.34 (m, 1H), 2.32-2.38 (m, 1H), 2.53-2.59 (m, 1H), 2.66-2.73 (m, 1H), 4.24-4.31 (m, 2H), 4.96 (brs, 1H), 6.61 (d, J=8.80 Hz, 2H), 6.93-7.02 (m, 2H), 7.15 (brs, 1H), 7.95 (d, J=8.80 Hz, 2H).


Reference Example 20
tert-Butyl ((E)-3-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)allyl)carbamate
(Step 1)

N-((2S*,4R*)-7-Bromo-2-methyl-1,2,3,4-tetrahydroquinolin-4-yl)formamide (24 g, 62%) was obtained in the same manner as in step 1 of reference example 1 using 3-bromoaniline (25.0 g, 145 mmol).


ESI-MS m/z: 269 (M+H)+


(Step 2)

N-((2S*,4R*)-7-Bromo-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)formamide (5.5 g, 19%) was obtained from N-((2S*,4R*)-7-bromo-2-methyl-1,2,3,4-tetrahydroquinolin-4-yl)formamide (24 g, 89 mmol) obtained in step 1 in the same manner as in step 2 of reference example 1.


ESI-MS m/z: 325 (M+H)+


(Step 3)

1-((2S*,4R*)-4-Amino-7-bromo-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (2.0 g, 74%) was obtained from N-((2S*,4R*)-7-bromo-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)formamide (3.0 g, 9.2 mmol) obtained in step 2 in the same manner as in step 3 of reference example 1.


ESI-MS m/z: 297 (M+H)+


(Step 4)

1-((2S*,4R*)-7-Bromo-2-methyl-4-((4-nitrophenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one. (0.18 g, 25%) was obtained from 1-((2S*,4R*)-4-amino-7-bromo-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (500 mg, 1.69 mmol) obtained in step 3 and (4-nitrophenyl)boronic acid (422 mg, 2.53 mmol) in the same manner as in Reference example 1 Step 4.


ESI-MS m/z: 418 (M+H)+


(Step 5)

1-((2S*,4R*)-7-Bromo-2-methyl-4-((4-nitrophenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.33 g, 0.79 mmol) obtained in step 4 was dissolved in toluene (5 mL), then tert-butyl (E)-(3-(tributylstannyl)allyl)carbamate (0.422 g, 0.95 mmol) and Pd(PPh3)4 (0.091 g, 0.08 mmol) were added to the solution, and the mixture was stirred at 110° C. for 5 hours under an argon atmosphere. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=7/3) to give tert-butyl (E)-3-((2S*,4R*)-2-methyl-4-((4-nitrophenyl)amino)-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)allyl)carbamate (0.3 g, 77%).


ESI-MS m/z: 495 (M+H)+


(Step 6)

tert-Butyl ((E)-3-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)allyl)carbamate (0.25 g, 88%) was obtained from tert-butyl (E)-(3-((2S*,4R*)-2-methyl-4-((4-nitrophenyl)amino)-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)allyl)carbamate (0.3 g, 0.61 mmol) obtained in step 5 in the same manner as in step 2 of reference example 16. ESI-MS m/z: 465 (M+H)+


Reference Example 21
tert-Butyl 4-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)-3,6-dihydropyridine-1(2H)-carboxylate
(Step 1)

1-((2S*,4R*)-7-Bromo-2-methyl-4-((4-nitrophenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.18 g, 25%) obtained in step 4 of reference example 20 was dissolved in a mixed solvent (6 mL) of 1,2-dimethoxyethane and water (5:1), then tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydropyridine-1(2H)-carboxylate (0.388 g, 1.25 mmol), lithium chloride (0.052 g, 1.25 mmol), sodium carbonate (0.177 g, 1.67 mmol) and Pd(PPh3)4 (0.096 g, 0.08 mmol) were added to the solution and the mixture was stirred at 100° C. for 2 hours under an argon atmosphere. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=7/3) to give tert-butyl 4-((2S*,4R*)-2-methyl-4-((4-nitrophenyl)amino)-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)-3,6-dihydropyridine-1(2H)-carboxylate (0.3 g, 68%).


ESI-MS m/z: 521 (M+H)+


(Step 2)

tert-Butyl 4-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)-3,6-dihydropyridine-1(2H)-carboxylate (0.25 g, 88%) was obtained from tert-butyl 4-((2S*,4R*)-2-methyl-4-((4-nitrophenyl)amino)-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)-3,6-dihydropyridine-1(2H)-carboxylate (0.3 g, 0.57 mmol) obtained in step 1 in the same manner as in step 2 of reference example 16.


Reference Example 22
4-(2,3,9-Trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline

4-(4-Bromophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine (2.0 g, 5.17 mmol) obtained in step 3 of reference example 4 was dissolved in DMSO (30 mL), then copper iodide (0.196 g, 1.03 mmol), 1,2-dimethylethylenediamine (0.136 g, 1.55 mmol) and 28% aqueous ammonia (150 mL) were added to the solution, and the mixture was stirred at 130° C. for 16 hours. A saturated aqueous sodium sulfate solution was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile) to give 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline (0.850 g, 19%).


ESI-MS m/z: 324 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.71 (s, 3H), 2.40 (s, 3H), 2.57 (s, 3H), 4.00 (d, J=12.47 Hz, 1H), 5.09 (d, J=12.72 Hz, 1H), 5.57 (s, 2H), 6.52 (d, J=8.80 Hz, 2H), 7.15 (d, J=8.0 Hz, 2H).


Reference Example 23
1-(4-Aminobenzyl)-2-ethyl-1,5,6,7-tetra hydro-4H-indol-4-one
(Step 1)

2-(2-Oxobutyl)cyclohexane-1,3-dione (1.7 g, 9.34 mmol) synthesized according to the method described in the literature (Eur. J. of Org. Chem. 2016, 5169-5179) was dissolved in toluene (20 ml), then tert-butyl (4-(aminomethyl)phenyl)carbamate (2.49 g, 11.21 mmol) was added to the solution, and the mixture was stirred at room temperature for 10 minutes, then refluxed for 4 hours, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate/petroleum ether=1/4 to 1/2) to give tert-butyl (4-((2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)phenyl)carbamate (0.550 g, 16%).


ESI-MS m/z: 369 (M+H)+


(Step 2)

1-(4-Aminobenzyl)-2-ethyl-1,5,6,7-tetrahydro-4H-indol-4-one (0.350 g, 87%) was obtained from tert-butyl (4-((2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)phenyl)carbamate (0.550 g, 1.49 mmol) obtained in step 1 in the same manner as in step 1 of example 8h.


ESI-MS m/z: 269 (M+H)+


Reference Example 24
1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylic acid
(Step 1)

Commercially available ethyl 3-bromo-5-hydroxybenzaldehyde (0.25 g, 1.24 mmol) was dissolved in a mixed solvent (3 mL) of 1,4-dioxane and water (2:1), then commercially available 3,5-dimethyl-4-(4,4,5,5-tetra methyl-1,3,2-dioxaborolan-2-yl)isoxazole (0.332 g, 1.49 mmol), tripotassium phosphate (0.791 g, 3.73 mmol) and Pd(dppf)Cl2 (0.09 g, 0.12 mmol) were added to the solution, and the mixture was stirred at 100° C. for 4 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by column chromatography (ethyl acetate/petroleum ether=30/70) to give 3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzaldehyde (0.17 g, 63%).


ESI-MS m/z: 218 (M+H)+


(Step 2)

Ethyl 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylate (0.75 g, 23%) was obtained from 3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzaldehyde (2.0 g, 9.22 mmol) obtained in step 1 and commercially available ethyl piperidine-4-carboxylate (1.73 g, 11.06 mmol) in the same manner as in step 1 of example 7d.


ESI-MS m/z: 359 (M+H)+


(Step 3)

1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylic acid (0.295 g, 58%) was obtained from ethyl 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylate (0.55 g, 1.54 mmol) obtained in step 2 in the same manner as in step 2 of example 3d.


ESI-MS m/z: 331 (M+H)+


Reference Example 25
3-((4-Aminopiperidin-1-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol dihydrochloride
(Step 1)

tert-Butyl (1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidin-4-yl)carbamate (0.76 g, 21%) was obtained from 3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzaldehyde (2.0 g, 9.22 mmol) obtained in step 1 of reference example 24 and commercially available tert-butyl piperidin-4-ylcarbamate (1.84 g, 9.22 mmol) in the same manner as in step 1 of example 7d.


ESIMS, (M+H)+, m/z: 402.35.


(Step 2)

3-((4-Aminopiperidin-1-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol dihydrochloride (0.23 g, 7%) was obtained from tert-butyl (1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidin-4-yl)carbamate (0.740 g, 1.84 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 302.27. 1H NMR (DMSO-d6, δ): 1.91-2.07 (m, 4H), 2.25 (s, 3H), 2.43 (s, 3H), 2.73-2.89 (m, 2H), 3.19-3.25 (m, 3H), 3.96-4.11 (m, 2H), 6.81-7.03 (m, 3H), 8.14 (s, 1H), 8.24-8.29 (m, 3H), 9.89 (brs, 1H).


Reference Example 26

(S)-4-(6-(2-(2-(Dimethylamino)ethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid


(Step 1)

(S)-4-{6-[2-(tert-Butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (1.0 g, 2.14 mmol) obtained in reference example 3 was dissolved in DMF (5 mL), then potassium carbonate (0.88 g, 6.44 mmol) and benzyl bromide (0.55 g, 3.22 mmol) were added to the solution. The mixture was stirred at 100° C. for 2 hours. Water was added to the reaction mixture, and the precipitated solid was collected by filtration and dried under reduced pressure to give benzyl (S)-4-(6-(2-(tert-butoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (1.1 g, 92%).


ESI-MS m/z: 557 (M+H)+


(Step 2)

Benzyl (S)-4-(6-(2-(tert-butoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (1.1 g, 1.98 mmol) obtained in step 1 was dissolved in 1,4-dioxane (5 mL), then hydrogen chloride/1,4-dioxane solution (4 mol/L, 5.0 mL, 20 mmol) was added to the solution and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture, and the aqueous layer was extracted twice with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by column chromatography (methylene chloride/methanol=95/5) to give (S)-2-(4-(4-((benzyloxy)carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (0.8 g, 80%).


ESI-MS m/z: 501 (M+H)+


(Step 3)

A crude product of benzyl (S)-4-(6-(2-(2-(dimethylamino)ethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.165 g) was obtained from (S)-2-(4-(4-((benzyloxy)carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (0.250 g, 0.5 mmol) obtained in step 2 and 2-(dimethylamino)ethan-1-ol (0.044 g, 0.5 mmol) in the same manner as in step 1 of example 1a.


ESI-MS m/z: 572 (M+H)+


(Step 4)

The crude product of benzyl (S)-4-(6-(2-(2-(dimethylamino)ethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate obtained in step 3 (0.165 g) was dissolved in methanol (5 mL), then palladium on carbon (0.05 g, 10 wt %) was added to the solution, and the mixture was stirred at room temperature for 2 hours under a hydrogen atmosphere. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure to obtain a crude product of (S)-4-(6-(2-(2-(dimethylamino)ethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.300 g).


ESI-MS m/z: 482 (M+H)+


Reference Example 27
4-((S)-6-(2-(((1r,4S)-4-Hydroxycyclohexyl)oxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid
(Step 1)

(S)-2-(4-(4-((Benzyloxy)carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (0.250 g, 0.5 mmol) obtained in step 2 of reference example 26 was dissolved in chloroform (5 mL), then p-toluenesulfonic acid (0.019 g, 0.1 mmol) and trans-1,4-cyclohexanediol (0.290 g, 2.5 mmol) were added to the solution and the mixture was stirred at 70° C. for 36 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% formic acid aqueous solution=45/55) to give benzyl 4-((S)-6-(2-(((1r,4S)-4-hydroxycyclohexyl)oxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.110 g, 37%).


ESIMS, (M+H)+, m/z: 599.23.


(Step 2)

4-((S)-6-(2-(((1r,4S)-4-Hydroxycyclohexyl)oxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.115 g, 90%) was obtained from benzyl 4-((S)-6-(2-(((1r,4S)-4-hydroxycyclohexyl)oxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.150 g, 0.25 mmol) obtained in step 1 in the same manner as in step 4 of reference example 26.


ESIMS, (M+H)+, m/z: 509.34: 1H NMR (DMSO-d6, δ) 1.23-1.32 (m, 2H), 1.37-1.45 (m, 2H), 1.60 (s, 3H), 1.75-1.78 (m, 2H), 1.85-1.91 (m, 2H), 2.42 (s, 3H), 2.61 (s, 3H), 3.17 (d, J=5.38 Hz, 1H), 3.40 (dd, J=8.80, 6.36 Hz, 1H), 3.46-3.55 (m, 1H), 4.49-4.56 (m, 2H), 4.70-4.74 (m, 1H), 7.51 (d, J=8.31 Hz, 2H), 7.97 (d, J=8.4 Hz, 2H), 13.17 (brs, 1H).


Reference Example 28

(S)-4-(6-(2-(Ethylamino)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid


(Step 1)

Benzyl (S)-4-(6-(2-(ethylamino)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.180 g, 86%) was obtained from (S)-2-(4-(4-((benzyloxy)carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (0.200 g, 0.4 mmol) obtained in step 2 of reference example 26 and ethylamine (2 mol/L THF solution, 0.6 ml, 1.2 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 528.24.


(Step 2)

(S)-4-(6-(2-(Ethylamino)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.135 g, 90%) was obtained from benzyl (S)-4-(6-(2-(ethylamino)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.180 g, 0.34 mmol) obtained in step 1 in the same manner as in step 4 of reference example 26.


ESIMS, (M+H)+, m/z: 438.


Reference Example 29
(S)-4-(6-(2-(4-(2-Hydroxyethyl)piperazin-1-yl)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid
(Step 1)

A crude product (0.140 g) of benzyl (S)-4-(6-(2-(4-(2-hydroxyethyl)piperazin-1-yl)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate was obtained from (S)-2-(4-(4-((benzyloxy)carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (0.150 g, 0.3 mmol) obtained in step 2 of reference example 26, and 2-(piperazin-1-yl)ethan-1-ol (0.039 g, 0.3 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 613.27.


(Step 2)

(S)-4-(6-(2-(4-(2-Hydroxyethyl)piperazin-1-yl)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.062 g, 80%) was obtained from the crude product (0.140 g) of benzyl (S)-4-(6-(2-(4-(2-hydroxyethyl)piperazin-1-yl)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate obtained in step 1 in the same manner as in step 4 of reference example 26.


ESIMS, (M+H)+, m/z: 523.


Reference Example 30
(S)-4-(6-(2-(3-Methoxypropoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (Step 1)

Benzyl (S)-4-(6-(2-(3-methoxypropoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.192 g, 56%) was obtained from (S)-2-(4-(4-((benzyloxy)carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (0.3 g, 0.6 mmol) obtained in step 2 of reference example 26 and 3-methoxypropan-1-ol (0.540 g, 6 mmol) in the same manner as in step 1 of reference example 27.


ESIMS, (M+H)+, m/z: 573.31.


(Step 2)

(S)-4-(6-(2-(3-Methoxypropoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.130 g, 80%) was obtained from benzyl (S)-4-(6-(2-(3-methoxypropoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.192 g, 0.33 mmol) obtained in step 1 in the same manner as in step 4 of reference example 26.


ESIMS, (M+H)+, m/z: 483.


Reference Example 31

(S)-4-(6-(2-(2-Methoxyethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (Step 1) Benzyl (S)-4-(6-(2-(2-methoxyethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.2 g, 59%) was obtained from (S)-2-(4-(4-((benzyloxy)carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (0.3 g, 0.6 mmol) obtained in step 2 of reference example 26, and 2-methoxyethan-1-ol (0.456 g, 6 mmol) in the same manner as in step 1 of reference example 27.


ESIMS, (M+H)+, m/z: 559.29.


(Step 2)

(S)-4-(6-(2-(2-Methoxyethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.125 g, 75%) was obtained from benzyl (S)-4-(6-(2-(2-methoxyethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoate (0.2 g, 0.36 mmol) obtained in step 1 in the same manner as in step 4 of reference example 26.


ESIMS, (M+H)+, m/z: 469.


Reference Example 32
4-((2-((2-(Dimethylamino)ethoxy)carbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid
(Step 1)

Aluminum chloride (4.73 g, 35.6 mmol) was dissolved in dichloromethane (25 mL), then 1,5,6,7-tetrahydro-4H-indol-4-one (2.0 g, 14.9 mmol) was added to the solution, and the mixture was stirred at −40° C. for 5 minutes. Trichloroacetyl chloride (2.02 mL, 17.8 mmol) was added to the reaction mixture, and the mixture was stirred at −40° C. for 5 minutes and then at room temperature for 16 hours. A saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the aqueous layer was extracted twice with dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by column chromatography (petroleum ether/ethyl acetate=7/3 to 6/4) to give 2-(2,2,2-trichloroacetyl)-1,5,6,7-tetrahydro-4H-indol-4-one (2.0 g, 48%).


ESIMS, (M+H)+, m/z: 280.03.


(Step 2)

2-(2,2,2-Trichloroacetyl)-1,5,6,7-tetra hydro-4H-indol-4-one (2.0 g, 7.17 mmol) obtained in step 1 was dissolved in methanol (15 mL), then sodium methoxide (0.425 g, 7.88 mmol) was added to the solution, and the mixture was stirred at room temperature for 5 hours. The reaction mixture was diluted with hydrochloric acid (1 mol/L), and the aqueous layer was extracted with dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give methyl 4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (1.0 g, 72%).


ESIMS, (M+H)+, m/z: 194.11.


(Step 3)

Methyl 4-oxo-4,5,6,7-tetra hydro-1H-indole-2-carboxylate (1.0 g, 5.18 mmol) obtained in step 2 was dissolved in acetonitrile (10 mL), then potassium carbonate (1.43 g, 10.36 mmol) was added to the solution, and the mixture was stirred at room temperature for 5 minutes. tert-Butyl 4-(bromomethyl)benzoate (1.4 g, 5.18 mmol) was added to the reaction mixture, and the mixture was stirred at 80° C. for 16 hours. The reaction mixture was concentrated under reduced pressure, then water was added, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by column chromatography (ethyl acetate/petroleum ether=1/4) to give methyl 1-(4-(tert-butoxycarbonyl) benzyl)-4-oxo-4,5,6,7-tetra hydro-1H-indole-2-carboxylate (1.45 g, 73%).


ESIMS, (M+H)+, m/z: 384.21.


(Step 4)

1-(4-(tert-Butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylic acid (0.900 g, 64%) was obtained from methyl 1-(4-(tert-butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (1.45 g, 3.78 mmol) obtained in step 3 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 370.22.


(Step 5)

2-(Dimethylamino)ethyl 1-(4-(tert-butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (0.280 g, 81%) was obtained from 1-(4-(tert-butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylic acid (0.3 g, 0.81 mmol) obtained in step 4 and 2-(dimethylamino)ethan-1-ol (0.12 mL, 1.22 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 441.46.


(Step 6)

4-((2-((2-(Dimethylamino)ethoxy)carbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid (0.150 g, 61%) was obtained from 2-(dimethylamino)ethyl 1-(4-(tert-butoxycarbonyl) benzyl)-4-oxo-4,5,6,7-tetra hydro-1H-indole-2-carboxylate (0.280 g, 0.64 mmol) obtained in step 5 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 385: 1H NMR (DMSO-d6, δ) δ2.04 (t, J=6.0 Hz, 2H), 2.40 (t, J=6.4 Hz, 2H), 2.45 (s, 6H), 2.75 (t, J=6.0 Hz, 2H), 2.90-2.92 (m, 2H), 4.32 (t, J=5.2 Hz, 2H), 5.69 (s, 2H), 7.12 (d, J=8.4 Hz, 2H), 7.30 (s, 1H), 7.90 (d, J=8.0 Hz, 2H).


Reference Example 33
4-((2-((2-Hydroxyethoxy)carbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid
(Step 1)

The mixture of 2-((tert-butyldimethylsilyl)oxy)ethyl 1-(4-(tert-butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate and 2-hydroxyethyl 1-(4-(tert-butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetra hydro-1H-indole-2-carboxylate was obtained as a crude product (0.350 g) from 1-(4-(tert-butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylic acid (0.3 g, 0.81 mmol) obtained in step 4 of reference example 32 and 2-((tert-butyldimethylsilyl)oxy)ethan-1-ol (0.19 mL, 0.97 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 528.36.


(Step 2)

A crude product (0.3 g) of 4-((2-((2-hydroxyethoxy)carbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid was obtained from the crude products (0.350 g) of 2-((tert-butyldimethylsilyl)oxy)ethyl 1-(4-(tert-butoxycarbonyl) benzyl)-4-oxo-4,5,6,7-tetra hydro-1H-indole-2-carboxylate and 2-hydroxyethyl 1-(4-(tert-butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 358.35.


Reference Example 34
4-((2-(Methoxycarbonyl)-4-oxo-4,5,6,7-tetra hydro-1H-indol-1-yl)methyl)benzoic acid

4-((2-(Methoxycarbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid (0.1 g, 81%) was obtained from methyl 1-(4-(tert-butoxycarbonyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (0.145 g, 0.37 mmol) obtained in step 3 of reference example 32 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 328: 1H NMR (CDCl3, δ) δ2.13-2.18 (m, 2H), 2.53 (t, J=6.5 Hz, 2H), 2.69 (t, J=6.10 Hz, 2H), 3.78 (s, 3H), 5.69 (s, 2H), 7.06 (d, J=8.5 Hz, 2H), 7.44 (s, 1H), 8.05 (d, J=8.5 Hz, 2H).


Reference Example 35
3-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[1.1.1]pentane-1-carboxylic acid
(Step 1)

Methyl 3-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[1.1.1]pentane-1-carboxylate (0.110 g, 67%) was obtained from 1-[(2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (0.100 g, 0.46 mmol) obtained in step 3 of reference example 1 and methyl 3-formylbicyclo[1.1.1]pentane-1-carboxylate (0.085 g, 0.55 mmol) in the same manner as in step 3 of example 5b.


ESIMS, (M+H)+, m/z: 357.


(Step 2)

3-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[1.1.1]pentane-1-carboxylic acid (0.09 g, 86%) was obtained from methyl 3-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[1.1.1]pentane-1-carboxylate (0.110 g, 0.31 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 343.


Reference Example 36

4-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[2.2.2]octane-1-carboxylic acid (Step 1) Methyl 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[2.2.2]octane-1-carboxylate (0.280 g, 77%) was obtained from 1-[(2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (0.200 g, 0.91 mmol) obtained in step 3 of reference example 1 and 4-formylbicyclo[2.2.2]octane-1-carboxylate (0.180 g, 0.91 mmol) in the same manner as in step 3 of example 5b.


ESIMS, (M+H)+, m/z: 399


(Step 2)

A crude product (0.160 g) of 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[2.2.2]octane-1-carboxylic acid was obtained from methyl 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[2.2.2]octane-1-carboxylate (0.106 g, 0.53 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 385.


Reference Example 37
3-(3,5-Dimethylisoxazol-4-yl)-5-(piperazin-1-ylmethyl)phenol trifluoroacetate
(Step 1)

tert-Butyl 4-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperazine-1-carboxylate (0.500 g, 56%) was obtained from 3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzaldehyde (0.500 g, 2.30 mmol) obtained in step 1 of reference example 24 and tert-butyl piperazine-1-carboxylate (0.429 g, 2.30 mmol) in the same manner as in step 3 of example 5b.


ESIMS, (M+H)+, m/z: 388.


(Step 2)

A crude product (0.500 g) of 3-(3,5-dimethylisoxazol-4-yl)-5-(piperazin-1-ylmethyl)phenol trifluoroacetate was obtained from tert-butyl 4-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperazine-1-carboxylate (0.480 g, 1.24 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H−TFA)+, m/z: 288.


Reference Example 38
3-((6-Amino-2-azaspiro[3.3]heptan-2-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol trifluoroacetate
(Step 1)

tert-Butyl (2-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)-2-azaspiro[3.3]heptan-6-yl)carbamate (0.230 g, 61%) was obtained from 3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzaldehyde (0.200 g, 0.92 mmol) obtained in step 1 of reference example 24 and tert-butyl (2-azaspiro[3.3]heptan-6-yl)carbamate (0.234 g, 1.10 mmol) in the same manner as in step 3 of example 5b.


ESIMS, (M+H)+, m/z: 415.


(Step 2)

A crude product (0.200 g) of 3-((6-amino-2-azaspiro[3.3]heptan-2-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol trifluoroacetate was obtained from tert-butyl (2-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)-2-azaspiro[3.3]hepta n-6-yl)carbamate (0.200 g, 0.47 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H−TFA)+, m/z: 314.


Reference Example 39
1-(((1r,4r)-4-Aminocyclohexyl)methyl)-2-ethyl-1,5,6,7-tetrahydro-4H-indol-4-one hydrochloride
(Step 1)

tert-Butyl ((1r,4r)-4-((2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)cyclohexyl)carbamate (0.110 g, 27%) was obtained from 2-(2-oxobutyl)cyclohexane-1,3-dione (0.2 g, 1.09 mmol) synthesized according to the method described in the literature (Eur. J. of Org. Chem. 2016, 5169-5179) and tert-butyl ((1r,4r)-4-(aminomethyl)cyclohexyl)carbamate (0.498 g, 2.18 mmol) in the same manner as in step 1 of reference example 5.


ESIMS, (M+H)+, m/z: 376.


(Step 2)

A crude product of 1-(((1r,4r)-4-aminocyclohexyl)methyl)-2-ethyl-1,5,6,7-tetrahydro-4H-indol-4-one hydrochloride (0.080 g, 64%) was obtained from tert-butyl a1r,4r)-4-((2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)cyclohexyl)carbamate (0.110 g, 0.40 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H−HCl)+, m/z: 276.


Reference Example 40
(R)-4-(2-(4-Aminophenoxy)ethyl)-1,3-dimethylpiperazin-2-one
(Step 1)

tert-Butyl (4-(2-chloroethoxy)phenyl)carbamate (137 mg, 87%) was obtained from commercially available (4-(2-chloroethoxy)phenyl)carbamate (100 mg, 0.583 mmol) in the same manner as in step 1 of reference example 8.



1H-NMR (CDCl3,δ): 1.53 (s, 9H), 3.80 (d, J=6.0 Hz, 2H), 4.20 (d, J=6.0 Hz, 2H), 6.36 (brs, 1H), 6.86 (d, J=8.8 Hz, 2H), 7.25-7.30 (m, 2H).


(Step 2)

tert-Butyl (4-(2-chloroethoxy)phenyl)carbamate (47.8 mg, 0.176 mmol) obtained in step 1 was dissolved in DMA (1.0 ml), and commercially available (R)-1,3-dimethylpiperazin-2-one (31.5 mg, 0.246 mmol), N,N-diisopropylethylamine (0.138 ml, 0.792 mmol) and potassium iodide (35.0 mg, 0.211 mmol) were added to the solution, and the mixture was stirred at 100° C. for 17 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution and extracted 3 times with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=100/0 to 98/2) to give tert-butyl (R)-(4-(2-(2,4-dimethyl-3-oxopiperazin-1-yl)ethoxy)phenyl)carbamate (27.9 mg, 44%). ESIMS, (M+H)+, m/z: 364.


(Step 3)

A crude product (27.9 mg) of (R)-4-(2-(4-aminophenoxy)ethyl)-1,3-dimethylpiperazin-2-one trifluoroacetate was obtained from tert-butyl (R)-(4-(2-(2,4-dimethyl-3-oxopiperazin-1-yl)ethoxy)phenyl)carbamate (27.4 mg, 0.075 mmol) obtained in step 2 in the same manner as in step 2 of example 1k.


ESIMS, (M+H−TFA)+, m/z: 264.


Reference Example 41
Methyl (R)-4-(2-(2,4-dimethyl-3-oxopiperazin-1-yl)ethoxy)benzoate

Methyl (R)-4-(2-(2,4-dimethyl-3-oxopiperazin-1-yl)ethoxy)benzoate (63.1 mg, 89%) was obtained from commercially available (R)-1,3-dimethylpiperazin-2-one (41.6 mg, 0.325 mmol) and methyl 4-(2-bromoethoxy)benzoate (60.0 mg, 0.232 mmol) in the same manner as in step 2 of reference example 40.


ESIMS, (M+H)+, m/z: 307.


Reference Example 42
5-(2-((4-Aminopiperidin-1-yl)methyl)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one dihydrochloride
(Step 1)

Commercially available 5-bromo-4-chloropyridin-2-amine (10.0 g, 48.31 mmol) was dissolved in sulfuric acid (200 ml), an aqueous solution (100 mL) of sodium nitrite (3.66 g, 53.14 mmol) was added to the solution at 0° C., and the mixture was stirred at room temperature for 2 hours. Ice water was added to the reaction mixture, and the precipitated solid was collected by filtration and washed with diethyl ether to give 5-bromo-4-chloropyridin-2(1H)-one (7.5 g, 75%).


ESIMS, (M+H)+, m/z: 208.


(Step 2)

5-Bromo-4-chloropyridin-2(1H)-one (18.0 g, 86.99 mmol) obtained in step 1 was dissolved in DMF (200 ml), then cesium carbonate (31.18 g, 95.70 mmol) was added to the solution, and the mixture was stirred at room temperature for 15 minutes. Subsequently, methyl iodide (6.5 mL, 104.40 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was diluted with water and extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was washed with n-pentane to give 5-bromo-4-chloro-1-methylpyridin-2(1H)-one (11.3 g, 59%).


ESIMS, (M+H)+, m/z: 222.


(Step 3)

5-Bromo-4-chloro-1-methylpyridin-2(1H)-one (10.0 g, 45.25 mmol) obtained in step 2 was dissolved in methanol (100 ml), then a solution of 25% sodium methoxide in methanol (39.09 mL, 180.99 mmol) was added to the solution, and the mixture was stirred at 70° C. for 5 hours. The reaction mixture was cooled to room temperature and concentrated under reduced pressure. The obtained residue was diluted with water and extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was washed with diethyl ether to give 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (7.0 g, 71%).


ESIMS, (M+H)+, m/z: 218.


(Step 4)

2-(4-Methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzaldehyde (0.220 g, 79%) was obtained from 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (0.250 g, 1.15 mmol) obtained in step 3 and commercially available (2-formylphenyl)boronic acid (0.206 g, 1.38 mmol) in the same manner as in step 1 of reference example 21.


ESIMS, (M+H)+, m/z: 244.


(Step 5)

tert-Butyl (1-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-4-yl)carbamate (0.240 g, 62%) was obtained from 2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzaldehyde (0.220 g, 0.90 mmol) obtained in step 4 and tert-butyl piperidin-4-ylcarbamate (0.181 g, 0.90 mmol) in the same manner as in step 3 of example 6d.


ESIMS, (M+H)+, m/z: 428.


(Step 6)

5-(2-((4-Aminopiperidin-1-yl)methyl)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one dihydrochloride (0.180 g, 80%) was obtained from tert-butyl (1-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-4-yl)carbamate (0.240 g, 0.56 mmol) obtained in step 5 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 328.


Reference Example 43
N-(4-((3-Aminopiperidin-1-yl)methyl)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide
(Step 1)

A crude product (3.2 g) of 4-nitro-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzaldehyde was obtained from commercially available 2-bromo-4-nitrobenzaldehyde (4.0 g, 17.47 mmol) in the same manner as in step 1 of example 5n.



1H-NMR (CDCl3,δ): 1.27 (s, 12H), 8.20-8.23 (m, 2H), 8.53 (dd, J=8.5, 2.5 Hz, 1H), 9.95 (s, 1H).


(Step 2)

The crude product (3.57 g) of 4-nitro-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzaldehyde obtained in step 1 and 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (1.0 g, 4.61 mmol) obtained in step 3 of reference example 42 were dissolved in a mixed solvent of 1,4-dioxane and water (75 mL, 2:1), then tripotassium phosphate (2.93 g, 13.82 mmol), Pd2(dba)3 (0.422 g, 0.46 mmol), and 1,3,5,7-tetramethyl-6-phenyl-2,4,8-trioxa-6-phosphaadamantane (0.148 g, 0.50 mmol) were added to the solution, and the mixture was stirred at 90° C. for 2 hours. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=95/5) to give 2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)-4-nitrobenzaldehyde (0.7 g, total yield of 2 steps 53%).


ESIMS, (M+H)+, m/z: 289.


(Step 3)

tert-Butyl (1-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)-4-nitrobenzyl)piperidin-3-yl)carbamate (0.400 g, 35%) was obtained from 2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)-4-nitrobenzaldehyde (0.7 g, 2.43 mmol) obtained in step 2 and tert-butyl piperidin-3-ylcarbamate (0.486 g, 2.43 mmol) in the same manner as in step 3 of example 6d.


ESIMS, (M+H)+, m/z: 474.


(Step 4)

tert-Butyl (1-(4-amino-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-3-yl)carbamate (0.340 g, 90%) was obtained from tert-butyl (1-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)-4-nitrobenzyl)piperidin-3-yl)carbamate (0.400 g, 0.84 mmol) obtained in step 3 in the same manner as in step 2 of reference example 7.


ESIMS, (M+H)+, m/z: 444.


(Step 5)

tert-Butyl (1-(4-(N-(ethylsulfonyl)ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-3-yl)carbamate (0.250 g, 52%) was obtained from tert-butyl (1-(4-amino-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-3-yl)carbamate (0.340 g, 0.77 mmol) obtained in step 4 and ethanesulfonyl chloride (0.146 mL, 1.54 mmol) in the same manner as in step 1 of example 4c.


ESIMS, (M+H)+, m/z: 628.


(Step 6)

tert-Butyl (1-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-3-yl)carbamate (0.200 g, 94%) was obtained from tert-butyl (1-(4-(N-(ethylsulfonyl)ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-3-yl)carbamate (0.250 g, 0.40 mmol) obtained in step 5 in the same manner as in step 6 of reference example 46.


ESIMS, (M+H)+, m/z: 535.


(Step 7)

A crude product (0.180 g) of N-(4-((3-aminopiperidin-1-yl)methyl)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide hydrochloride was obtained from tert-butyl (1-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-3-yl)carbamate (0.200 g, 0.37 mmol) obtained in step 5 in the same manner as in step 2 of example 1a.


ESIMS, (M+H−HCl)+, m/z: 435.


Reference Example 44
5-(2-(3-Aminophenoxy)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one
(Step 1)

tert-Butyl (3-(2-bromophenoxy)phenyl)carbamate (0.800 g, 38%) was obtained from commercially available 2-bromophenol (1.0 g, 5.81 mmol) and commercially available (3-((tert-butoxycarbonyl)amino)phenyl)boronic acid (1.79 g, 7.56 mmol) in the same manner as in step 1 of reference example 45.


ESIMS, (M+H)+, m/z: 364.


(Step 2)

A crude product (2.8 g) of tert-butyl (3-(2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)phenyl)carbamate was obtained from tert-butyl (3-(2-bromophenoxy)phenyl)carbamate (10.0 g, 27.55 mmol) obtained in step 1 in the same manner as in step 1 of example 5n.


ESIMS, (M+H)+, m/z: 413.


(Step 3)

tert-Butyl (3-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)carbamate (0.800 g, total yield of 2 steps 41%) was obtained from the crude product (4.73 g) of tert-butyl (3-(2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)phenyl)carbamate obtained in step 2 and 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (1.0 g, 4.61 mmol) obtained in step 3 of reference example 42 in the same manner as in step 1 of reference example 21.


ESIMS, (M+H)+, m/z: 423.


(Step 4)

A crude product (0.540 g) of 5-(2-(3-aminophenoxy)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one hydrochloride was obtained from tert-butyl (3-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)carbamate (0.80 g, 1.89 mmol) obtained in step 3 in the same manner as in step 2 of example 1a.


ESIMS, (M+H−HCl)+, m/z: 323.


Reference Example 45
3-(2-(4-Methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoic acid
(Step 1)

Commercially available 2-bromophenol (10.0 g, 57.80 mmol) was dissolved in dichloromethane (150 mL), then commercially available (3-(ethoxycarbonyl)phenyl)boronic acid (16.82 g, 86.70 mmol), copper(II) acetate (15.69 g, 86.70 mmol) and pyridine (23.3 mL, 289.01 mmol) were added to the solution, and the mixture was stirred at room temperature for 48 hours under an oxygen atmosphere. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=100/0 to 98/2) to give ethyl 3-(2-bromophenoxy)benzoate (3.5 g, 21%).


ESIMS, (M+H)+, m/z: 321.


(Step 2)

Ethyl 3-(2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)benzoate (7.0 g, 85%) was obtained from ethyl 3-(2-bromophenoxy)benzoate (7.2 g, 22.5 mmol) obtained in step 1 in the same manner as in step 1 of example 5n.


ESIMS, (M+H)+, m/z: 369.


(Step 3)

Ethyl 3-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoate (2.0 g, 57%) was obtained from ethyl 3-(2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)benzoate (6.78 g, 18.43 mmol) obtained in step 2 and 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (2.0 g, 9.21 mmol) obtained in step 3 of reference example 42 in the same manner as in step 1 of reference example 21.


ESIMS, (M+H)+, m/z: 380.


(Step 4)

3-(2-(4-Methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoic acid (0.71 g, 77%) was obtained from ethyl 3-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoate (1.0 g, 2.63 mmol) obtained in step 3 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 352.


Reference Example 46
N-(4-(3-Aminophenoxy)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide
(Step 1)

tert-Butyl (3-(2-bromo-4-nitrophenoxy)phenyl)carbamate (8.0 g, 86%) was obtained from commercially available 2-bromo-1-fluoro-4-nitrobenzene (5.0 g, 22.73 mmol) and commercially available tert-butyl (3-hydroxyphenyl)carbamate (5.22 g, 25.00 mmol) in the same manner as in step 2 of reference example 48.


ESIMS, (M+H)+, m/z: 409.


(Step 2)

tert-Butyl (3-(4-amino-2-bromophenoxy)phenyl)carbamate (7.0 g, 95%) was obtained from tert-butyl (3-(2-bromo-4-nitrophenoxy)phenyl)carbamate (5.0 g, 22.73 mmol) obtained in step 1 in the same manner as in step 2 of reference example 7.


ESIMS, (M+H)+, m/z: 381.


(Step 3)

A crude product (8.5 g) of tert-butyl (3-(4-amino-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)phenyl)carbamate was obtained from tert-butyl (3-(4-amino-2-bromophenoxy)phenyl)carbamate (5.0 g, 13.18 mmol) obtained in step 2 in the same manner as in step 1 of example 5n.


ESIMS, (M+H)+, m/z: 428.


(Step 4)

tert-Butyl (3-(4-amino-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)carbamate (1.0 g, total yield of 2 steps 25%) was obtained from the crude product (7.82 g) of (3-(4-amino-2-(4,4,5,5-tetramethyl-1,3,2-dioxa borolan-2-yl)phenoxy)phenyl)carbamate obtained in step 3 and 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (2.0 g, 9.17 mmol) obtained in step 3 of reference example 42 in the same manner as in step 2 of reference example 43.


ESIMS, (M+H)+, m/z: 438.


(Step 5)

A crude product (1.1 g) of tert-butyl (3-(4-(N-(ethylsulfonyl)ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)carbamate was obtained from tert-butyl (3-(4-amino-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)carbamate (1.0 g, 2.28 mmol) obtained in step 4 and ethanesulfonyl chloride (0.26 mL, 2.74 mmol) in the same manner as in step 1 of example 4c.


ESIMS, (M+H)+, m/z: 622.


(Step 6)

The crude product (1.6 g) of tert-butyl (3-(4-(N-(ethylsulfonyl)ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)carbamate obtained in step 5 was dissolved in a mixed solvent of THF and water (30 mL, 2:1), then lithium hydroxide monohydrate (0.433 g, 10.30 mmol) was added to the solution, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was diluted with ice water and the aqueous layer was extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (acetonitrile/0.1% formic acid aqueous solution=50/50) to give tert-butyl (3-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)carbamate (0.750 g, total yield of 2 steps 55%).


ESIMS, (M+H)+, m/z: 530.


(Step 7)

N-(4-(3-Aminophenoxy)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide hydrochloride (1.06 g, 65%) was obtained from tert-butyl (3-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)carbamate (1.25 g, 2.36 mmol) obtained in step 6 in the same manner as in step 2 of example 1a.


ESIMS, (M+H—HCl)+, m/z: 430.


Reference Example 47
3-(4-(Ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoic acid
(Step 1)

Ethyl 3-(2-bromo-4-nitrophenoxy)benzoate (13.0 g, 78%) was obtained from commercially available 2-bromo-1-fluoro-4-nitrobenzene (10.0 g, 45.45 mmol) and commercially available ethyl 3-hydroxybenzoate (8.29 g, 49.99 mmol) in the same manner as in step 2 of reference example 48.


ESIMS, (M+H)+, m/z: 366.


(Step 2)

Ethyl 3-(4-amino-2-bromophenoxy)benzoate (10 g, 83%) was obtained from ethyl 3-(2-bromo-4-nitrophenoxy)benzoate (13.0 g, 35.61 mmol) obtained in step 1 in the same manner as in step 2 of reference example 7.


ESIMS, (M+H)+, m/z: 336.


(Step 3)

A crude product (14.0 g) of ethyl 3-(4-amino-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)benzoate was obtained from ethyl 3-(4-amino-2-bromophenoxy)benzoate (10 g, 29.85 mmol) obtained in step 2 in the same manner as in step 1 of example 5n.


ESIMS, (M+H)+, m/z: 384.


(Step 4)

Ethyl 3-(4-amino-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoate (5.5 g, total yield of 2 steps 76%) was obtained from the crude product (17.7 g) of ethyl 3-(4-amino-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)benzoate obtained in step 3 and 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (4.0 g, 18.5 mmol) obtained in step 3 of reference example 42 in the same manner as in step 2 of reference example 43.


ESIMS, (M+H)+, m/z: 396.


(Step 5)

Ethyl 3-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoate (2.8 g, 57%) was obtained from ethyl 3-(4-amino-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoate (4.0 g, 10.15 mmol) obtained in step 4 and ethanesulfonyl chloride (0.9 mL, 10.15 mmol) in the same manner as in step 1 of example 4c.


ESIMS, (M+H)+, m/z: 487.


(Step 6)

3-(4-(Ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoic acid (1.8 g, 96%) was obtained from ethyl 3-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoate (2.0 g, 4.11 mmol) obtained in step 5 in the same manner as in step 6 of reference example 46.


ESIMS, (M+H)+, m/z: 459.


Reference Example 48
N-(4-(((1r,4r)-4-Aminocyclohexyl)oxy)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide
(Step 1)

Commercially available 2-bromo-1-fluoro-4-nitrobenzene (1.0 g, 4.54 mmol) was dissolved in DMF (5 mL), then commercially available tert-butyl ((1r,4r)-4-hydroxycyclohexyl)carbamate (0.978 g, 4.54 mmol) and cesium carbonate (4.44 g, 13.64 mmol) were added to the solution, and the mixture was stirred at 120° C. for 16 hours. The reaction mixture was diluted with water and extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=80/20) to give tert-butyl ((1r,4r)-4-(2-bromo-4-nitrophenoxy)cyclohexyl)carbamate (1.2 g, 64%).


ESIMS, (M+H)+, m/z: 415.


(Step 2)

tert-Butyl ((1r,4r)-4-(4-amino-2-bromophenoxy)cyclohexyl)carbamate (0.870 g, 94%) was obtained from tert-butyl ((1r,4r)-4-(2-bromo-4-nitrophenoxy)cyclohexyl)carbamate (1.0 g, 2.41 mmol) obtained in step 1 in the same manner as in step 2 of reference example 7.


ESIMS, (M+H)+, m/z: 385, 387.


(Step 3)

A crude product (1.3 g) of tert-butyl a1r,4r)-4-(4-amino-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)cyclohexyl)carbamate was obtained from tert-butyl a1r,4r)-4-(4-amino-2-bromophenoxy)cyclohexyl)carbamate (0.850 g, 2.21 mmol) obtained in step 2 in the same manner as in step 1 of example 5n.


ESIMS, (M+H)+, m/z: 434.


(Step 4)

tert-Butyl a1r,4r)-4-(4-amino-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)cyclohexyl)carbamate (0.3 g, total yield of 2 steps 74%) was obtained from the crude product (0.792 g) of tert-butyl a1r,4r)-4-(4-amino-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)cyclohexyl)carbamate obtained in step 3 and 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (0.2 g, 0.92 mmol) obtained in step 3 of reference example 42 in the same manner as in step 1 of reference example 21.


ESIMS, (M+H)+, m/z: 445.


(Step 5)

tert-Butyl a1r,4r)-4-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)cyclohexyl)carbamate (0.090 g, 75%) was obtained from tert-butyl a1r,4r)-4-(4-amino-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)cyclohexyl)carbamate (0.100 g, 0.22 mmol) obtained in step 4 and ethanesulfonyl chloride (0.021 mL, 0.22 mmol) in the same manner as in step 1 of example 4c.


ESIMS, (M+H)+, m/z: 537


(Step 6)

A crude product (0.080 g) of N-(4-(((1r,4r)-4-aminocyclohexyl)oxy)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide hydrochloride was obtained from tert-butyl a1r,4r)-4-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)cyclohexyl)carbamate (0.090 g, 0.17 mmol) obtained in step 5 in the same manner as in step 3 of reference example 46.


ESIMS, (M+H−HCl)+, m/z: 436.


Reference Example 49
5-(2-(4-Aminophenoxy)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one
(Step 1)

1-Bromo-2-(4-nitrophenoxy)benzene (1.3 g, 76%) was obtained from commercially available 2-bromophenol (1.0 g, 5.78 mmol) and commercially available 1-fluoro-4-nitrobenzene (0.897 g, 6.36 mmol) in the same manner as in step 2 of reference example 48.


ESIMS, (M+H)+, m/z: 294.


(Step 2)

4-(2-Bromophenoxy)aniline (0.950 g, 81%) was obtained from 1-bromo-2-(4-nitrophenoxy)benzene (1.3 g, 4.42 mmol) obtained in step 1 in the same manner as in step 2 of reference example 7.


ESIMS, (M+H)+, m/z: 264.


(Step 3)

A crude product (1.5 g) of 4-(2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)aniline was obtained from 4-(2-bromophenoxy)aniline (0.950 g, 3.59 mmol) obtained in step 2 in the same manner as in step 1 of example 5n.


ESIMS, (M+H)+, m/z: 312.


(Step 4)

5-(2-(4-Aminophenoxy)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one (0.3 g, total yield of 2 steps 81%) was obtained from the crude product (0.716 g) of 4-(2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)aniline obtained in step 3 and 5-bromo-4-methoxy-1-methylpyridin-2(1H)-one (0.250 g, 1.15 mmol) obtained in step 3 of reference example 42 in the same manner as in step 1 of reference example 21.


ESIMS, (M+H)+, m/z: 323.


Reference Example 50
1-(4-Aminobenzyl)-5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one hydrochloride
(Step 1)

4-(6-Methoxypyridin-3-yl)-3,5-dimethylisoxazole (3.6 g, 66%) was obtained from commercially available 5-bromo-2-methoxypyridine (5.0 g, 26.59 mmol) and commercially available 3,5-dimethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)isoxazole (5.93 g, 26.59 mmol) in the same manner as in step 1 of reference example 21.


ESIMS, (M+H)+, m/z: 205.


(Step 2)

4-(6-Methoxypyridin-3-yl)-3,5-dimethylisoxazole (3.6 g, 17.65 mmol) obtained in step 1 was dissolved in ethanol (10 mL), then a 47% hydrogen bromide aqueous solution (36 mL) was added to the solution, and the mixture was stirred at 90° C. for 8 hours. The reaction mixture was diluted with water and the aqueous layer was extracted with 5% methanol/dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was washed with diethyl ether to give 5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one (2.7 g, 80%).


ESIMS, (M+H)+, m/z: 191.


(Step 3)

5-(3,5-Dimethylisoxazol-4-yl)pyridin-2(1H)-one (0.3 g, 1.58 mmol) obtained in step 2 was dissolved in DMF (5 mL), then commercially available tert-butyl (4-(bromomethyl)phenyl)carbamate (0.452 g, 1.58 mmol) and potassium carbonate (0.654 g, 4.73 mmol) were added to the solution, and the mixture was stirred at 70° C. for 16 hours. The reaction mixture was diluted with water and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure.


The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=50/50) to give tert-butyl (4-((5-(3,5-dimethylisoxazol-4-yl)-2-oxopyridin-1(2H)-yl)methyl)phenyl)carbamate (0.210 g, 34%).


ESIMS, (M+H)+, m/z: 397.


(Step 4)

A crude product (0.180 g) of 1-(4-aminobenzyl)-5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one hydrochloride was obtained from tert-butyl (4-((5-(3,5-dimethylisoxazol-4-yl)-2-oxopyridin-1(2H)-yl)methyl)phenyl)carbamate (0.210 g, 0.53 mmol) obtained in step 3 in the same manner as in step 2 of example 1a.


ESIMS, (M+H−HCl), m/z: 296.


Reference Example 51
1-(((1r,4r)-4-Aminocyclohexyl)methyl)-5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one hydrochloride
(Step 1)

tert-Butyl ((1r,4r)-4-((5-(3,5-dimethylisoxazol-4-yl)-2-oxopyridin-1(2H)-yl)methyl)cyclohexyl)carbamate (0.180 g, 43%) was obtained from 5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one (0.20 g, 1.05 mmol) obtained in step 2 of reference example 50 and tert-butyl ((1r,4r)-4-(bromomethyl)cyclohexyl)carbamate (0.307 g, 1.05 mmol) in the same manner as in step 3 of reference example 50.


ESIMS, (M+H)+, m/z: 403.


(Step 2)

A crude product (0.160 g) of 1-(((1r,4r)-4-aminocyclohexyl)methyl)-5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one hydrochloride was obtained from tert-butyl ((1r,4r)-4-((5-(3,5-dimethylisoxazol-4-yl)-2-oxopyridin-1(2H)-yl)methyl)cyclohexyl)carbamate (0.180 g, 0.45 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H−HCl)+, m/z: 303.


Reference Example 52
3-(((3-Aminobicyclo[1.1.1]pentan-1-yl)amino)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol hydrochloride
(Step 1)

tert-Butyl (3-((3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)amino)bicyclo[1.1.1]pentan-1-yl)carbamate (0.160 g, 43%) was obtained from 3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzaldehyde (0.2 g, 0.92 mmol) obtained in step 1 of reference example 24 and commercially available tert-butyl (3-aminobicyclo[1.1.1]pentan-1-yl)carbamate (0.182 g, 0.92 mmol) in the same manner as in step 3 of example 5b.


ESIMS, (M+H)+, m/z: 400.


(Step 2)

A crude product (0.150 g) of 3-(((3-aminobicyclo[1.1.1]pentan-1-yl)amino)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol hydrochloride was obtained from tert-butyl (3-((3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)amino)bicyclo[1.1.1]pentan-1-yl)carbamate (0.160 g, 0.40 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 301.


Example 1a
N,N′-(Propane-1,3-diyl)bis(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide) (Compound 1a)
(Step 1)

4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (200 mg, 0.89 mmol) obtained in step 6 of reference example 1 was dissolved in DMF (6.0 mL), then HATU (337 mg, 0.89 mmol), tert-butyl (3-aminopropyl)carbamate (155 mg, 0.89 mmol) and N,N-diisopropylethylamine (0.21 mL, 1.18 mmol) were added to the solution, and the mixture was stirred at room temperature overnight. A saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=100/0 to 90/10) to give tert-butyl [3-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propyl]carbamate (330 mg, 75%).


ESIMS, (M+H)+, m/z: 495.


(Step 2)

tert-Butyl [3-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propyl]carbamate (330 mg, 0.67 mmol) obtained in step 1 was dissolved in ethyl acetate (20 mL), then hydrogen chloride/1,4-dioxane solution (4 mol/L, 5.0 mL, 20 mmol) was added to the solution. The mixture was stirred at room temperature for 24 hours. The resulting solid was collected by filtration and washed with ethyl acetate to give N-(3-aminopropyl)-4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (260 mg, 89%).


ESIMS, (M+H)+, m/z: 395.


(Step 3)

A crude product of compound 1a (360 mg) was obtained from N-(3-aminopropyl)-4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (543 mg, 1.38 mmol) obtained in step 2 and 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (466 mg, 1.38 mmol) obtained in step 6 of reference example 1 in the same manner as in step 1. The obtained crude product was purified by reverse phase high performance liquid chromatography (reverse phase HPLC) (Column: CHIRALART Cellulose-SB S-5 μm, methyl tert-butyl ether (MtBE)/methanol=80/20, flow rate 1 mL/min, rt=3.9 min) to give compound 1a (34 mg, 3.4%).


ESIMS, (M+H)+, m/z: 715. 1H NMR (CDCl3,δ): 1.08-1.20 (m, 12H), 1.21-1.38 (m, 4H), 1.70-1.90 (m, 2H), 2.30-2.44 (m, 2H), 2.50-2.71 (m, 4H), 3.40-3.75 (m, 4H), 4.19-4.29 (m, 2H), 4.88-5.01 (m, 2H), 6.63 (d, J=8.4 Hz, 4H), 7.11-7.31 (m, 8H), 7.76 (d, J=8.7 Hz, 4H).


HPLC (CHIRAL Cellulose-SB (0.46×15 cm, 3 μm), MtBE (0.1% DEA)/methanol=80/20, flow rate 1.0 ml/min): rt=7.9 min


Example 1b

Di-tert-butyl 2,2′-[(6S,6′S)-({[propane-1,3-diylbis(azanediyl)]bis(carbonyl)}bis(4,1-phenylene))bis(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-4,6-diyl)]diacetate (Compound 1b)


(Step 1)

(S)-4-{6-[2-(tert-Butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (800 mg, 1.71 mmol) obtained in reference example 3 was dissolved in DMF (10 mL), then HATU (744 mg, 1.71 mmol), N,N-diisopropylethylamine (5 mL, 28.1 mmol) and benzyl N-(3-aminopropyl)carbamate (464 mg, 2.23 mmol) were added to the solution, and the mixture was stirred at room temperature for 25 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=90/10 to 50/50) to give tert-butyl (S)-2-(4-{4-[(3-{[(benzyloxy)carbonyl]amino}propyl)carbamoyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (910 mg).


ESIMS, (M+H)+, m/z: 657.


(Step 2)

tert-Butyl (S)-2-(4-{4-[(3-{[(benzyloxy)carbonyl]amino}propyl)carbamoyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (900 mg, 1.37 mmol) obtained in step 1 was dissolved in methanol (20 mL), then 10% palladium on carbon (0.20 g, 10 wt %) was added to the solution, and the mixture was stirred at room temperature for 5 hours under a hydrogen atmosphere. The reaction mixture was suction filtered, and the filtrate was concentrated under reduced pressure to give a crude product (0.72 g) of tert-butyl (S)-2-(4-{4-[(3-aminopropyl)carbamoyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate.


ESIMS, (M+H)+, m/z: 523.


(Step 3)

(S)-4-{6-[2-(tert-Butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (500 mg, 1.07 mmol) obtained in reference example 3 was dissolved in DMF (45 mL), then COMU (2 g, 4.62 mmol) and N,N-diisopropylethylamine (5 mL, 28.0 mmol) were added to the solution, and the mixture was stirred at room temperature for 5 minutes. The crude product (700 mg, 1.34 mmol) of tert-butyl (5)-2-(4-{4-[(3-aminopropyl)carbamoyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate obtained in step 2 was added to the reaction mixture, and the mixture was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by reverse phase HPLC (0.1% formic acid/acetonitrile=53/47 to 43/57) to give compound 1b (285 mg, total yield of 3 steps 18%).


ESIMS, (M+H)+, m/z: 971. 1H NMR (DMSO-d6, δ): 1.58 (s, 18H), 1.75 (s, 6H), 1.70-1.90 (m, 2H), 2.41 (s, 6H), 2.61 (s, 6H), 3.20-3.40 (m, 8H), 4.44 (t, J=7.8 Hz, 2H), 7.48 (d, J=8.4 Hz, 4H), 7.87 (d, J=8.4 Hz, 4H), 8.60 (t, J=5.6 Hz, 2H).


Example 1c
4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-[1-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)piperidin-4-yl]benzamide (Compound 1c)
(Step 1)

tert-Butyl 4-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)piperidine-1-carboxylate (62 mg, 80%) was obtained from 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (50 mg, 0.148 mmol) obtained in step 6 of reference example 1 and tert-butyl 4-aminopiperidine-1-carboxylate (30 mg, 0.148 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 521.


(Step 2)

4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-(piperidin-4-yl)benzamide hydrochloride (55 mg, 92%) was obtained from tert-butyl 4-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)piperidine-1-carboxylate (66 mg, 0.127 mmol) obtained in step 1 in the same manner as in step 2 of example 1a. ESIMS, (M+H)+, m/z: 421.


(Step 3)

Compound 1c (30 mg, 28%) was obtained from 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-(piperidin-4-yl)benzamide hydrochloride (49 mg, 0.144 mmol) obtained in step 2 in the same manner as in step 3 of example 1a.


ESIMS, (M+H)+, m/z: 741. 1H NMR (DMSO-d6, δ): 1.10-1.20 (m, 12H), 1.24-1.36 (m, 2H), 2.03-2.17 (m, 2H), 2.31-2.44 (m, 2H), 2.51-2.75 (m, 4H), 2.93-3.19 (m, 5H), 4.18-4.32 (m, 4H), 4.87-5.02 (m, 2H), 5.91-5.99 (m, 1H), 6.56-6.64 (m, 5H), 7.14-7.35 (m, 11H), 7.58-7.68 (m, 2H).


Example 1d
4-{[3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxyphenyl](hydroxy)methyl}-N-[3-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propyl]benzamide (Compound 1d)

N-(3-Aminopropyl)-4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (123 mg, 0.32 mmol) obtained in step 2 of example 1a was dissolved in DMF (6.0 mL), then 4-{[3-(3,5-dimethylisoxazol-4-yl)-5-hydroxyphenyl](hydroxy)methyl}benzoic acid (110 mg, 0.32 mmol) obtained in reference example 6, EDCI (124 mg, 0.65 mmol), HOBt (88 mg, 0.65 mmol) and N,N-diisopropylethylamine (0.23 mL, 1.30 mmol) were added to the solution, and the mixture was stirred at room temperature for 16 hours. Water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=63/37 to 59/41) to give compound 1d (39 mg, 17%).


ESIMS, (M+H)+, m/z: 716. 1H NMR (CD3OD, δ): 1.08-1.19 (m, 6H), 1.23-1.38 (m, 1H), 1.80-1.91 (m, 2H), 2.19 (s, 3H), 2.34 (s, 3H), 2.38-2.49 (m, 1H), 2.54-2.72 (m, 2H), 3.29-3.32 (m, 1H), 3.39-3.50 (m, 4H), 4.25 (dd, J=12.3, 4.2 Hz, 1H), 5.79 (s, 1H), 6.61-6.70 (m, 3H), 6.79 (s, 1H), 6.84 (s, 1H), 7.18-7.30 (m, 4H), 7.50 (d, J=8.4 Hz, 2H), 7.66 (d, J=8.7 Hz, 2H), 7.80 (d, J=8.4 Hz, 2H).


Example 1e

4-[(2-Ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl]-N-[3-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propyl]benzamide (Compound 1e) Compound 1e (15 mg, 24%) was obtained from N-(3-aminopropyl)-4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (40 mg, 0.093 mmol) obtained in step 2 of example 1a and 4-[(2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl]benzoic acid (28 mg, 0.093 mmol) obtained in reference example 5 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 674. 1H NMR (CDCl3, δ): 1.10-1.22 (m, 9H), 1.27-1.35 (m, 1H), 1.79-1.89 (m, 2H), 2.06-2.18 (m, 2H), 2.37-2.48 (m, 3H), 2.51-2.72 (m, 6H), 3.44-3.59 (m, 4H), 4.22-4.32 (m, 1H), 4.92-5.04 (m, 1H), 5.11 (s, 2H), 6.40 (s, 1H), 6.60-6.66 (m, 2H), 6.96-7.01 (m, 2H), 7.11-7.17 (m, 1H), 7.19-7.24 (m, 2H), 7.28-7.35 (m, 1H), 7.68-7.72 (m, 2H), 7.72-7.78 (m, 1H), 7.82-7.88 (m, 2H).


Example 1f
4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{3-[4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide]propyl}benzamide (Compound 1f)

Compound 1f (20 mg, 34%) was obtained from N-(3-aminopropyl)-4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (35 mg, 0.081 mmol) obtained in step 2 of example 1a and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (29 mg, 0.081 mmol) obtained in reference example 4 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 729. 1H NMR (CDCl3, δ): 1.11-1.21 (m, 6H), 1.28-1.37 (m, 1H), 1.66 (s, 3H), 2.42 (s, 3H), 2.53-2.74 (m, 6H), 3.48-3.61 (m, 4H), 4.11-4.18 (m, 1H), 4.19-4.33 (m, 2H), 4.89-5.01 (m, 1H), 5.47-5.55 (m, 1H), 6.58-6.65 (m, 2H), 6.84-6.91 (m, 1H), 7.14-7.25 (m, 3H), 7.28-7.33 (m, 1H), 7.55-7.61 (m, 2H), 7.68-7.73 (m, 2H), 7.75-7.83 (m, 1H), 7.92-7.96 (m, 2H).


Example 1g
4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-[1-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)azetidin-3-yl]benzamide (Compound 1g)
(Step 1)

tert-Butyl 3-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)azetidine-1-carboxylate (47 mg, 80%) was obtained from 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (40 mg, 0.118 mmol) obtained in step 6 of reference example 1 and tert-butyl 4-aminoazetidine-1-carboxylate (20 mg, 0.118 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 493.


(Step 2)

N-(Azetidin-3-yl)-4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (34 mg, 100%) was obtained from tert-butyl 3-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)azetidine-1-carboxylate (39 mg, 0.079 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 393.


(Step 3)

Compound 1g (12 mg, 21%) was obtained from N-(azetidin-3-yl)-4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (34 mg, 0.079 mmol) obtained in step 2 in the same manner as in step 3 of example 1a.


ESIMS, (M+H)+, m/z: 713. 1H NMR (CDCl3,δ): 1.09-1.19 (m, 12H), 1.23-1.35 (m, 2H), 2.32-2.46 (m, 2H), 2.51-2.72 (m, 4H), 4.16-4.29 (m, 4H), 4.58-4.72 (m, 2H), 4.82-5.03 (m, 3H), 6.49-6.63 (m, 4H), 7.14-7.25 (m, 8H), 7.25-7.33 (m, 2H), 7.43-7.54 (m, 2H), 7.67-7.76 (m, 2H).


Example 1h

tert-Butyl 2-[(S)-2,3,9-trimethyl-4-(4-{[3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propyl]carbamoyl}phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (Compound 1h)


(Step 1)

tert-Butyl [3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propyl]carbamate (512 mg, 100%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (350 mg, 1.03 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 495.


(Step 2)

N-(3-Aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (279 mg, 100%) was obtained from tert-butyl [3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propyl]carbamate (320 mg, 0.647 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 395.


(Step 3)

Compound 1h (35 mg, 36%) was obtained from N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (50 mg, 0.116 mmol) obtained in step 2 and (S)-4-{6-[2-(tert-Butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (54 mg, 0.116 mmol) obtained in reference example 3 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 843. 1H NMR (CDCl3, δ): 1.10-1.18 (m, 6H), 1.25-1.35 (m, 1H), 1.50 (s, 9H), 1.97-2.10 (m, 2H), 2.19 (s, 3H), 2.30-2.46 (m, 4H), 2.52-2.73 (m, 5H), 3.45-3.59 (m, 6H), 4.16-4.28 (m, 1H), 4.37-4.44 (m, 1H), 4.56-4.64 (m, 1H), 4.83-5.01 (m, 1H), 6.51-6.66 (m, 2H), 6.99-7.10 (m, 1H), 7.10-7.23 (m, 3H), 7.50-7.59 (m, 2H), 7.67-7.77 (m, 2H), 7.84-7.98 (m, 3H).


Example 1i
tert-Butyl 2-((S)-4-{4-[4-(4-{(S)-6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzamide)piperidine-1-carbonyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 1i)
(Step 1)

tert-Butyl 4-aminopiperidine-1-carboxylate (1.0 g, 5.0 mmol) was dissolved in dichloromethane (15 mL), then N,N-diisopropylethylamine (2.61 mL, 15 mmol) and benzyl chloroformate (0.78 mL, 5.5 mmol) were added to the solution under ice cooling. The mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=85/15 to 80/20) to give tert-butyl 4-{[(benzyloxy)carbonyl]amino}piperidine-1-carboxylate (1.17 g, 70%).


ESIMS, (M+H)+, m/z: 335.


(Step 2)

Benzylpiperidin-4-ylcarbamate (0.80 g, 85%) was obtained from tert-butyl 4-{[(benzyloxy)carbonyl]amino}piperidine-1-carboxylate (1.17 g, 3.50 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 235.


(Step 3)

tert-Butyl (S)-2-(4-[4-(4-{[(benzyloxy)carbonyl]amino}piperidine-1-carbonyl)phenyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (105 mg, 72%) was obtained from benzylpiperidin-4-ylcarbamate (69 mg, 0.25 mmol) obtained in step 2 and (S)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (104 mg, 0.21 mmol) obtained in reference example 3 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 683.


(Step 4)

tert-Butyl (S)-2-(4-[4-(4-{[(benzyloxy)carbonyl]amino}piperidine-1-carbonyl)phenyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (105 mg, 0.15 mmol) obtained in step 3 was dissolved in methanol (3.0 mL), then 20% palladium hydroxide (50 mg) was added to the solution, and the mixture was stirred at room temperature for 16 hours under a hydrogen atmosphere. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained residue was slurry-refined with pentane to give tert-butyl (S)-2-{4-[4-(4-aminopiperidine-1-carbonyl)phenyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (70 mg, 83%).


ESIMS, (M+H)+, m/z: 549.


(Step 5)

Compound 1i (80 mg, 42%) was obtained from tert-butyl (5)-2-{4-[4-(4-aminopiperidine-1-carbonyl)phenyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (105 mg, 0.19 mmol) obtained in step 4 and (S)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (89 mg, 0.19 mmol) obtained in reference example 3 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 997. 1H NMR (DMSO-d6, δ): 1.44 (s, 19H), 1.58 (s, 4H), 1.66 (s, 3H), 1.75 (brs, 1H), 1.91 (brs, 1H), 2.36-2.42 (m, 6H), 2.60-2.64 (m, 6H), 2.95 (brs, 1H), 3.15-3.16 (m, 1H), 3.37 (m, 4H), 3.49-3.51 (m, 1H), 4.08 (brs, 1H), 4.44 (q, J=6.5 Hz, 3H), 7.42 (d, J=8.0 Hz, 2H), 7.49 (t, J=8.5 Hz, 4H), 7.87 (d, J=8.0 Hz, 2H), 8.39 (d, J=7.5 Hz, 1H).


Example 1j
N,N′-[(1r,3r)-Cyclobutane-1,3-diyl]bis(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide) (Compound 1j)
(Step 1)

tert-Butyl [(1R,3r)-3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)cyclobutyl]carbamate (70 mg, 94%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (50 mg, 0.148 mmol) obtained in step 7 of reference example 1 and tert-butyl [(1r,3r)-3-aminocyclobutyl]carbamate (28 mg, 0.148 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 507.


(Step 2)

N-[(1r,3R)-3-Aminocyclobutyl]-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (60 mg, 98%) was obtained from tert-butyl [(1R,3r)-3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)cyclobutyl]carbamate (70 mg, 0.138 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 407.


(Step 3)

Compound 1j (25 mg, 28%) was obtained from N-[(1r,3R)-3-aminocyclobutyl]-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (60 mg, 0.137 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (42 mg, 0.124 mmol) obtained in step 7 of reference example 1 as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 727. 1H NMR (CDCl3, δ): 1.11-1.19 (m, 12H), 1.23-1.37 (m, 2H), 2.31-2.45 (m, 2H), 2.44-2.53 (m, 2H), 2.53-2.75 (m, 4H), 4.16-4.33 (m, 4H), 4.59-4.75 (m, 2H), 4.90-5.02 (m, 2H), 6.24-6.29 (m, 2H), 6.59-6.64 (m, 4H), 7.14-7.32 (m, 10H), 7.63-7.69 (m, 4H).


Example 1k
1,1′-{(2S,2'S,4R,4′R)-{[(2,5-Diazabicyclo[2.2.1]heptane-2,5-dicarbonyl)bis(4,1-phenylene)]bis(azanediyl)}bis[2-methyl-3,4-dihydroquinoline-4,1(2H)-diyl]}bis(propan-1-one) (Compound 1k)
(Step 1)

tert-Butyl 5-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (38 mg, 49%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (50 mg, 0.148 mmol) obtained in step 7 of reference example 1 and tert-butyl 2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (35.2 mg, 0.177 mmol) in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 519.


(Step 2)

tert-Butyl 5-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate (38 mg, 0.073 mmol) obtained in step 1 was dissolved in dichloromethane (1 mL), then trifluoroacetic acid (1 mL) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure to give a crude product of 1-[(2S,4R)-4-{[4-(2,5-diazabicyclo[2.2.1]heptane-2-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate (38 mg).


ESIMS, (M+H)+, m/z: 419.


(Step 3)

Compound 1k (17 mg, 32%) was obtained from the crude product (38 mg) of 1-[(2S,4R)-4-{[4-(2,5-diazabicyclo[2.2.1]heptane-2-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (50 mg, 0.148 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 739. 1H-NMR (CDCl3, a): 1.12-1.19 (m, 12H), 1.26-1.36 (m, 4H), 2.31-2.43 (m, 2H), 2.53-2.72 (m, 4H), 3.67-3.83 (m, 4H), 4.11-4.18 (m, 2H), 4.18-4.27 (m, 2H), 4.90-5.00 (m, 2H), 6.54-6.66 (m, 4H), 7.14-7.33 (m, 9H), 7.39-7.49 (m, 3H).


Example 11
N,N′-(2-Oxopropane-1,3-diyl)bis(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide) (Compound 1l)
(Step 1)

N,N′-(2-Hydroxypropane-1,3-diyl)bis(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide) (200 mg, 19%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (500 mg, 1.47 mmol) obtained in step 7 of reference example 1 and 1,3-diaminopropan-2-ol (66 mg, 0.73 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 731.


(Step 2)

N,N′-(2-Hydroxypropane-1,3-diyl)bis(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide) (50 mg, 0.068 mmol) obtained in step 1 was dissolved in dichloromethane (3 mL), then DMP (58 mg, 0.136 mmol) was added to the solution, and the mixture was stirred at 50° C. for 2 hours. Aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with dichloromethane. The organic layer was washed with water and saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (acetonitrile/10 mM aqueous ammonium bicarbonate solution=42/58) to give compound 1l (22 mg, 22%).


ESIMS, (M+H)+, m/z: 729. 1H-NMR (DMSO-d6, δ): 1.00-1.06 (m, 12H), 1.18-1.25 (m, 2H), 2.22-2.27 (m, 2H), 2.56-2.62 (m, 4H), 4.10 (d, J=5.49 Hz, 4H), 4.29 (t, J=11.60 Hz, 2H), 4.74 (d, J=6.71 Hz, 2H), 6.63-6.68 (m, 6H), 7.10 (d, J=7.63 Hz, 2H), 7.17 (t, J=7.32 Hz, 2H), 7.25-7.32 (m, 4H), 7.67 (d, J=8.54 Hz, 4H), 8.41 (t, J=5.49 Hz, 2H).


Example 1m
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{1-[4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoyl]piperidin-4-yl}benzamide (Compound 1m)
(Step 1)

tert-Butyl {1-[4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoyl]piperidin-4-yl}carbamate (200 mg, 88%) was obtained from 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (150 mg, 0.420 mmol) obtained in reference example 4 and tert-butyl (piperidin-4-yl)carbamate (93 mg, 0.460 mmol) in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 535.


(Step 2)

A crude product (65 mg) of (4-aminopiperidin-1-yl)[4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl]methanone hydrochloride was obtained from tert-butyl {1-[4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoyl]piperidin-4-yl}carbamate (110 mg, 0.200 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 435.


(Step 3)

Compound inn (25 mg, total yield of 2 steps 9%) was obtained from the crude product (196 mg) of (4-aminopiperidin-1-yl)[4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl]methanone hydrochloride obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (120 mg, 0.350 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 755. 1H-NMR (DMSO-d6, δ): 0.99-1.05 (m, 6H), 1.17-1.24 (m, 1H), 1.40-1.51 (m, 2H), 1.64 (s, 3H), 1.71 (s, 1H), 1.86 (s, 1H), 2.25 (dd, J=15.72, 7.48 Hz, 1H), 2.41 (s, 3H), 2.51-2.64 (m, 5H), 2.95 (s, 1H), 3.14-3.17 (m, 1H), 3.49-3.50 (m, 1H), 4.03 (d, J=7.63 Hz, 1H), 4.18 (d, J=12.82 Hz, 1H), 4.24-4.29 (m, 1H), 4.42 (s, 1H), 4.74 (d, J=6.10 Hz, 1H), 5.27 (d, J=12.51 Hz, 1H), 6.57 (d, J=7.93 Hz, 1H), 6.64 (d, J=8.54 Hz, 2H), 7.08 (d, J=7.63 Hz, 1H), 7.16 (t, J=7.32 Hz, 1H), 7.20-7.32 (m, 2H), 7.40 (d, J=8.24 Hz, 2H), 7.54 (d, J=7.93 Hz, 2H), 7.63 (d, J=8.85 Hz, 2H), 7.85 (d, J=7.63 Hz, 1H).


Example 1n
tert-Butyl 2-[(S)-2,3,9-trimethyl-4-(4-{[1-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)azetidin-3-yl]carbamoyl}phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (Compound 1n)
(Step 1)

tert-Butyl [1-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)azetidin-3-yl]carbamate (170 mg, 81%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (150 mg, 0.440 mmol) obtained in step 7 of reference example 1 and tert-butyl (azetidin-3-yl)carbamate (76 mg, 0.440 mmol) in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 493.


(Step 2)

tert-Butyl [1-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)azetidin-3-yl]carbamate (170 mg, 0.340 mmol) obtained in step 1 was dissolved in dichloromethane (6 mL), then trifluoroacetic acid (1 mL) was added to the solution, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure to give 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate (150 mg, 89%).


ESIMS, (M+H)+, m/z: 393.


(Step 3)

Compound 1n (69 mg, 39%) was obtained from 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate (100 mg, 0.190 mmol) obtained in step 2 and (S)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (92 mg, 0.190 mmol) obtained in reference example 3 in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 841. 1H-NMR (DMSO-d6, δ): 0.99-1.05 (m, 6H), 1.20-1.25 (m, 1H), 1.44 (s, 9H), 1.59 (s, 3H), 2.19-2.27 (m, 1H), 2.41 (s, 3H), 2.57-2.64 (m, 5H), 3.34-3.36 (m, 2H), 4.15 (s, 1H), 4.23-4.28 (m, 3H), 4.43 (t, J=1.5 Hz, 1H), 4.53-4.75 (m, 3H), 6.65 (d, J=2.5 Hz, 3H), 7.10 (d, J=7.32 Hz, 1H), 7.16-7.19 (m, 1H), 7.25-7.32 (m, 2H), 7.47-7.51 (m, 4H), 7.91 (d, J=8.85 Hz, 2H), 9.12 (d, J=7.02 Hz, 1H).


Example 10
tert-Butyl 2-[(S)-2,3,9-trimethyl-4-(4-{[2-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)ethyl]carbamoyl}phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (Compound 1o)
(Step 1)

tert-Butyl (S)-2-(4-{4-[(2-{[(benzyloxy)carbonyl]amino}ethyl)carbamoyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (290 mg, 70%) was obtained from (S)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (300 mg, 0.64 mmol) obtained in reference example 3 and benzyl (2-aminoethyl)carbamate (249 mg, 1.29 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 643.


(Step 2)

tert-Butyl (S)-2-(4-{4-[(2-aminoethyl)carbamoyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (200 mg, 87%) was obtained from tert-butyl (S)-2-(4-{4-[(2-{[(benzyloxy)carbonyl]amino}ethyl)carbamoyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (290 mg, 0.45 mmol) obtained in step 1 in the same manner as in step 4 of example 1i.


ESIMS, (M+H)+, m/z: 509.


(Step 3)

Compound 10 (220 mg, 67%) was obtained from tert-butyl (S)-2-(4-{4-[(2-aminoethyl)carbamoyl]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (200 mg, 0.39 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (133 mg, 0.39 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 829. 1H-NMR (DMSO-d6, δ): 0.99-1.06 (m, 6H), 1.17-1.26 (m, 1H), 1.43 (s, 9H), 1.59 (s, 3H), 2.22-2.28 (m, 1H), 2.41 (s, 3H), 2.57-2.64 (m, 5H), 3.24-3.28 (m, 2H), 3.40 (s, 4H), 4.27 (m, 1H), 4.44 (t, J=7.2 Hz, 1H), 4.73-4.74 (m, 1H), 6.58 (d, J=8.0 Hz, 1H), 6.65 (d, J=8.5 Hz, 2H), 7.08 (d, J=7.5 Hz, 1H), 7.16 (t, J=7.5 Hz, 1H), 7.25-7.32 (m, 2H), 7.48 (d, J=8.0 Hz, 2H), 7.63 (d, J=8.5 Hz, 2H), 7.88 (d, J=8.0 Hz, 2H), 8.21 (brs, 1H), 8.68 (brs, 1H).


Example 2a
4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{2-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-2-oxoethyl}benzamide (Compound 2a)
(Step 1)

A crude product (263 mg) of (9H-fluoren-9-yl)methyl{2-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-2-oxoethyl}carbamate was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (100 mg, 0.323 mmol obtained in step 2 of reference example 7 and {[(9H-fluoren-9-yl)methoxy]carbonyl}glycine (144 mg, 0.485 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 589.


(Step 2)

The crude product (263 mg) of (9H-fluoren-9-yl)methyl {2-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-2-oxoethyl}carbamate obtained in step 1 was dissolved in DMF (1.6 mL), then piperidine (0.160 mL, 1.62 mmol) was added to the solution, and the mixture was stirred at room temperature overnight. Water was added to the reaction mixture, then the reaction mixture was filtered, and the filtrate was extracted twice with ethyl acetate. The organic layer was washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel chromatography (chloroform/methanol=10/0 to 9/1) to give 2-amino-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)acetamide (50.7 mg, total yield of 2 steps 43%).


ESIMS, (M+H)+, m/z: 367.


(Step 3)

Compound 2a (3.2 mg, 9%) was obtained from 2-amino-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)acetamide (19.5 mg, 0.053 mmol) obtained in step 2 and 4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (21.4 mg, 0.063 mmol) obtained in step 6 of reference example 1 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 687 1H-NMR (CDCl3, δ): 1.10-1.20 (m, 12H), 1.24-1.33 (m, 2H), 2.31-2.44 (m, 2H), 2.51-2.73 (m, 4H), 4.10-4.19 (m, 2H), 4.21-4.30 (m, 4H), 4.88-5.00 (m, 2H), 5.32-5.37 (m, 1H), 6.59 (d, J=9.0 Hz, 2H), 6.63 (d, J=8.5 Hz, 2H), 7.13-7.30 (m, 8H), 7.33 (d, J=9.0 Hz, 2H), 7.71 (d, J=9.0 Hz, 2H).


Example 2b
tert-Butyl 2-[(S)-4-{4-[2-(4-{(S)-6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzamide)acetamide]phenyl}-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (Compound 2b)
(Step 1)

(S)-4-{6-[2-(tert-Butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (200 mg, 0.430 mmol) obtained in reference example 3 was dissolved in toluene (10 mL), then DPPA (124 mg, 0.450 mmol) and triethylamine (104 mg, 1.03 mmol) were added to the solution, and the mixture was stirred at room temperature for 3 hours. Water (3 mL) was added to the reaction mixture, and the mixture was stirred at 70° C. for 2 hours. The reaction mixture was cooled to room temperature, diluted with ethyl acetate, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (acetonitrile/10 mmol/L aqueous ammonium bicarbonate solution=42/58) to give tert-butyl (S)-2-{4-(4-aminophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (45 mg, 22%).


ESIMS, (M+H)+, m/z: 438.


(Step 2)

tert-Butyl (S)-2-{4-[4-(2-{[(benzyloxy)carbonyl]amino}acetamide)phenyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (70 mg, 74%) was obtained from tert-butyl (S)-2-{4-(4-aminophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (60 mg, 0.140 mmol) obtained in step 1, and 2-{[(benzyloxy)carbonyl]amino}acetic acid (34.4 mg, 0.160 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 629.


(Step 3)

tert-Butyl (S)-2-{4-[4-(2-{[(benzyloxy)carbonyl]amino}acetamide)phenyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (70 mg, 0.110 mmol) obtained in step 2 was dissolved in methanol (20 mL), then palladium on carbon (70 mg, 10 wt %) was added to the solution, and the mixture was stirred overnight at room temperature under a hydrogen atmosphere. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure to give tert-butyl (S)-2-{4-[4-(2-aminoacetamide)phenyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (50 mg, 84%).


ESIMS, (M+H)+, m/z: 495.


(Step 4)

Compound 2b (17 mg, 17%) was obtained from tert-butyl


(S)-2-{4-[4-(2-aminoacetamide)phenyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (53 mg, 0.110 mmol) obtained in step 3 and (S)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (50 mg, 0.110 mmol) obtained in reference example 3 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 943. 1H-NMR (CD3OD,δ): 1.53 (s, 18H), 1.73 (d, J=8.8 Hz, 6H), 2.48 (s, 6H), 2.80-2.70 (m, 6H), 3.52-3.40 (m, 4H), 4.22 (s, 2H), 4.64-4.51 (m, 2H), 7.44 (d, J=8.8 Hz, 2H), 7.60 (d, J=8.4 Hz, 2H), 7.67 (d, J=9.2 Hz, 2H), 7.94 (d, J=8.4 Hz, 2H).


Example 2c
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{(R)-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxopropan-2-yl}benzamide (Compound 2c)
(Step 1)

tert-Butyl {(R)-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxopropan-2-yl}carbamate (160 mg, 68%) was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (150 mg, 0.480 mmol) obtained in step 2 of reference example 7, and (tert-butoxycarbonyl)-D-alanine (92 mg, 0.480 mmol) in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 481.


(Step 2)





    • (R)-2-Amino-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)propanamide hydrochloride (160 mg, 92%) was obtained from tert-butyl {(R)-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxopropan-2-yl}carbamate (200 mg, 0.410 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.





ESIMS, (M+H)+, m/z: 381.


(Step 3)

Compound 2c (86 mg, 32%) was obtained from (R)-2-amino-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)propanamide hydrochloride (160 mg, 0.380 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (130 mg, 0.380 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 701. 1H-NMR (DMSO-d6, δ): 0.98-1.06 (m, 12H), 1.11-1.23 (m, 2H), 1.37 (d, J=7.2 Hz, 3H), 2.20-2.33 (m, 2H), 2.55-2.67 (m, 4H), 4.12 (brs, 1H), 4.26-4.28 (m, 1H), 4.53 (t, J=7.2 Hz, 1H), 4.71-4.73 (m, 2H), 5.86 (d, J=8.0 Hz, 1H), 6.57-6.67 (m, 5H), 7.09-7.18 (m, 4H), 7.23-7.32 (m, 6H), 7.70 (d, J=8.8 Hz, 2H), 8.04 (d, J=7.6 Hz, 1H), 9.59 (s, 1H)


Example 2d
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{(S)-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxopropan-2-yl}benzamide (Compound 2d)
(Step 1)

tert-Butyl {(S)-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxopropan-2-yl}carbamate (155 mg, 67%) was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (150 mg, 0.480 mmol) obtained in step 2 of reference example 7, and (tert-butoxycarbonyl)-L-alanine (92 mg, 0.480 mmol) in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 481.


(Step 2)

(S)-2-Amino-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)propanamide hydrochloride (120 mg, 90%) was obtained from tert-butyl {(S)-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxopropan-2-yl}carbamate (155 mg, 0.320 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 381.


(Step 3)

Compound 2d (55 mg, 27%) was obtained from (S)-2-amino-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)propanamide hydrochloride (120 mg, 0.310 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (106 mg, 0.310 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 701. 1H-NMR (DMSO-d6, δ): 0.98-1.06 (m, 12H), 1.14-1.24 (m, 2H), 1.35 (d, J=7.6 Hz, 3H), 2.20-2.28 (m, 2H), 2.55-2.64 (m, 4H), 4.08-4.12 (m, 1H), 4.26-4.31 (m, 1H), 4.54 (t, J=7.0 Hz, 1H), 4.71-4.75 (m, 2H), 5.85 (d, J=8.0 Hz, 1H), 6.56-6.60 (m, 3H), 6.66 (d, J=8.8 Hz, 2H), 7.09-7.18 (m, 4H), 7.24-7.32 (m, 6H), 7.71 (d, J=8.0 Hz, 2H), 8.04 (d, J=7.2 Hz, 1H), 9.58 (s, 1H)


Example 2e
N-{(S)-3-Methyl-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxobutan-2-yl}-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide (Compound 2e)
(Step 1)

tert-Butyl {(S)-3-methyl-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxobutan-2-yl}carbamate (160 mg, 67%) was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (150 mg, 0.480 mmol) obtained in step 2 of reference example 7 and (tert-butoxycarbonyl)-L-valine (105 mg, 0.480 mmol) in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 509.


(Step 2)

(S)-2-Amino-3-methyl-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)butanamide hydrochloride (125 mg, 92%) was obtained from tert-butyl {(S)-3-methyl-1-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-1-oxobutan-2-yl}carbamate (160 mg, 0.314 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 409.


(Step 3)

Compound 2e (55 mg, 27%) was obtained from (S)-2-amino-3-methyl-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)butanamide hydrochloride (125 mg, 0.280 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (95 mg, 0.280 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1d.


ESIMS, (M−H)−, m/z: 727. 1H-NMR (DMSO-d6, δ): 0.93-1.06 (m, 18H), 1.11-1.26 (m, 2H), 2.13-2.28 (m, 3H), 2.56-2.63 (m, 4H), 4.11-4.23 (m, 1H), 4.27-4.36 (m, 2H), 4.71-4.75 (m, 2H), 5.86 (d, J=8.0 Hz, 1H), 6.58-6.67 (m, 4H), 7.08-7.18 (m, 4H), 7.25-7.33 (m, 5H), 7.70 (d, J=8.4 Hz, 2H), 7.81 (d, J=8.8 Hz, 1H), 9.70 (s, 1H).


Example 2f
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{3-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-3-oxopropyl}benzamide (Compound 2f)
(Step 1)

Ethyl 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propanoate (150 mg, 77%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (150 mg, 0.44 mmol) obtained in step 7 of reference example 1 and ethyl 3-aminopropanoate hydrochloride (0.102 g, 0.66 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 438.


(Step 2)

Ethyl 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)propanoate (150 mg, 0.34 mmol) obtained in step 1 was dissolved in a mixed solvent (5.0 mL) of THF and water (4:1), then lithium hydroxide monohydrate (0.029 g, 0.69 mmol) was added to the solution, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was concentrated under reduced pressure, then the obtained residue was diluted with ice water, and an aqueous citric acid solution was added at 0° C. until the diluted residue became acidic. The precipitated solid was collected by filtration and dried under reduced pressure to give a crude product of 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino]benzamide}propanoic acid (100 mg).


ESIMS, (M+H)+, m/z: 410.


(Step 3)

Compound 2f (65 mg, total yield of 2 steps 27%) was obtained from the crude product (100 mg, 0.24 mmol) of 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino]benzamide}propanoic acid obtained in step 2 and 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (75.0 mg, 0.24 mmol) obtained in step 2 of reference example 7 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 701. 1H-NMR (DMSO-d6, δ): 1.01-1.05 (m, 12H), 1.13-1.24 (m, 2H), 2.21-2.23 (m, 2H), 2.56-2.62 (m, 6H), 3.48 (q, J=6.5 Hz, 2H), 4.09-4.12 (m, 1H), 4.25-4.26 (m, 1H), 4.72-4.74 (m, 2H), 5.87 (d, J=8.0 Hz, 1H), 6.56-6.65 (m, 5H), 7.09 (d, J=7.5 Hz, 1H), 7.15-7.18 (m, 3H), 7.23-7.31 (m, 6H), 7.63 (d, J=8.5 Hz, 2H), 8.14 (t, J=5.3 Hz, 1H), 9.59 (s, 1H).


Example 2g
1-(4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)piperidine-4-carboxamide (Compound 2g)
(Step 1)

A crude product (0.12 g) of tert-butyl 4-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)carbamoyl]piperidine-1-carboxylate was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.1 g, 0.32 mmol) obtained in step 2 of reference example 7 and 1-(tert-butoxycarbonyl)piperidine-4-carboxylic acid (0.074 g, 0.32 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 521.


(Step 2)

A crude product (0.15 g) of N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)piperidine-4-carboxamide hydrochloride was obtained from the crude product (0.17 g, 0.32 mmol) of tert-butyl 4-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)carbamoyl]piperidine-1-carboxylate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 421.


(Step 3)

Compound 2g (0.032 g, total yield of 3 steps 9%) was obtained from the crude product (0.15 g, 0.32 mmol) of N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)piperidine-4-carboxamide hydrochloride obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.11 g, 0.32 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 741.61. 1H-NMR (DMSO-d6, δ): 0.99-1.05 (m, 12H), 1.13-1.24 (m, 2H), 1.55-1.57 (m, 2H), 1.77 (d, J=11.60 Hz, 2H), 2.21-2.25 (m, 2H), 2.53-2.62 (m, 5H), 2.92 (s, 2H), 4.09-4.22 (m, 4H), 4.73 (t, J=7.25 Hz, 2H), 5.87 (d, J=7.93 Hz, 1H), 6.49 (d, J=7.63 Hz, 1H), 6.58 (d, J=8.54 Hz, 2H), 6.66 (d, J=8.24 Hz, 2H), 7.14-7.31 (m, 12H), 9.54 (s, 1H).


Example 2h
1-(4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)azetidine-3-carboxamide (Compound 2h)
(Step 1)

A crude product (0.12 g, 75%) of tert-butyl 3-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)carbamoyl]azetidine-1-carboxylate was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.1 g, 0.32 mmol) obtained in step 2 of reference example 7 and 1-(tert-butoxycarbonyl)azetidine-3-carboxylic acid (0.065 g, 0.32 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 493.


(Step 2)

A crude product (0.1 g) of N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)azetidine-3-carboxamide hydrochloride was obtained from the crude product (0.12 g, 0.24 mmol) of tert-butyl 3-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)carbamoyl]azetidine-1-carboxylate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 393.


(Step 3)

Compound 2h (0.03 g, total yield of 3 steps 18%) was obtained from the crude product (0.1 g, 0.23 mmol) of N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)azetidine-3-carboxamide hydrochloride obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.078 g, 0.23 mmol) obtained in step 7 of reference example 1 were used in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 713.53. 1H-NMR (DMSO-d6, δ): 1.00-1.05 (m, 12H), 1.14-1.22 (m, 2H), 2.21-2.24 (m, 2H), 2.59 (d, J=8.5 Hz, 4H), 3.50 (s, 1H), 4.06-4.12 (m, 3H), 4.26-4.45 (m, 3H), 4.73 (s, 2H), 5.91 (d, J=7.63 Hz, 1H), 6.59-6.67 (m, 5H), 7.01-7.19 (m, 4H), 7.26-7.32 (m, 6H), 7.45 (d, J=8.54 Hz, 2H), 9.70 (s, 1H).


Example 2i
(R)-1-(4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)pyrrolidine-3-carboxamide (Compound 2i)
(Step 1)

tert-Butyl (R)-3-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)carbamoyl]pyrrolidine-1-carboxylate (55 mg, 84%) was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (40 mg, 0.129 mmol) obtained in step 2 of reference example 7 and (R)-1-(tert-butoxycarbonyl)pyrrolidine-3-carboxylic acid (28 mg, 0.129 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 507.


(Step 2)

(R)—N-(4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)pyrrolidine-3-carboxamide hydrochloride (57 mg, 100%) was obtained from tert-butyl (R)-3-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)carbamoyl]pyrrolidine-1-carboxylate (65 mg, 0.128 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 407.


(Step 3)

Compound 2i (25 mg, 28%) was obtained from (R)—N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)pyrrolidine-3-carboxamide hydrochloride (55 mg, 0.124 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (42 mg, 0.124 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 727. 1H-NMR (CDCl3, δ): 1.07-1.20 (m, 12H), 1.20-1.33 (m, 2H), 2.32-2.44 (m, 3H), 2.50-2.68 (m, 4H), 2.86-3.14 (m, 1H), 3.36-3.66 (m, 4H), 3.72-3.92 (m, 2H), 4.07-4.25 (m, 2H), 4.82-5.02 (m, 2H), 6.52-6.66 (m, 4H), 7.11-7.49 (m, 13H), 7.99-8.19 (m, 1H).


Example 2j
3-(4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)benzamide (Compound 2j)
(Step 1)

A crude product (0.12 g) of methyl 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)benzoate was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.1 g, 0.29 mmol) obtained in step 7 of reference example 1 and methyl 3-aminobenzoate (0.045 g, 0.29 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 472.


(Step 2)

3-(4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)benzoic acid (0.1 g, 87%) was obtained from the crude product (0.12 g, 0.25 mmol) of methyl 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)benzoate obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 458.


(Step 3)

Compound 2j (0.037 g, 19%) was obtained from 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide)benzoic acid (0.1 g, 0.21 mmol) obtained in step 2 and 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.068 g, 0.218 mmol) obtained in step 2 of reference example 7 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 749. 1H-NMR (DMSO-d6, δ): 0.99-1.07 (m, 12H), 1.56-1.25 (m, 2H), 2.22-2.29 (m, 2H), 2.55-2.66 (m, 4H), 4.10-4.19 (m, 1H), 4.27-4.36 (m, 1H), 4.75 (t, J=6.6 Hz, 2H), 5.95 (d, J=8.0 Hz, 1H), 6.65 (d, J=8.8 Hz, 2H), 6.73 (d, J=8.0 Hz, 3H), 7.12 (d, J=8.8 Hz, 1H), 7.19 (d, J=5.2 Hz, 3H), 7.24-7.33 (m, 4H), 7.41-7.47 (m, 3H), 7.59 (d, J=8.0 Hz, 1H), 7.82 (d, J=8.4 Hz, 2H), 7.96 (d, J=8.8 Hz, 1H), 8.23 (s, 1H), 9.91 (s, 1H), 9.98 (s, 1H).


Example 3a
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{[1-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-1H-1,2,3-triazol-4-yl]methyl}benzamide (Compound 3a)
(Step 1)

4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-(prop-2-yn-1-yl)benzamide (52 mg, 96%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (50 mg, 0.148 mmol) obtained in step 7 of reference example 1 and propargylamine (0.014 mL, 0.222 mmol) in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 376.


(Step 2)

1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (6 mg, 0.019 mmol) obtained in step 3 of reference example 7 was dissolved in acetonitrile, then ADMP (6.6 mg, 0.023 mmol) and DMAP (2.8 mg, 0.023 mmol) were added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure to give a crude product (15 mg) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one.


ESIMS, (M+H)+, m/z: 336.


(Step 3)

A crude product (15 mg) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-(prop-2-yn-1-yl)benzamide (6.7 mg, 0.018 mmol) obtained in step 1 were dissolved in a mixed solvent (0.6 mL) of ethanol and water (1:1), then sodium L-ascorbate (1.8 mg, 0.0089 mmol) and copper sulfate pentahydrate (4.5 mg, 0.018 mmol) were added to the solution, and the mixture was stirred at 60° C. overnight. The reaction mixture was diluted with ethyl acetate, dried over magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (acetonitrile/0.1° A) TFA aqueous solution=45/55 to 50/50) to give compound 3a (4 mg, total yield of 2 steps 9%).


ESIMS, (M+H)+, m/z: 711. 1H-NMR (CDCl3, δ): 1.12-1.21 (m, 12H), 1.23-1.37 (m, 2H), 2.35-2.45 (m, 2H), 2.54-2.74 (m, 4H), 4.01 (brs, 2H), 4.20-4.28 (m, 2H), 4.76 (d, J=5.9 Hz, 2H), 4.95-4.97 (m, 2H), 6.61 (d, J=8.6 Hz, 2H), 6.70 (d, J=8.6 Hz, 2H), 7.14-7.37 (m, 8H), 7.50 (d, J=8.6 Hz, 2H), 7.68 (d, J=8.6 Hz, 2H), 8.05 (s, 1H).


Example 3b
tert-Butyl 2-[(S)-4-(4-{4-[(4-{(S)-6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzamide)methyl]-1H-1,2,3-triazol-1-yl}phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (Compound 3b)
(Step 1)

tert-Butyl (S)-2-[4-(4-bromophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (5.0 g, 10.0 mmol) synthesized according to the method described in WO2017/030814 was dissolved in a mixed solvent (2.0 mL) of ethanol and water (3:1), then sodium azide (26 mg, 0.399 mmol), (1R,2R)—N,N′-dimethylcyclohexane-1,2-diamine (0.00473 mL, 0.030 mmol), sodium (R)-ascorbate (2.4 mg, 0.012 mmol) and copper iodide (3.8 mg, 0.02 mmol) were added to the solution, and the mixture was refluxed for 3 hours. A saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=100/0 to 60/40) to give tert-butyl (S)-2-[4-(4-azidophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (60 mg, 65%).


ESIMS, (M+H)+, m/z: 464.


(Step 2)

tert-Butyl (S)-2-{2,3,9-trimethyl-4-[4-(prop-2-yn-1-ylcarbamoyl)phenyl]-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (90 mg, 93%) was obtained from (5)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (90 mg, 0.193 mmol) obtained in reference example 3 and prop-2-yn-1-amine (0.0183 mL, 0.289 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 504.


(Step 3)

tert-Butyl (S)-2-[4-(4-azidophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl]acetate (21 mg, 0.045 mmol) obtained in step 1 and tert-butyl (S)-2-{2,3,9-trimethyl-4-[4-(prop-2-yn-1-ylcarbamoyl)phenyl]-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl}acetate (27 mg, 0.054 mmol) obtained in step 2 were dissolved in a mixed solvent (1.5 mL) of s-butanol and water (3:2), then sodium (R)-ascorbate (2.4 mg, 0.012 mmol) and copper(II) sulfate pentahydrate (5.7 mg, 0.023 mmol) were added to the solution, and the mixture was stirred at 50° C. for 6 hours. Water was added to the reaction mixture, and the mixture was extracted twice with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (aqueous ammonium bicarbonate solution/acetonitrile=50/50-40/60) to give compound 3b (14 mg, 32%).


ESIMS, (M+H)+, m/z: 967. 1H-NMR (CDCl3, δ): 1.24-1.27 (m, 3H), 1.48-1.53 (m, 18H), 1.61-1.63 (m, 3H), 2.36-2.48 (m, 6H), 2.63-2.78 (m, 6H), 3.49-3.60 (m, 4H), 4.54-4.64 (m, 2H), 4.75-4.85 (m, 2H), 7.05-7.14 (m, 1H), 7.47-7.56 (m, 2H), 7.59-7.67 (m, 2H), 7.69-7.84 (m, 4H), 8.13 (s, 1H).


Example 3c
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{[5-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-1,3,4-oxadiazol-2-yl]methyl}benzamide (Compound 3c)
(Step 1)

tert-Butyl {2-[2-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)hydrazinyl]-2-oxoethyl}carbamate (30 mg, 25%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (80 mg, 0.236 mmol) obtained in step 7 of reference example 1 and tert-butyl (2-hydrazinyl-2-oxoethyl)carbamate (67.1 mg, 0.355 mmol) in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 510.


(Step 2)

tert-Butyl {2-[2-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)hydrazinyl]-2-oxoethyl}carbamate (15 mg, 29 μmol) obtained in step 1 was dissolved in acetonitrile (0.3 mL), then triphenylphosphine (15 mg, 0.059 mmol), carbon tetrachloride (0.011 mL, 0.118 mmol) and triethylamine (0.0082 mL, 0.059 mmol) were added to the solution, and the mixture was stirred at 80° C. for 1 hour. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by reverse phase HPLC (acetonitrile/0.1% TFA aqueous solution=40/60 to 50/50) to give tert-butyl {[5-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-1,3,4-oxadiazol-2-yl]methyl}carbamate (10 mg, yield 69%).


ESI-MS, (M+H)+, m/z: 492.


(Step 3) tert-Butyl {[5-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-1,3,4-oxadiazol-2-yl]methyl}carbamate (10 mg, 0.020 mmol) obtained in step 2 was dissolved in dichloromethane (1 mL), then trifluoroacetic acid (1 mL) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure to give a crude product (8 mg) of 1-[(2S,4R)-4-({4-[5-(aminomethyl)-1,3,4-oxadiazol-2-yl]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate.


ESI-MS, (M+H)+, m/z: 392.


(Step 4)

Compound 3c (2.3 mg, total yield of 2 steps 16%) was obtained from the crude product (8 mg) of 1-[(2S,4R)-4-({4-[5-(aminomethyl)-1,3,4-oxadiazol-2-yl]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate obtained in step 3 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (10.3 mg, 0.031 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1d.


ESI-MS, (M+H)+, m/z: 712. 1H-NMR (CDCl3,δ): 1.13-1.19 (m, 12H), 1.25-1.35 (m, 2H), 2.23 (t, J=7.7 Hz, 1H), 2.33-2.43 (m, 2H), 2.54-2.65 (m, 2H), 2.64-2.74 (m, 2H), 4.23-4.30 (m, 2H), 4.91 (d, J=5.4 Hz, 2H), 4.93-5.01 (m, 2H), 5.32-5.37 (m, 1H), 6.63 (d, J=8.6 Hz, 2H), 6.68 (d, J=8.6 Hz, 2H), 7.15-7.34 (m, 8H), 7.71 (d, J=8.6 Hz, 2H), 7.87 (d, J=8.6 Hz, 2H).


Example 3d
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{[5-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-1,2,4-oxadiazol-3-yl]methyl}benzamide (Compound 3d)
(Step 1)

Methyl 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (1.9 g, 5.39 mmol) obtained in step 5 of reference example 1 was dissolved in THF (20 mL), then di-tert-butyl dicarbonate (3.53 g, 16.2 mmol) and dimethylaminopyridine (66 mg, 0.539 mmol) were added to the solution, and the mixture was stirred overnight under reflux. The reaction mixture was cooled to room temperature and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=8/2 to 6/4) to give methyl 4-{(tert-butoxycarbonyl)[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (2.09 g, 86%).


ESIMS, (M+H)+, m/z: 453.


(Step 2)

Methyl 4-{(tert-butoxycarbonyl)[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoate (259 mg, 0.572 mmol) obtained in step 1 was dissolved in methanol (3 mL), then aqueous sodium hydroxide solution (4 mol/L, 3 mL) was added to the solution, and the mixture was stirred for 3 hours under reflux. The reaction mixture was neutralized with hydrochloric acid (5 mol/L), and extracted twice with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure to give a crude product (270 mg) of 4-{(tert-butoxycarbonyl)[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid.


ESIMS, (M−H)−, m/z: 437.


(Step 3)

The crude product (270 mg) of 4-{(tert-butoxycarbonyl)[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid obtained in step 2 was dissolved in DMF (3 mL), then tert-butyl [2-amino-2-(hydroxyimino)ethyl]carbamate (175 mg, 0.924 mmol), COMU (396 mg, 0.924 mmol) and N,N-diisopropylethylamine (0.209 mL, 1.23 mmol) were added to the solution, and the mixture was stirred at 60° C. overnight, and then at 100° C. for 4 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=8/2 to 6/4) to give tert-butyl [4-(3-{[(tert-butoxycarbonyl)amino]methyl}-1,2,4-oxadiazol-5-yl)phenyl][(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]carbamate (57 mg, total yield of 2 steps 15%).


ESIMS, (M+H)+, m/z: 592.


(Step 4)

tert-Butyl [4-(3-{[(tert-butoxycarbonyl)amino]methyl}-1,2,4-oxadiazol-5-yl)phenyl][(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]carbamate (57 mg, 0.096 mmol) obtained in step 3 was dissolved in dichloromethane (1 mL), then trifluoroacetic acid (1 mL) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure to give a crude product (37 mg) of 1-[(2S,4R)-4-({4-[3-(aminomethyl)-1,2,4-oxadiazol-5-yl]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate.


ESIMS, (M+H)+, m/z: 392.


(Step 5)

Compound 3d (1.6 mg, total yield of 2 steps 2%) was obtained from the crude product (37 mg, 0.095 mmol) of 1-[(2S,4R)-4-({4-[3-(aminomethyl)-1,2,4-oxadiazol-5-yl]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate obtained in step 4 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (32 mg, 0.095 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1d.


ESIMS, (M+H)+, m/z: 712. 1H-NMR (CDCl3, δ): 1.11-1.20 (m, 12H), 1.27-1.37 (m, 2H), 2.33-2.44 (m, 2H), 2.54-2.74 (m, 4H), 4.22-4.33 (m, 2H), 4.81 (d, J=5.0 Hz, 2H), 4.96 (s, 2H), 6.63 (d, J=8.6 Hz, 2H), 6.69 (d, J=8.2 Hz, 2H), 7.14-7.34 (m, 8H), 7.72 (d, J=8.6 Hz, 2H), 7.95 (d, J=8.2 Hz, 2H).


Example 3e
1-[(2S,4R)-2-Methyl-4-({4-[3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-7-carbonyl]phenyl}amino)-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (Compound 3e)
(Step 1)

tert-Butyl 3-bromo-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (80 mg, 0.265 mmol) purchased from J&W PharmLab was dissolved in THF (1.5 ml), then isopropylmagnesium chloride-lithium chloride (1.3 mol/L THF solution, 0.346 ml, 0.450 mmol) was added to the solution at −10° C., and the mixture was stirred at −10° C. for 1 hour. Tributyltin chloride (0.122 ml, 0.450 mmol) was added to the reaction mixture, and the mixture was stirred at 0° C. for 1 hour and then at room temperature for 1 hour. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure to give a crude product (312 mg) of tert-butyl 3-(tributylstannyI)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate.


ESIMS, (M+H)+, m/z: 514.


(Step 2)

1-{(2S,4R)-4-[(4-Bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (39.6 mg, 0.106 mmol) obtained in reference example 2 was dissolved in toluene (2 mL), then the crude product (312 mg) of tert-butyl 3-(tributylstannyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate obtained in step 1 and Pd(PPh3)4 (12.3 mg, 0.011 mmol) were added to the solution, and the mixture was stirred under reflux for 1 hour. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (chloroform/methanol=99/1 to 97/3) and reverse phase HPLC (0.05% TFA/acetonitrile=53/35 to 43/45) to give tert-butyl 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (28.2 mg, 52%).


ESIMS, (M+H)+, m/z: 516.


(Step 3)

1-((2S,4R)-2-Methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (23.0 mg, 93%) was obtained from tert-butyl 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (28.2 mg, 0.055 mmol) obtained in step 2 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 416.


(Step 4)

Compound 3e (15.7 mg, 42%) was obtained from 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (23.0 mg, 0.051 mmol) obtained in step 3 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (17.2 mg, 0.051 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 736.6. 1H-NMR (DMSO-d6, δ): 0.98-1.06 (m, 12H), 1.17-1.28 (m, 2H), 2.19-2.30 (m, 2H), 2.54-2.69 (m, 4H), 3.85-3.89 (m, 2H), 4.01-4.08 (m, 2H), 4.15-4.30 (m, 2H), 4.70-4.79 (m, 4H), 6.29 (d, J=7.7 Hz, 1H), 6.62 (d, J=7.7 Hz, 1H), 6.70 (dd, J=8.6, 4.5 Hz, 4H), 6.88 (s, 1H), 7.12-7.37 (m, 12H).


Example 3f
1-[(2S,4R)-2-Methyl-4-({4-[2-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-7-carbonyl]phenyl}amino)-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (Compound 3f)
(Step 1)

1-{(2S,4R)-4-[(4-Bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (200 mg, 0.536 mmol) obtained in reference example 2 was dissolved in 1,4-dioxane (1 mL), then potassium acetate (105 mg, 1.07 mmol), bis(pinacolato)diboron (163 mg, 0.643 mmol) and PdCl2(dppf)-CH2Cl2 (43.8 mg, 0.054 mmol) were added to the solution, and the mixture was stirred for 2 hours under reflux. Water and ethyl acetate were added to the reaction mixture, the mixture was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=90/10 to 60/40) to give 1-((2S,4R)-2-methyl-4-{[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (101 mg, 45%).


ESIMS, (M+H)+, m/z: 421.


(Step 2)

1-((2S,4R)-2-Methyl-4-{[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (50.0 mg, 0.119 mmol) obtained in step 1 was dissolved in a mixed solvent (3.3 mL) of 1,4-dioxane and water(3:1), then tert-butyl 2-bromo-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (53.9 mg, 0.178 mmol) purchased from J&W PharmLab, cesium carbonate (78.0 mg, 0.238 mmol) and Pd(PPh3)4 (20.6 mg, 0.018 mmol) were added to the solution, and the mixture was stirred for 14 hours under reflux. Water and ethyl acetate were added to the reaction mixture, the mixture was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=50/50 to 0/100) to give a crude product (87.4 mg) of tert-butyl 2-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate.


ESIMS, (M+H)+, m/z: 516.


(Step 3)

1-((2S,4R)-2-Methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (49.4 mg, 92%) was obtained from the crude product (87.4 mg) of tert-butyl 2-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate obtained in step 2 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 416.


(Step 4)

Compound 3f (11.4 mg, 15%) was obtained from 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (42.1 mg, 0.101 mmol) obtained in step 3 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (37.7 mg, 0.111 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 736. 1H-NMR (DMSO-d6, δ): 0.99-1.06 (m, 12H), 1.14-1.28 (m, 2H), 2.19-2.30 (m, 2H), 2.57-2.67 (m, 4H), 3.92 (t, J=5.0 Hz, 2H), 4.05 (t, J=5.0 Hz, 2H), 4.14-4.31 (m, 2H), 4.69-4.79 (m, 4H), 6.02 (d, J=7.7 Hz, 1H), 6.60-6.65 (m, 3H), 6.70 (d, J=8.6 Hz, 2H), 7.13-7.23 (m, 4H), 7.24-7.34 (m, 7H), 7.44 (d, J=8.6 Hz, 2H).


Example 4a
N1,N5-bis(4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)glutaramide (Compound 4a)
(Step 1)

A crude product (0.15 g) of methyl 5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoate was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.1 g, 0.32 mmol) obtained in step 2 of reference example 7 and 5-methoxy-5-oxopentanoic acid (0.047 g, 0.32 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 438.


(Step 2)

A crude product (0.1 g) of 5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoic acid was obtained from the crude product (0.15 g, 0.34 mmol) of methyl 5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoate obtained in step 1 in the same manner as in step 2 of example 2f. ESIMS, (M+H)+, m/z: 424.


(Step 3)

Compound 4a (0.09 g, total yield of 3 steps 39%) was obtained from the crude product (0.1 g, 0.23 mmol) of 5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoic acid obtained in step 2 and 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.073 g, 0.23 mmol) obtained in step 2 of reference example 7 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 715.54. 1H-NMR (DMSO-d6, δ): 0.98-1.04 (m, 12H), 1.11-1.18 (m, 2H), 1.84-1.88 (m, 2H), 2.21-2.29 (m, 6H), 2.59 (t, J=15.25 Hz, 4H), 4.11 (s, 2H), 4.72 (d, J=6.5 Hz, 2H), 5.86 (d, J=7.93 Hz, 2H), 6.58 (d, J=8.5 Hz, 4H), 7.16 (d, J=4.27 Hz, 4H), 7.25-7.31 (m, 8H), 9.52 (s, 2H).


Example 4b
3-Methyl-N1,N5-bis(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)pentanediamide (Compound 4b)
(Step 1)

A crude product (0.1 g, 68%) of methyl 3-methyl-5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoate was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.1 g, 0.32 mmol) obtained in step 2 of reference example 7 and 5-methoxy-3-methyl-5-oxopentanoic acid (0.052 g, 0.324 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 452.


(Step 2)

A crude product (0.09 g, 94%) of 3-methyl-5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoic acid was obtained from the crude product (0.1 g, 0.22 mmol) of methyl 3-methyl-5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoate obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 438.


(Step 3)

Compound 4b (0.04 g, 27%) was obtained from the crude product of 3-methyl-5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoic acid (0.09 g, 0.20 mmol) obtained in step 2 and 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.064 g, 0.23 mmol) obtained in step 2 of reference example 7 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 729. 1H-NMR (DMSO-d6, δ): 0.94 (d, J=6.41 Hz, 3H), 0.98-1.04 (m, 12H), 1.11-1.15 (m, 2H), 2.12 (dd, J=13.73, 8.54 Hz, 2H), 2.21-2.31 (m, 4H), 2.36-2.45 (m, 1H), 2.51-2.61 (m, 4H), 4.08-4.12 (m, 2H), 4.72 (d, J=6.41 Hz, 2H), 5.86 (d, J=7.93 Hz, 2H), 6.58 (d, J=9.16 Hz, 4H), 7.16 (d, J=4.27 Hz, 4H), 7.23-7.30 (m, 8H), 9.53 (s, 2H).


Example 4c
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{3-[N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)sulfamoyl]phenyl}benzamide (Compound 4c)
(Step 1)

1-{(2S*,4R*)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (200 mg, 0.536 mmol) obtained in step 2 of reference example 7 was dissolved in dichloromethane (1 mL), then pyridine (0.026 mL, 0.323 mmol) and 3-nitrobenzenesulfonyl chloride (43.0 mg, 0.194 mmol) were added to the solution, and the mixture was stirred at room temperature for 2 hours. Hydrochloric acid (1 mol/L) and ethyl acetate were added to the reaction mixture, the mixture was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=80/20 to 40/60) to give N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-3-nitrobenzenesulfonamide (74.4 mg, 93%).


ESIMS, (M−H)+, m/z: 493.


(Step 2)

3-Amino-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)benzenesulfonamide (74.2 mg, quantitative) was obtained from N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-3-nitrobenzenesulfonamide (74.4 mg, 0.150 mmol) obtained in step 1 in the same manner as in step 2 of reference example 7.


ESIMS, (M−H)+, m/z: 463.


(Step 3)

Compound 4c (15.9 mg, 47%) was obtained from 3-amino-N-(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)benzenesulfonamide (20.0 mg, 0.043 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (14.6 mg, 0.043 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 785. 1H-NMR (DMSO-d6, δ): 0.95-1.07 (m, 12H), 1.22-1.28 (m, 2H), 2.14-2.30 (m, 2H), 2.57-2.69 (m, 4H), 4.00-4.08 (m, 1H), 4.29-4.36 (m, 1H), 4.62-4.78 (m, 2H), 5.97 (d, J=8.6 Hz, 1H), 6.48-6.52 (m, 2H), 6.72 (d, J=8.6 Hz, 2H), 6.76-6.80 (m, 3H), 7.07-7.13 (m, 2H), 7.15-7.22 (m, 2H), 7.25-7.32 (m, 4H), 7.45 (t, J=7.9 Hz, 1H), 7.79 (d, J=8.6 Hz, 2H), 7.85 (d, J=9.1 Hz, 1H), 7.93 (d, J=8.2 Hz, 1H), 8.22 (s, 1H), 9.56 (s, 1H), 10.06 (s, 1H).


Example 4d
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{2-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)sulfonamide]ethyl}benzamide (Compound 4d)
(Step 1)

1-{(2S,4R)-4-[(4-Bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (200 mg, 0.536 mmol) obtained in reference example 2 was dissolved in 1,4-dioxane (4 mL), then (4-methoxyphenyl)methanethiol (0.112 ml, 0.804 mmol), Pd2(dba)3 (49.1 mg, 0.054 mmol), xantphos (62.0 mg, 0.107 mmol) and N,N-diisopropylethylamine (0.187 ml, 1.072 mmol) were added to the solution, and the mixture was stirred for 15 hours under reflux. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=80/20 to 40/60) to give 1-[(2S,4R)-4-({4-[(4-methoxybenzyl)thio]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (244 mg, quantitative).


ESIMS, (M−H)+, m/z: 445.


(Step 2)

1-[(2S,4R)-4-({4-[(4-Methoxybenzyl)thio]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (127 mg, 0.284 mmol) obtained in step 1 was dissolved in a mixed solvent (0.9 mL) of acetonitrile and water (8:1), then trichloroisocyanuric acid (79.0 mg, 0.341 mmol) was added to the solution at −15° C., and the mixture was stirred for 30 minutes. The reaction mixture was heated to −5° C., then N-(tert-butoxycarbonyl)-1,2-diaminoethane (0.135 ml, 0.853 mmol) was added to the reaction mixture, and the mixture was stirred for 30 minutes. The reaction mixture was heated to 5° C., then N-(tert-butoxycarbonyl)-1,2-diaminoethane (0.090 ml, 0.569 mmol) was added to the reaction mixture, and the mixture was stirred for 30 minutes. Water and saturated aqueous ammonium chloride solution were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=70/30 to 20/80) to give tert-butyl {2-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)sulfonamide]ethyl}carbamate (14.4 mg, 10%).


ESIMS, (M−H)+, m/z: 515.


(Step 3)

A crude product (24.7 mg) of N-(2-aminoethyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzenesulfonamide hydrochloride was obtained from tert-butyl {2-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)sulfonamide]ethyl}carbamate (23.4 mg, 0.045 mmol) obtained in step 2 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 417.


(Step 4)

Compound 4d (23.9 mg, total yield of 2 steps 72%) was obtained from the crude product (24.7 mg) of N-(2-aminoethyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzenesulfonamide hydrochloride obtained in step 3 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (15.2 mg, 0.045 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b. ESIMS, (M+H)+, m/z: 737.51. 1H-NMR (DMSO-d6, δ): 1.00 (t, J=7.5 Hz, 6H), 1.05 (d, J=6.3 Hz, 6H), 1.18-1.25 (m, 2H), 2.19-2.30 (m, 2H), 2.59 (q, J=7.5 Hz, 4H), 2.80 (t, J=6.3 Hz, 2H), 3.24 (dt, J=6.3, 5.9 Hz, 2H), 4.24-4.32 (m, 2H), 4.69-4.78 (m, 2H), 6.57 (d, J=7.2 Hz, 1H), 6.64 (d, J=9.1 Hz, 2H), 6.73 (d, J=9.1 Hz, 2H), 6.87 (d, J=8.2 Hz, 1H), 7.08 (d, J=7.2 Hz, 2H), 7.16 (q, J=6.3 Hz, 2H), 7.24-7.33 (m, 5H), 7.49 (d, J=8.6 Hz, 2H), 7.59 (d, J=8.6 Hz, 2H), 8.03 (t, J=5.9 Hz, 1H).


Example 4e
N-(4-{[(2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-3-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]propanamide (Compound 4e)
(Step 1)

Methyl 3-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]propanoate (0.12 g, 72%) was obtained from 1-{(2S,4R)-4-[(4-bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.150 g, 0.403 mmol) obtained in reference example 2 and methyl 3-mercaptopropionate (0.13 mL, 1.21 mmol) in the same manner as in step 1 of example 4d.


ESIMS, (M+H)+, m/z: 413.


(Step 2)

A crude product (0.075 g, 86%) of 3-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]propanoic acid was obtained from methyl 3-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]propanoate (0.09 g, 0.22 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 399.


(Step 3)

Compound 4e (0.04 g, 30%) was obtained from the crude product (0.075 g, 0.19 mmol) of 3-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]propanoic acid obtained in step 2 and 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.058 g, 0.19 mmol) obtained in step 2 of reference example 7 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 690.69. 1H-NMR (DMSO-d6, δ): 0.98-1.05 (m, 12H), 1.14-1.19 (m, 2H), 2.20-2.26 (m, 2H), 2.45-2.47 (m, 2H), 2.55-2.61 (m, 4H), 2.97 (t, J=7.2 Hz, 2H), 4.11-4.15 (m, 2H), 4.72 (brs, 2H), 5.84 (d, J=8.0 Hz, 1H), 6.24 (d, J=7.6 Hz, 1H), 6.56-6.65 (m, 4H), 7.13-7.30 (m, 12H), 9.54 (s, 1H).


Example 4f
4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}-N-{2-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]ethyl}benzamide (Compound 4f)
(Step 1)

tert-Butyl {2-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]ethyl}carbamate (0.080 g, 42%) was obtained from 1-{(2S,4R)-4-[(4-bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.150 g, 0.403 mmol) obtained in reference example 2 and tert-butyl (2-mercaptoethyl)carbamate (0.214 g, 1.21 mmol) in the same manner as in step 1 of example 4d.


ESIMS, (M+H)+, m/z: 470.


(Step 2)

1-[(2S,4R)-4-({4-[(2-Aminoethyl)thio]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one hydrochloride (0.06 g, 87%) was obtained from tert-butyl {2-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]ethyl}carbamate (0.08 g, 0.17 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 370.


(Step 3)

Compound 4f (0.025 g, 25%) was obtained from 1-[(2S,4R)-4-({4-[(2-aminoethyl)thio]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one hydrochloride (0.06 g, 0.15 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.05 g, 0.15 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 690. 1H-NMR (DMSO-d6, δ): 1.02-1.05 (m, 12H), 1.14-1.24 (m, 2H), 2.21-2.26 (m, 2H), 2.54-2.63 (m, 4H), 2.85 (t, J=7.0 Hz, 2H), 3.35 (s, 2H), 4.15 (brs, 1H), 4.24-4.27 (m, 1H), 4.73-4.74 (m, 2H), 6.25 (d, J=7.5 Hz, 1H), 6.58 (d, J=7.5 Hz, 1H), 6.62-6.65 (m, 4H), 7.09 (d, J=8.0 Hz, 1H), 7.13-7.19 (m, 3H), 7.22-7.31 (m, 6H), 7.60 (d, J=8.5 Hz, 2H), 8.17 (t, J=5.5 Hz, 1H).


Example 5a
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)oxazole-4-carboxamide (Compound 5a)
(Step 1)

1-{(2S,4R)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (200 mg, 0.646 mmol) obtained in step 3 of reference example 7 and trimethylsilyl isocyanate (0.128 mL, 0.970 mmol) were dissolved in THF (4 mL), and the mixture was stirred for 3 hours under reflux. The reaction mixture was cooled to room temperature, then water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=10/0 to 9/1) to give 1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)urea (185 mg, 81%).


ESI-MS, (M+H)+, m/z: 353.


(Step 2)

1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)urea (180 mg, 0.511 mmol) obtained in step 1 and ethyl 3-bromopyruvate (0.077 mL, 0.613 mmol) were dissolved in ethanol (5 mL), and the mixture was stirred for 4 hours under reflux. The reaction mixture was cooled to room temperature and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=6/4 to 2/8) to give ethyl 2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)oxazole-4-carboxylate (150 mg, 65%).


ESI-MS, (M+H)+, m/z: 449.


(Step 3)

Ethyl 2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)oxazole-4-carboxylate (40 mg, 0.089 mmol) obtained in step 2 and trimethyltin hydroxide (18 mg, 0.098 mmol) were dissolved in 1,2-dichloroethane (1 mL), and the mixture was stirred at 80° C. overnight. The reaction mixture was cooled to room temperature and filtered through diatomaceous earth. The filtrate was concentrated under reduced pressure to give a crude product (40 mg) of 2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)oxazole-4-carboxylic acid.


ESI-MS, (M+H)+, m/z: 421.


(Step 4)

A crude product of compound 5a was obtained from the crude product (30 mg) of 2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)oxazole-4-carboxylic acid obtained in step 3 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (27 mg, 0.086 mmol) obtained in step 3 of reference example 7 in the same manner as in step 3 of example 1b. The obtained crude product was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=60/40 to 50/50) to give compound 5a (8 mg, total yield of 2 steps 16%).


ESI-MS, (M+H)+, m/z: 712. 1H-NMR (CDCl3, δ): 1.10-1.18 (m, 12H), 1.22-1.31 (m, 2H), 2.32-2.43 (m, 2H), 2.52-2.71 (m, 4H), 3.79-3.86 (m, 2H), 4.12-4.22 (m, 2H), 4.94 (s, 2H), 6.63 (d, J=9.1 Hz, 2H), 6.66 (d, J=9.1 Hz, 2H), 6.75 (s, 1H), 7.13-7.23 (m, 4H), 7.27-7.35 (m, 5H), 7.47 (d, J=8.6 Hz, 2H), 7.82 (s, 1H), 8.46 (s, 1H).


Example 5b
1-((2S,4R)-2-Methyl-4-((4-((2-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-5,6-dihydroimidazo[1,2-a]pyrazin-7(8H)-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 5b)
(Step 1)

A saturated aqueous sodium hydrogen carbonate solution was added to 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.120 g, 0.265 mmol) obtained in step 3 of example 3f, and the organic layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (0.090 g) of 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one.


ESIMS, (M+H)+, m/z: 430.


(Step 2)

The crude product (0.09 g) of 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one obtained in step 3 of example 3f was dissolved in methanol (2 mL, then tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.091 g, 0.22 mmol) obtained in reference example 8 and acetic acid (0.08 mL, 1.30 mmol) were added to the solution, and the mixture was stirred at room temperature for 40 minutes. Sodium cyanoborohydride (0.041 g, 0.65 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 6 hours. The reaction mixture was diluted with water, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (0.120 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((2-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-5,6-dihydroimidazo[1,2-a]pyrazin-7(8H)-yl)methyl)phenyl)carbamate.


ESIMS, (M+H)+, m/z: 822.


(Step 3)

Compound 5b (0.020 g, yield of 3 steps 10%) was obtained from the crude product (0.140 g, 0.17 mmol) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((2-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-5,6-dihydroimidazo[1,2-a]pyrazin-7(8H)-yl)methyl)phenyl)carbamate obtained in step 2 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 722: 1H-NMR (DMSO-d6, δ) 0.96-1.08 (m, 12H), 1.11-1.28 (m, 2H), 2.18-2.28 (m, 2H), 2.55-2.64 (m, 4H), 2.81 (t, J=5.36 Hz, 2H), 3.52 (d, J=16.93 Hz, 4H), 3.93 (t, J=5.25 Hz, 2H), 4.10-4.20 (m, 2H), 4.68-4.80 (m, 2H), 5.99-6.05 (m, 2H), 6.62 (t, J=8.4 Hz, 4H), 7.08 (d, J=8.34 Hz, 2H), 7.15-7.22 (m, 5H), 7.23-7.32 (m, 4H), 7.42 (d, J=8.4 Hz, 2H).


Example 5c
1,1′-((2S,2'S,4R,4′R)-((((5,6-Dihydroimidazo[1,2-a]pyrazine-3,7(8H)-diyl)bis(methylene))bis(4,1-phenylene))bis(azanediyl))bis(2-methyl-3,4-dihydroquinoline-4,1(2H)-diyl))bis(propan-1-one) (Compound 5c)
(Step 1)

Commercially available tert-butyl 3-bromo-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.644 g, 2.13 mmol) was dissolved in THF (5 mL), then isopropylmagnesium chloride-lithium chloride (1.3 mol/L THF solution, 2.46 mL, 3.20 mmol) was added to the solution at 0° C., and the mixture was stirred at 0° C. for 30 minutes. tert-Butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.3 g, 0.71 mmol) obtained in reference example 8 was added to the reaction mixture at 0° C., and the mixture was stirred at 0° C. for 30 minutes. The reaction mixture was diluted with saturated aqueous ammonium chloride solution, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=1/4) to give tert-butyl 3-((4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)(hydroxy)methyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.150 g, 32%).


ESIMS, (M+H)+, m/z: 646.


(Step 2)

tert-Butyl 3-((4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)(hydroxy)methyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.100 g, 0.15 mmol) obtained in step 1 was dissolved in trifluoroacetic acid (1 mL), then triethylsilane was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure to give a crude product (0.085 g) of 1-a2S,4R)-2-methyl-4-((4-((5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate.


ESIMS, (M−TFA+H)+, m/z: 430.


(Step 3)

A saturated aqueous sodium hydrogen carbonate solution was added to crude product (0.120 g) of 1-((2S,4R)-2-methyl-4-((4-((5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate obtained in step 2, and the organic layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (0.090 g) of 1-((2S,4R)-2-methyl-4-((4-((5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one.


ESIMS, (M+H)+, m/z: 430.


(Step 4)

tert-Butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)-5,6-dihydroimidazo[1,2-a]pyrazin-7(8H)-yl)methyl)phenyl)carbamate (0.120 g, total yield of 3 steps 68%) was obtained from the crude product (0.090 g) of 1-((2S,4R)-2-methyl-4-((4-((5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one obtained in step 3 and tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.088 g, 0.21 mmol) obtained in reference example 8 in the same manner as in step 2 of example 5b.


ESIMS, (M+H)+, m/z: 836.


(Step 5)

Compound 5c (0.027 g, 26%) was obtained from tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)-5,6-dihydroimidazo[1,2-a]pyrazin-7(8H)-yl)methyl)phenyl)carbamate (0.120 g, 0.14 mmol) obtained in step 4 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 736; 1H-NMR (DMSO-d6, δ) 0.97-1.05 (m, 12H), 1.12-1.22 (m, 2H), 2.18-2.32 (m, 2H), 2.57-2.61 (m, 4H), 2.68-2.78 (m, 2H), 3.45 (s, 2H), 3.50 (s, 2H), 3.61-3.70 (m, 2H), 3.73 (s, 2H), 4.05-4.15 (m, 2H), 4.71-4.73 (m, 2H), 5.93 (d, J=7.6 Hz, 1H), 6.02 (d, J=7.6 Hz, 1H), 6.50 (s, 1H), 6.59 (dd, J=12.99, 8.46 Hz, 4H), 6.90 (d, J=8.4 Hz, 2H), 7.03 (d, J=8.4 Hz, 2H), 7.14-7.19 (m, 4H), 7.22-7.30 (m, 4H).


Example 5d
2,2′-Azanediylbis(N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide) (Compound 5d)
(Step 1)

tert-Butyl N-(((9H-fluoren-9-yl)methoxy)carbonyl)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)glycinate (250 mg, 97%) was obtained from 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.112 g, 0.36 mmol) and N-(((9H-fluoren-9-yl)methoxy)carbonyl)-N-(2-(tert-butoxy)-2-oxoethyl)glycine (0.150 g, 0.36 mmol) obtained in reference example 7 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 703.48.


(Step 2)

tert-Butyl N-(((9H-fluoren-9-yl)methoxy)carbonyl)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)glycinate (240 mg, 0.34 mmol) obtained in step 1 was dissolved in dichloromethane (3 mL), then trifluoroacetic acid (1.5 mL) was added to the solution under ice cooling, and the mixture was stirred for 2 hours. The reaction mixture was concentrated under reduced pressure to give a crude product (0.200 g) of N-(((9H-fluoren-9-yl)methoxy)carbonyl)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)glycine.


ESIMS, (M+H)+, m/z: 647.02.


(Step 3)

A crude product (0.200 g) of (9H-fluoren-9-yl)methyl bis(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)carbamate was obtained from the crude product (0.200 g) of N-(((9H-fluoren-9-yl)methoxy)carbonyl)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)glycine obtained in step 2 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.095 g, 0.31 mmol) obtained in reference example 7 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 938.60.


(Step 4)

Compound 5d (0.037 g, total yield of 3 steps 19%) was obtained from the crude product (0.250 g) of (9H-fluoren-9-yl)methyl bis(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)carbamate obtained in step 3 and in the same manner as in step 2 of example 2a.


ESIMS, (M+H)+, m/z: 716.21. 1H-NMR (DMSO-d6, δ): 0.98-1.04 (m, 12H), 1.13-1.17 (m, 2H), 2.20-2.26 (m, 2H), 2.53-2.61 (m, 4H), 3.29 (s, 4H), 4.10-4.14 (m, 2H), 4.72-4.74 (m, 2H), 5.87 (d, J=7.6 Hz, 2H), 6.60 (d, J=9.2 Hz, 4H), 7.16 (d, J=3.2 Hz, 4H), 7.23-7.35 (m, 8H), 9.63 (s, 2H).


Example 5e
1-((2S,4R)-2-Methyl-4-((4-(((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)azetidin-3-yl)amino)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 5e)
(Step 1)

tert-Butyl [1-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoyl)azetidin-3-yl]carbamate (0.160 g, 0.32 mmol) obtained in step 1 of example 1n was dissolved in dichloromethane (2 mL), then trifluoroacetic acid (1 mL) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, then the obtained residue was neutralized with a saturated aqueous sodium hydrogen carbonate solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (0.115 g, 90%).


ESIMS, (M+H)+, m/z: 393.66.


(Step 2)

tert-Butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-(((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)azetidin-3-yl)amino)methyl)phenyl)carbamate (0.180 g, 76%) was obtained from 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (0.115 g, 0.29 mmol) obtained in step 1 and tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.123 g, 0.29 mmol) obtained in reference example 8 in the same manner as in step 2 of example 5b.


ESIMS, (M+H)+, m/z: 799.79.


(Step 3)

Compound 5e (0.063 g, 41%) was obtained from tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-(((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)azetidin-3-yl)amino)methyl)phenyl)carbamate (0.180 g, 0.22 mmol) obtained in step 2 in the same manner as in step 1.


ESI-MS m/z: 699.5 (M+H)+: 1H-NMR (DMSO-d6,δ): 0.98-1.05 (m, 12H), 1.09-1.25 (m, 2H), 2.18-2.28 (m, 2H), 2.53-2.67 (m, 4H), 3.48-3.57 (m, 3H), 3.65-4.33 (m, 6H), 4.61-4.82 (m, 2H), 5.92 (d, J=7.67 Hz, 1H), 6.57-6.65 (m, 5H), 7.03 (d, J=8.55 Hz, 2H), 7.09-7.19 (m, 4H), 7.22-7.31 (m, 4H), 7.41 (d, J=8.8 Hz, 2H).


Example 5f
1-((2S,4R)-2-Methyl-4-((4-(((2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)amino)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 5f)

tert-Butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (30 mg, 0.071 mmol) obtained in reference example 8 was dissolved in dichloromethane (1.5 mL), then 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (28.7 mg, 0.071 mmol) obtained in step 2 of example 6q was added to the solution, and the mixture was stirred at room temperature for 10 minutes. Sodium triacetoxyborohydride (75 mg, 0.355 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was diluted with 1 mol/L aqueous sodium hydroxide solution, and the aqueous layer was extracted with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was dissolved in dichloromethane (5 mL), then trifluoroacetic acid (1 mL) was added to the solution, and the mixture was stirred at room temperature for 30 min. The reaction mixture was neutralized with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with chloroform. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=50/50-40/60) to give compound 5f (46.3 mg, 92%).


ESIMS, (M+H)+, m/z: 710: 1H-NMR (CDCl3, δ) 1.06-1.41 (m, 16H), 2.30-2.41 (m, 2H), 2.50-2.71 (m, 4H), 3.09 (t, J=5.2 Hz, 2H), 3.70 (s, 2H), 3.79 (d, J=7.6 Hz, 1H), 3.90 (d, J=7.6 Hz, 1H), 4.09-4.31 (m, 4H), 4.85-5.08 (m, 1H), 6.58 (d, J=8.8 Hz, 2H), 6.63 (d, J=8.8 Hz, 2H), 7.06-7.36 (m, 12H), 7.54 (s, 1H), 7.69 (s, 1H).


Example 5g
1-((2S,4R)-2-Methyl-4-((4-((((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1,3,4-oxadiazol-2-yl)methyl)amino)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 5g)
(Step 1)

A crude product (468 mg) of tert-butyl (4-(2-((tert-butoxycarbonyl)glycyl)hydrazine-1-carbonyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate was obtained from 4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (300 mg, 0.684 mmol) obtained in step 2 of reference example 8 and tert-butyl (2-hydrazinyl-2-oxoethyl)carbamate (259 mg, 1.37 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 610.


(Step 2)

A crude product (374 mg) of tert-butyl (4-(5-(((tert-butoxycarbonyl)amino)methyl)-1,3,4-oxadiazol-2-yl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate was obtained from the crude product (450 mg) of tert-butyl (4-(2-((tert-butoxycarbonyl)glycyl)hydrazine-1-carbonyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate obtained in step 1 in the same manner as in step 2 of example 3c.


ESIMS, (M+H)+, m/z: 592.


(Step 3)

The crude product (370 mg) of tert-Butyl (4-(5-(((tert-butoxycarbonyl)amino)methyl)-1,3,4-oxadiazol-2-yl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate obtained in step 2 was dissolved in dichloromethane (10 mL), then trifluoroacetic acid (2 mL) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was diluted with ethyl acetate and washed twice with water. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by column chromatography (chloroform/methanol=100/0 to 80/20) to give 1-((2S,4R)-4-((4-(5-(aminomethyl)-1,3,4-oxadiazol-2-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (250 mg, total yield of 3 steps 97%).


ESIMS, (M+H)+, m/z: 392.


(Step 4)

Compound 5g (42.9 mg, total yield of 2 steps 87%) was obtained from tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (30 mg, 0.071 mmol) obtained in reference example 8 and 1-[(2S,4R)-4-({4-[5-(aminomethyl)-1,3,4-oxadiazol-2-yl]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (27.8 mg, 0.071 mmol) obtained in step 3 in the same manner as in example 5f.


ESIMS, (M−H)−, m/z: 696: 1H-NMR (CDCl3, δ) 1.06-1.41 (m, 16H), 2.31-2.46 (m, 2H), 2.52-2.65 (m, 3H), 2.67-2.78 (m, 1H), 3.79 (s, 2H), 4.06 (s, 2H), 4.06-4.17 (m, 1H), 4.21-4.40 (m, 2H), 4.81-5.08 (m, 2H), 6.58 (d, J=8.8 Hz, 2H), 6.68 (d, J=8.8 Hz, 2H), 7.09-7.38 (m, 10H), 7.85 (d, J=8.8 Hz, 2H).


Example 5h
1-((2S,4R)-2-Methyl-4-((4-((((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 5h)
(Step 1)

tert-Butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((prop-2-yn-1-ylamino)methyl)phenyl)carbamate (0.140 g, 85%) was obtained from tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.150 g, 0.35 mmol) obtained in reference example 8 and prop-2-yn-1-amine (0.023 g, 0.42 mmol) in the same manner as in step 2 of example 5b.


ESIMS, (M+H)+, m/z: 462.39.


(Step 2)

tert-Butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)carbamate (0.130 g, 53%) was obtained from tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((prop-2-yn-1-ylamino)methyl)phenyl)carbamate (0.140 g, 0.30 mmol) obtained in step 1 and the crude product (0.102 g) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 5j.


ESIMS, (M+H)+, m/z: 797.67.


(Step 3)

Compound 5h (0.040 g, 35%) was obtained from tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)carbamate (0.130 g, 0.16 mmol) obtained in step 2 in the same manner as in step 2 of example 1a. ESI-MS m/z: 697.69 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.07 (m, 12H), 1.13-1.26 (m, 2H), 2.21-2.28 (m, 2H), 2.55-2.66 (m, 4H), 3.76 (s, 2H), 3.94 (s, 2H), 4.10-4.19 (m, 1H), 4.21-4.31 (m, 1H), 4.65-4.84 (m, 2H), 6.05 (d, J=7.34 Hz, 1H), 6.50 (d, J=7.82 Hz, 1H), 6.63 (d, J=8.31 Hz, 2H), 6.80 (d, J=8.56 Hz, 2H), 7.13-7.20 (m, 6H), 7.24-7.33 (m, 4H), 7.54 (d, J=8.56 Hz, 2H), 8.44 (s, 1H).


Example 5i
2-((4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)amino)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride (Compound 5i)
(Step 1)

A crude product (0.170 g) of tert-butyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)carbamate was obtained from 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.150 g, 0.48 mmol) obtained in reference example 7 and (tert-butoxycarbonyl)glycine (0.084 g, 0.48 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 467.28.


(Step 2)

A crude product (0.130 g) of 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride was obtained from the crude product (0.170 g) of tert-butyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)carbamate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 367.25.


(Step 3)

A crude product (0.120 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-(((2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)amino)methyl)phenyl)carbamate was obtained from the crude product (0.130 g) of 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride obtained in step 2 and tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.136 g, 0.32 mmol) obtained in reference example 8 in the same manner as in step 2 of example 5b.


ESIMS, (M+H)+, m/z: 773.70.


(Step 4)

Compound 5i (0.030 g, total yield of 3 steps 28%) was obtained from the crude product (0.120 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-(((2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)amino)methyl)phenyl)carbamate obtained in step 3 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 673.61. 1H-NMR (DMSO-d6, δ): 0.99-1.05 (m, 12H), 1.12-1.20 (m, 1H), 2.20-2.27 (m, 2H), 2.56-2.63 (m, 4H), 3.67-3.78 (m, 2H), 4.03-4.21 (m, 4H), 4.73-4.75 (m, 2H), 5.99-6.05 (m, 1H), 6.29-6.32 (m, 1H), 6.62-6.69 (m, 4H), 7.08-7.18 (m, 4H), 7.22-7.32 (m, 8H), 9.15 (brs, 2H), 10.18 (s, 1H).


Example 5j
1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazolee-4-carboxamide (Compound 5j)
(Step 1)

N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propiolamide (0.140 g, 80%) was obtained from 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.150 g, 0.48 mmol) obtained in reference example 7 and propiolic acid (0.036 g, 0.51 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 362.25.


(Step 2)

tert-Butyl (4-(hydroxymethyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.150 g, 0.35 mmol) obtained in step 3 of reference example 8 was dissolved in toluene (3 mL), then DPPA (0.11 mL, 0.53 mmol) and DBU (0.1 mL, 0.70 mmol) were added to the solution, and the mixture was stirred at room temperature for 16 hours. Water (3 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give a crude product (0.180 g) of tert-butyl (4-(azidomethyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetra hydroquinolin-4-yl)carbamate.


ESIMS, (M+H)+, m/z: 450.29.


(Step 3)

N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propiolamide (0.085 g, 0.23 mmol) obtained in step 1 and the crude product (0.180 g) of tert-butyl (4-(azidomethyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate obtained in step 2 were dissolved in t-butanol (2 mL), then sodium L-ascorbate (9 mg, 0.05 mmol), copper sulfate pentahydrate (6 mg, 0.023 mmol) and water (1 mL) were added to the solution, and the mixture was stirred at room temperature for 16 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% formic acid aqueous solution=45/55) to give tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)-1H-1,2,3-triazol-1-yl)methyl)phenyl)carbamate (0.100 g, 52%).


ESIMS, (M+H)+, m/z: 811.58.


(Step 4)

Compound 5j (0.020 g, 23%) was obtained from tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)-1H-1,2,3-triazol-1-yl)methyl)phenyl)carbamate (0.1 g, 0.12 mmol) obtained in step 3 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 711.50. 1H NMR (DMSO-d6, δ): 0.98-1.12 (m, 12H), 1.15-1.17 (m, 2H), 2.20-2.27 (m, 2H), 2.51-2.62 (m, 4H), 4.11-4.17 (m, 2H), 4.71-4.74 (m, 2H), 5.47 (s, 2H), 5.96 (d, J=7.87 Hz, 1H), 6.22 (d, J=7.63 Hz, 1H), 6.60-6.65 (m, 4H), 7.10-7.18 (m, 6H), 7.23-7.30 (m, 4H), 7.48 (d, J=8.82 Hz, 2H), 8.61 (s, 1H), 10.03 (s, 1H).


Example 5k
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3,6-dihydropyridin-1(2H)-yl)acetamide (Compound 5k)
(Step 1)

1-((2S,4R)-4-((4-Bromophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (300 mg, 0.804 mmol) obtained in reference example 2 and tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydropyridine-1(2H)-carboxylate (373 mg, 1.21 mmol) were dissolved in a mixed solvent of 1,4-dioxane (2.5 mL) and water (1.0 mL), then Pd(dppf)Cl2 dichloromethane complex (65.6 mg, 0.080 mmol) and potassium phosphate (512 mg, 2.41 mmol) were added to the solution, and the mixture was stirred at 100° C. overnight. The reaction mixture was cooled to room temperature and filtered through diatomaceous earth. The filtrate was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=8/2 to 5/5) to give tert-butyl 4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3,6-dihydropyridine-1(2H)-carboxylate (348 mg, 91%).


ESI-MS, (M+H)+, m/z: 476.


(Step 2)

A crude product (275 mg) of 1-((2S,4R)-2-methyl-4-((4-(1,2,3,6-tetrahydropyridin-4-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate was obtained from tert-butyl 4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3,6-dihydropyridine-1(2H)-carboxylate (348 mg, 0.732 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESI-MS, (M+H)+, m/z: 376.


(Step 3)

The crude product (275 mg) of 1-((2S,4R)-2-methyl-4-((4-(1,2,3,6-tetrahydropyridin-4-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate obtained in step 2 was dissolved in DMF (5 mL), then tert-butyl bromoacetate (0.161 mL, 1.10 mmol) and cesium carbonate (716 mg, 2.2 mmol) were added to the solution, and the mixture was stirred at room temperature overnight. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed twice with water and once with saturated brine, dried over magnesium sulfate, and concentrated under reduced pressure to give a crude product (421 mg) of tert-butyl 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3,6-dihydropyridin-1(2H)-yl)acetate.


ESI-MS, (M+H)+, m/z: 490.


(Step 4)

A crude product (100 mg) of 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3,6-dihydropyridin-1(2H)-yl)acetic acid trifluoroacetate was obtained from the crude product (421 mg) of tert-butyl 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3,6-dihydropyridin-1(2H)-yl)acetate obtained in step 3 in the same manner as in step 2 of example 1k.


ESI-MS, (M+H)+, m/z: 434.


(Step 5)

A crude product of compound 5k was obtained from the crude product (40 mg) of 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3,6-dihydropyridin-1(2H)-yl)acetic acid trifluoroacetate obtained in step 4 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (35 mg, 0.112 mmol) obtained in step 3 of reference example 7 in the same manner as in step 3 of example 1b. The crude product obtained was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=45/55 to 35/65) to give compound 5k (4 mg, total yield of 4 steps 6%).


ESI-MS, (M+H)+, m/z: 725. 1H-NMR (CDCl3) δ: 1.11-1.19 (m, 12H), 2.20-2.25 (m, 1H), 2.32-2.42 (m, 2H), 2.51-2.71 (m, 6H), 2.85 (t, J=5.7 Hz, 2H), 3.24 (s, 2H), 3.31 (d, J=2.7 Hz, 2H), 3.78 (d, J=8.2 Hz, 1H), 3.90 (d, J=7.2 Hz, 1H), 4.13-4.24 (m, 2H), 4.89-4.99 (m, 2H), 5.32-5.37 (m, 1H), 5.98 (s, 1H), 6.59-6.64 (m, 4H), 7.13-7.22 (m, 4H), 7.25-7.32 (m, 6H), 7.39 (d, J=9.1 Hz, 2H), 9.03 (s, 1H).


Example 5l
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfonyl)propanamide (Compound 5l)
(Step 1)

N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thio)propanamide (0.4 g, 62%) was obtained from 3-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)thio]propanoic acid (0.370 g, 0.93 mmol) obtained in step 2 of example 4e and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.287 g, 0.93 mmol) obtained in step 3 of reference example 7 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 690.


(Step 2)

N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thio)propanamide (0.2 g, 0.29 mmol) obtained in step 1 was dissolved in dichloromethane (4 mL), then meta-chloroperbenzoic acid (60% w/w (water content), 0.167 g, 0.58 mmol) was added to the solution at 0° C., and the mixture was stirred at room temperature for 2 hours. The reaction mixture was diluted with water and the aqueous layer was extracted with dichloromethane. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=40/60 to 10/90) to give compound 5l (0.027 g, 13%).


ESIMS, (M+H)+, m/z: 722: 1H-NMR (DMSO-d6, δ) 0.97-1.05 (m, 12H), 1.13-1.21 (m, 2H), 2.19-2.26 (m, 2H), 2.54-2.62 (m, 6H), 3.40 (t, J=7.56 Hz, 2H), 4.08-4.13 (m, 1H), 4.25-4.34 (m, 1H), 4.71-4.74 (m, 2H), 5.86 (d, J=7.89 Hz, 1H), 6.57 (d, J=8.99 Hz, 2H), 6.78 (d, J=8.77 Hz, 2H), 7.07 (t, J=8.0 Hz, 2H), 7.14-7.33 (m, 9H), 7.56 (d, J=8.99 Hz, 2H), 9.69 (s, 1H).


Example 5m
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfinyl)propanamide (Compound 5m)

N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thio)propanamide (0.150 g, 0.22 mmol) obtained in step 1 of example 5l was dissolved in dichloromethane (2 mL), then meta-chloroperbenzoic acid (60% w/w (containing water), 0.037 g, 0.13 mmol) was added to the solution at 0° C., and the mixture was stirred at room temperature for 2 hours. The reaction mixture was diluted with water and the aqueous layer was extracted with dichloromethane. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=55/45 to 19/81) to give compound 5m (0.042 g, 27%).


ESIMS, (M+H)+, m/z: 706: 1H-NMR (DMSO-d6, δ) 0.98-1.05 (m, 12H), 1.10-1.25 (m, 2H), 2.20-2.27 (m, 2H), 2.38-2.45 (m, 1H), 2.53-2.64 (m, 5H), 2.94-3.01 (m, 1H), 3.06-3.13 (m, 1H), 4.07-5.13 (m, 1H), 4.22-4.28 (m, 1H), 4.71-4.76 (m, 2H), 5.85 (d, J=8.0 Hz, 1H), 6.57 (d, J=8.77 Hz, 2H), 6.65 (dd, J=7.2, 2.0 Hz, 1H), 6.80 (d, J=8.4 Hz, 2H), 7.11-7.19 (m, 4H), 7.24-7.32 (m, 6H), 7.38-7.40 (m, 2H), 9.64 (s, 1H).


Example 5n
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenoxy)ethyl)benzamide (Compound 5n)
(Step 1)

1-((2S,4R)-4-((4-Bromophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (500 mg, 1.34 mmol) obtained in reference example 2 was dissolved in 1,4-dioxane (10 mL), then bis(pinacolato)diboron (395 mg, 1.61 mmol) and potassium acetate (276 mg, 2.82 mmol) were added to the solution, and the mixture was stirred at room temperature for 5 minutes under an argon atmosphere. PdCl2(dppf) dichloromethane complex (49 mg, 0.067 mmol) was added to the mixture, and the mixture was stirred at 100° C. for 16 hr under an argon atmosphere. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane/ethyl acetate=100/0 to 70/30) to give 1-((2S,4R)-2-methyl-4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (380 mg, 67%).


ESI-MS m/z: 421 (M+H)+


(Step 2)

1-((2S,4R)-2-Methyl-4-((4-(4,4,5,5-tetra methyl-1,3,2-dioxaborolan-2-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (380 mg, 0.900 mmol) obtained in step 1 was dissolved in THF (5 mL), then 30% aqueous hydrogen peroxide solution (0.51 mL, 4.52 mmol) was added to the solution under ice cooling, and the mixture was stirred at room temperature for 16 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=100/0 to 70/30) to give 1-((2S,4R)-4-((4-hydroxyphenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (190 mg, 68%).


ESI-MS m/z: 311 (M+H)+


(Step 3)

1-((2S,4R)-4-((4-hydroxyphenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (300 mg, 0.97 mmol) obtained in step 2 was dissolved in acetonitrile (5 mL), then potassium carbonate (400 mg, 2.90 mmol) and tert-butyl (2-bromoethyl)carbamate (431 mg, 1.93 mmol) were added to the solution, and the mixture was stirred at 80° C. for 16 hours. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by reverse phase silica gel column chromatography (acetonitrile/0.1° A) formic acid=50/50) to give a crude product (300 mg) of tert-butyl (2-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenoxy)ethyl)carbamate. 1-((2S,4R)-4-((4-(2-aminoethoxy)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (200 mg, 77%) was obtained from the crude product obtained (0.03 g, 0.07 mmol) in the same manner as in step 2 of example 1a.


ESI-MS m/z: 354 (M+H)+


(Step 4)

Compound 5n (13 mg, 37%) was obtained from 1-((2S,4R)-4-((4-(2-aminoethoxy)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (20 mg, 0.05 mmol) obtained in step 3 and 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (14 mg, 0.04 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 674 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.06 (m, 12H), 1.11-1.13 (m, 2H), 2.22-2.25 (m, 2H), 2.52-2.64 (m, 4H), 3.52 (q, J=5.90 Hz, 2H), 3.94 (t, J=6.10 Hz, 2H), 4.05 (m, 1H), 4.27 (m, 1H), 4.66-4.80 (m, 2H), 5.64 (d, J=8.0 Hz, 1H), 6.58 (d, J=8.85 Hz, 3H), 6.65 (d, J=8.85 Hz, 2H), 6.75 (d, J=9.16 Hz, 2H), 7.09 (d, J=7.63 Hz, 1H), 7.14-7.17 (m, 3H), 7.23-7.31 (m, 4H), 7.65 (d, J=8.85 Hz, 2H), 8.22 (t, J=5.5 Hz, 1H).


Example 5o
2,2′-Oxybis(N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide) (Compound 5o)
(Step 1)

A crude product (0.15 g) of methyl 2-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxyethoxy)acetate was obtained from 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (270 mg, 0.63 mmol) obtained in reference example 7 in the same manner as in step 3 of example 1b. From the crude product obtained, a crude product (0.13 g) of 2-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxyethoxy)acetic acid was obtained in the same manner as in step 2 of example 2f.


ESI-MS m/z: 426 (M+H)+


(Step 2)

Compound 5o (6 mg, total yield of 2 steps 13%) was obtained from the crude product (0.13 g) of 2-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxyethoxy)acetic acid obtained in step 1 and 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (270 mg, 0.63 mmol) obtained in reference example 7 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 717 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.01-1.04 (m, 12H), 1.14-1.17 (m, 2H), 2.21-2.25 (m, 2H), 2.56-2.61 (m, 4H), 4.20-4.31 (m, 6H), 4.72-4.74 (m, 2H), 5.96 (d, J=8.0 Hz, 2H), 6.62 (d, J=9.0 Hz, 4H), 7.15-7.18 (m, 4H), 7.24-7.30 (m, 4H), 7.34 (d, J=8.85 Hz, 4H), 9.76 (s, 2H).


Example 5p
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenoxy)propyl)benzamide (Compound 5p)
(Step 1)

1-((2S,4R)-4-((4-Hydroxyphenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (190 mg, 68%) obtained in step 2 of example 5n was dissolved in acetonitrile (5 mL), then potassium carbonate (0.334 g, 2.41 mmol) and tert-butyl (3-bromopropyl)carbamate (0.288 g, 1.21 mmol) were added to the solution, and the mixture was stirred at 80° C. for 16 hours. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1° A) formic acid=60/40) to give tert-butyl (3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenoxy)propyl)carbamate (0.05 g, 13%).


ESI-MS m/z: 468 (M+H)+


(Step 2)

1-((2S,4R)-4-((4-(3-Aminopropoxy)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.04 g, 93%) was obtained from tert-butyl (3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenoxy)propyl)carbamate (0.05 g, 0.11 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 368 (M+H)+


(Step 3)

Compound 5p (0.024 g, 35%) was obtained from 1-((2S,4R)-4-((4-(3-aminopropoxy)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.04 g, 0.1 mmol) obtained in step 2 and 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (30 mg, 0.09 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 688 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.97-1.08 (m, 12H), 1.10-1.25 (m, 2H), 1.89 (quin, J=6.47 Hz, 2H), 2.20-2.28 (m, 2H), 2.54-2.63 (m, 4H), 3.34-3.37 (m, 2H), 3.88 (t, J=6.25 Hz, 2H), 4.02-4.06 (m, 1H), 4.26-4.28 (m, 1H), 4.71-4.79 (m, 2H), 5.60 (d, J=7.67 Hz, 1H), 6.53 (d, J=7.67 Hz, 1H), 6.58 (d, J=8.99 Hz, 2H), 6.64 (d, J=8.77 Hz, 2H), 6.73 (d, J=8.99 Hz, 2H), 7.09 (d, J=7.2 Hz, 1H), 7.14-7.19 (m, 3H), 7.24-7.31 (m, 4H), 7.63 (d, J=8.77 Hz, 2H), 8.07 (d, J=5.4 Hz, 1H).


Example 5q
1-((2S,4R)-2-Methyl-4-((4-((7-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 5q)
(Step 1)

tert-Butyl 3-((4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)(hydroxy)methyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.20 g, 0.31 mmol) obtained in step 1 of example 6a was dissolved in trifluoroacetic acid (2.0 mL), then triethylsilane (0.1 mL, 0.62 mmol) was added to the solution, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was concentrated under reduced pressure to give 1-((2S,4R)-2-methyl-4-((4-((5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate (0.2 g, 98%).


ESI-MS m/z: 430 (M+H)+


(Step 2)

Compound 5q (0.1 g, 45%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.1 g, 0.29 mmol) obtained in reference example 1 and 1-((2S,4R)-2-methyl-4-((4-((5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate (0.19 g, 0.29 mmol) obtained in step 1 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 750 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.97-1.06 (m, 12H), 1.11-1.26 (m, 2H), 2.19-2.26 (m, 2H), 2.54-2.64 (m, 4H), 3.73-3.87 (m, 6H), 4.07-4.13 (m, 1H), 4.22-4.27 (m, 1H), 4.65-4.73 (m, 4H), 5.92 (d, J=7.67 Hz, 1H), 6.55-6.60 (m, 4H), 6.68 (d, J=8.55 Hz, 2H), 6.91-6.93 (m, 2H), 7.13-7.21 (m, 4H), 7.22-7.32 (m, 6H).


Example 5r
N,4-Bis(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)butanamide (Compound 5r)
(Step 1)

1-{(2S,4R)-4-[(4-Bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (55.3 mg, 0.148 mmol) obtained in reference example 2 was dissolved in THF (1.0 mL), then SPhos (24.33 mg, 0.059 mmol), palladium acetate (6.65 mg, 0.030 mmol) and 4-ethoxy-4-oxobutylzinc bromide (0.5 mol/L THF solution, 0.44 mL, 0.22 mmol) were added to the solution, and the mixture was stirred at room temperature for 2 hours. A saturated aqueous ammonium chloride solution and ethyl acetate were added to the reaction mixture, the mixture was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=90/10 to 70/30) to give ethyl 4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)butanoate (57.5 mg, 95%).


ESIMS, (M+H)+, m/z: 409.


(Step 2)

Ethyl 4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)butanoate (53.8 mg, 0.132 mmol) obtained in step 1 was dissolved in ethanol (0.88 mL), then aqueous sodium hydroxide solution (4 mol/L, 0.17 mL, 0.66 mmol) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, then water was added to the obtained residue, and the mixture was washed with ethyl acetate. Hydrochloric acid (1 mol/L) was added to the aqueous layer, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure to give 4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)butyric acid (42.0 mg, 84%).


ESIMS, (M−H)−, m/z: 379.


(Step 3)

Compound 5r (30.1 mg, 81%) was obtained from 4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)butyric acid (21.0 mg, 0.055 mmol) obtained in step 2, and 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (13.76 g, 68.81 mmol) obtained in reference example 7 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 672. 1H-NMR (DMSO-d6, δ): 0.98-1.04 (m, 12H), 1.10-1.21 (m, 2H), 1.75-1.83 (m, 2H), 2.19-2.28 (m, 4H), 2.45 (t, J=7.2 Hz, 2H), 2.53-2.62 (m, 4H), 4.06-4.15 (m, 2H), 4.68-4.77 (m, 2H), 5.84 (d, J=6.8 Hz, 2H), 6.57 (d, J=8.2 Hz, 4H), 6.93 (d, J=8.2 Hz, 2H), 7.14-7.18 (m, 4H), 7.23-7.30 (m, 6H), 9.47 (s, 1H).


Example 6a
1-((2S,4R)-4-((4-(3-(Hydroxy(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)methyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-7-carbonyl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propa n-1-one (Compound 6a)
(Step 1)

Commercially available tert-butyl 3-bromo-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.4 g, 1.32 mmol) was dissolved in THF (4 mL), then isopropylmagnesium chloride-lithium chloride (1.3 mol/L THF solution, 1.52 mL, 1.99 mmol) was added to the solution under ice-cooling, and the mixture was stirred for 30 minutes at room temperature. The THF solution (1 mL) of tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.558 g, 1.32 mmol) obtained in reference example 8 was added dropwise to the reaction mixture under ice cooling, and the mixture was further stirred at room temperature for 2 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% formic acid=40/60) to give tert-butyl 3-((4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)(hydroxy)methyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.4 g, 46%). ESI-MS m/z: 646 (M+H)+


(Step 2) 1-((2S,4R)-4-((4-(Hydroxy(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.110 g, 98%) was obtained from tert-butyl 3-((4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)(hydroxy)methyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (150 mg, 0.23 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 446 (M+H)+


(Step 3)

Compound 6a (0.045 g, 28%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.070 g, 0.21 mmol) obtained in reference example 1 and 1-((2S,4R)-4-((4-(hydroxy(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.107 g, 0.21 mmol) obtained in step 2 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 766 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.06 (m, 12H), 1.13-1.26 (m, 2H), 2.19-2.28 (m, 2H), 2.55-2.67 (m, 4H), 3.86-3.94 (m, 4H), 4.15-4.28 (m, 2H), 4.61-4.75 (m, 4H), 5.59 (brs, 2H), 6.02 (d, J=6.58 Hz, 1H), 6.36 (d, J=3.29 Hz, 1H), 6.59-6.63 (m, 3H), 6.69 (d, J=8.77 Hz, 2H), 7.09-7.23 (m, 6H), 7.26-7.32 (m, 6H).


Example 6b
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3-(N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfamoyl)propanamide (Compound 6b)
(Step 1)

Methyl 3-(N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfamoyl)propanoate (0.12 g, 81%) was obtained from 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (100 mg, 0.32 mmol) obtained in reference example 7 and methyl 3-(chlorosulfonyl)propanoate (0.046 mg, 0.35 mmol) in the same manner as in step 1 of example 6g.


ESI-MS m/z: 460 (M+H)+


(Step 2)

1-((2S,4R)-4-((4-Aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.067 g, 0.21 mmol) obtained in reference example 7 was dissolved in toluene (2 mL), then trimethylaluminum (2 mol/L toluene solution, 0.326 mL, 0.65 mmol) was added to the solution under ice cooling, and the mixture was stirred for 30 minutes at room temperature. Methyl 3-(N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfamoyl)propanoate (100 mg, 0.21 mmol) obtained in step 1 was added to the reaction mixture, and the mixture was stirred at 80° C. for 16 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=65/35 to 10/90) to give compound 6b (0.048 g, 30%).


ESI-MS m/z: 737 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.97-1.04 (m, 12H), 1.10-1.20 (m, 2H), 2.20-2.26 (m, 2H), 2.54-2.61 (m, 4H), 2.66-2.70 (m, 2H), 3.22 (t, J=7.8 Hz, 2H), 4.09-4.14 (m, 2H), 4.70-4.75 (m, 2H), 5.87 (d, J=8.0 Hz, 1H), 6.05 (d, J=7.6 Hz, 1H), 6.60 (dd, J=16.4, 8.8 Hz, 4H), 6.99 (d, J=8.8 Hz, 2H), 7.15-7.17 (m, 4H), 7.23-7.29 (m, 6H), 9.15 (s, 1H), 9.70 (s, 1H).


Example 6c
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)ethyl)benzamide (Compound 6c)
(Step 1)

N-(But-3-yn-1-yl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide (38 mg, 66%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (50 mg, 0.148 mmol) obtained in step 7 of reference example 1 and 3-butyn-1-amine (0.018 μL, 0.222 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 390.


(Step 2)

A crude product of compound 6c was obtained from the crude product (30 mg) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a and N-(but-3-yn-1-yl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide (20 mg, 0.051 mmol) obtained in step 1 of example 6c in the same manner as in step 3 of example 3a. The crude product obtained was purified by reverse phase HPLC (0.05% TFA aqueous solution/acetonitrile=55/45 to 50/50) to give compound 6c (11 mg, total yield of 2 steps 29%).


ESIMS, (M+H)+, m/z: 725. 1H-NMR (CDCl3) δ: 1.13-1.20 (m, 12H), 1.24-1.35 (m, 2H), 2.33-2.44 (m, 2H), 2.54-2.74 (m, 4H), 3.07 (t, J=6.1 Hz, 2H), 3.84 (q, J=6.0 Hz, 2H), 4.10-4.27 (m, 4H), 4.96 (s, 2H), 6.61 (d, J=8.6 Hz, 2H), 6.70 (d, J=9.1 Hz, 2H), 7.02 (t, J=5.0 Hz, 1H), 7.15-7.22 (m, 5H), 7.25-7.33 (m, 2H), 7.48 (d, J=8.6 Hz, 2H), 7.69 (d, J=7.2 Hz, 3H).


Example 6d
1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 6d)
(Step 1)

tert-Butyl 3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)azetidine-1-carboxylate (55 mg, 49%) was obtained from 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (70 mg, 0.23 mmol) obtained in step 3 of reference example 7 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 493 (M+H)+


(Step 2)

tert-Butyl 3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)azetidine-1-carboxylate (0.08 g, 0.162 mmol) obtained in step 1 was dissolved in ethyl acetate (0.8 mL), then 4 mol/L hydrochloric acid (0.61 mL, 2.4 mmol) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure to give N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide hydrochloride (43 mg, 67%).


ESI-MS m/z: 393 (M+H)+


(Step 3)

tert-Butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (51 mg, 0.12 mmol) obtained in reference example 8 was dissolved in dichloromethane (1.5 mL), then N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide hydrochloride (43 mg, 0.11 mmol) obtained in step 2, and sodium triacetoxyborohydride (38 mg, 0.18 mmol) were added to the solution, and the mixture was stirred at room temperature for 3 hours. Sodium triacetoxyborohydride (38 mg, 0.18 mmol) was added again to the mixture, and the mixture was stirred at room temperature for 3 hours. A 1 mol/L aqueous sodium hydroxide solution was added to the reaction mixture, and the mixture was extracted twice with dichloromethane. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=100/0 to 19/1) to give tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)azetidin-1-yl)methyl)phenyl)carbamate (29 mg, 30%).


ESI-MS m/z: 799 (M+H)+


(Step 4)

tert-Butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)azetidin-1-yl)methyl)phenyl)carbamate (29 mg, 0.0036 mmol) obtained in step 3 was dissolved in ethyl acetate (1 mL), then 4 mol/L hydrochloric acid (0.18 mL, 0.73 mmol) was added to the solution, and the mixture was stirred at room temperature for 1 hour. A saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted 3 times with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (0.05 mmol/L ammonium bicarbonate/acetonitrile=50/50 to 40/60) to give compound 6d (9 mg, 36%).


ESI-MS m/z: 697 (M+H)+: 1H-NMR (CDCl3, δ): 1.07-1.19 (m, 12H), 1.19-1.41 (m, 2H), 2.25-2.42 (m, 2H), 2.50-2.72 (m, 4H), 3.03-3.16 (m, 1H), 3.35-3.49 (m, 4H), 3.53 (s, 2H), 3.74-3.87 (m, 2H), 4.07-4.21 (m, 2H), 4.79-5.03 (m, 2H), 6.55-6.62 (m, 4H), 7.06-7.11 (m, 2H), 7.10-7.21 (m, 4H), 7.23-7.32 (m, 4H), 7.32-7.38 (m, 2H), 8.42 (s, 1H).


Example 6e
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfonamide)propanamide (Compound 6e)
(Step 1)

Ethyl 3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfonamide)propanoate (9.3 mg, 7.6%) was obtained from 1-[(2S,4R)-4-({4-[(4-methoxybenzyl)thio]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one (116 mg, 0.260 mmol) obtained in step 1 of example 4d, ethyl 3-aminopropanoate hydrochloride (120 mg, 0.779 mmol) and triethylamine (0.109 ml, 0.779 mmol) in the same manner as in step 2 of example 4d.


ESIMS, (M−H)−, m/z: 472.


(Step 2)

Compound 6e (8.8 mg, 57%) was obtained from 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (13.76 g, 68.81 mmol) obtained in reference example 7 and ethyl 3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfonamide)propanoate (10.0 mg, 0.055 mmol) obtained in step 1 in the same manner as in step 2 of example 6b.


ESIMS, (M+H)+, m/z: 737. 1H-NMR (DMSO-d6, δ): 1.12-1.17 (m, 12H), 1.30-1.34 (m, 2H), 2.31-2.42 (m, 2H), 2.53-2.69 (m, 6H), 3.24 (q, J=6.0 Hz, 2H), 4.09-4.17 (m, 1H), 4.19-4.25 (m, 1H), 4.47 (d, J=6.8 Hz, 1H), 4.88-5.00 (m, 2H), 5.33-5.39 (m, 1H), 6.57 (d, J=9.1 Hz, 2H), 6.62 (d, J=9.1 Hz, 2H), 7.12-7.21 (m, 5H), 7.24-7.26 (m, 2H), 7.28-7.32 (m, 2H), 7.48 (s, 1H), 7.65 (d, J=9.1 Hz, 2H).


Example 6f
1,1′-((2S,2'S,4R,4R)-(((5,6,7,8-Tetrahydroimidazo[1,2-a]pyrazine-3,7-dicarbonyl)bis(4,1-phenylene))bis(azanediyl))bis(2-methyl-3,4-dihydroquinoline-4,1(2H)-diyl))bis(propan-1-one) (Compound 6f)
(Step 1)

tert-Butyl 3-((4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)(hydroxy)methyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.20 g, 0.31 mmol) obtained in step 1 of example 6a was dissolved in dichloromethane (5 mL), then Dess-Martin periodinane (0.197 g, 0.46 mmol) was added to the solution under ice cooling, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered through Celite, then saturated aqueous sodium hydrogen carbonate solution was added to the obtained filtrate, and the mixture was extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (0.1% formic acid aqueous solution/acetonitrile=45/55) to give tert-butyl 3-(4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (9 mg, 36%).


ESI-MS m/z: 644 (M+H)+


(Step 2)

1-((2S,4R)-2-methyl-4-((4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-3-carbonyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.09 g, 94%) was obtained from tert-butyl 3-(4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (120 mg, 0.19 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 444 (M+H)+


(Step 3)

Compound 6f (0.035 g, 26%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.070 g, 0.21 mmol) obtained in reference example 1 and 1-((2S,4R)-2-methyl-4-((4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-3-carbonyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.091 g, 0.18 mmol) obtained in step 2 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 764 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.05-1.07 (m, 12H), 1.21-1.26 (m, 2H), 2.22-2.26 (m, 2H), 2.58-2.64 (m, 4H), 3.93 (s, 2H), 4.21-4.30 (m, 1H), 4.36-4.37 (m, 3H), 4.75-4.81 (m, 4H), 6.64 (d, J=7.63 Hz, 1H), 6.70 (d, J=8.54 Hz, 2H), 6.75 (d, J=8.54 Hz, 2H), 7.02 (d, J=7.63 Hz, 1H), 7.10-7.15 (m, 2H), 7.19 (t, J=7.32 Hz, 2H), 7.26-7.35 (m, 6H), 7.50 (s, 1H), 7.71 (d, J=8.5 Hz, 2H).


Example 6g
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)sulfamoyl)ethyl)benzamide (Compound 6g)
(Step 1)

1-((2S,4R)-4-((4-Aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (100 mg, 0.32 mmol) obtained in reference example 7 was dissolved in pyridine (2 mL), then benzyl (2-(chlorosulfonyl)ethyl)carbamate (0.108 g, 0.38 mmol) was added to the solution under ice cooling, and the mixture was stirred at room temperature for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. n-Pentane was added to the obtained residue and the resulting solid was filtered to give benzyl (2-(N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino) phenyl)sulfamoyl)ethyl)carbamate (0.14 g, 79%).


(Step 2)

Benzyl (2-(N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino) phenyl)sulfamoyl)ethyl)carbamate (0.16 g, 0.29 mmol) obtained in step 1 was dissolved in methanol (2 mL), then 20% palladium hydroxide/carbon (0.04 g) was added to the solution, and the mixture was stirred at room temperature for 1 hour under a hydrogen atmosphere. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure to give 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ethane-1-sulfonamide (0.11 g, 92%).


(Step 3)

Compound 6g (0.066 g, 37%) was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.070 g, 0.21 mmol) obtained in reference example 1 and 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ethane-1-sulfonamide (0.11 g, 92%) obtained in step 2 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 737 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.97-1.05 (m, 12H), 1.14-1.21 (m, 2H), 2.22-2.25 (m, 2H), 2.55-2.62 (m, 4H), 3.13-3.16 (m, 2H), 3.56-3.59 (m, 2H), 4.05-4.15 (m, 1H), 4.23-4.30 (m, 1H), 4.71-4.74 (m, 2H), 6.07 (d, J=7.5 Hz, 1H), 6.60-6.65 (m, 5H), 7.00 (d, J=9.0 Hz, 2H), 7.08 (d, J=7.5 Hz, 1H), 7.14-7.19 (m, 3H), 7.24-7.32 (m, 4H), 7.60 (d, J=9.0 Hz, 2H), 8.19 (t, J=5.75 Hz, 1H), 9.14 (brs, 1H).


Example 6h
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-((4-((2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)benzamide (Compound 6h)
(Step 1)

tert-Butyl (4-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)carbamate (110 mg, 46%) was obtained from 1-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (150 mg, 0.48 mmol) obtained in step 2 of reference example 7, and 4-(tert-butoxycarbonylamino)but-2-ynoic acid (145 mg, 0.72 mmol) in the same manner as in step 1 of example 1a.


ESI-MS, (M+H)+, m/z: 491.


(Step 2)

4-Amino-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)but-2-ynamide trifluoroacetate (80 mg, 90%) was obtained from tert-butyl (4-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)carbamate (90 mg, 0.18 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESI-MS, (M+H)+, m/z: 391.


(Step 3)

4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)benzamide (0.034 g, 30%) was obtained from 4-amino-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)but-2-ynamide trifluoroacetate (80 mg, 0.16 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.53 mg, 0.16 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESI-MS, (M+H)+, m/z: 711.38.


(Step 4)

4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)benzamide (14 mg, 0.020 mmol) obtained in step 3 was purified with SFC (CHIRALPAK IB, CO2/methanol=75/25 to 70/30, 30 mL/min, rt=12.72 min) to give 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)benzamide (4.3 mg, 31%).


ESI-MS, (M+H)+, m/z: 711. 1H-NMR (CDCl3) δ: 1.11-1.19 (m, 12H), 1.21-1.35 (m, 2H), 2.30-2.44 (m, 2H), 2.51-2.73 (m, 4H), 3.85 (d, J=7.2 Hz, 1H), 4.11-4.18 (m, 1H), 4.22-4.29 (m, 2H), 4.38 (d, J=5.4 Hz, 2H), 4.95 (s, 2H), 6.30 (t, J=5.4 Hz, 1H), 6.58 (d, J=8.6 Hz, 2H), 6.63 (d, J=8.6 Hz, 2H), 7.13-7.23 (m, 5H), 7.27-7.35 (m, 5H), 7.54 (s, 1H), 7.67 (d, J=9.1 Hz, 2H).


Example 6i
N-(4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-2-(1-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)acetamide (Compound 6i)
(Step 1)

Commercially available 3-butynoic acid (0.272 g, 3.23 mmol) was dissolved in dichloromethane (5 mL), then oxalyl chloride (1.04 mL, 12.13 mmol) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, then a dichloromethane solution (2 mL) of 1-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.5 g, 1.61 mmol) obtained in step 2 of reference example 7 and N,N-diisopropylethylamine (0.847 mL, 4.85 mmol) was added to the resulting residue, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=1/1) to give N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)but-3-ynamide (0.12 g, 21%).


ESIMS, (M+H)+, m/z: 376.


(Step 2)

1-{(2S*,4R*)-4-[(4-Azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.07 g, 32%) was obtained from 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.25 g, 0.80 mmol) obtained in step 2 of reference example 7 in the same manner as in step 2 of example 3a.


ESIMS, (M+H)+, m/z: 336.


(Step 3)

Compound 6i (0.014 g, 7%) was obtained from 1-{(2S*,4R*)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.09, 0.26 mmol) obtained in step 2 and N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)but-3-ynamide (0.110 g, 0.29 mmol) obtained in step 1 in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 711: 1H-NMR (DMSO-d6, δ) 0.98-1.07 (m, 12H), 1.11-1.20 (m, 2H), 2.20-2.33 (m, 2H), 2.55-2.63 (m, 4H), 3.74 (s, 2H), 4.09-4.14 (m, 1H), 4.14-4.28 (m, 1H), 4.73-4.76 (m, 2H), 5.88 (d, J=8.0 Hz, 1H), 6.47 (d, J=7.67 Hz, 1H), 6.60 (d, J=8.8 Hz, 2H), 6.79 (d, J=9.2 Hz, 2H), 7.15-7.21 (m, 4H), 7.23-7.32 (m, 6H), 7.56 (d, J=8.8 Hz, 2H), 8.37 (s, 1H), 9.83 (brs, 1H).


Example 6j
N-(4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-2-(3-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)acetamide (Compound 6j)
(Step 1)

Commercially available ethyl glycinate hydrochloride (0.112 g, 0.80 mmol) and triphosgene (0.096 g, 0.32 mmol) were dissolved in dichloromethane (10 mL), then a dichloromethane solution (1 mL) of triethylamine (0.5 mL, 3.23 mmol) was added to the solution at −10° C., and the mixture was stirred at 0° C. for 1 hour. A dichloromethane solution (15 mL) of 1-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.25 g, 0.80 mmol) obtained in step 2 of reference example 7 was added dropwise to the reaction mixture at 0° C., and the mixture was stirred at room temperature for 6 hours. The reaction mixture was diluted with water, the resulting solid was removed by filtration, and the filtrate was extracted with dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=4/1) to give a crude product (0.26 g) of ethyl ((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)glycinate.


ESIMS, (M+H)+, m/z: 439


(Step 2)

Compound 6j (0.045 g, total yield of 2 steps 14%) was obtained from the crude product (0.14 g) of ethyl ((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)glycinate obtained in step 1 and 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.1 g, 0.32 mmol) obtained in step 2 of reference example 7 in the same manner as in step 2 of example 6n.


ESIMS, (M+H)+, m/z: 702: 1H-NMR (DMSO-d6, δ) 0.98-1.04 (m, 12H), 1.09-1.19 (m, 2H), 2.19-2.28 (m, 2H), 2.55-2.60 (m, 4H), 3.83 (d, J=5.6 Hz, 2H), 4.05-4.12 (m, 2H), 4.65-4.80 (m, 2H), 5.69 (d, J=8.0 Hz, 1H), 5.87 (d, J=8.0 Hz, 1H), 6.19 (t, J=5.4 Hz, 1H), 6.58 (dd, J=15.6, 8.8 Hz, 4H), 7.10 (d, J=8.4 Hz, 2H), 7.17 (dd, J=7.6, 3.6 Hz, 4H), 7.23-7.30 (m, 6H), 8.31 (s, 1H), 9.61 (s, 1H).


Example 6k
N1,N5-Bis(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 6k)
(Step 1)

Methyl 5-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoate (0.450 g, 91%) was obtained from 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.350 g, 1.13 mmol) obtained in step 3 of reference example 7 and 5-methoxy-5-oxopentanoic acid (0.181 g, 1.24 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 438.


(Step 2)

5-[(4-{[(2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoic acid (0.350 g, 80%) was obtained from methyl 5-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoate (0.450 g, 1.03 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M−H)−, m/z: 422.


(Step 3)

Compound 6k (0.290 g, 49%) was obtained from 5-[(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoic acid (0.350 g, 0.82 mmol) obtained in step 2 and 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.255 g, 0.82 mmol) obtained in step 3 of reference example 7 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 715: 1H-NMR (DMSO-d6, δ): 0.98-1.04 (m, 12H), 1.10-1.19 (m, 2H), 1.85 (t, J=7.2 Hz, 2H), 2.20-2.29 (m, 6H), 2.53-2.61 (m, 4H), 4.08-4.14 (m, 2H), 4.72-4.73 (m, 2H), 5.83 (d, J=7.89 Hz, 2H), 6.58 (d, J=8.99 Hz, 4H), 7.15-7.16 (m, 4H), 7.23-7.31 (m, 8H), 9.50 (s, 2H).


Example 61
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(3-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)ethyl)benzamide (Compound 61)
(Step 1)

1-{(2S*,4R*)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.2 g, 0.64 mmol) obtained in step 2 of reference example 7 and commercially available tert-butyl (2-aminoethyl)carbamate (0.135 g, 0.84 mmol) were dissolved in THF (6 mL), then DMAP (0.418 g, 3.43 mmol), N,N-diisopropylethylamine (0.34 mL, 1.94 mmol) and triphosgene were added to the solution at 0° C., and the mixture was stirred at room temperature for 30 minutes and then at 70° C. for 4 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (0.3 g) of tert-butyl (2-(3-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)ethyl)carbamate.


ESIMS, (M+H)+, m/z: 496


(Step 2)

A crude product (0.2 g) of 1-(2-aminoethyl)-3-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)urea hydrochloride was obtained from the crude product (0.3 g) of tert-butyl (2-(3-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)ethyl)carbamate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 396


(Step 3)

Compound 61 (0.04 g, total yield of 3 steps 1.9%) was obtained from the crude product (0.159 g) of 1-(2-aminoethyl)-3-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)urea hydrochloride obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.125 g, 0.36 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 716; 1H-NMR (DMSO-d6, δ) 0.98-1.06 (m, 12H), 1.08-1.20 (m, 2H), 2.20-2.28 (m, 2H), 2.54-2.64 (m, 4H), 3.18-3.23 (m, 4H), 4.04-4.10 (m, 1H), 4.24-4.30 (m, 1H), 4.67-4.77 (m, 2H), 5.67 (d, J=7.6 Hz, 1H), 6.03 (t, J=5.6 Hz, 1H), 6.55 (d, J=8.8 Hz, 3H), 6.65 (d, J=8.8 Hz, 2H), 7.07-7.10 (m, 3H), 7.14-7.19 (m, 3H), 7.23-7.31 (m, 4H), 7.64 (d, J=8.8 Hz, 2H), 8.04 (s, 1H), 8.12 (t, J=5.0 Hz, 1H).


Example 6m
4-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperazine-1-carboxamide (Compound 6m)
(Step 1)

1-{(2S*,4R*)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.3 g, 0.97 mmol) obtained in step 2 of reference example 7 was dissolved in THF (10 mL), then triethylamine (0.4 mL, 2.91 mmol) and commercially available tert-butyl 4-(chlorocarbonyl)piperazine-1-carboxylate (0.24 g, 0.97 mmol) were added to the solution at 0° C., and the mixture was stirred at room temperature for 16 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (0.15 g) of tert-butyl 4-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)piperazine-1-carboxylate.


ESIMS, (M+H)+, m/z: 522.


(Step 2)

A crude product (0.2 g) of N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperazine-1-carboxamide hydrochloride was obtained from the crude product (0.3 g) of tert-butyl 4-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)piperazine-1-carboxylate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 422.


(Step 3)

Compound 6m (0.06 g, total yield of 3 steps 44.1%) was obtained from the crude product (0.2 g) of N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperazine-1-carboxamide hydrochloride obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.2 g, 0.43 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 742: 1H-NMR (DMSO-d6, δ) 0.98-1.06 (m, 12H), 1.09-1.20 (m, 2H), 2.19-2.28 (m, 2H), 2.53-2.64 (m, 4H), 3.43-3.52 (m, 8H), 4.07-4.13 (m, 1H), 4.20-4.26 (m, 1H), 4.72-4.75 (m, 2H), 5.74 (d, J=8.0 Hz, 1H), 6.54 (dd, J=18.0, 7.2 Hz, 3H), 6.67 (d, J=8.8 Hz, 2H), 7.10-7.32 (m, 12H), 8.19 (s, 1H).


Example 6n
N-(4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)acetamide (Compound 6n)
(Step 1)

Ethyl 1-{(2S,4R)-4-[(4-bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.212 g, 0.57 mmol) obtained in reference example 2 was dissolved in THF (20 mL), then commercially available ethyl 2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazol-1-yl)acetate (0.2 g, 0.71 mmol), potassium carbonate (0.363 g, 1.71 mmol), and Pd(dppf)Cl2 (0.038 g, 0.05 mmol) were added to the solution, and the mixture was stirred at 80° C. for 16 hour. The reaction mixture was diluted with water, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by column chromatography (methanol/dichloromethane=0/100 to 6/94) to give ethyl 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)acetate (0.130 g, 37%).


ESIMS, (M+H)+, m/z: 447.


(Step 2)

Compound 6n (0.050 g, 24%) was obtained from ethyl 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)acetate (0.076 g, 0.25 mmol) obtained in step 1 and 1-{(2S*,4R*)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.110 g, 0.25 mmol) obtained in step 2 of reference example 7 in the same manner as in step 2 of example 6b.


ESIMS, (M+H)+, m/z: 710: 1H-NMR (DMSO-d6, δ) 0.98-1.05 (m, 12H), 1.11-1.24 (m, 2H), 2.20-2.28 (m, 2H), 2.54-2.67 (m, 4H), 4.09-4.20 (m, 2H), 4.70-4.75 (m, 2H), 4.90 (m, 2H), 5.92 (d, J=7.67 Hz, 1H), 6.03 (d, J=7.67 Hz, 1H), 6.63 (dd, J=18.85, 8.77 Hz, 4H), 7.15-7.18 (m, 4H), 7.23-7.32 (m, 8H), 7.71 (s, 1H), 7.94 (s, 1H), 9.92 (s, 1H).


Example 60
1-((2S,4R)-2-Methyl-4-((4-(1-(1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)piperid in-4-yl)-1H-pyrazol-4-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 60)
(Step 1)

Ethyl 1-{(2S,4R)-4-[(4-bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.150 g, 0.40 mmol) obtained in reference example 2 was dissolved in 1,4-dioxane (4 mL), then commercially available (1-(1-(tert-butoxycarbonyl)piperidin-4-yl)-1H-pyrazol-4-yl)boronic acid (0.142 g, 0.48 mmol) and cesium carbonate (0.392 g, 1.21 mmol), Pd(PPh3)4 (0.046 g, 0.04 mmol) and water (1 mL) were added to the solution, and the mixture was stirred at 120° C. for 1 hour. The reaction mixture was diluted with water, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by column chromatography (ethyl acetate/petroleum ether=3/7) to give tert-butyl 4-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)piperidine-1-carboxylate (0.065 g, 30%).


ESIMS, (M+H)+, m/z: 544.


(Step 2)

1-((2S,4R)-2-Methyl-4-((4-(1-(piperidin-4-yl)-1H-pyrazol-4-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.050 g, 87%) was obtained from tert-butyl 4-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)piperidine-1-carboxylate (0.065 g, 0.120 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 444.


(Step 3)

1-((2S,4R)-2-Methyl-4-((4-(1-(1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)piperid in-4-yl)-1H-pyrazol-4-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.035 g, 27%) was obtained from 1-((2S,4R)-2-methyl-4-((4-(1-(piperidin-4-yl)-1H-pyrazol-4-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.080 g, 0.17 mmol) obtained in step 2 and 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.057 g, 0.17 mmol) obtained in step 7 of reference example 1 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 764: 1H-NMR (DMSO-d6, δ) 0.99-1.06 (m, 12H), 1.17-1.25 (m, 2H), 1.86-1.90 (m, 2H), 2.04-2.07 (m, 2H), 2.21-2.33 (m, 2H), 2.55-2.67 (m, 4H), 3.06-3.10 (m, 2H), 4.14-4.23 (m, 4H), 4.40-4.42 (m, 1H), 4.71-4.75 (m, 2H), 6.00 (d, J=7.89 Hz, 1H), 6.49 (d, J=7.67 Hz, 1H), 6.66 (dd, J=11.62, 8.77 Hz, 4H), 7.14-7.21 (m, 4H), 7.23-7.31 (m, 8H), 7.68 (s, 1H), 8.03 (s, 1H).


Example 6p
1,1′-((2S,2'S,4R,4′R)-(((1,4-Diazepane-1,4-dicarbonyl)bis(4,1-phenylene))bis(azanediyl))bis(2-methyl-3,4-dihydroquinoline-4,1(2H)-diyl))bis(propan-1-one) (Compound 6p)

Compound 6p (0.035 g, 11%) was obtained from 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.1 g, 0.29 mmol) obtained in step 7 of reference example 1 and 1,4-diazepine (0.015 g, 0.15 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 741: 1H-NMR (DMSO-d6, δ) 0.98-1.05 (m, 12H), 1.16-1.24 (m, 2H), 1.73-1.75 (m, 2H), 2.18-2.27 (m, 2H), 2.54-2.62 (m, 4H), 3.53-3.62 (m, 8H), 4.18-4.23 (m, 2H), 4.73-4.76 (m, 2H), 6.43 (d, J=7.6 Hz, 2H), 6.63 (d, J=8.4 Hz, 4H), 7.13-7.19 (m, 8H), 7.24-7.31 (m, 4H).


Example 6q
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)benzamide (Compound 6q)
(Step 1)

A crude product of tert-butyl (2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)carbamate was obtained from 1-((2S,4R)-4-((4-bromophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (600 mg, 1.6 mmol) and tert-butyl (2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazol-1-yl)ethyl)carbamate (650 mg, 1.93 mmol) obtained in reference example 2 in the same manner as in step 1 of example 5k. The crude product obtained was purified by silica gel column chromatography (heptane/ethyl acetate=6/4 to 2/8) to give tert-butyl (2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)carbamate (640 mg, 79%).


ESI-MS, (M+H)+, m/z: 504.


(Step 2)

A crude product of 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one was obtained from tert-butyl (2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)carbamate (640 mg, 1.27 mmol) obtained in step 1 in the same manner as in step 2 of example 1k. The crude product obtained was purified by silica gel column chromatography (chloroform/methanol=10/0 to 8/2) to give 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (440 mg, 86%).


ESI-MS, (M+H)+, m/z: 404.


(Step 3)

A crude product (200 mg) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)carbamoyl)phenyl)carbamate was obtained from 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (100 mg, 0.248 mmol) obtained in step 2 and 4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (109 mg, 0.248 mmol) obtained in step 2 of reference example 8 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 824.


(Step 4)

A crude product of compound 6q was obtained from the crude product (200 mg) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)carbamoyl)phenyl)carbamate obtained in step 3 in the same manner as in step 2 of example 1k. The crude product obtained was purified by reverse phase HPLC (0.05% TFA aqueous solution/acetonitrile=5/5 to 3/7) to give compound 6q (18 mg, total yield of 2 steps 10%).


ESI-MS, (M+H)+, m/z: 724. 1H-NMR (CDCl3) δ: 1.12-1.18 (m, 12H), 1.21-1.34 (m, 2H), 2.32-2.44 (m, 2H), 2.53-2.62 (m, 2H), 2.62-2.72 (m, 2H), 3.90 (q, J=5.3 Hz, 2H), 4.18-4.26 (m, 2H), 4.39 (t, J=5.4 Hz, 2H), 4.94 (d, J=5.9 Hz, 2H), 6.60 (d, J=8.6 Hz, 2H), 6.64 (d, J=8.6 Hz, 2H), 6.83 (t, J=5.4 Hz, 1H), 7.14-7.22 (m, 5H), 7.27-7.33 (m, 5H), 7.56 (s, 1H), 7.62 (d, J=9.1 Hz, 2H), 7.76 (s, 1H).


Example 7a
3-((1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxamide)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-1-carboxamide (Compound 7a)
(Step 1)

tert-Butyl azetidin-3-ylcarbamate (0.218 g, 1.05 mmol) was dissolved in THF (10 mL), then N,N-diisopropylethylamine (0.70 mL, 4.04 mmol) and DMAP (0.049 g, 4.04 mmol) were added to the solution at 0° C., and the mixture was stirred at 0° C. for 5 minutes. Triphosgene (0.12 g, 0.40 mmol) was added to the reaction mixture, and the mixture was stirred at 0° C. for 30 minutes. 1-{(2S,4R)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.25 g, 0.81 mmol) obtained in reference example 7 was added to the mixture, and the mixture was stirred at 65° C. for 3 hours. Water was added to the reaction mixture, and the mixture was extracted 3 times with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=1/1) to give tert-butyl (1-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)azetidin-3-yl)carbamate (0.150 g, 36%).


ESIMS, (M+H)+, m/z: 508.34.


(Step 2)

3-Amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-1-carboxamide trifluoroacetate (0.085 g, 83%) was obtained from tert-butyl (1-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)azetidin-3-yl)carbamate (0.1 g, 0.20 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 408.36


(Step 3)

Compound 7a (0.035 g, 27%) was obtained from 3-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-1-carboxamide trifluoroacetate (0.099 g, 0.19 mmol) obtained in step 2 and (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.06 g, 0.17 mmol) obtained in reference example 11 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 734.40 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.81-0.83 (m, 1H), 0.94-1.06 (m, 13H), 1.08-1.18 (m, 2H), 1.33-1.44 (m, 2H), 1.73-1.78 (m, 3H), 1.91-2.17 (m, 4H), 2.19-2.27 (m, 1H), 2.52-2.61 (m, 5H), 3.41-3.50 (m, 1H), 3.69 (dd, J=8.39, 5.34 Hz, 2H), 4.06-4.12 (m, 3H), 4.34-4.42 (m, 1H), 4.59-4.77 (m, 2H), 5.74 (d, J=7.63 Hz, 1H), 6.55 (d, J=9.16 Hz, 2H), 7.13-7.17 (m, 4H), 7.22-7.29 (m, 5H), 7.48-7.50 (m, 1H), 8.05 (s, 1H), 8.35 (d, J=6.71 Hz, 1H).


Example 7b
1-((2S*,4R*)-2-Methyl-4-(((1R,4r)-4-(2-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-7-carbonyl)cyclohexyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 7b)

Compound 7b (0.037 g, 22%) was obtained from 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.100 g, 0.22 mmol) obtained in step 3 of example 3f and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.076 g, 0.22 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 742: 1H-NMR (DMSO-d6, δ) 0.83 (d, J=9.78 Hz, 1H), 0.92-1.08 (m, 12H), 1.14-1.32 (m, 3H), 1.34-1.52 (m, 2H), 1.66-1.81 (m, 2H), 1.90-2.06 (m, 2H), 2.11-2.30 (m, 2H), 2.55-2.75 (m, 6H), 3.41-3.51 (m, 2H), 3.81-4.08 (m, 4H), 4.09-4.22 (m, 1H), 4.56-4.85 (m, 4H), 6.03 (d, J=7.6 Hz, 1H), 6.63 (d, J=8.58 Hz, 2H), 7.15-7.31 (m, 8H), 7.42-7.54 (m, 3H).


Example 7c
N1-((1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)-N3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-1,3-dicarboxamide (Compound 7c)

1-((2S,4R)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.106 g, 0.28 mmol) obtained in reference example 9 was dissolved in DMF (3 mL), then DMAP (0.084 g, 0.69 mmol), triethylamine (0.15 mL, 1.10 mmol) and CDI (0.044 g, 0.28 mmol) were added to the solution, and the mixture was stirred at 85° C. for 1 hour. A DMF solution (1 mL) of crude product (0.140 g) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide trifluoroacetate obtained in step 1 of example 10e was added to the reaction mixture, and the mixture was stirred at 85° C. for 16 hours. The reaction mixture was diluted with ice water and extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=60/40 to 10/90) to give compound 7c (0.070 g, 35%).


ESI-MS m/z: 734.51 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.81-0.83 (m, 1H), 0.93-1.22 (m, 18H), 1.70-1.77 (m, 3H), 1.87-2.01 (m, 2H), 2.06-2.29 (m, 2H), 2.52-2.62 (m, 4H), 3.34-3.48 (m, 3H), 3.83-3.90 (m, 4H), 4.07-4.17 (m, 1H), 4.58-4.77 (m, 2H), 5.91 (d, J=7.87 Hz, 1H), 6.06 (d, J=7.87 Hz, 1H), 6.59 (d, J=8.82 Hz, 2H), 7.15-7.31 (m, 9H), 7.48-7.50 (m, 1H), 9.63 (s, 1H).


Example 7d
0-((1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)carbamothioate (Compound 7d)
(Step 1)

1-((2S*,4R*)-4-Amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (2.01 g, 9.21 mmol) obtained in step 3 of reference example 1 was dissolved in methanol (20 mL), then 4-hydroxycyclohexan-1-one (1.58 g, 13.8 mmol), sodium cyanoborohydride (1.78 g, 28.3 mmol) and acetic acid (2.64 mL, 46.0 mmol) were added to the solution, and the mixture was stirred at 50° C. for 15 hours. The reaction mixture was neutralized with an aqueous sodium hydroxide solution (4 mol/L), and the aqueous layer was extracted with chloroform. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=75/25 to 70/30) to give 1-((2S*,4R*)-4-(((1r,4R)-4-hydroxycyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (1.30 g, 45%) and 1-((2S*,4R*)-4-(((1s,4S)-4-hydroxycyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (1.39 g, 48%).


1-((2S*,4R*)-4-(((1r,4R)-4-Hydroxycyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one

ESIMS, (M+H)+, m/z: 317; 1H-NMR (CDCl3, δ) 0.85-0.98 (m, 2H), 1.01-1.13 (m, 6H), 1.16-1.43 (m, 4H), 1.88-2.09 (m, 4H), 2.18-2.34 (m, 1H), 2.46-2.74 (m, 3H), 3.53 (dd, J=12.4, 4.4 Hz, 1H), 3.61-3.73 (m, 1H), 4.76-4.91 (m, 1H), 7.04-7.16 (m, 1H), 7.18-7.27 (m, 2H), 7.42-7.48 (m, 1H).


1-((2S*,4R*)-4-(((1s,4S)-4-Hydroxycyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one

ESIMS, (M+H)+, m/z: 317; 1H-NMR (CDCl3, δ) 0.87-1.04 (m, 1H), 1.06-1.14 (m, 6H), 1.58-1.89 (m, 8H), 2.27 (ddd, J=15.4, 8.0, 8.0 Hz, 1H), 2.46-2.65 (m, 2H), 2.76-2.87 (m, 1H), 3.52 (dd, J=12.0, 4.0 Hz, 1H), 3.81-3.98 (m, 1H), 4.78-4.96 (m, 1H), 7.10 (d, J=6.8 Hz, 1H), 7.21-7.33 (m, 2H), 7.48-7.58 (m, 1H).


(Step 2)

tert-Butyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)carbamate (227 mg, 100%) was obtained from 1-{(2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (150 mg, 0.485 mmol) obtained in step 3 of reference example 7 and commercially available (tert-butoxycarbonyl)glycine (102 mg, 0.582 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 467


(Step 3)

2-Amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride (196 mg, 100%) was obtained from tert-butyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)carbamate (227 mg, 0.486 mmol) obtained in step 2 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 367


(Step 4)

1-((2S*,4R*)-4-(((1r,4R)-4-Hydroxycyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (50.8 mg, 0.161 mmol) obtained in step 1 was dissolved in DMF (1 mL), then triethylamine (0.112 mL, 0.803 mmol), DMAP (49.0 mg, 0.401 mmol) and 1,1′-thiocarbonyldiimidazole (28.6 mg, 0.161 mmol) were added to the solution, and the mixture was stirred at room temperature for 1 hour. 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride (70.6 mg, 0.193 mmol) obtained in step 4 was added to the reaction mixture, and the mixture was stirred at 70° C. for 15 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=55/45 to 50/50) to give compound 7d (16.1 mg, 14%).


ESIMS, (M+H)+, m/z: 725; 1H-NMR (CDCl3, δ) 1.03-1.48 (m, 18H), 1.90-2.43 (m, 6H), 2.47-2.69 (m, 4H), 2.70-2.82 (m, 1H), 3.44-3.61 (m, 1H), 3.77-3.89 (m, 1H), 4.09-4.23 (m, 1H), 4.34 (d, J=5.2 Hz, 2H), 4.78-5.04 (m, 2H), 5.19-5.45 (m, 1H), 6.60 (d, J=9.2 Hz, 2H), 6.94-7.35 (m, 9H), 7.42-7.55 (m, 1H), 7.80 (brs, 1H).


Example 7e
(1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)carbamate (Compound 7e)
(Step 1)

Ethyl ((((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)oxy)carbonyl)glycinate (55.8 mg, 69%) was obtained from 1-((2S*,4R*)-4-(((1r,4R)-4-hydroxycyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (50.8 mg, 0.161 mmol) obtained in step 1 of example 7d and ethyl glycinate hydrochloride (33.0 mg, 0.237 mmol) in the same manner as in example 7c.


ESIMS, (M+H)+, m/z: 446.


(Step 2)

Ethyl ((((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)oxy)carbonyl)glycinate (55.0 mg, 0.123 mmol) obtained in step 1 was dissolved in THF (1 mL), then potassium trimethylsilanolate (55.3 mg, 0.431 mmol) was added to the solution, and the mixture was stirred at 50° C. for 5.5 hours, and the reaction mixture was concentrated under reduced pressure. The obtained residue was dissolved in DMF (1 mL), then N,N-diisopropylethylamine (0.107 mL, 0.615 mmol), COMU (79.0 mg, 0.185 mmol) and 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (38.1 mg, 0.123 mmol) obtained in step 3 of reference example 7 were added to the solution, and the mixture was stirred at room temperature for 15 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=0/40 to 50/50) to give compound 7e (18.3 mg, 21%).


ESIMS, (M+H)+, m/z: 709; 1H-NMR (CDCl3, δ) 0.82-0.99 (m, 2H), 1.03-1.56 (m, 14H), 1.91-2.15 (m, 5H), 2.18-2.42 (m, 2H), 2.45-2.80 (m, 5H), 3.51 (dd, J=12.0, 4.0 Hz, 1H), 3.83 (d, J=3.6 Hz, 1H), 3.97 (d, J=6.0 Hz, 2H), 4.08-4.22 (m, 1H), 4.58-4.75 (m, 1H), 4.78-5.03 (m, 2H), 5.40 (brs, 1H), 6.60 (d, J=9.2 Hz, 2H), 7.01-7.36 (m, 9H), 7.43-7.51 (m, 1H), 7.85 (brs, 1H).


Example 7f
2-((4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl ((1R,4R)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamate (Compound 7f)
(Step 1)

Methyl glycolate (0.2 g, 2.22 mmol) and pyridine (0.35 mL, 4.44 mmol) were dissolved in dichloromethane (5 mL), then 4-nitrophenyl chloroformate (0.492 g, 2.44 mmol) was added to the solution at 0° C., and the mixture was stirred at room temperature for 2 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=85/15) to give a crude product of methyl 2-(((4-nitrophenoxy)carbonyl)oxy)acetate (0.405 g).


ESIMS, (M+H)+, m/z: 256.17.


(Step 2)

1-((2S,4R)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.15 g, 0.39 mmol) obtained in reference example 9 and triethylamine (0.27 mL, 1.94 mmol) were dissolved in dichloromethane (2 mL), then the crude product (0.148 g) of methyl 2-(((4-nitrophenoxy)carbonyl)oxy)acetate obtained in step 1 was added to the solution, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by reverse phase column chromatography (acetonitrile/water=40/60 to 60/40) to give 3-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)oxazolidine-2,4-dione (0.090 g, 58%).


ESIMS, (M+H)+, m/z: 400.27.


(Step 3)

A crude product (0.11 g) of 2-((((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamoyl)oxy)acetic acid was obtained from 3-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)oxazolidine-2,4-dione (0.09 g, 0.21 mmol) obtained in step 2 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 418.33.


(Step 4)

Compound 7f (0.038 g, 30%) was obtained from the crude product (0.11 g) of 2-((((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamoyl)oxy)acetic acid obtained in step 3 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.055 g, 0.18 mmol) obtained in reference example 7 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 709.49. 1H-NMR (DMSO-d6, δ): 0.80-0.83 (m, 1H), 0.93-1.04 (m, 12H), 1.11-1.24 (m, 5H), 1.80-1.96 (m, 5H), 2.07-2.29 (m, 2H), 2.51-2.62 (m, 5H), 3.20-3.28 (m, 1H), 3.44 (dd, J=11.32, 2.98 Hz, 1H), 4.07-4.17 (m, 1H), 4.46 (s, 2H), 4.64-4.73 (m, 2H), 5.92 (d, J=7.87 Hz, 1H), 6.60 (d, J=8.82 Hz, 2H), 7.15-7.30 (m, 10H), 7.47-7.49 (m, 1H), 9.58 (s, 1H).


Example 7g
2-(((1R,4R)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)oxazole-4-carboxamide (Compound 7g)
(Step 1)

1-((2S,4R)-4-(((1r,4R)-4-Aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (200 mg, 0.515 mmol) obtained in reference example 9 was dissolved in water (1 mL), then potassium cyanate (45.9 mg, 0.566 mmol) was added to the solution, and the mixture was stirred at 70° C. overnight. The reaction mixture was cooled to room temperature and extracted twice with chloroform. The organic layer was dried over magnesium sulfate and concentrated under reduced pressure to give a crude product (185 mg) of 1-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)urea.


ESI-MS, (M+H)+, m/z: 359.


(Step 2)

A crude product (100 mg) of ethyl 2-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)oxazole-4-carboxylate was obtained from the crude product (185 mg) of 1-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)urea obtained in step 1 in the same manner as in step 2 of example 5a.


ESI-MS, (M+H)+, m/z: 455.


(Step 3)

A crude product (70 mg) of ethyl 2-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)oxazole-4-carboxylate obtained in step 2 was dissolved in THF (1 mL), then potassium trimethylsilanolate (39.5 mg, 0.308 mmol) was added to the solution, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure to give a crude product (60 mg) of 2-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)oxazole-4-carboxylic acid.


ESI-MS, (M+H)+, m/z: 427.


(Step 4)

A crude product of compound 7g was obtained from the crude product (60 mg) of 2-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)oxazole-4-carboxylic acid obtained in step 3 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (52.2 mg, 0.169 mmol) obtained in step 3 of reference example 7 in the same manner as in step 3 of example 1b. The crude product obtained was purified by reverse phase HPLC (0.05% aqueous ammonium bicarbonate solution/acetonitrile=55/45 to 50/50) to give compound 7g (4 mg, total yield of 4 steps 4%).


ESI-MS, (M+H)+, m/z: 718. 1H-NMR (CDCl3)δ: 1.07-1.18 (m, 12H), 1.22-1.43 (m, 4H), 2.01-2.16 (m, 2H), 2.19-2.43 (m, 4H), 2.48-2.78 (m, 6H), 3.52-3.67 (m, 2H), 3.76-3.85 (m, 1H), 4.12-4.21 (m, 1H), 4.49 (d, J=7.7 Hz, 1H), 4.56 (s, 1H), 4.83-5.00 (m, 2H), 6.63 (m, 3H), 7.08-7.22 (m, 4H), 7.27-7.33 (m, 3H), 7.49 (m, 3H), 7.75 (s, 1H), 8.44 (s, 1H).


Example 7h
N-((3-(((1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexy))amino)oxetan-3-yl)methyl)-3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propanamide (Compound 7h)
(Step 1)

1-((2S,4R)-4-(((1r,4R)-4-Aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (50 mg, 0.129 mmol) obtained in reference example 9 was suspended in THF (1 mL), then N,N-diisopropylethylamine (0.090 mL, 0.515 mmol) and 3-(nitromethylene)oxetane (16.30 mg, 0.142 mmol) were added to the suspension at 0° C., and the mixture was stirred at room temperature for 5.5 hours. The reaction mixture was diluted with saturated aqueous ammonium chloride solution, and the aqueous layer was extracted with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (chloroform/methanol=95/5 to 80/20) to give 1-((2S,4R)-2-methyl-4-(((1r,4R)-4-((3-(nitromethyl)oxetan-3-yl)amino)cyclohexyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (28.9 mg, 52%).


ESIMS, (M+H)+, m/z: 431.


(Step 2)

1-((2S,4R)-4-(((1r,4R)-4-((3-(Aminomethyl)oxetan-3-yl)amino)cyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (20.9 mg, 80%) was obtained from 1-((2S,4R)-2-methyl-4-(((1r,4R)-4-((3-(nitromethyl)oxetan-3-yl)amino)cyclohexyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (28.0 mg, 0.065 mmol) obtained in step 1 in the same manner as in step 2 of reference example 17.


ESIMS, (M+H)+, m/z: 401.


(Step 3)

Ethyl 1-((2S,4R)-4-((4-bromophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (311 mg, 0.833 mmol) obtained in reference example 2 was dissolved in THF (5 mL), then palladium acetate (37.4 mg, 0.167 mmol), SPhos (137 mg, 0.333 mmol) and 3-ethoxy-3-oxopropylzinc bromide (0.50 mol/L THF solution, 3.33 mL, 1.67 mmol) were added to the solution, and the mixture was stirred at room temperature for 22 hours. The reaction mixture was diluted with saturated aqueous ammonium chloride solution, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate/heptane=1/9 to 3/7) to give ethyl 3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propanoate (95.6 mg, 29%).


ESIMS, (M+H)+, m/z: 395.


(Step 4)

A crude product (90.0 mg) of 3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propanoic acid was obtained from ethyl 3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propanoate (95.0 mg, 0.241 mmol) obtained in step 3 and in the same manner as in step 6 of reference example 1.


ESIMS, (M+H)+, m/z: 367.


(Step 5)

Compound 7h (6.8 mg, 20%) was obtained from 1-((2S,4R)-4-(((1r,4R)-4-((3-(aminomethyl)oxetan-3-yl)amino)cyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (18.4 mg, 0.046 mmol) obtained in step 2 and the crude product (16.3 mg) of 3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propanoic acid obtained in step 4 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 749; 1H-NMR (CDCl3, δ) 1.32-1.40 (m, 16H), 1.70-1.84 (m, 2H), 1.89-2.08 (m, 2H), 2.17-2.69 (m, 10H), 2.88 (t, J=8.0 Hz, 2H), 3.50 (dd, J=12.0, 4.0 Hz, 1H), 3.57-3.69 (m, 3H), 3.71-3.86 (m, 1H), 4.14 (d, J=12.4 Hz, 1H), 4.30 (d, J=6.8 Hz, 1H), 4.32 (d, J=6.8 Hz, 1H), 4.37 (d, J=6.8 Hz, 1H), 4.39 (d, J=6.8 Hz, 1H), 4.76-5.05 (m, 2H), 5.70-5.86 (m, 1H), 6.57 (d, J=8.8 Hz, 2H), 7.03 (d, J=8.8 Hz, 2H), 7.06-7.34 (m, 7H), 7.42-7.49 (m, 1H).


Example 7i
1-((2S*,4R*)-2-Methyl-4-(((1r,4R)-4-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-7-carbonyl)cyclohexyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 7i)
(Step 1)

tert-Butyl 3-(4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.140 g, 94%) was obtained from tert-butyl 3-((4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)(hydroxy)methyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.150 g, 0.23 mmol) obtained in step 1 of example 5c in the same manner as in step 4 of example 7r.


ESIMS, (M+H)+, m/z: 644.


(Step 2)

A crude product (0.105 g) of 1-((2S,4R)-2-methyl-4-((4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-3-carbonyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride was obtained from tert-butyl 3-(4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.140 g, 0.22 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 444.


(Step 3)

Compound 7i (0.030 g, total yield of 2 steps 22%) was obtained from the crude product (0.099 g) of 1-((2S,4R)-2-methyl-4-((4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-3-carbonyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride obtained in step 2 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.06 g, 0.17 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 770; 1H-NMR (DMSO-d6, δ) 0.78-0.89 (m, 1H), 0.82-1.07 (m, 12H), 1.12-1.31 (m, 3H), 1.38-1.51 (m, 2H), 1.66-1.77 (m, 3H), 1.92-2.04 (m, 2H), 2.09-2.26 (m, 2H), 2.51-2.66 (m, 6H), 3.47 (d, J=10.07 Hz, 1H), 3.87-4.03 (m, 2H), 4.19-4.26 (m, 1H), 4.32-4.38 (m, 2H), 4.57-4.68 (m, 1H), 4.69-4.94 (m, 3H), 6.75 (d, J=8.54 Hz, 2H), 7.02 (d, J=7.93 Hz, 1H), 7.11 (d, 3=7.63 Hz, 1H), 7.16-7.35 (m, 6H), 7.47-7.55 (m, 2H), 7.71 (d, J=8.8 Hz, 2H).


Example 7j
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((3-(((1R,4R)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)oxetan-3-yl)methyl)benzamide (Compound 7j)

1-((2S,4R)-4-(((1r,4R)-4-((3-(Aminomethyl)oxetan-3-yl)amino)cyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (20.9 mg, 0.052 mmol) obtained in step 2 of example 7h and 4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (16.3 mg, 0.046 mmol) obtained in step 2 of reference example 8 were dissolved in DMF (0.5 mL), then N,N-diisopropylethylamine (0.023 mL, 0.130 mmol) and COMU (33.5 mg, 0.078 mmol) were added to the solution, and the mixture was stirred at room temperature for 17 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was dissolved in dichloromethane (0.5 mL), then trifluoroacetic acid (0.5 mL) was added to the solution, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was neutralized with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with chloroform. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=60/40 to 55/45) to give compound 5f (4.0 mg, 11%).


ESIMS, (M+H)+, m/z: 721; 1H-NMR (CDCl3, δ) 1.03-1.36 (m, 16H), 1.76-2.12 (m, 4H), 2.16-2.43 (m, 2H), 2.45-2.74 (m, 7H), 3.50 (dd, J=12.0, 4.4 Hz, 1H), 3.84 (d, J=4.4 Hz, 2H), 4.16-4.33 (m, 2H), 4.47 (s, 4H), 4.77-5.04 (m, 2H), 6.44-6.53 (m, 1H), 6.62 (d, J=8.4 Hz, 2H), 7.05-7.34 (m, 8H), 7.42-7.51 (m, 1H), 7.65 (d, J=8.4 Hz, 2H).


Example 7k
(1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)cyclohexane-1-carboxamide (Compound 7k)

Compound 7k (0.064 g, 35%) was obtained from 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride (0.105 g, 0.26 mmol) obtained in step 3 of example 7d and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.100 g, 0.26 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 693; 1H-NMR (DMSO-d6, δ) 0.77-0.89 (m, 1H), 0.91-1.20 (m, 16H), 1.33-1.45 (m, 2H), 1.67-1.83 (m, 3H), 1.90-2.05 (m, 2H), 2.08-2.28 (m, 3H), 2.52-2.64 (m, 4H), 3.42-3.51 (m, 1H), 3.78 (d, J=5.70 Hz, 2H), 4.08-4.12 (m, 1H), 4.59-4.78 (m, 2H), 5.88 (d, J=7.89 Hz, 1H), 6.59 (d, J=8.77 Hz, 2H), 7.16 (d, J=3.73 Hz, 2H), 7.22-7.29 (m, 7H), 7.46-7.52 (m, 1H), 7.97 (t, J=5.6 Hz, 1H), 9.53 (s, 1H).


Example 71
1-((2S*,4R*)-2-Methyl-4-(((1r,4R)-4-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-7-carbonyl)cyclohexyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 71)

Compound 71 (0.023 g, 23%) was obtained from the crude product (0.082 g) of 1-((2S,4R)-2-methyl-4-((4-((5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate obtained in step 2 of example 5c and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.045 g, 0.13 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 756; 1H-NMR (DMSO-d6, δ) 0.79-0.88 (m, 1H), 0.99-1.07 (m, 12H), 1.11-1.20 (m, 2H), 1.22-1.30 (m, 1H), 1.31-1.47 (m, 2H), 1.61-1.72 (m, 3H), 1.88-2.04 (m, 2H), 2.08-2.28 (m, 2H), 2.53-2.71 (m, 6H), 3.42-3.52 (m, 1H), 3.63-3.80 (m, 4H), 3.81-3.94 (m, 2H), 4.08-4.12 (m, 1H), 4.55-4.72 (m, 4H), 5.95 (d, J=7.87 Hz, 1H), 6.58 (d, J=8.11 Hz, 3H), 6.91 (d, J=8.11 Hz, 2H), 7.15 (brs, 2H), 7.22-7.29 (m, 5H), 7.50 (brs, 1H).


Example 7m
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(3-((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxamide)propyl)benzamide (Compound 7m)

Compound 7m (0.059 g, 18%) was obtained from N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.200 g, 0.46 mmol) obtained in step 2 of example 1h, and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.176 g, 0.46 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 721. 1H-NMR (DMSO-d6, δ): 0.75-0.87 (m, 1H), 0.90-1.25 (m, 16H), 1.31-1.45 (m, 2H), 1.53-1.63 (m, 2H), 1.72 (d, J=11.68 Hz, 3H), 1.89-2.18 (m, 4H), 2.21-2.29 (m, 1H), 2.52-2.66 (m, 4H), 3.06 (q, J=6.44 Hz, 2H), 3.20 (q, J=6.60 Hz, 2H), 3.40-3.51 (m, 1H), 4.22-4.30 (m, 1H), 4.56-4.79 (m, 2H), 6.56 (d, J=8.0 Hz, 1H), 6.65 (d, J=8.82 Hz, 2H), 7.06-7.11 (m, 1H), 7.13-7.33 (m, 6H), 7.46-7.53 (m, 1H), 7.62 (d, J=8.82 Hz, 2H), 7.73 (t, J=5.60 Hz, 1H), 8.02 (t, J=5.60 Hz, 1H).


Example 7n
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(1-((1R,4R)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carbonyl)azetidin-3-yl)benzamide (Compound 7n)

Compound 7n (0.048 g, 32%) was obtained from 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate (0.106 g, 0.21 mmol) obtained in step 2 of example 1n and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.08 g, 0.21 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 719. 1H-NMR (DMSO-d6, δ): 0.76-0.86 (m, 1H), 0.93-1.06 (m, 13H), 1.09-1.26 (m, 3H), 1.29-1.44 (m, 2H), 1.69 (d, J=12.87 Hz, 3H), 1.91-2.04 (m, 2H), 2.08-2.30 (m, 3H), 2.52-2.64 (m, 4H), 3.40-3.50 (m, 1H), 3.81 (dd, J=10.13, 5.36 Hz, 1H), 4.01-4.11 (m, 2H), 4.22-4.32 (m, 1H), 4.39-4.48 (m, 1H), 4.59-4.68 (m, 2H), 4.70-4.78 (m, 1H), 6.62-6.68 (m, 3H), 7.08-7.32 (m, 7H), 7.48-7.50 (m, 1H), 7.67 (d, J=8.82 Hz, 2H), 8.55 (d, J=6.8 Hz, 1H).


Example 7o
N1-((1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 7o)

Compound 70 (0.060 g, 25%) was obtained from 1-(4-(((1r,4r)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.127 g, 0.33 mmol) obtained in reference example 9 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.140 g, 0.33 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 721.55. 1H-NMR (DMSO-d6,δ): 0.79-0.89 (m, 1H), 0.93-1.04 (m, 12H), 1.10-1.19 (m, 5H), 1.75-1.78 (m, 4H), 1.91-1.99 (m, 2H), 2.05-2.26 (m, 6H), 2.53-2.61 (m, 5H), 3.45-3.52 (m, 2H), 3.91-4.15 (m, 1H), 4.61-4.78 (m, 2H), 5.82 (d, J=7.6 Hz, 1H), 6.57 (d, J=9.2 Hz, 2H), 7.15 (d, J=3.6 Hz, 2H), 7.22-7.30 (m, 7H), 7.47-7.49 (m, 1H), 7.64 (d, J=8.0 Hz, 1H), 9.46 (s, 1H).


Example 7p
4-((1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carbonyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperazine-1-carboxamide (Compound 7p)
(Step 1)

1-{(2S,4R)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (70 mg, 0.226 mmol) obtained in reference example 7 was dissolved in THF (3 mL), then triethylamine (0.095 ml, 0.679 mmol) and tert-butyl 4-(chlorocarbonyl)piperazine-1-carboxylate (61.9 mg, 0.249 mmol) were added to the solution, and the mixture was stirred at room temperature overnight. Water and saturated aqueous ammonium chloride solution were added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=100/0 to 90/10) to give tert-butyl 4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)piperazine-1-carboxylate (156 mg, quantitative).


ESIMS, (M−H)−, m/z: 520.80.


(Step 2)

N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperazine-1-carboxamide (113.9 mg, quantitative) was obtained from tert-butyl 4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)piperazine-1-carboxylate (118 mg, 0.226 mmol) obtained in step 1 in the same manner as in step 1 of example 8h.


ESIMS, (M+H)+, m/z: 422.58.


(Step 3)

Compound 7p (27.2 mg, 63%) was obtained from N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperazine-1-carboxamide (20 mg, 0.058 mmol) obtained in step 2 and (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (20 mg, 0.058 mmol) obtained in reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 749.04. 1H-NMR (DMSO-d6, δ): 0.80-0.86 (m, 1H), 0.93-1.04 (m, 12H), 1.10-1.28 (m, 3H), 1.35-1.47 (m, 2H), 1.69 (d, J=11.8 Hz, 2H), 1.91-2.03 (m, 2H), 2.11-2.28 (m, 2H), 2.53-2.64 (m, 6H), 3.35-3.51 (m, 10H), 4.07-4.14 (m, 1H), 4.60-4.76 (m, 2H), 5.76 (d, J=7.7 Hz, 1H), 6.56 (d, J=8.6 Hz, 2H), 7.11 (d, J=8.6 Hz, 2H), 7.14-7.30 (m, 7H), 7.50 (t, J=3.6 Hz, 1H), 8.21 (s, 1H).


Example 7q
(1R,4R)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1,3,4-oxadiazol-2-yl)methyl)cyclohexane-1-carboxamide (Compound 7q)

Compound 7q (97.5 mg, 59%) was obtained from (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (80 mg, 0.232 mmol) obtained in reference example 11 and 1-((2S,4R)-4-((4-(5-(aminomethyl)-1,3,4-oxadiazol-2-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (91 mg, 0.232 mmol) obtained in step 3 of example 5g in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 718; 1H-NMR (CDCl3, δ) 1.04-1.41 (m, 17H), 1.96-2.80 (m, 12H), 3.56 (dd, J=12.0, 4.0 Hz, 1H), 4.22-4.38 (m, 2H), 4.72 (d, J=5.6 Hz, 2H), 4.79-5.06 (m, 2H), 6.24-6.33 (m, 1H), 6.68 (d, J=8.8 Hz, 2H), 7.05-7.36 (m, 7H), 7.43-7.50 (m, 1H), 7.84 (d, J=8.8 Hz, 2H).


Example 7r
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(3-((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxamide)-2-oxopropyl)benzamide (Compound 7r)
(Step 1)

tert-Butyl (4-((3-((tert-butoxycarbonyl)amino)-2-hydroxypropyl)carbamoyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (324 mg, 93%) was obtained from 4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (250 mg, 0.570 mmol) obtained in step 2 of reference example 8 and tert-butyl (3-amino-2-hydroxypropyl)carbamate (130 mg, 0.684 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 611


(Step 2)

N-(3-Amino-2-hydroxypropyl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide hydrochloride (216 mg, 100%) was obtained from tert-butyl (4-((3-((tert-butoxycarbonyl)amino)-2-hydroxypropyl)carbamoyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (322 mg, 0.527 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 411.


(Step 3)

N-(2-Hydroxy-3-((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxamide)propyl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide (24.1 mg, 22%) was obtained from N-(3-amino-2-hydroxypropyl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide hydrochloride (60.0 mg, 0.146 mmol) obtained in step 2 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (50.3 mg, 0.146 mmol) obtained in step 2 of reference example 11 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 737.


(Step 4)

N-(2-Hydroxy-3-((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxamide)propyl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide (11.6 mg, 0.016 mmol) obtained in step 3 was dissolved in dichloromethane (0.2 mL), then DMP (26.7 mg, 0.062 mmol) was added to the solution, and the mixture was stirred at room temperature for 4 hours. The reaction mixture was diluted with saturated sodium thiosulfate and stirred for 5 minutes. Furthermore, a saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate, concentrated under reduced pressure, and the obtained residue was purified by reverse phase HPLC (10 mmol/L ammonium bicarbonate aqueous solution/acetonitrile=65/35 to 55/45) to give compound 7r (4.1 mg, 35%) was obtained.


ESIMS, (M+H)+, m/z: 735; 1H-NMR (CDCl3, δ) 1.04-1.16 (m, 12H), 1.20-1.49 (m, 4H), 1.93-2.44 (m, 7H), 2.47-2.79 (m, 5H), 3.56 (dd, J=12.4, 4.0 Hz, 1H), 4.19-4.31 (m, 2H), 4.24 (d, J=4.4 Hz, 2H), 4.35 (d, J=4.4 Hz, 2H), 4.76-5.06 (m, 2H), 6.19-6.31 (m, 1H), 6.62 (d, J=8.8 Hz, 2H), 6.68-6.76 (m, 1H), 7.07-7.38 (m, 8H), 7.43-7.51 (m, 1H), 7.68 (d, J=8.8 Hz, 2H).


Example 8a
(1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)ethyl)cyclohexane-1-carboxamide (Compound 8a)
(Step 1)

(1R,4r)-N-(But-3-yn-1-yl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxamide (87 mg, 76%) was obtained from (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (100 mg, 0.290 mmol) obtained in reference example 11 and 3-butyn-1-amine (0.029 mL, 0.348 mmol) in the same manner as in step 3 of example 1b.


ESI-MS, (M+H)+, m/z: 396.


(Step 2)

A crude product of compound 8a was obtained from the crude product (80 mg) of 1-((2S,4R)-4-((4-azidophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one obtained in step 2 of example 3a and (1R,4r)-N-(but-3-yn-1-yl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxamide (80 mg, 0.202 mmol) obtained in step 1 in the same manner as in step 3 of example 3a. The obtained crude product of compound 8a was purified by reverse phase HPLC (0.05% ammonium bicarbonate aqueous solution/acetonitrile=6/4 to 5/5) to give compound 8a (85 mg, total yield of 2 steps 57%).


ESI-MS, (M+H)+, m/z: 731. 1H-NMR (CDCl3), δ: 1.06-1.12 (m, 6H), 1.15-1.20 (m, 6H), 1.47-1.56 (m, 2H), 1.56-1.64 (m, 3H), 1.90-1.97 (m, 2H), 1.98-2.05 (m, 1H), 2.06-2.15 (m, 2H), 2.22-2.34 (m, 1H), 2.34-2.44 (m, 1H), 2.46-2.63 (m, 3H), 2.64-2.75 (m, 2H), 2.97 (t, J=6.1 Hz, 2H), 3.55 (dd, J=11.8, 4.1 Hz, 1H), 3.66 (dd, J=6.0, 3.0 Hz, 2H), 4.11-4.17 (m, 1H), 4.20-4.27 (m, 1H), 4.85 (d, J=7.2 Hz, 1H), 4.97 (d, J=6.8 Hz, 1H), 6.38-6.44 (m, 1H), 6.71 (d, J=8.6 Hz, 2H), 7.07-7.13 (m, 1H), 7.17-7.26 (m, 4H), 7.27-7.33 (m, 2H), 7.43-7.47 (m, 1H), 7.49 (d, J=9.1 Hz, 2H), 7.68 (s, 1H).


Example 8b
N-((1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)-2-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxyethoxy)acetamide (Compound 8b)
(Step 1)

Methyl 2-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxyethoxy)acetate (140 mg, 99%) was obtained from 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (100 mg, 0.323 mmol) obtained in step 3 of reference example 7 and 2-(2-methoxy-2-oxyethoxy)acetic acid (96 mg, 0.646 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 440


(Step 2)

Methyl 2-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxyethoxy)acetate (54.0 mg, 0.123 mmol) obtained in step 1 was dissolved in a mixed solvent (1.2 mL) of THF and methanol (1:1), then an aqueous sodium hydroxide solution (4 mol/L, 1.0 mL) was added to the solution, and the mixture was stirred at room temperature overnight. The reaction mixture was neutralized with 6 mol/L hydrochloric acid, and the aqueous layer was extracted with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was dissolved in DMF (1 mL), then N,N-diisopropylethylamine (0.104 mL, 0.611 mmol), COMU (79 mg, 0.183 mmol) and 1-((2S,4R)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (47.5 mg, 0.122 mmol) obtained in reference example 9 were added to the solution, and the mixture was stirred at room temperature for 21 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=55/45 to 50/50) to give compound 8b (15.7 mg, 18%).


ESIMS, M+H)+, m/z: 724.03; 1H-NMR (CDCl3, δ) 1.04-1.17 (m, 12H), 1.19-1.40 (m, 5H), 1.94-2.19 (m, 4H), 2.17-2.42 (m, 2H), 2.45-2.73 (m, 5H), 3.45-3.59 (m, 1H), 3.76-3.96 (m, 2H), 4.08-4.22 (m, 2H), 4.12 (s, 2H), 4.16 (s, 2H), 4.77-5.06 (m, 2H), 6.15-6.28 (m, 1H), 6.62 (d, J=9.2 Hz, 2H), 7.07-7.35 (m, 8H), 7.37 (d, J=9.2 Hz, 2H), 7.43-7.57 (m, 1H), 8.13 (brs, 1H).


Example 8c
1-((1R,4R)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carbonyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 8c)

Compound 8c (0.028 g, 40%) was obtained from the crude product (0.050 g) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide trifluoroacetate obtained in step 1 of example 10e and (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.034 g, 0.10 mmol) obtained in reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 719.71. 1H-NMR (DMSO-d6, δ): 0.79-0.88 (m, 1H), 0.94-1.25 (m, 15H), 1.31-1.41 (m, 2H), 1.69 (d, J=13.37 Hz, 3H), 1.93-2.03 (m, 2H), 2.10-2.29 (m, 3H), 2.56-2.60 (m, 5H), 3.41-3.47 (m, 2H), 3.85-4.03 (m, 2H), 4.11-4.13 (m, 1H), 4.20-4.32 (m, 2H), 4.59-4.79 (m, 2H), 5.90 (d, J=7.89 Hz, 1H), 6.61 (d, J=8.77 Hz, 2H), 7.17 (d, J=3.73 Hz, 2H), 7.20-7.34 (m, 7H), 7.49-7.51 (m, 1H), 9.69 (s, 1H).


Example 8d
1-((2S*,4R*)-2-Methyl-4-(((1r,4R)-4-(4-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)piperidine-1-carbonyl)cyclohexyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 8d)

(Step 1) 1-((2S,4R)-4-((4-Bromophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (60 mg, 0.161 mmol) obtained in reference example 2 was dissolved in a mixed solvent (1.8 mL) of 1,4-dioxane and water (8:1), then tert-butyl 4-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazol-1-yl)piperidine-1-carboxylate (72.8 mg, 0.193 mmol), Pd(PPh3)4 (19 mg, 0.016 mmol) and cesium carbonate (157 mg, 0.482 mmol) were added to the solution, and the mixture was stirred at 120° C. for 1 hour under an argon atmosphere under microwave irradiation. Water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=100/0 to 90/10) to give tert-butyl 4-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)piperidine-1-carboxylate (0.4 g, 84%).


(Step 2)

tert-Butyl 4-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)piperidine-1-carboxylate (0.55 g, 0.101 mmol) obtained in step 1 was dissolved in ethyl acetate (0.8 mL), then 4 mol/L hydrochloric acid (0.39 mL, 1.52 mmol) was added to the solution, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was suction filtered, and the obtained solid was washed with ethyl acetate to give a crude product (55 mg) of 1-((2S,4R)-2-methyl-4-((4-(1-(piperidin-4-yl)-1H-pyrazol-4-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride.


(Step 3)

Compound 8d (10 mg, 2 step yield 12%) was obtained from the crude product (55 mg) of 1-((2S,4R)-2-methyl-4-((4-(1-(piperidin-4-yl)-1H-pyrazol-4-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride obtained in step 2 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.039 g, 0.115 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 770 (M+H)+: 1H-NMR (CDCl3, δ): 1.05-1.19 (m, 12H), 1.19-1.37 (m, 2H), 1.57-1.75 (m, 4H), 1.80-1.90 (m, 2H), 1.89-2.09 (m, 2H), 2.10-2.44 (m, 6H), 2.45-2.82 (m, 7H), 3.18-3.30 (m, 1H), 3.51-3.63 (m, 1H), 3.81-3.93 (m, 1H), 4.01-4.14 (m, 1H), 4.16-4.27 (m, 1H), 4.31-4.44 (m, 1H), 4.72-5.01 (m, 3H), 6.59-6.67 (m, 2H), 7.06-7.36 (m, 10H), 7.43-7.49 (m, 1H), 7.53-7.58 (m, 1H), 7.66-7.74 (m, 1H).


Example 8e
(1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thiophen-2-yl)methyl)cyclohexane-1-carboxamide (Compound 8e)
(Step 1)

tert-Butyl ((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thiophen-2-yl)methyl)carbamate (22 mg, 23%) was obtained from 1-((2S,4R)-4-((4-bromophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (70 mg, 0.188 mmol) obtained in reference example 2 and (5-(((tert-butoxycarbonyl)amino)methyl)thiophen-2-yl)boronic acid (57.9 mg, 0.225 mmol) in the same manner as in step 1 of example 8d.


ESI-MS m/z: 506 (M+H)+


(Step 2)

A crude product (25 mg) of 1-((2S,4R)-4-((4-(5-(aminomethyl)thiophen-2-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride was obtained from tert-butyl ((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thiophen-2-yl)methyl)carbamate (22 mg, 0.044 mmol) obtained in step 1 in the same manner as in step 2 of example 8d.


ESI-MS m/z: 406 (M+H)+


(Step 3)

Compound 8e (8 mg, total yield of 2 steps 24%) was obtained from the crude product (25 mg) of 1-((2S,4R)-4-((4-(5-(aminomethyl)thiophen-2-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride obtained in step 2 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.019 g, 0.057 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 732 (M+H)+: 1H-NMR (CDCl3, δ): 1.04-1.20 (m, 12H), 1.20-1.39 (m, 2H), 1.48-1.68 (m, 2H), 1.93-2.17 (m, 7H), 2.19-2.44 (m, 2H), 2.45-2.76 (m, 5H), 3.50-3.61 (m, 1H), 3.92-4.01 (m, 1H), 4.15-4.29 (m, 1H), 4.53-4.62 (m, 2H), 4.79-5.01 (m, 2H), 5.77-5.86 (m, 1H), 6.59-6.65 (m, 2H), 6.86 (d, J=3.8 Hz, 1H), 6.97 (d, J=3.8 Hz, 1H), 7.08-7.12 (m, 1H), 7.14-7.23 (m, 2H), 7.23-7.32 (m, 5H), 7.37-7.41 (m, 2H), 7.43-7.48 (m, 1H).


Example 8f
1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)-N-((1R,4R)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)-1H-1,2,3-triazole-4-carboxamide (Compound 8f)
(Step 1)

tert-Butyl (4-(hydroxymethyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetra hydroquinolin-4-yl)carbamate (90 mg, 0.212) obtained in step 3 of reference example 8 was dissolved in toluene (2 mL), then diphenylphosphoryl azide (0.055 mL, 0.254 mmol) and DBU (0.038 mL, 0.254 mmol) were added to the solution, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was purified by silica gel column chromatography (heptane/ethyl acetate=8/2 to 5/5) to give tert-butyl (4-(azidomethyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (67 mg, 70%).


(Step 2)

A crude product (40 mg) of 1-(4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)-1H-1,2,3-triazole-4-carboxylic acid was obtained from tert-butyl (4-(azidomethyl)phenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (50 mg, 0.111 mmol) obtained in step 1 and acetylene monocarboxylic acid (0.010 mL, 0.167 mmol) in the same manner as in step 3 of example 3a.


ESI-MS, (M+H)+, m/z: 520.


(Step 3)

A crude product (52 mg) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((4-(((1R,4R)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamoyl)-1H-1,2,3-triazol-1-yl)methyl)phenyl)carbamate was obtained from the crude product (40 mg) of 1-(4-((tert-butoxycarbonyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzyl)-1H-1,2,3-triazole-4-carboxylic acid obtained in step 2 and 1-((2S*,4R*)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (25 mg, 0.064 mmol) obtained in reference example 10 in the same manner as in step 3 of example 1b.


ESI-MS, (M+H)+, m/z: 817.


(Step 4)

A crude product of compound 8f was obtained from the crude product (52 mg) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((4-(((1R,4R)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamoyl)-1H-1,2,3-triazol-1-yl)methyl)phenyl)carbamate obtained in step 3 in the same manner as in step 2 of example 1k. The crude product obtained was purified by reverse phase HPLC (0.05% aqueous ammonium bicarbonate solution/acetonitrile=55/45 to 45/55) to give compound 8f (13 mg, total yield of 3 steps 28%).


ESI-MS, (M+H)+, m/z: 717. 1H-NMR (CDCl3), δ: 1.06-1.12 (m, 6H), 1.12-1.17 (m, 6H), 1.23-1.40 (m, 5H), 1.98-2.05 (m, 1H), 2.07-2.16 (m, 3H), 2.22-2.43 (m, 2H), 2.47-2.74 (m, 5H), 3.54 (dd, J=12.2, 4.1 Hz, 1H), 3.91-3.97 (m, 1H), 3.99 (d, J=7.2 Hz, 1H), 4.13-4.22 (m, 1H), 4.82-4.98 (m, 2H), 5.42 (s, 2H), 6.61 (d, J=8.6 Hz, 2H), 6.98 (d, J=8.2 Hz, 1H), 7.07-7.32 (m, 10H), 7.46-7.50 (m, 1H), 7.92 (s, 1H).


Example 8g
(1R,4r)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)cyclohexane-1-carboxamide (Compound 8g)
(Step 1)

tert-Butyl (4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)carbamate (79 mg, 100%) was obtained from 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (50 mg, 0.162 mmol) obtained in step 3 of reference example 7 and 4-((tert-butoxycarbonyl)amino)but-2-ynoic acid (32.2 mg, 0.162 mmol) in the same manner as in step 3 of example 1b.


ESI-MS m/z: 491 (M+H)+


(Step 2)

A crude product (79 mg) of 4-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)but-2-ynamide trifluoroacetate was obtained from tert-butyl (4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)carbamate (79 mg, 0.161 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESI-MS m/z: 391 (M+H)+


(Step 3)

Compound 8g (25 mg, total yield of 2 steps 22%) was obtained from the crude product (32 mg, 0.094 mmol) of 4-Amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)but-2-ynamide trifluoroacetate obtained in step 2 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (32 mg, 0.094 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 717 (M+H)+: 1H-NMR (CDCl3, δ): 0.96-1.11 (m, 12H), 1.11-1.23 (m, 2H), 1.40-1.66 (m, 4H), 1.82-2.00 (m, 3H), 2.00-2.13 (m, 3H), 2.13-2.36 (m, 2H), 2.36-2.70 (m, 5H), 3.40-3.52 (m, 1H), 3.86-4.00 (m, 1H), 4.00-4.14 (m, 3H), 4.72-4.88 (m, 2H), 6.37-6.46 (m, 1H), 6.46-6.56 (m, 2H), 6.97-7.15 (m, 3H), 7.15-7.23 (m, 4H), 7.23-7.32 (m, 2H), 7.36-7.43 (m, 1H), 7.96-8.06 (m, 1H).


Example 8h
1-((2S*,4R*)-2-methyl-4-(((1R,4R)-4-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-7-carbonyl)cyclohexyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 8h)
(Step 1)

tert-Butyl 3-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-5,6-dihydroimidazo[1,2-a]pyrazine-7(8H)-carboxylate (0.325 g, 0.63 mmol) obtained in step 2 of example 3e was dissolved in 1,4-dioxane (15 mL), then hydrogen chloride/1,4-dioxane solution (4 mol/L, 4.0 mL, 16 mmol) was added to the solution at 0° C., and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was basified with a 10% aqueous sodium hydrogen carbonate solution, and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.220 g, 84%).


ESIMS, (M+H)+, m/z: 416.27


(Step 2)

Compound 8h (0.045 g, 30%) was obtained from 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.084 g, 0.20 mmol) obtained in step 1 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 742.7. 1H-NMR (DMSO-d6, δ): 0.97-1.06 (m, 12H), 1.15-1.23 (m, 1H), 1.41-1.68 (m, 4H), 1.84-1.92 (m, 2H), 2.09-2.34 (m, 4H), 2.54-2.69 (m, 4H), 2.72-2.80 (m, 1H), 2.94 (t, J=9.10 Hz, 1H), 3.90-4.08 (m, 3H), 4.13-4.40 (m, 4H), 4.65-4.78 (m, 2H), 4.86-5.14 (m, 2H), 6.53-6.63 (m, 1H), 6.78 (d, J=8.33 Hz, 2H), 7.12-7.21 (m, 2H), 7.25-7.45 (m, 7H), 7.61 (brs, 1H), 9.13 (brs, 2H).


Example 8i
(1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thio)ethyl)cyclohexane-1-carboxamide (Compound 8i)

Compound 8i (0.036 g, 30%) was obtained from 1-[(2S,4R)-4-({4-[(2-aminoethyl)thio]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one hydrochloride (0.078 g, 0.19 mmol) obtained in step 2 of example 4f and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.06 g, 0.17 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 696.68. 1H-NMR (DMSO-d6, δ): 0.91-1.22 (m, 15H), 1.31-2.31 (m, 11H), 2.52-2.63 (m, 4H), 2.66-2.76 (m, 2H), 3.08-3.20 (m, 2H), 3.38 (brs, 1H), 4.11-4.19 (m, 1H), 4.54-4.81 (m, 2H), 6.27 (d, J=7.45 Hz, 1H), 6.62 (d, J=8.55 Hz, 2H), 7.08-7.52 (m, 10H), 7.87 (brs, 1H), 9.11 (s, 1H).


Example 8j
2-(3-((1R,4R)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)ureido)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide (Compound 8j)
(Step 1)

1-((2S,4R)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.250 g, 0.64 mmol) obtained in reference example 9 was dissolved in DMF (5 mL), then triethylamine (0.18 mL, 1.29 mmol), DMAP (0.196 g, 1.61 mmol) and CDI (0.208 g, 0.64 mmol) were added to the solution at room temperature, and the mixture was stirred at 80° C. for 45 minutes. Ethyl glycinate hydrochloride (0.116 g, 0.84 mmol) was added to the reaction mixture at room temperature, and the mixture was stirred at 80° C. for 16 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% formic acid aqueous solution=60/40) to give ethyl (((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamoyl)glycinate (0.150 g, 52%).


ESIMS, (M+H)+, m/z: 445.56.


(Step 2)

2-(3-((1R,4r)-4-((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-ylamino)cyclohexyl)ureido)acetic acid (0.110 g, 79%) was obtained from ethyl (((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)carbamoyl)glycinate (0.150 g, 0.34 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 417.36.


(Step 3)

2-(3-((1R,4r)-4-((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-ylamino)cyclohexyl)ureido)acetic acid (0.110 g, 0.26 mmol) obtained in step 2 was dissolved in DMF (5 mL), then DCC (0.076 g, 0.37 mmol) and DMAP (0.096 g, 0.79 mmol) were added to the solution, and the mixture was stirred at room temperature for 30 minutes. 1-{(2S,4R)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.082 g, 0.26 mmol) obtained in reference example 7 was added to the reaction mixture, and the mixture was stirred at room temperature for 16 hours. The reaction mixture was added to ice water and the mixture was stirred for 10 minutes. The resulting solid was collected by filtration and dried under reduced pressure. The obtained solid was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=70/30 to 37/63) to give compound 8j (0.064 g, 34%).


ESI-MS m/z: 708.67 (M+H)+: 1H-NMR (DMSO-d6,δ): 0.78-0.86 (m, 1H), 0.93-1.06 (m, 12H), 1.09-1.22 (m, 4H), 1.83-1.99 (m, 4H), 2.07-2.28 (m, 2H), 2.53-2.67 (m, 5H), 3.37-3.38 (m, 1H), 3.43 (dd, J=12.0, 4.0 Hz, 1H), 3.76 (d, J=5.48 Hz, 2H), 4.08-4.14 (m, 1H), 4.60-4.78 (m, 2H), 5.87 (d, J=7.89 Hz, 1H), 5.96 (t, J=5.37 Hz, 1H), 6.09 (d, J=7.02 Hz, 1H), 6.59 (d, J=8.77 Hz, 2H), 7.16 (d, J=3.73 Hz, 2H), 7.19-7.27 (m, 7H), 7.49 (t, J=4.2 Hz, 1H), 9.54 (s, 1H).


Example 8k
(1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1,2,4-oxadiazol-3-yl)methyl)cyclohexane-1-carboxamide (Compound 8k)

A crude product of compound 8k was obtained from the crude product (11 mg) of 1-((2S,4R)-4-((4-(3-(aminomethyl)-1,2,4-oxadiazol-5-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one obtained in step 4 of example 3d and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid obtained in step 2 of reference example 11 (10 mg, 0.029 mmol) in the same manner as in step 3 of example 1b. The crude product of compound 8k was purified by reverse phase HPLC (0.05% TFA aqueous solution/acetonitrile=65/35 to 55/45) to give compound 8k (1 mg, 4%).


ESI-MS, (M+H)+, m/z: 718. 1H-NMR (CDCl3), δ: 1.11-1.19 (m, 12H), 1.24-1.52 (m, 2H), 1.66-1.78 (m, 2H), 2.03-2.19 (m, 4H), 2.22-2.45 (m, 5H), 2.50-2.65 (m, 2H), 2.65-2.75 (m, 1H), 2.81-2.89 (m, 1H), 3.34-3.44 (m, 1H), 4.07 (dd, J=13.1, 3.2 Hz, 1H), 4.30 (dd, J=11.6, 4.3 Hz, 1H), 4.61 (d, J=5.4 Hz, 2H), 4.89-5.02 (m, 2H), 6.31-6.36 (m, 1H), 6.68 (d, J=9.1 Hz, 2H), 7.18-7.24 (m, 4H), 7.27-7.35 (m, 2H), 7.38-7.43 (m, 1H), 7.47-7.53 (m, 1H), 7.92 (d, J=8.6 Hz, 2H).


Example 8l
(1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)cyclohexane-1-carboxamide (compound 8l)
(Step 1)

A crude product (30 mg) of (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)cyclohexane-1-carboxamide was obtained from (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (30 mg, 0.087 mmol) obtained in step 2 of reference example 11 and propargylamine (0.007 μL, 0.105 mmol) in the same manner as in step 3 of example 1b.


ESI-MS, (M+H)+, m/z: 382.


(Step 2)

A crude product of compound 8l was obtained from the crude product (30 mg) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a and the crude product (30 mg) of (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)cyclohexane-1-carboxamide obtained in step 1 of example 8l in the same manner as in step 3 of 3a. The crude product obtained was purified by reverse phase HPLC (0.05% aqueous ammonium bicarbonate solution/acetonitrile=6/4 to 5/5) to give compound 8l (31 mg, total yield of 2 steps 56%).


ESI-MS, (M+H)+, m/z: 717. 1H-NMR (CDCl3) δ: 1.06-1.19 (m, 12H), 1.18-1.36 (m, 3H), 1.49-1.55 (m, 2H), 1.92-2.06 (m, 3H), 2.08-2.17 (m, 2H), 2.21-2.44 (m, 2H), 2.47-2.74 (m, 5H), 3.55 (dd, J=12.2, 4.1 Hz, 1H), 4.11 (d, J=7.2 Hz, 1H), 4.19-4.27 (m, 1H), 4.57 (d, J=5.4 Hz, 2H), 4.80-4.89 (m, 1H), 4.92-5.01 (m, 1H), 6.23 (t, J=5.7 Hz, 1H), 6.71 (d, J=9.1 Hz, 2H), 7.07-7.12 (m, 1H), 7.16-7.20 (m, 1H), 7.21 (d, J=7.2 Hz, 1H), 7.22-7.26 (m, 2H), 7.28-7.33 (m, 2H), 7.44-7.47 (m, 1H), 7.49 (d, J=9.1 Hz, 2H), 7.83 (s, 1H).


Example 8m
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)-4-oxobut-2-yn-1-yl)benzamide (Compound 8m)
(Step 1)

tert-Butyl (4-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl))amino)-4-oxobut-2-yn-1-yl)carbamate (0.120 g, 72%) was obtained from 1-((2S,4R)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.120 g, 0.31 mmol) obtained in reference example 9 and 4-((tert-butoxycarbonyl)amino)but-2-ynoic acid (0.062 g, 0.31 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 497.33.


(Step 2)

A crude product (0.130 g) of 4-amino-N-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)but-2-ynamide trifluoroacetate was obtained from tert-butyl (4-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl))amino)-4-oxobut-2-yn-1-yl)carbamate (0.120 g, 0.24 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 397.44.


(Step 3)

Compound 8m (0.026 g, total yield of 2 steps 15%) was obtained from the crude product (0.126 g) of 4-amino-N-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)but-2-ynamide trifluoroacetate obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.060 g, 0.18 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 717.4. 1H-NMR (DMSO-d6, δ): 0.79-0.86 (m, 1H), 0.91-1.27 (m, 17H), 1.70-1.80 (m, 2H), 1.84-2.03 (m, 2H), 2.06-2.33 (m, 2H), 2.53-2.68 (m, 5H), 3.39-3.52 (m, 2H), 4.16 (d, J=5.26 Hz, 2H), 4.26-4.32 (m, 1H), 4.57-4.79 (m, 2H), 6.62-6.68 (m, 3H), 7.09 (d, J=7.6 Hz, 1H), 7.14-7.32 (m, 6H), 7.46 (brs, 1H), 7.65 (d, J=8.77 Hz, 2H), 8.48-8.55 (m, 2H).


Example 8n
(1R,4r)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)ethyl)cyclohexane-1-carboxamide (Compound 8n)
(Step 1)

tert-Butyl (2-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)ethyl)carbamate (0.240 g, 60%) was obtained from 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.250 g, 0.81 mmol) obtained in reference example 7 and tert-butyl (2-aminoethyl)carbamate (0.16 mL, 1.05 mmol) in the same manner as in step 1 of example 14h.


ESIMS, (M+H)+, m/z: 496.36.


(Step 2)

1-(2-Aminoethyl)-3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)urea hydrochloride (0.210 g, 100%) was obtained from tert-butyl (2-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)ethyl)carbamate (0.240 g, 0.48 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 396.31.


(Step 3)

Compound 8n (0.066 g, 19%) was obtained from 1-(2-aminoethyl)-3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)urea hydrochloride (0.210 g, 0.49 mmol) obtained in step 2 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.167 g, 0.49 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 722.67. 1H-NMR (DMSO-d6,δ): 0.77-0.89 (m, 1H), 0.92-1.19 (m, 15H), 1.39 (q, J=12.50 Hz, 2H), 1.74 (d, J=12.50 Hz, 3H), 1.90-2.28 (m, 5H), 2.51-2.65 (m, 5H), 3.09 (brs, 4H), 3.46 (dd, J=11.62, 3.29 Hz, 1H), 4.02-4.12 (m, 1H), 4.56-4.78 (m, 2H), 5.68 (d, J=7.67 Hz, 1H), 5.91 (brs, 1H), 6.55 (d, J=8.77 Hz, 2H), 7.08 (d, J=8.77 Hz, 2H), 7.12-7.31 (m, 7H), 7.45-7.53 (m, 1H), 7.75 (brs, 1H), 8.02 (s, 1H).


Example 8o
(1R,4r)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)cyclohexane-1-carboxamide (Compound 8o)

Compound 8o (41.2 mg, 78%) was obtained from (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (25.0 mg, 0.073 mmol) obtained in step 2 of reference example 11 and 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (29.3 mg, 0.073 mmol) obtained in step 2 of example 6q in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 730; 1H-NMR (CDCl3, δ) 1.04-1.34 (m, 18H), 1.86-2.17 (m, 5H), 2.19-2.43 (m, 2H), 2.45-2.75 (m, 5H), 3.54 (dd, J=12.4, 4.4 Hz, 1H), 3.66-3.79 (m, 2H), 3.86-3.96 (m, 1H), 4.11-4.33 (m, 3H), 4.77-5.20 (m, 2H), 6.08-6.24 (m, 1H), 6.65 (d, J=8.8 Hz, 2H), 7.04-7.31 (m, 10H), 7.42-7.48 (m, 1H), 7.51 (s, 1H), 7.73 (s, 1H).


Example 8p
1-((2S,4R)-2-Methyl-4-(((1R,4R)-4-((1R,4R)-5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-2,5-diazabicyclo[2.2.1]heptane-2-carbonyl)cyclohexyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (compound 8p)

Compound 8p (27.2 mg, 50%) was obtained from (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (25.0 mg, 0.073 mmol) obtained in step 2 of reference example 11 and 1-((2S,4R)-4-((4-(2,5-diazabicyclo[2.2.1]heptane-2-carbonyl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (30.4 mg, 0.073 mmol) obtained in step 2 of example 1k in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 745; 1H-NMR (CDCl3, δ) 0.84-1.36 (m, 18H), 1.72-2.43 (m, 10H), 2.45-2.82 (m, 5H), 3.37-3.88 (m, 5H), 4.08-4.29 (m, 2H), 4.75-5.10 (m, 3H), 6.52-6.67 (m, 2H), 7.04-7.34 (m, 7H), 7.37-7.51 (m, 3H).


Example 8q
1-((1R,4r)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carbonyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperidine-4-carboxamide (Compound 8q)
(Step 1)

tert-Butyl 4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)piperidine-1-carboxylate (0.180 g, 71%) was obtained from 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.150 g, 0.48 mmol) obtained in step 3 of reference example 7 and 1-(tert-butoxycarbonyl)-piperidine-4-carboxylic acid (0.111 g, 0.48 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 521.41.


(Step 2)

A crude product (0.160 g) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperidine-4-carboxamide hydrochloride was obtained from tert-butyl 4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)piperidine-1-carboxylate (0.180 g, 0.35 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 421.32.


(Step 3)

Compound 8q (0.071 g, 27%) was obtained from the crude product (0.160 g) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperidine-4-carboxamide hydrochloride obtained in step 2 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.121 g, 0.35 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 747.54. 1H-NMR (DMSO-d6, δ): 0.74-0.89 (m, 1H), 0.92-1.06 (m, 12H), 1.08-1.29 (m, 3H), 1.32-1.84 (m, 9H), 1.89-2.03 (m, 2H), 2.07-2.29 (m, 2H), 2.52-2.64 (m, 7H), 2.98-3.10 (m, 1H), 3.46 (dd, J=11.51, 3.40 Hz, 1H), 4.00 (d, J=12.72 Hz, 1H), 4.11-4.21 (m, 1H), 4.38-4.47 (m, 1H), 4.58-4.76 (m, 2H), 5.84 (d, J=7.89 Hz, 1H), 6.58 (d, J=8.99 Hz, 2H), 7.16 (d, J=3.73 Hz, 2H), 7.19-7.32 (m, 7H), 7.47-7.54 (m, 1H), 9.51 (s, 1H).


Example 8r
1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-N-((1R,4R)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)azetidine-3-carboxamide (Compound 8r)
(Step 1)

Methyl 1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)azetidine-3-carboxylate (0.360 g, 70%) was obtained from 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.4 g, 1.18 mmol) obtained in step 7 of reference example 1 and methyl azetidine-3-carboxylate hydrochloride (0.268 g, 1.77 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 436.45.


(Step 2)

1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)azetidine-3-carboxylic acid (0.330 g, 95%) was obtained from methyl 1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)azetidine-3-carboxylate (0.360 g, 0.83 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 422.49.


(Step 3)

Compound 8r (0.033 g, 19%) was obtained from 1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)azetidine-3-carboxylic acid (0.1 g, 0.24 mmol) obtained in step 2 and 1-((2S,4R)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.090 g, 0.24 mmol) obtained in reference example 9 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 719.57. 1H-NMR (DMSO-d6, δ): 0.75-0.86 (m, 1H), 0.94-1.06 (m, 12H), 1.11-1.26 (m, 5H), 1.80-1.91 (m, 4H), 2.10-2.26 (m, 2H), 2.51-2.63 (m, 5H), 3.34-3.36 (m, 1H), 3.52-3.54 (m, 2H), 4.22-4.28 (m, 5H), 4.63-4.65 (m, 1H), 4.73-4.75 (m, 1H), 6.63-6.66 (m, 3H), 7.10 (d, J=7.6 Hz, 1H), 7.16-7.32 (m, 6H), 7.43 (d, J=8.77 Hz, 2H), 7.48 (brs, 1H), 7.84-7.86 (m, 1H).


Example 9a
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(N-((1R,4R)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)sulfamoyl)ethyl)benzamide (Compound 9a)
(Step 1)

1-((2S*,4R*)-4-(((1r,4R)-4-Aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.2 g, 0.51 mmol) obtained in step 2 of reference example 10 was dissolved in dichloromethane (5 mL), then triethylamine (0.29 mL, 2.07 mmol) was added to the solution, and the mixture was stirred at room temperature for 10 minutes. Benzyl (2-(chlorosulfonyl)ethyl)carbamate (0.143 g, 0.51 mmol) was added to the reaction mixture at 0° C., and the mixture was stirred at room temperature for 16 hours. The reaction mixture was diluted with water and extracted with dichloromethane. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1° A) formic acid aqueous solution=45/55) to give Benzyl (2-(N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)sulfamoyl)ethyl)carbamate (0.150 g, 52%).


ESIMS, (M+H)+, m/z: 557.29.


(Step 2)

Benzyl (2-(N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)sulfamoyl)ethyl)carbamate (0.150 g, 0.27 mmol) obtained in step 1 was dissolved in THF (5 mL), then palladium carbon (0.2 g, 10% wt) was added to the solution, and the mixture was stirred at room temperature for 36 hours under a hydrogen atmosphere. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure to give 2-amino-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)ethane-1-sulfonamide (0.090 g, 80%). ESIMS, (M+H)+, m/z: 423.37.


(Step 3)

Compound 9a (0.045 g, 28%) was obtained from 2-amino-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)ethane-1-sulfonamide (0.090 g, 0.21 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.072 g, 0.21 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 743.47. 1H-NMR (DMSO-d6,δ): 0.77-0.85 (m, 1H), 0.93-1.06 (m, 12H), 1.09-1.32 (m, 6H), 1.74 (brs, 1H), 1.90-1.97 (m, 4H), 2.10-2.16 (m, 1H), 2.22-2.27 (m, 1H), 2.52-2.64 (m, 4H), 3.06-3.11 (m, 1H), 3.19-3.22 (m, 2H), 3.42 (dd, J=11.74, 3.42 Hz, 1H), 3.54-3.59 (m, 2H), 4.25-4.31 (m, 1H), 4.60-4.76 (m, 2H), 6.60 (d, J=7.83 Hz, 1H), 6.66 (d, J=8.80 Hz, 2H), 7.08 (d, J=7.6 Hz, 1H), 7.13-7.32 (m, 7H), 7.46-7.48 (m, 1H), 7.61 (d, J=8.80 Hz, 2H), 8.15-8.18 (m, 1H).


Example 9b
N-((1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)-2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)acetamide (Compound 9b)
(Step 1)

2-(4-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)acetic acid (0.140 g, 60%) was obtained from ethyl 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)acetate (0.250 g, 0.56 mmol) obtained in step 1 of example 6n in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 419.29.


(Step 2)

Compound 9b (0.031 g, 12%) was obtained from 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)acetic acid (0.150 g, 0.36 mmol) obtained in step 1 and 1-((2S*,4R*)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.113 g, 0.36 mmol) obtained in step 2 of reference example 10 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 716.51. 1H-NMR (DMSO-d6,δ): 0.85-1.05 (m, 13H), 1.11-1.24 (m, 5H), 1.84-2.33 (m, 7H), 2.54-2.67 (m, 4H), 3.35-3.52 (m, 2H), 4.14-4.19 (m, 1H), 4.66-4.75 (m, 4H), 6.03 (d, J=7.67 Hz, 1H), 6.65 (d, J=8.33 Hz, 2H), 7.17-7.30 (m, 9H), 7.48-7.54 (m, 2H), 7.68 (s, 1H), 7.87 (s, 1H), 8.02 (brs, 1H).


Example 9c
N-((1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)-2-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)acetamide (Compound 9c)

Compound 9c (0.021 g, 17%) was obtained from ((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)glycine (0.070 g, 0.17 mmol) obtained in step 2 of example 14h and 1-((2S*,4R*)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.066 g, 0.17 mmol) obtained in step 2 of reference example 10 in the same manner as in step 3 of example 14f.


ESIMS, (M+H)+, m/z: 708.5. 1H-NMR (DMSO-d6, δ): 0.76-0.89 (m, 1H), 0.94-1.04 (m, 12H), 1.09-1.23 (m, 6H), 1.72-1.83 (m, 2H), 1.91-2.00 (m, 2H), 2.07-2.26 (m, 2H), 2.54-2.58 (m, 4H), 2.85-3.05 (m, 1H), 3.44-3.52 (m, 2H), 3.65 (d, J=5.38 Hz, 2H), 4.01-4.07 (m, 1H), 4.59-4.79 (m, 2H), 5.68 (d, J=8.0 Hz, 1H), 6.07 (t, J=5.26 Hz, 1H), 6.55 (d, J=8.8 Hz, 2H), 7.08 (d, J=8.8 Hz, 2H), 7.16-7.29 (m, 7H), 7.48-7.50 (m, 1H), 7.75 (d, J=7.83 Hz, 1H), 8.27 (s, 1H).


Example 9d
(1R,4R)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-(((1R,4R)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)-4-oxobut-2-yn-1-yl)cyclohexane-1-carboxamide (Compound 9d)
(Step 1)

tert-Butyl (4-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl))amino)-4-oxobut-2-yn-1-yl)carbamate (0.100 g, 31%) was obtained from commercially available 4-((tert-butoxycarbonyl)amino)but-2-ynoic acid (0.129 g, 0.65 mmol) and 1-((2S,4R)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.250 g, 0.65 mmol) obtained in reference example 11 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 497.


(Step 2)

4-Amino-N-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)but-2-ynamide trifluoroacetate (0.095 g, 93%) was obtained from tert-butyl (4-(((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)-4-oxobut-2-yn-1-yl)carbamate (0.100 g, 0.20 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M-TFA+H)+, m/z: 397.


(Step 3)

Compound 9d (0.030 g, 28%) was obtained from 4-amino-N-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)but-2-ynamide trifluoroacetate (0.089 g, 0.17 mmol) obtained in step 2 and (1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.05 g, 0.14 mmol) obtained in step 2 of reference example 11 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 723; 1H-NMR (DMSO-d6,δ) 0.74-0.87 (m, 2H), 0.88-1.02 (m, 12H), 1.03-1.27 (m, 6H), 1.30-1.44 (m, 2H), 1.69-1.81 (m, 6H), 1.86-2.18 (m, 8H), 2.52-2.62 (m, 4H), 3.39-3.58 (m, 3H), 3.98 (t, J=5.2 Hz, 2H), 4.56-4.69 (m, 2H), 7.19-7.28 (m, 6H), 7.46-7.49 (m, 2H), 8.27 (t, J=5.48 Hz, 1H), 8.51 (t, J=8.0 Hz, 1H).


Example 9h
1-(1-((1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carbonyl)azetidin-3-yl)-3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)urea (Compound 9h)
(Step 1)

tert-Butyl (1-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carbonyl)azetidin-3-yl)carbamate (0.2 g, 55%) was obtained from (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.25 g, 0.73 mmol) obtained in reference example 11 and tert-butyl azetidin-3-ylcarbamate (0.149 g, 0.87 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 499.38.


(Step 2)

1-((2S,4R)-4-(((1r,4R)-4-(3-Aminoazetidine-1-carbonyl)cyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate (0.18 g, 88%) was obtained from tert-butyl (1-((1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carbonyl)azetidin-3-yl)carbamate (0.2 g, 0.40 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 399.37.


(Step 3)

1-((2S,4R)-4-(((1r,4R)-4-(3-Aminoazetidine-1-carbonyl)cyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one trifluoroacetate (0.08 g, 0.16 mmol) obtained in step 2 was dissolved in DMF (5 mL), then CDI (0.038 g, 0.23 mmol), DMAP (0.047 g, 0.39 mmol) and N,N-diisopropylethylamine (0.13 mL, 0.78 mmol) were added to the solution, and the mixture was stirred at room temperature for 2 hours. 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.048 g, 0.16 mmol) obtained in reference example 7 was added to the reaction mixture, and the mixture was stirred at room temperature for 16 hours. Ice water was added to the reaction mixture, and the resulting solid was collected by filtration, and dried under reduced pressure. The obtained solid was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=90/10 to 10/90) to give compound 9h (0.054 g, 47%).


ESIMS, (M+H)+, m/z: 734.43. 1H-NMR (DMSO-d6, δ): 0.97-1.04 (m, 13H), 1.10-1.17 (m, 2H), 1.40-1.45 (m, 4H), 1.75-1.84 (m, 2H), 2.10-2.25 (m, 5H), 2.54-2.62 (m, 3H), 2.91 (brs, 1H), 3.65-3.68 (m, 1H), 3.98-4.08 (m, 3H), 4.40-4.440 (m, 3H), 4.70-4.73 (m, 2H), 5.75 (d, J=7.63 Hz, 1H), 6.52-6.61 (m, 3H), 7.08 (d, J=8.54 Hz, 2H), 7.15-7.17 (m, 2H), 7.24-7.30 (m, 2H), 7.39-7.41 (m, 4H), 8.09 (s, 1H), 9.03 (brs, 1H).


Example 10a
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidine-1-carbonyl)azetidine-3-carboxamide (Compound 10a)

Compound 10a (0.0185 g, 8%) was obtained from the crude product (0.080 g) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide trifluoroacetate obtained in step 1 of example 10e and 1-((2S,4R)-2-Methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.067 g, 0.17 mmol) obtained in reference example 13 in the same manner as in step 1 of example 14h.


ESIMS, (M+H)+, m/z: 720. 1H-NMR (DMSO-d6, δ): 0.79-0.89 (m, 1H), 0.94-1.04 (m, 12H), 1.13-1.24 (m, 4H), 1.85-1.87 (m, 3H), 2.07-2.28 (m, 2H), 2.54-2.62 (m, 3H), 2.77-2.84 (m, 3H), 3.39-3.50 (m, 2H), 3.66 (d, J=9.90 Hz, 2H), 3.98-4.00 (m, 4H), 4.08-4.17 (m, 1H), 4.59-4.77 (m, 2H), 5.91 (d, J=7.93 Hz, 1H), 6.60 (d, J=8.85 Hz, 2H), 7.14-7.32 (m, 9H), 7.47-7.52 (m, 1H), 9.64 (s, 1H).


Example 10b
4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)piperidine-1-carboxamide (Compound 10b)
(Step 1)

1-((2S*,4R*)-2-Methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (1.0 g, 2.68 mmol) obtained in step 2 of reference example 12 was dissolved in methanol (5 mL), then an aqueous ammonia solution (7 mol/L methanol solution, 5 mL) was added to the solution at 0° C., and the mixture was stirred at room temperature for 10 minutes. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% aqueous ammonium bicarbonate solution=18/82) to give 1-((2S*,4R*)-2-methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.55 g, 68%).


(Step 2)

1-((2S*,4R*)-2-Methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.2 g, 0.66 mmol) obtained in step 1 and prop-2-yn-1-amine (0.036 g, 0.66 mmol) were dissolved in THF (10 mL), then N,N-diisopropylethylamine (1.15 mL, 6.64 mmol) and DMAP (0.096 g, 0.79 mmol) were added to the solution, and the mixture was stirred at room temperature for 10 minutes. Triphosgene (0.098 g, 0.33 mmol) was added to the reaction mixture at 0° C., and the mixture was stirred at 50° C. for 24 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1° A) formic acid aqueous solution=40/60) to give 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)piperidine-1-carboxamide (0.12 g, 47%).


ESIMS, (M+H)+, m/z: 383.35.


(Step 3)

Compound 10b (0.058 g, 31%) was obtained from 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)piperidine-1-carboxamide (0.1 g, 0.26 mmol) obtained in step 2 and the crude product (0.087 g) of 1-((2S,4R)-4-((4-azidophenyl)amino)-2-methyl-3,4-di hydroquinolin-1(2H)-yl)propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 5j.


ESIMS, (M+H)+, m/z: 718.60. 1H-NMR (DMSO-d6, δ): 0.82-0.84 (m, 1H), 0.93-1.06 (m, 12H), 1.17-1.23 (m, 3H), 1.83-1.85 (m, 3H), 2.07-2.29 (m, 2H), 2.52-2.66 (m, 4H), 2.78 (t, J=12.04 Hz, 3H), 3.44-3.50 (m, 1H), 3.88-3.91 (m, 2H), 4.26-4.32 (m, 3H), 4.59-4.80 (m, 2H), 6.49 (d, J=7.63 Hz, 1H), 6.78 (d, J=9.06 Hz, 2H), 6.99 (t, J=5.60 Hz, 1H), 7.14-7.33 (m, 7H), 7.48-7.55 (m, 3H), 8.25 (s, 1H).


Example 10c
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidin-1-yl)-4-oxobut-2-yn-1-yl)benzamide (Compound 10c)
(Step 1)

A crude product (0.250 g) of tert-butyl (4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperid in-1-yl)-4-oxobut-2-yn-1-yl)carbamate was obtained from 1-((2S,4R)-2-methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.200 g, 0.53 mmol) obtained in step 2 of reference example 13 and commercially available 4-((tert-butoxycarbonyl)amino)but-2-ynoic acid (0.106 g, 0.53 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 483.


(Step 2)

A crude product of 4-amino-1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidin-1-yl)but-2-yn-1-one trifluoroacetate (0.170 g) was obtained from tert-butyl (4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidin-1-yl)-4-oxobut-2-yn-1-yl)carbamate (0.170 g, 0.35 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M-TFA+H)+, m/z: 383.


(Step 3)

Compound 10c (0.047 g, 33%) was obtained from the crude product (0.100 g) of 4-amino-1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidin-1-yl)but-2-yn-1-one trifluoroacetate obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.068 g, 0.20 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 703; 1H-NMR (DMSO-d6, δ) 0.79-0.91 (m, 1H), 0.93-1.06 (m, 12H), 1.20-1.25 (m, 3H), 1.83-1.98 (m, 3H), 2.06-2.17 (m, 1H), 2.19-2.28 (m, 1H), 2.54-2.69 (m, 4H), 2.82-2.95 (m, 2H), 3.18-3.27 (m, 1H), 3.42-3.50 (m, 1H), 4.04-4.14 (m, 2H), 4.17-4.21 (m, 2H), 4.21-4.33 (m, 1H), 4.58-4.67 (m, 1H), 4.69-4.79 (m, 1H), 6.64-6.68 (m, 3H), 7.09 (d, J=7.87 Hz, 1H), 7.13-7.36 (m, 6H), 7.45-7.53 (m, 1H), 7.65 (dd, J=8.8, 3.2 Hz, 2H), 8.56-8.62 (m, 1H).


Example 10d
4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)piperidine-1-carboxamide (Compound 10d)

(Step 1) 1-((2S,4R)-4-((4-(1-(2-Aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.160 g, 94%) was obtained from tert-butyl (2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)carbamate (0.180 g, 0.36 mmol) obtained in step 1 of example 6q in the same manner as in step 2 of example 1a.


(Step 2)

Compound 10d (0.023 g, 5%) was obtained from 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.290 g, 0.66 mmol) obtained in step 1 and 1-((2S*,4R*)-2-methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.332 g, 0.86 mmol) obtained in step 2 of reference example 12 in the same manner as in step 1 of example 14h.


ESIMS, (M+H)+, m/z: 731.63. 1H-NMR (DMSO-d6,δ): 0.93-1.08 (m, 13H), 1.11-1.32 (m, 5H), 1.79-1.94 (m, 2H), 2.04-2.15 (m, 1H), 2.20-2.30 (m, 1H), 2.53-2.67 (m, 4H), 2.70-2.80 (m, 2H), 2.92-3.02 (m, 1H), 3.36-3.44 (m, 2H), 3.88 (d, J=12.96 Hz, 2H), 4.08-4.20 (m, 3H), 4.59-4.79 (m, 2H), 6.03 (d, J=7.82 Hz, 1H), 6.62-6.67 (m, 3H), 7.16-7.41 (m, 9H), 7.47 (d, J=6.11 Hz, 1H), 7.70 (s, 1H), 7.87 (s, 1H).


Example 10e
N-(4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)piperidine-1-carbonyl)azetidine-3-carboxamide (Compound 10e)
(Step 1)

A crude product (0.250 g) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide trifluoroacetate was obtained from tert-butyl 3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)azetidine-1-carboxylate (0.290 g, 0.66 mmol) obtained in step 1 of example 6d in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 393.36.


(Step 2)

Compound 10e (0.011 g, 3%) was obtained from the crude product (0.250 g) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide trifluoroacetate obtained in step 1 and 1-((2S*,4R*)-2-methyl-4-(piperidin-4-ylamino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.248 g, 0.64 mmol) obtained in step 2 of reference example 12 in the same manner as in step 1 of example 14h.


ESIMS, (M+H)+, m/z: 720.47. 1H-NMR (DMSO-d6, δ): 0.78-0.88 (m, 1H), 0.92-1.08 (m, 12H), 1.12-1.27 (m, 3H), 1.79-2.04 (m, 3H), 2.09-2.38 (m, 2H), 2.52-2.62 (m, 4H), 2.80 (t, J=11.6 Hz, 3H), 3.38-3.52 (m, 2H), 3.68 (d, J=10.4 Hz, 2H), 3.96-4.04 (m, 4H), 4.09-4.15 (m, 1H), 4.59-4.68 (m, 2H), 5.91 (d, J=8.0 Hz, 1H), 6.59 (d, J=9.2 Hz, 2H), 7.15-7.19 (m, 2H), 7.23-7.32 (m, 7H), 7.50 (brs, 1H), 9.64 (s, 1H).


Example 10f
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-(((1R,3R)-3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclobutyl)amino)-4-oxobut-2-yn-1-yl)benzamide (Compound 10f)
(Step 1)

A crude product (0.097 g) of tert-butyl (4-(((1R,3r)-3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclobutyl)amino)-4-oxobut-2-yn-1-yl)carbamate was obtained from 1-((2S*,4R*)-4-(((1r,3R)-3-aminocyclobutyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.2 g, 0.56 mmol) obtained in step 2 of reference example 14 and 4-((tert-butoxycarbonyl)amino)but-2-ynoic acid (0.110 g, 0.56 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 469.40.


(Step 2)

A crude product (0.070 g) of 4-amino-N-((1R,3r)-3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclobutyl)but-2-ynamide trifluoroacetic acid was obtained from the crude product (0.090 g) of tert-butyl (4-(((1R,3r)-3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclobutyl)amino)-4-oxobut-2-yn-1-yl)carbamate obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 369.35.


(Step 3)

Compound 10f (0.021 g, total yield of 3 steps 21%) was obtained from the crude product (0.070 g) of 4-amino-N-((1R,3r)-3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclobutyl)but-2-ynamide trifluoroacetate obtained in step and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.049 g, 0.14 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 689.45. 1H-NMR (DMSO-d6, δ): 0.75-0.85 (m, 1H), 0.90-1.09 (m, 12H), 1.22 (td, J=12.28, 8.55 Hz, 2H), 2.03-2.31 (m, 7H), 2.54-2.69 (m, 4H), 3.44-3.57 (m, 1H), 4.14-4.33 (m, 4H), 4.52-4.79 (m, 2H), 6.62-6.68 (m, 3H), 7.09 (d, J=7.67 Hz, 1H), 7.14-7.32 (m, 6H), 7.45 (brs, 1H), 7.65 (d, J=8.77 Hz, 2H), 8.54 (t, J=5.48 Hz, 1H), 8.88 (d, J=6.4 Hz, 1H).


Example 10g
1-(4-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 10g)
(Step 1)

A crude product (0.30 g) of methyl 1-(4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoyl)azetidine-3-carboxylate was obtained from 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoic acid (0.25 g, 0.71 mmol) obtained in step 2 of reference example 15 and methyl azetidine-3-carboxylate hydrochloride (0.107 g, 0.71 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 450.40.


(Step 2)

1-(4-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoyl)azetidine-3-carboxylic acid (0.12 g, total yield of 2 steps 39%) was obtained from the crude product (0.30 g) of methyl 1-(4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoyl)azetidine-3-carboxylate obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 436.40.


(Step 3)

1-(4-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoyl)azetidine-3-carboxylic acid (0.1 g, 0.23 mmol) obtained in step 2 was dissolved in DMF (5 mL), then DCC (0.071 g, 0.34 mmol) and DMAP (0.084 g, 0.69 mmol) were added to the solution, and the mixture was stirred at room temperature for 15 minutes. 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.071 g, 0.23 mmol) obtained in reference example 7 was added to the reaction mixture, and the mixture was stirred at room temperature for 16 hours. Ice water was added to the reaction mixture, and the resulting solid was collected by filtration, and dried under reduced pressure. The obtained solid was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=55/45 to 10/90) to give compound 10 g (0.045 g, 27%).


ESIMS, (M+H)+, m/z: 727.45. 1H-NMR (DMSO-d6, δ): 0.86-0.89 (m, 1H), 0.91 (t, J=7.39 Hz, 3H), 0.98-1.04 (m, 9H), 1.14-1.16 (m, 1H), 2.06-2.15 (m, 1H), 2.19-2.28 (m, 1H), 2.47-2.49 (m, 1H), 2.53-2.64 (m, 3H), 2.65-2.70 (m, 1H), 3.34-3.37 (m, 1H), 3.48-3.53 (m, 1H), 3.94-3.97 (m, 2H), 4.10-4.20 (m, 3H), 4.37-4.46 (m, 2H), 4.60-4.76 (m, 2H), 5.92 (d, J=7.87 Hz, 1H), 6.60 (d, J=9.06 Hz, 2H), 7.14-7.16 (m, 2H), 7.23-7.33 (m, 7H), 7.51-7.63 (m, 5H), 9.72 (s, 1H).


Example 10h
4-((a2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)benzamide (Compound 10h)
(Step 1)

4-((a2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)-N-(prop-2-yn-1-yl)benzamide (0.18 g, 65%) was obtained from 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)benzoic acid (0.25 g, 0.71 mmol) obtained in step 2 of reference example 15 and prop-2-yn-1-amine (0.04 mL, 0.71 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 390.37.


(Step 2)

Compound 10h (0.065 g, 20%) was obtained from 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)-N-(prop-2-yn-1-yl)benzamide (0.174 g, 0.45 mmol) obtained in step 1 and the crude product (0.15 g) of 1-((2S,4R)-4-((4-azidophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 5j.


ESIMS, (M+H)+, m/z: 725.55. 1H-NMR (DMSO-d6, δ): 0.89-0.93 (m, 4H), 0.99-1.06 (m, 9H), 1.20-1.22 (m, 1H), 2.09-2.11 (m, 1H), 2.23-2.25 (m, 1H), 2.47-2.48 (m, 1H), 2.56-2.69 (m, 4H), 3.33-3.37 (m, 1H), 3.90-4.03 (m, 2H), 4.21-4.26 (m, 1H), 4.56-4.61 (m, 3H), 4.74-4.76 (m, 1H), 6.49 (d, J=7.87 Hz, 1H), 6.78 (d, J=9.06 Hz, 2H), 7.14-7.32 (m, 7H), 7.50-7.58 (m, 5H), 7.86 (d, J=8.34 Hz, 2H), 8.40 (s, 1H), 8.98 (t, J=5.60 Hz, 1H).


Example 10j
1-((2S,4R)-2-Methyl-4-((4-((((1-(6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)amino)-3,4-dihydroquinoline-1(2H)-yl)propan-1-one (Compound 10j)
(Step 1)

A crude product (0.160 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((prop-2-yn-1-ylamino)methyl)phenyl)carbamate was obtained from tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.150 g, 0.35 mmol) obtained in reference example 8 and prop-2-yn-1-amine (0.039 g, 0.71 mmol) in the same manner as in step 1 of example 7b.


ESIMS, (M+H)+, m/z: 462.


(Step 2)

1-((2S*,4R*)-4-((5-Azidopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.110 g, 68%) was obtained from 1-((2S*,4R*)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.150 g, 0.48 mmol) obtained in step 2 of reference example 16 in the same manner as in step 2 of example 3a.


ESIMS, (M+H)+, m/z: 337.


(Step 3)

tert-Butyl ((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((((1-(6-((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)carbamate (0.1 g, 42%) was obtained from the crude product (0.137 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((prop-2-yn-1-ylamino)methyl)phenyl)carbamate obtained in step 1 and 1-((2S*,4R*)-4-((5-azidopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.100 g, 0.30 mmol) obtained in step 2 in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 798.


(Step 4)

Compound 10j (0.026 g, 30%) was obtained from tert-butyl ((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((((1-(6-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)carbamate (0.1 g, 0.12 mmol) obtained in step 3 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 698; 1H-NMR (DMSO-d6, δ) 0.93-1.08 (m, 12H), 1.09-1.31 (m, 2H), 2.14-2.28 (m, 2H), 2.53-2.70 (m, 4H), 3.60 (s, 2H), 3.77 (s, 2H), 4.01-4.12 (m, 1H), 4.72-4.76 (m, 3H), 5.94 (d, J=7.87 Hz, 1H), 6.59 (d, J=8.58 Hz, 2H), 6.81 (d, J=9.06 Hz, 1H), 7.08 (d, J=8.34 Hz, 2H), 7.14-7.34 (m, 8H), 7.42 (d, J=8.34 Hz, 1H), 7.90 (dd, J=8.94, 2.74 Hz, 1H), 8.36-8.41 (m, 2H).


Example 10k
N1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-N5-(6-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)glutaramide (Compound 10k)

A crude product of compound 10k was obtained from 1-((2S,4R)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (50 mg, 0.161 mmol) obtained in reference example 17 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (80 mg, 0.193 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b. The crude product obtained was purified by reverse phase HPLC (0.05% aqueous ammonium bicarbonate solution/acetonitrile=6/4 to 5/5) to give compound 10k (48 mg, 41%).


ESI-MS, (M+H)+, m/z: 716. 1H-NMR (CDCl3, δ): 1.11-1.18 (m, 12H), 1.19-1.32 (m, 2H), 2.08-2.17 (m, 2H), 2.29-2.42 (m, 2H), 2.46-2.60 (m, 4H), 2.61-2.71 (m, 2H), 3.50 (d, J=5.4 Hz, 2H), 3.81 (d, J=7.2 Hz, 1H), 4.11-4.19 (m, 1H), 4.54-4.65 (m, 2H), 4.87-4.98 (m, 2H), 6.43 (d, J=9.1 Hz, 1H), 6.60 (d, J=9.1 Hz, 2H), 7.12-7.21 (m, 4H), 7.25-7.33 (m, 6H), 7.45 (s, 1H), 7.79-7.83 (m, 2H), 8.13 (d, J=2.3 Hz, 1H).


Example 101
N1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-N5-(5-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-2-yl)glutaramide (compound 101)
(Step 1)

1-((2S*,4R*)-2-Methyl-4-((6-nitropyridin-3-yl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (71.8 mg, 96%) was obtained from 1-((2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (47.8 mg, 0.219 mmol) obtained in step 3 of reference example 1 and 5-fluoro-2-nitropyridine (62.2 mg, 0.438 mmol) in the same manner as in step 1 of reference example 16.


ESIMS, (M−H)−, m/z: 339.


(Step 2)

1-((2S*,4R*)-4-((6-Aminopyridin-3-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (52.8 mg, 81%) was obtained from 1-((2S*,4R*)-2-methyl-4-((6-nitropyridin-3-yl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (71.8 mg, 0.211 mmol) obtained in step 1 in the same manner as in step 2 of reference example 16.


ESIMS, (M+H)+, m/z: 311.


(Step 3)

Compound 101 (4.1 mg, 5%) was obtained from 1-((2S*,4R*)-4-((6-aminopyridin-3-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (32.4 mg, 0.104 mmol) obtained in step 2 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (44.0 mg, 0.104 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 716; 1H-NMR (CDCl3, δ) 1.02-1.08 (m, 14H), 2.13 (t, J=6.8 Hz, 2H), 2.26-2.73 (m, 10H), 3.71-3.88 (m, 2H), 4.07-4.19 (m, 2H), 4.81-5.04 (m, 2H), 6.59 (d, J=8.8 Hz, 2H), 6.99 (dd, J=8.8, 2.8 Hz, 1H), 7.07-7.36 (m, 10H), 7.55 (s, 1H), 7.73 (d, J=2.8 Hz, 1H), 8.03 (d, J=8.8 Hz, 1H), 8.23 (brs, 1H).


Example 10m
1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)-N-(6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)piperidine-4-carboxamide (compound 10m)
(Step 1)

A crude product (0.130 g) of methyl 1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)piperidine-4-carboxylate was obtained from 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.1 g, 0.29 mmol) obtained in reference example 1 and methyl piperidine-4-carboxylate (0.042 g, 0.29 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 464.33.


(Step 2)

A crude product (0.080 g) of 1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)piperidine-4-carboxylic acid was obtained from the crude product (0.130 g) of methyl 1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)piperidine-4-carboxylate obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 450.29.


(Step 3)

Compound 10m (0.034 g, 26%) was obtained from the crude product (0.080 g) of 1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoyl)piperidine-4-carboxylic acid obtained in step 2 and 1-((2S*,4R*)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.055 g, 0.18 mmol) obtained in step 2 of reference example 16 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 742.60; 1H-NMR (DMSO-d6, δ): 0.99-1.06 (s, 12H), 1.17-1.22 (m, 2H), 1.51-1.61 (m, 2H), 1.80 (d, J=11.6 Hz, 2H), 2.14-2.31 (m, 2H), 2.52-2.62 (m, 5H), 2.88-2.99 (m, 2H), 4.05-4.25 (m, 3H), 4.69-4.75 (m, 3H), 6.49 (d, J=7.6 Hz, 1H), 6.59-6.67 (m, 3H), 6.76 (d, J=8.4 Hz, 1H), 7.13-7.30 (m, 10H), 7.67 (dd, J=8.8, 2.4 Hz, 1H), 8.08 (s, 1H), 9.65 (s, 1H).


Example 10n
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-((6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)amino)-4-oxobut-2-yn-1-yl)benzamide (Compound 10n)
(Step 1)

tert-Butyl (4-((6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)amino)-4-oxobut-2-yn-1-yl)carbamate (0.165 g, 58%) was obtained from 1-((2S*,4R*)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.18 g, 0.58 mmol) obtained in step 2 of reference example 16 and 4-((tert-butoxycarbonyl)amino)but-2-ynoic acid (0.08 g, 0.40 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 492.20.


(Step 2)

A crude product (0.15 g) of 4-amino-N-(6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)but-2-ynamide trifluoroacetate was obtained from tert-butyl (4-((6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)amino)-4-oxobut-2-yn-1-yl)carbamate (0.15 g, 0.30 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (MH)−, m/z: 390.17.


(Step 3)

Compound 10n (0.05 g, total yield of 2 steps 23%) was obtained from the crude product (0.15 g) of 4-amino-N-(6-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)but-2-ynamide trifluoroacetate obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.07 g, 0.20 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 712.43 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.06 (m, 12H), 1.16-1.26 (m, 2H), 2.15-2.30 (m, 2H), 2.52-2.65 (m, 4H), 4.23-4.32 (m, 3H), 4.69-4.75 (m, 3H), 6.63-6.69 (m, 4H), 7.09-7.20 (m, 5H), 7.24-7.32 (m, 4H), 7.67 (d, J=8.77 Hz, 3H), 8.12 (d, J=2.41 Hz, 1H), 8.60 (t, J=5.48 Hz, 1H), 10.47 (brs, 1H).


Example 100
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(3-((6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)amino)-3-oxopropyl)benzamide (Compound 100)

Compound 100 (10 mg, 31%) was obtained from the crude product (19 mg) of 3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propanoic acid obtained in step 2 of example 2f and 1-(2S*,4R*)-(4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (16 mg, 0.051 mmol) obtained in step 2 of reference example 16 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 702 (M+H)+: 1H-NMR (CDCl3, δ): 1.10-1.21 (m, 12H), 1.23-1.34 (m, 2H), 2.28-2.45 (m, 2H), 2.48-2.75 (m, 6H), 3.71-3.84 (m, 2H), 4.16-4.29 (m, 2H), 4.54-4.68 (m, 2H), 4.85-5.07 (m, 2H), 6.37-6.46 (m, 1H), 6.55-6.65 (m, 2H), 6.86-6.99 (m, 1H), 7.11-7.23 (m, 5H), 7.23-7.34 (m, 3H), 7.59-7.72 (m, 2H), 7.72-7.86 (m, 1H), 8.14-8.19 (m, 1H), 8.22-8.32 (m, 1H).


Example 10p
1-(4-((((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)piperidine-1-carbonyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 10p)
(Step 1)

tert-Butyl 3-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)azetidine-1-carboxylate (80 mg, 0.16 mmol) obtained in step 1 of example 6 was dissolved in ethyl acetate (0.8 mL), then 4 mol/L hydrochloric acid (0.61 mL, 2.4 mmol) was added to the solution, and the mixture was stirred at room temperature for 1 hour. A saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was extracted with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure to give a crude product (55 mg) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide.


ESI-MS m/z: 393 (M+H)+


(Step 2)

The crude product (51 mg) of N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide obtained in step 1 was dissolved in dichloromethane (1.3 mL), then triphosgene (19 mg, 0.064 mmol) and N,N-diisopropylethylamine (0.067 ml, 0.39 mmol) were added to the solution, and the mixture was stirred at 0° C. for 2 hours. The 1-((2S*,4R*)-2-methyl-4-((piperid in-4-ylmethyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.05 g, 0.129 mmol) obtained in step 2 of reference example 18 was added to the reaction mixture, and the mixture was further stirred at 0° C. for 2 hours. Water was added to the reaction mixture, and the mixture was extracted 3 times with chloroform. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform/methanol=19/1) to give compound 10p (38 mg, yield of 2 steps 50%).


ESI-MS m/z: 734 (M+H)+: 1H-NMR (CDCl3, δ): 1.00-1.19 (m, 12H), 1.19-1.37 (m, 2H), 1.74-2.07 (m, 3H), 2.21-2.43 (m, 4H), 2.43-2.90 (m, 10H), 3.29-3.45 (m, 2H), 3.76-4.01 (m, 3H), 4.10-4.33 (m, 4H), 4.70-5.03 (m, 2H), 6.57-6.68 (m, 2H), 6.94-6.98 (m, 1H), 7.08-7.31 (m, 6H), 7.31-7.38 (m, 2H), 7.41-7.48 (m, 1H), 7.48-7.52 (m, 1H).


Example 10q
N,N′-(Propane-1,3-diyl)bis(4-(((2S,4R)-6-fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide) (Compound 10q)

Compound 10q (0.065 g, 41%) was obtained from 4-((6-fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.1 g, 0.28 mmol) obtained in step 5 of reference example 19 and commercially available propane-1,3-diamine (0.0104 g, 0.14 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 751; 1H-NMR (DMSO-d6, δ) 0.99-1.05 (m, 12H), 1.16-1.24 (m, 2H), 1.70 (quin, J=6.74 Hz, 2H), 2.21-2.27 (m, 2H), 2.54-2.64 (m, 4H), 3.24-3.27 (m, 4H), 4.27-4.33 (m, 2H), 4.73-4.74 (m, 2H), 6.56 (d, J=7.89 Hz, 2H), 6.69 (d, J=8.77 Hz, 4H), 6.83 (dd, J=9.10, 2.74 Hz, 2H), 7.07-7.13 (m, 2H), 7.38 (dd, J=8.55, 5.04 Hz, 2H), 7.66 (d, J=8.55 Hz, 4H), 8.10 (t, J=5.8 Hz, 2H).


Example 10r
N,N′-(Ethane-1,2-diyl)bis(4-(((2S,4R)-6-fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide) (Compound 10r)

Compound 10r (0.062 g, 40%) was obtained from 4-((6-fluoro-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.1 g, 0.28 mmol) obtained in step 5 of reference example 19 and commercially available ethane-1,2-diamine (0.0084 g, 0.14 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 737: 1H-NMR (DMSO-d6, δ) 0.99-1.05 (m, 12H), 1.15-1.24 (m, 2H), 2.20-2.26 (m, 2H), 2.54-2.64 (m, 4H), 3.36-3.37 (m, 4H), 4.27-4.33 (m, 2H), 4.73-4.74 (m, 2H), 6.56 (d, J=7.67 Hz, 2H), 6.68 (d, J=8.77 Hz, 4H), 6.82 (dd, J=9.10, 2.74 Hz, 2H), 7.10 (td, J=8.60, 2.96 Hz, 2H), 7.38 (dd, J=8.77, 5.04 Hz, 2H), 7.65 (d, J=8.77 Hz, 4H), 8.20 (brs, 2H).


Example 10s
N1-(4-(((2S*,4R*)-7-(3-Aminopropyl)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 10s)

Compound 10s (0.054 g, 37%) was obtained from N1-(4-(((2S*,4R*)-7-((E)-3-aminoprop-1-en-1-yl)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (0.150 g, 0.19 mmol) obtained in step 2 of example 10t in the same manner as in step 2 of example 1b.


ESI-MS m/z: 772.62 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.04 (m, 12H), 1.09-1.19 (m, 2H), 1.63 (dq, 3=14.63, 7.25 Hz, 2H), 1.84-1.89 (m, 2H), 2.21-2.29 (m, 6H), 2.53-2.60 (m, 8H), 2.89-2.97 (m, 1H), 4.05-4.14 (m, 2H), 4.68-4.73 (m, 2H), 5.81 (dd, J=17.98, 7.89 Hz, 2H), 6.58 (dd, J=8.77, 4.17 Hz, 4H), 6.97-7.17 (m, 5H), 7.23-7.31 (m, 6H), 9.51 (s, 2H).


Example 10t
N1-(4-(((2S*,4R*)-7-((E)-3-Aminoprop-1-en-1-yl)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 10t)
(Step 1)

tert-Butyl ((E)-3-((2S*,4R*)-2-methyl-4-((4-(5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanamide)phenyl)amino)-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)allyl)carbamate (0.190 g, 77%) was obtained from tert-butyl ((E)-3-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)allyl)carbamate (0.131 g, 0.28 mmol) obtained in step 6 of reference example 20 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.120 g, 0.28 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 870.90.


(Step 2)

Compound 10t (0.036 g, 21%) was obtained from tert-butyl ((E)-3-((2S*,4R*)-2-methyl-4-((4-(5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanamide)phenyl)amino)-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)allyl)carbamate (0.190 g, 0.22 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 770.64 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.06 (m, 12H), 1.11-1.20 (m, 2H), 1.83-1.89 (m, 2H), 2.20-2.33 (m, 6H), 2.53-2.67 (m, 4H), 3.57-3.63 (m, 2H), 4.09-4.15 (m, 2H), 4.64-4.78 (m, 2H), 6.27 (dt, 3=15.89, 6.52 Hz, 2H), 6.59 (d, J=7.89 Hz, 4H), 6.70-6.74 (m, 1H), 7.17 (d, J=3.51 Hz, 3H), 7.23-7.32 (m, 7H), 7.39 (s, 1H), 8.02 (brs, 3H), 9.53 (s, 2H).


Example 10u
N1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-N5-(4-(((2S*,4R*)-2-methyl-1-propionyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (compound 10u)
(Step 1)

tert-Butyl 4-((2S*,4R*)-2-methyl-4-((4-(5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanamide)phenyl)amino)-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)-3,6-dihydropyridine-1(2H)-carboxylate (0.080 g, 36%) was obtained from tert-butyl 4-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)-3,6-dihydropyridine-1(2H)-carboxylate (0.121 g, 0.25 mmol) obtained in step 2 of reference example 21 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.105 g, 0.25 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 896.76.


(Step 2)

Compound 10u (0.036 g, 21%) was obtained from tert-butyl 4-((2S*,4R*)-2-methyl-4-((4-(5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanamide)phenyl)amino)-1-propionyl-1,2,3,4-tetrahydroquinolin-7-yl)-3,6-dihydropyridine-1(2H)-carboxylate (0.08 g, 0.09 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 796.57 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.05 (m, 12H), 1.10-1.19 (m, 2H), 1.83-1.87 (m, 2H), 2.22-2.29 (m, 6H), 233-2.37 (m, 1H), 2.51-2.62 (m, 6H), 2.94 (t, J=5.59 Hz, 2H), 3.37 (d, J=18.85 Hz, 2H), 4.08-4.13 (m, 2H), 4.68-4.78 (m, 2H), 5.81-5.84 (m, 2H), 6.20 (brs, 1H), 6.57-6.59 (m, 4H), 7.10 (d, J=7.89 Hz, 1H), 7.16 (d, J=3.51 Hz, 2H), 7.21-7.31 (m, 8H), 9.50 (s, 2H).


Example 12a
1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)-N-((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1,3,4-oxadiazol-2-yl)methyl)piperidine-4-carboxamide (Compound 12a)
(Step 1)

tert-Butyl {[5-(4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)-1,3,4-oxadiazol-2-yl]methyl}carbamate (0.2 g, 0.41 mmol) obtained in step 2 of example 3c was dissolved in ethyl acetate (3 mL), then hydrogen chloride/ethyl acetate solution (4 mol/L, 2 mL, 8 mmol) was added to the solution, and the mixture was stirred at room temperature for 2 hours. The resulting solid was collected by filtration and washed with ethyl acetate to give 1-[(2S,4R)-4-({4-[5-(aminomethyl)-1,3,4-oxadiazol-2-yl]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one hydrochloride (0.150 g, 86%).


ESIMS, (M+H)+, m/z: 392.35.


(Step 2)

Compound 12a (0.021 g, 12%) was obtained from 1-[(2S,4R)-4-({4-[5-(aminomethyl)-1,3,4-oxadiazol-2-yl]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one hydrochloride (0.113 g, 0.27 mmol) obtained in step 1 and 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylic acid (0.08 g, 0.24 mmol) obtained in reference example 24 in the same manner as in step 3 of example 1b.


ESI-MS, (M+H)+, m/z: 704.35. 1H-NMR (DMSO-d6, δ): 1.01-1.06 (m, 6H), 1.22-1.27 (m, 1H), 1.62-1.71 (m, 4H), 1.86-2.00 (m, 2H), 2.18-2.28 (m, 5H), 2.38 (s, 3H), 2.57-2.64 (m, 2H), 2.80-2.88 (m, 2H), 3.35-3.46 (m, 2H), 4.29-4.34 (m, 1H), 4.50 (d, J=5.80 Hz, 2H), 4.72-4.75 (m, 1H), 6.61-6.80 (m, 5H), 6.88 (d, J=7.63 Hz, 1H), 7.10 (d, J=7.63 Hz, 1H), 7.18 (td, J=7.48, 1.22 Hz, 1H), 7.26-7.33 (m, 2H), 7.67 (d, J=8.85 Hz, 2H), 8.56 (brs, 1H), 9.53 (brs, 1H).


Example 12b
1-(1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carbonyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 12b)

Compound 12b (0.046 g, 21%) was obtained from the crude product (0.168 g) of N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide trifluoroacetate obtained in step 1 of example 10e and 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylic acid (0.1 g, 0.30 mmol) obtained in step 3 of reference example 24 in the same manner as in step 1 of example 1a.


ESI-MS, (M+H)+, m/z: 705.39. 1H-NMR (DMSO-d6, δ): 0.98-1.04 (m, 6H), 1.13-1.16 (m, 1H), 1.52-1.58 (m, 4H), 1.92-1.97 (m, 2H), 2.20-2.26 (m, 5H), 2.38 (s, 3H), 2.56-2.62 (m, 2H), 2.82-2.85 (m, 2H), 3.41 (s, 3H), 3.87 (dd, J=9.54, 5.62 Hz, 1H), 3.94-3.99 (m, 1H), 4.08-4.15 (m, 1H), 4.20-4.23 (m, 1H), 4.29 (t, J=8.07 Hz, 1H), 4.72-4.73 (m, 1H), 5.93 (d, J=7.83 Hz, 1H), 6.58-6.61 (m, 3H), 6.68 (s, 1H), 6.74 (s, 1H), 7.15-7.16 (m, 2H), 7.25-7.32 (m, 4H), 9.51 (brs, 1H), 9.71 (s, 1H).


Example 12c

N1-(1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidin-4-yl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 12c)


Compound 12c (0.036 g, 21%) was obtained from 3-((4-aminopiperidin-1-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol dihydrochloride (0.079 g, 0.24 mmol) obtained in step 2 of reference example 25 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.1 g, 0.24 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESI-MS, (M+H)+, m/z: 707.41. 1H-NMR (DMSO-d6,δ): 0.98-1.04 (m, 6H), 1.13-1.15 (m, 1H), 1.35-1.38 (m, 2H), 1.69-1.78 (m, 4H), 1.99 (t, J=10.46 Hz, 2H), 2.08 (t, J=7.41 Hz, 2H), 2.18-2.23 (m, 6H), 2.38 (s, 3H), 2.53-2.63 (m, 2H), 2.73-2.80 (m, 2H), 3.40 (s, 2H), 3.49-3.58 (m, 1H), 4.06-4.14 (m, 1H), 4.67-4.77 (m, 1H), 5.85 (d, J=7.85 Hz, 1H), 6.56-6.61 (m, 3H), 6.69 (d, J=16.80 Hz, 2H), 7.16 (dd, J=4.90, 1.20 Hz, 2H), 7.23-7.30 (m, 4H), 7.72 (d, J=7.63 Hz, 1H), 9.22-9.80 (m, 2H).


Example 12d
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-4-(3-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)propyl)piperidine-1-carboxamide (Compound 12d)
(Step 1)

tert-Butyl 4-(3-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)propyl)piperidine-1-carboxylate (0.34 g, 73%) was obtained from N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrobenzenesulfonamide (0.3 g, 0.74 mmol) obtained in step 1 of example 12e and tert-butyl 4-(3-bromopropyl)piperidine-1-carboxylate (0.339 g, 1.11 mmol) in the same manner as in step 2 of example 12e.


ESIMS, (M+H)+, m/z: 629.70.


(Step 2)

N-((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitro-N-(3-(piperidin-4-yl))propyl)benzenesulfonamide hydrochloride (0.25 g, 82%) was obtained from tert-butyl 4-(3-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)propyl)piperidine-1-carboxylate (0.34 g, 0.54 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 529.36.


(Step 3)

N-((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitro-N-(3-(piperidin-4-yl))propyl)benzenesulfonamide hydrochloride (0.24 g, 0.42 mmol) obtained in step 2 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.131 g, 0.42 mmol) obtained in reference example 7 were dissolved in THF (5 mL), then N,N-diisopropylethylamine (0.37 mL, 2.12 mmol) and DMAP (0.129 g, 1.06 mmol) were added to the solution, and the mixture was stirred at room temperature for 10 minutes. Triphosgene (0.083 g, 0.42 mmol) was added to the reaction mixture at 0° C., and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=1/1) to give a crude product (0.2 g) of 4-(3-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)propyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperidine-1-carboxamide.


ESIMS, (M+H)+, m/z: 864.39.


(Step 4)

Compound 12d (0.028 g, total yield of 2 steps 10%) was obtained from the crude product (0.2 g) of 4-(3-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)propyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)piperidine-1-carboxamide obtained in step 3 in the same manner as in step 5 of example 12e.


ESI-MS, (M+H)+, m/z: 679.51. 1H-NMR (DMSO-d6,δ): 0.81-0.83 (m, 1H), 0.93-1.06 (m, 14H), 1.09-1.18 (m, 1H), 1.27-1.34 (m, 2H), 1.37-1.47 (m, 1H), 1.48-1.58 (m, 2H), 1.61-1.70 (m, 2H), 1.85-2.01 (m, 1H), 2.07-2.17 (m, 1H), 2.20-2.29 (m, 1H), 2.54-2.64 (m, 5H), 2.65-2.76 (m, 3H), 3.24-3.29 (m, 1H), 4.08-4.09 (m, 3H), 4.59-4.66 (m, 1H), 4.68-4.77 (m, 1H), 5.72 (d, J=7.63 Hz, 1H), 6.55 (d, J=8.85 Hz, 2H), 7.10 (d, J=8.85 Hz, 2H), 7.13-7.29 (m, 7H), 7.44-7.47 (m, 1H), 8.05 (s, 1H).


Example 12e
1-((2S*,4R*)-2-Methyl-4-((2-(2-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methoxy)ethoxy)ethyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 12e)
(Step 1)

1-((2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.5 g, 2.29 mmol) obtained in step 3 of reference example 1 was dissolved in pyridine (10 mL), then 2-nitrobenzenesulfonyl chloride (0.609 g, 2.75 mmol) was added to the solution, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% formic acid aqueous solution=10/90) to give N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrobenzenesulfonamide (0.25 g, 27%).


ESIMS, (M+H)+, m/z: 404.19.


(Step 2)

N-((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrobenzenesulfonamide (0.5 g, 1.24 mmol) obtained in step 1 was dissolved in DMF (5 mL), then potassium carbonate (0.513 g, 3.72 mmol) and 2-(2-bromoethoxy)ethan-1-ol (0.41 mL, 3.72 mmol) were added to the solution, and the mixture was stirred at 80° C. for 16 hours. The reaction mixture was diluted with ice water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1° A) formic acid aqueous solution=20/80) to give N-(2-(2-hydroxyethoxy)ethyl)-N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrobenzenesulfonamide (0.25 g, 41%).


ESIMS, (M+H)+, m/z: 492.29.


(Step 3)

N-(2-(2-Hydroxyethoxy)ethyl)-N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrobenzenesulfonamide (0.18 g, 0.37 mmol) obtained in step 2 was dissolved in 1,4-dioxane (3 mL), then propargyl bromide (0.218 g, 1.83 mmol), 40% sodium hydroxide aqueous solution (3.0 mL) and tetrabutylammonium hydrogensulfate (0.024 g, 0.07 mmol) were added to the solution at 10° C., and the mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered through Celite, and the filtrate was washed with ethyl acetate. Citric acid was added to the aqueous layer, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1° A) formic acid aqueous solution=20/80) to give N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitro-N-(2-(2-(prop-2-yn-1-yloxy)ethoxy)ethyl)benzenesulfonamide (0.15 g, 77%).


ESIMS, (M+H)+, m/z: 530.23.


(Step 4)

A crude product (0.15 g) of N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-N-(2-(2-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methoxy)ethoxy)ethyl)-2-nitrobenzenesulfonamide was obtained from N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitro-N-(2-(2-(prop-2-yn-1-yloxy)ethoxy)ethyl)benzenesulfonamide (0.15 g, 0.28 mmol) obtained in step 3 and the crude product (0.094 g) of 1-((2S,4R)-4-((4-azidophenyl)amino)-2-methyl-3,4-di hydroquinolin-1(2H)-yl)propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 5j.


ESIMS, (M+H)+, m/z: 865.36.


(Step 5)

The crude product (0.15 g) of N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-N-(2-(2-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methoxy)ethoxy)ethyl)-2-nitrobenzenesulfonamide obtained in step 4 was dissolved in DMF (3 mL), then potassium carbonate (0.047 g, 0.35 mmol) and benzenethiol (0.022 g, 0.21 mmol) were added to the solution, and the mixture was stirred at room temperature for 3 hours. The reaction mixture was diluted with ice water and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L ammonium bicarbonate/acetonitrile=75/25 to 30/70) to give compound 12e (0.035 g, yield of 2 steps 18%).


ESIMS, (M+H)+, m/z: 680.41. 1H-NMR (DMSO-d6,δ): 0.45-0.66 (m, 1H), 0.91-1.07 (m, 12H), 1.18-1.26 (m, 1H), 2.05-2.15 (m, 2H), 2.20-2.30 (m, 1H), 2.48-2.49 (m, 1H), 2.57-2.64 (m, 4H), 2.79-2.80 (m, 1H), 2.86-2.88 (m, 1H), 3.54-3.64 (m, 6H), 4.21-4.32 (m, 1H), 4.60 (s, 3H), 4.71-4.80 (m, 1H), 6.50 (d, J=7.87 Hz, 1H), 6.78 (d, J=8.82 Hz, 2H), 7.14-7.21 (m, 5H), 7.26-7.33 (m, 2H), 7.42-7.44 (m, 1H), 7.53 (d, J=9.06 Hz, 2H), 8.52 (s, 1H).


Example 12f
5-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)pentane amide (Compound 12f)
(Step 1)

Methyl 5-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)pentanoate (0.25 g, 65%) was obtained from N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrobenzenesulfonamide (0.3 g, 0.74 mmol) obtained in step 1 of example 12e and 5-bromopentanoate (0.21 mL, 1.49 mmol) in the same manner as in step 2 of example 12e.


ESIMS, (M+H)+, m/z: 518.31.


(Step 2)

5-((N-((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)pentanoic acid (0.2 g, 82%) was obtained from methyl 5-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)pentanoate (0.25 g, 0.48 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 504.31.


(Step 3)

5-((N-((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)-N-(prop-2-yn-1-yl)pentanamide (0.18 g, 83%) was obtained from 5-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)pentanoic acid (0.2 g, 0.40 mmol) obtained in step 2 and propargylamine (0.03 mL, 0.60 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 541.24.


(Step 4)

5-((N-((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)pentanamide (0.25 g, 86%) was obtained from 5-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)-N-(prop-2-yn-1-yl)pentanamide (0.18 g, 0.33 mmol) obtained in step 3 and the crude product (0.111 g, 0.33 mmol) of 1-((2S,4R)-4-((4-azidophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 5j.


ESIMS, (M+H)+, m/z: 876.45.


(Step 5)

Compound 12f (0.060 g, 30%) was obtained from 5-((N-((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)-2-nitrophenyl)sulfonamide)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)pentanamide (0.25 g, 0.30 mmol) obtained in step 4 in the same manner as in step 5 of example 12e.


ESIMS, (M+H)+, m/z: 691.43. 1H-NMR (DMSO-d6, δ): 0.79-0.81 (m, 1H), 0.92-1.06 (m, 12H), 1.20-1.22 (m, 1H), 1.44-1.52 (m, 2H), 1.57-1.63 (m, 2H), 1.82-1.89 (m, 1H), 2.09-2.17 (m, 3H), 2.21-2.29 (m, 1H), 2.48-2.49 (m, 1H), 2.56-2.65 (m, 4H), 2.66-2.74 (m, 1H), 3.25-3.29 (m, 1H), 4.23-4.27 (m, 1H), 4.35 (d, J=5.49 Hz, 2H), 4.56-4.64 (m, 1H), 4.71-4.79 (m, 1H), 6.49 (d, J=7.93 Hz, 1H), 6.77 (d, J=8.85 Hz, 2H), 7.14-7.22 (m, 5H), 7.26-7.32 (m, 2H), 7.42-7.43 (m, 1H), 7.53 (d, J=8.85 Hz, 2H), 8.30-8.32 (m, 2H).


Example 12g
9-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)nonanamide (Compound 12g)
(Step 1)

1-((2S*,4R*)-4-Amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.25 g, 1.15 mmol) obtained in step 3 of reference example 1 was dissolved in DMF (4 mL), then potassium carbonate (0.316 g, 2.29 mmol) and ethyl 9-bromononanoate (0.302 g, 1.15 mmol) were added, and the mixture was stirred at 100° C. for 16 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=80/20) to give ethyl 9-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)nonanoate (0.3 g, 65%).


ESIMS, (M+H)+, m/z: 403.36.


(Step 2)

9-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)nonanoic acid (0.17 g, 73%) was obtained from ethyl 9-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)nonanoate (0.25 g, 0.62 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 375.36.


(Step 3)

Compound 12g (0.063 g, 25%) was obtained from 9-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)nonanoic acid (0.14 g, 0.37 mmol) obtained in step 2 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.115 g, 0.37 mmol) obtained in step 3 of reference example 7 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 666.52. 1H-NMR (DMSO-d6, δ): 0.83-0.90 (m, 1H), 0.92-1.04 (m, 12H), 1.13-1.16 (m, 1H), 1.30-1.35 (m, 8H), 1.53-1.58 (m, 4H), 2.13-2.23 (m, 4H), 2.51-2.67 (m, 5H), 3.32-3.38 (m, 1H), 4.10-4.15 (m, 1H), 4.64-4.71 (m, 2H), 5.85 (d, J=7.87 Hz, 1H), 6.57 (d, J=8.82 Hz, 2H), 7.16 (d, J=3.81 Hz, 2H), 7.23-7.30 (m, 7H), 7.42-7.44 (m, 1H), 9.47 (s, 1H).


Example 12h
8-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)octanamide (Compound 12h)
(Step 1)

1-((2S*,4R*)-4-Amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.450 g, 2.06 mmol) obtained in step 3 of reference example 1 was dissolved in DMF (3 mL), then methyl 8-bromooctanoate (0.733 g, 3.09 mmol) and potassium carbonate (0.854 g, 6.19 mmol) were added to the solution, and the mixture was stirred at 100° C. for 16 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (petroleum ether/ethyl acetate=85/15) to give methyl 8-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)octanoate (0.234 g, 30%).


ESIMS, (M+H)+, m/z: 375.29.


(Step 2)

A crude product (0.135 g) of methyl 8-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)octanoate was obtained from methyl 8-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)octanoate (0.234 g, 0.62 mmol) obtained in step 1 in the same manner as in step 1 of example 3d.


ESIMS, (M+H)+, m/z: 475.34.


(Step 3)

A crude product (0.140 g) of 8-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)octanoic acid was obtained from the crude product (0.150 g) of methyl 8-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)octanoate obtained in step 2 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 461.38.


(Step 4)

A crude product (0.150 g) of tert-butyl ((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(8-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-8-oxooctyl)carbamate was obtained from the crude product (0.150 g) of 8-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)octanoic acid obtained in step 3 and 1-((2S,4R)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.087 g, 0.28 mmol) obtained in reference example 7 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 752.65.


(Step 5)

Compound 12h (0.030 g, total yield of 4 steps 8.5%) was obtained from the crude product (0.130 g) of tert-butyl ((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(8-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-8-oxooctyl)carbamate obtained in step 4 in the same manner as in step 2 of example 1a.


ESI-MS m/z: 652.52 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.79-0.84 (m, 1H), 0.92-1.04 (m, 12H), 1.13-1.18 (m, 1H), 1.25-1.40 (m, 6H), 1.42-1.61 (m, 4H), 2.11-2.26 (m, 4H), 2.44-2.49 (m, 1H), 2.53-2.63 (m, 4H), 2.68-2.72 (m, 1H), 3.28 (dd, J=12.28, 3.73 Hz, 2H), 4.08-4.12 (m, 1H), 4.58-4.77 (m, 2H), 5.86 (d, J=7.89 Hz, 1H), 6.57 (d, J=8.99 Hz, 2H), 7.16 (d, J=3.95 Hz, 2H), 7.22-7.30 (m, 7H), 7.44-7.47 (m, 1H), 9.48 (s, 1H).


Example 12i
4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)butanamide (Compound 12i)
(Step 1)

Methyl 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)butanoate (273 mg, 62%) was obtained from 1-((2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (300 mg, 1.374 mmol) obtained in step 3 of reference example 1 and methyl 4-bromobutanoate (0.207 mL, 1.649 mmol) in the same manner as in step 1 of reference example 15.


ESIMS, (M+H)+, m/z: 319.


(Step 2)

Methyl 4-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)butanoate (70.5 mg, 54%) was obtained from Methyl 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)butanoate (100 mg, 0.314 mmol) obtained in step 1 in the same manner as in step 1 of reference example 8.


ESIMS, (M+H)+, m/z: 419.


(Step 3)

Methyl 4-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)butanoate (180 mg, 0.430 mmol) obtained in step 2 was dissolved in THF (2 mL), then potassium trimethylsilanolate (110 mg, 0.860 mmol) was added to the solution, and the mixture was stirred at room temperature for 17.5 hours. The reaction mixture was concentrated under reduced pressure to give a crude product (263 mg) of 4-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)butyric acid.


ESIMS, (M+H)+, m/z: 405.


(Step 4)

tert-Butyl ((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)amino)-4-oxobutyl)carbamate (44.5 mg, 79%) was obtained from the crude product (29.0 mg) of 4-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)butyric acid obtained in step 3 and 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (31.8 mg, 0.079 mmol) obtained in step 2 of example 6q in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 790.


(Step 5)

Compound 12i (25.5 mg, 66%) was obtained from tert-butyl ((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)amino)-4-oxobutyl)carbamate (44.5 mg, 0.056 mmol) obtained in step 4 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 690; 1H-NMR (CDCl3, δ) 0.82-0.96 (m, 2H), 1.04-1.12 (m, 6H), 1.15-1.18 (m, 6H), 1.22-1.36 (m, 1H), 1.84-1.93 (m, 2H), 2.18-2.92 (m, 10H), 3.38 (dd, J=12.0, 4.0 Hz, 1H), 3.74-3.81 (m, 2H), 3.84-3.98 (m, 1H), 4.18-4.33 (m, 3H), 4.72-5.03 (m, 2H), 6.49-6.57 (m, 1H), 6.64 (d, J=8.8 Hz, 2H), 7.07-7.33 (m, 9H), 7.37-7.43 (m, 1H), 7.53 (s, 1H), 7.68 (s, 1H).


Example 12j
5-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1,3,4-oxadiazol-2-yl)methyl)pentane amide (Compound 12j)
(Step 1)

Methyl 5-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pentanoate (273 mg, 61%) was obtained from 1-((2S*,4R*)-4-amino-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (300 mg, 1.374 mmol) obtained in step 3 of reference example 1 and methyl 5-bromopentanoate (0.288 mL, 2.020 mmol) in the same manner as in step 1 of example 12i.


ESIMS, (M+H)+, m/z: 333.


(Step 2)

Methyl 5-((tert-butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pentanoate (33.4 mg, 61%) was obtained from methyl 5-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pentanoate (42.3 mg, 0.127 mmol) obtained in step 1 in the same manner as in step 2 of example 12i.


ESIMS, (M+H)+, m/z: 433.


(Step 3)

5-((tert-Butoxycarbonyl)((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pentanoate (20.6 mg, 0.048 mmol) obtained in step 2 was dissolved in THF (0.4 mL), then potassium trimethylsilanolate (110 mg, 0.860 mmol) was added to the solution, and the mixture was stirred at room temperature for 21 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was dissolved in DMF (0.5 mL), then N,N-diisopropylethylamine (0.042 mL, 0.240 mmol), COMU (30.8 mg, 0.072 mmol) and 1-((2S,4R)-4-((4-(5-(aminomethyl)-1,3,4-oxadiazol-2-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (18.8 mg, 0.048 mmol) obtained in step 3 of example 5g were added to the solution, and the mixture was stirred at room temperature for 17 hours. The reaction mixture was neutralized with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with chloroform. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. Compound 12j (9.8 mg, 30%) was obtained from the obtained residue in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 692; 1H-NMR (CDCl3, δ) 0.99-1.45 (m, 16H), 1.76-1.92 (m, 2H), 2.18-3.04 (m, 11H), 3.42 (dd, J=12.4, 4.0 Hz, 1H), 4.22-4.43 (m, 2H), 4.73 (d, J=5.6 Hz, 2H), 4.77-5.05 (m, 2H), 6.51-6.60 (m, 1H), 6.67 (d, J=9.2 Hz, 2H), 7.06-7.13 (m, 1H), 7.16-7.35 (m, 6H), 7.39-7.47 (m, 1H), 7.84 (d, J=9.2 Hz, 2H).


Example 13a
2-(Dimethylamino)ethyl 2-((S)-2,3,9-trimethyl-4-(4-((2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thio)ethyl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 13a)

Compound 13a (0.038 g, 26%) was obtained from 1-[(2S,4R)-4-({4-[(2-aminoethyl)thio]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one hydrochloride (0.070 g, 0.17 mmol) obtained in step 2 of example 4f and (S)-4-(6-(2-(2-(dimethylamino)ethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.083 g, 0.17 mmol) obtained in reference example 26 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 833.51. 1H-NMR (DMSO-d6, δ): 0.98-1.05 (m, 6H), 1.13-1.19 (m, 1H), 1.58 (s, 3H), 2.15 (s, 6H), 2.18-2.28 (m, 1H), 2.41 (s, 3H), 2.48-2.49 (m, 2H), 2.54-2.65 (m, 5H), 2.86-2.93 (m, 2H), 3.38-3.46 (m, 4H), 4.09-4.20 (m, 3H), 4.48-4.55 (m, 1H), 4.67-4.78 (m, 1H), 6.26 (d, J=7.63 Hz, 1H), 6.63 (d, J=8.82 Hz, 2H), 7.12-7.31 (m, 6H), 7.48 (d, J=8.34 Hz, 2H), 7.84 (d, J=8.58 Hz, 2H), 8.69 (t, J=5.6 Hz, 1H).


Example 13b
2-(Dimethylamino)ethyl 2-((S)-2,3,9-trimethyl-4-(4-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)azetidine-1-carbonyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 13b)
(Step 1)

A crude product (0.070 g) of 2-(dimethylamino)ethyl (S)-2-(4-(4-(3-((tert-butoxycarbonyl)amino)azetidine-1-carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate was obtained from (S)-4-(6-(2-(2-(dimethylamino)ethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.1 g, 0.21 mmol) obtained in reference example 26 and tert-butyl azetidin-3-ylcarbamate hydrochloride (0.043 g, 0.21 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 636.43.


(Step 2)

A crude product (0.06 g) of 2-(dimethylamino)ethyl (S)-2-(4-(4-(3-aminoazetidine-1-carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate trifluoroacetate was obtained from the crude product (0.070 g) of 2-(dimethylamino)ethyl (S)-2-(4-(4-(3-((tert-butoxycarbonyl)amino)azetidine-1-carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 536.42.


(Step 3)

Compound 13b (0.027 g, total yield of 3 steps 15%) was obtained from the crude product (0.06 g) of 2-(dimethylamino)ethyl (S)-2-(4-(4-(3-aminoazetidine-1-carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate trifluoroacetate obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.031 g, 0.09 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 856.3. 1H-NMR (DMSO-d6, δ): 1.00 (t, J=7.32 Hz, 3H), 1.05 (d, J=6.41 Hz, 3H), 1.20-1.24 (m, 2H), 1.61 (s, 3H), 2.14 (s, 6H), 2.15-2.30 (m, 1H), 2.42 (s, 3H), 2.56-2.64 (m, 6H), 3.36-3.51 (m, 2H), 4.03-4.11 (m, 1H), 4.13-4.21 (m, 3H), 4.24-4.35 (m, 2H), 4.47-4.53 (m, 1H), 4.54-4.61 (m, 1H), 4.67-4.81 (m, 2H), 6.62-6.67 (m, 3H), 7.08 (d, J=7.5 Hz, 1H), 7.16 (t, J=7.48 Hz, 1H), 7.25-7.32 (m, 2H), 7.50 (d, J=8.24 Hz, 2H), 7.66 (t, J=9.16 Hz, 4H), 8.59 (d, J=6.5 Hz, 1H).


Example 13c
2-(Dimethylamino)ethyl 2-((S)-2,3,9-trimethyl-4-(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 13c)

Compound 13c (0.035 g, 17%) was obtained from (S)-4-(6-(2-(2-(dimethylamino)ethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.118 g, 0.24 mmol) obtained in reference example 26 and N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.105 g, 0.24 mmol) obtained in step 2 of example 1h in the same manner as in step 3 of example 1b.


ESI-MS m/z: 858.49 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.01 (t, J=7.32 Hz, 3H), 1.06 (d, J=6.41 Hz, 3H), 1.13-1.27 (m, 1H), 1.60 (s, 3H), 1.73-1.76 (m, 2H), 2.16 (s, 6H), 2.20-2.33 (m, 1H), 2.42 (s, 3H), 2.52-2.56 (m, 2H), 2.58-2.65 (m, 5H), 3.26-3.45 (m, 4H), 3.44-3.47 (m, 2H), 4.17-4.20 (m, 2H), 4.21-4.31 (m, 1H), 4.51-4.55 (m, 1H), 4.68-4.79 (m, 1H), 6.58 (d, J=7.93 Hz, 1H), 6.66 (d, J=8.85 Hz, 2H), 7.10 (d, J=7.5 Hz, 1H), 7.17 (td, J=7.32, 0.92 Hz, 1H), 7.27 (t, J=7.0 Hz, 1H), 7.31 (d, J=7.0 Hz, 1H), 7.50 (d, J=8.54 Hz, 2H), 7.64 (d, J=8.85 Hz, 2H), 7.88 (d, J=8.54 Hz, 2H), 8.11 (t, J=5.65 Hz, 1H), 8.62 (t, J=6.0 Hz, 1H).


Example 13d
4-Hydroxycyclohexyl 2-((S)-2,3,9-trimethyl-4-(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 13d)

Compound 13d (0.027 g, 14%) was obtained from 4-((S)-6-(2-(((1r,4S)-4-hydroxycyclohexyl)oxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.115 g, 0.22 mmol) obtained in step 2 of reference example 27 and N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.097 g, 0.22 mmol) obtained in step 2 of example 1h in the same manner as in step 1 of example 1a.


ESI-MS m/z: 885.53 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.01 (t, J=7.4 Hz, 3H), 1.05 (d, J=6.4 Hz, 3H), 1.17-1.32 (m, 3H), 1.37-1.45 (m, 2H), 1.59 (s, 3H), 1.72-1.78 (m, 4H), 1.88-1.91 (m, 2H), 2.22-2.28 (m, 1H), 2.41 (s, 3H), 2.54-2.63 (m, 5H), 3.25-3.27 (m, 2H), 3.34-3.35 (m, 2H), 3.40 (d, J=7.23 Hz, 2H), 3.50 (dt, 3=8.22, 4.22 Hz, 1H), 4.23-4.29 (m, 1H), 4.48-4.53 (m, 2H), 4.70-4.75 (m, 2H), 6.54 (d, J=7.67 Hz, 1H), 6.65 (d, J=8.77 Hz, 2H), 7.10 (d, J=7.6 Hz, 1H), 7.16 (t, J=7.0 Hz, 1H), 7.25-7.31 (m, 2H), 7.47 (d, J=8.33 Hz, 2H), 7.63 (d, J=8.77 Hz, 2H), 7.87 (d, J=8.33 Hz, 2H), 8.07 (t, J=5.59 Hz, 1H), 8.58 (t, J=6.8 Hz, 1H).


Example 13e
4-((S)-6-(2-(Ethylamino)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)-N-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)benzamide (Compound 13e)

Compound 13e (0.040 g, 16%) was obtained from (S)-4-(6-(2-(ethylamino)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.135 g, 0.31 mmol) obtained in reference example 28 and N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.133 g, 0.31 mmol) obtained in step 2 of example 1h in the same manner as in step 3 of example 1b.


ESI-MS m/z: 814.50 (M+H)+: 1H-NMR (DMSO-d6,δ): 0.99-1.09 (m, 9H), 1.17-1.25 (m, 1H), 1.59 (s, 3H), 1.74 (quintet, J=6.8 Hz, 2H), 2.22-2.28 (m, 1H), 2.45 (s, 3H), 2.54-2.67 (m, 4H), 3.07-3.29 (m, 9H), 4.25-4.29 (m, 1H), 4.50-4.54 (m, 1H), 4.72-4.75 (m, 1H), 6.54 (d, J=7.89 Hz, 1H), 6.65 (d, J=8.77 Hz, 2H), 7.10 (d, J=7.6 Hz, 1H), 7.16 (t, J=7.4 Hz, 1H), 7.24-7.31 (m, 2H), 7.48 (d, J=8.4 Hz, 2H), 7.63 (d, J=8.4 Hz, 2H), 7.87 (d, J=8.55 Hz, 2H), 8.07 (t, J=5.37 Hz, 1H), 8.18 (t, J=5.26 Hz, 1H), 8.58 (t, J=5.8 Hz, 1H).


Example 13f
4-((S)-6-(2-(4-(2-Hydroxyethyl)piperazin-1-yl)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)-N-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)benzamide (Compound 13f)

Compound 13f (0.040 g, 23%) was obtained from (S)-4-(6-(2-(4-(2-hydroxyethyl)piperazin-1-yl)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.1 g, 0.19 mmol) obtained in step 2 of reference example 29 and N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.082 g, 0.19 mmol) obtained in step 2 of example 1h in the same manner as in step 1 of example 1a.


ESI-MS m/z: 899.60 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.01 (t, J=7.2 Hz, 3H), 1.05 (d, J=6.5 Hz, 3H), 1.13-1.27 (m, 1H), 1.60 (s, 3H), 1.72-1.75 (m, 2H), 2.19-2.31 (m, 1H), 2.37-2.39 (m, 2H), 2.41-2.44 (m, 5H), 2.57-2.63 (m, 5H), 3.27-3.31 (m, 6H), 3.41-3.42 (m, 2H), 3.51-3.55 (m, 3H), 3.64-3.66 (m, 3H), 4.21-4.28 (m, 1H), 4.45 (t, J=5.2 Hz, 1H), 4.59 (t, J=5.2 Hz, 1H), 4.68-4.72 (m, 1H), 6.58 (d, J=8.0 Hz, 1H), 6.65 (d, J=8.54 Hz, 2H), 7.09 (d, J=7.5 Hz, 1H), 7.16 (t, J=8.0 Hz, 1H), 7.25-7.28 (m, 1H), 7.31 (d, J=7.0 Hz, 1H), 7.50 (d, J=8.24 Hz, 2H), 7.63 (d, J=8.85 Hz, 2H), 7.87 (d, J=8.5 Hz, 2H), 8.10 (t, J=5.7 Hz, 1H), 8.61 (t, J=5.5 Hz, 1H).


Example 13g
2-Hydroxyethyl 2-((S)-2,3,9-trimethyl-4-(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 13g)

(Step 1) 2-Methoxyethyl 2-((S)-2,3,9-trimethyl-4-(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (0.075 g, 33%) was obtained from N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.125 g, 0.27 mmol) obtained in step 2 of example 1h and (S)-4-(6-(2-(2-methoxyethoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.114 g, 0.27 mmol) obtained in step 2 of reference example 31 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 844 (M+H)+


(Step 2)

2-Methoxyethyl 2-((S)-2,3,9-trimethyl-4-(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (0.19 g, 0.22 mmol) obtained in step 1 was dissolved in dichloromethane (5 mL), then boron tribromide (0.1 mL, 1.1 mmol) was added to the solution under ice cooling, and the mixture was stirred at room temperature for 1 hour. Methanol and water were sequentially added to the reaction mixture, and the mixture was extracted with dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=65/35 to 30/70) to give compound 13g (50 mg, 27%).


ESI-MS m/z: 831 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.92-1.06 (m, 6H), 1.17-1.25 (m, 1H), 1.59 (s, 3H), 1.71-1.77 (m, 2H), 2.22-2.33 (m, 1H), 2.41 (s, 3H), 2.55-2.67 (m, 5H), 3.24-3.27 (m, 2H), 3.33-3.34 (m, 2H), 3.40-3.52 (m, 2H), 3.60 (q, J=5.33 Hz, 2H), 4.11 (t, J=4.8 Hz, 2H), 4.23-4.29 (m, 1H), 4.53 (dd, J=7.78, 6.47 Hz, 1H), 4.71-4.78 (m, 1H), 4.81 (t, J=5.59 Hz, 1H), 6.54 (d, J=7.67 Hz, 1H), 6.65 (d, J=8.77 Hz, 2H), 7.09 (s, 1H), 7.16 (td, J=7.29, 1.21 Hz, 1H), 7.24-7.31 (m, 2H), 7.49 (d, J=8.33 Hz, 2H), 7.63 (d, J=8.55 Hz, 2H), 7.87 (d, J=8.55 Hz, 2H), 8.07 (t, J=5.59 Hz, 1H), 8.58 (t, J=4.8 Hz, 1H).


Example 13h
3-Methoxypropyl 2-((S)-2,3,9-trimethyl-4-(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 13h)

Compound 13h (0.045 g, 19%) was obtained from N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.116 g, 0.27 mmol) obtained in step 2 of example 1h and (S)-4-(6-(2-(3-methoxypropoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.13 g, 0.27 mmol) obtained in reference example 30 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 859 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.01 (t, J=7.32 Hz, 3H), 1.05 (d, J=6.41 Hz, 3H), 1.20-1.23 (m, 1H), 1.60 (s, 3H), 1.74 (quin, J=6.87 Hz, 2H), 1.82 (quin, J=6.33 Hz, 2H), 2.22-2.27 (m, 1H), 2.41 (d, J=0.61 Hz, 3H), 2.57-2.62 (m, 5H), 3.20 (s, 3H), 3.23-3.28 (m, 4H), 3.36 (t, J=6.26 Hz, 2H), 3.39-3.52 (m, 2H), 4.11-4.18 (m, 2H), 4.24-4.28 (m, 1H), 4.52 (dd, J=7.93, 6.41 Hz, 1H), 4.69-4.79 (m, 1H), 6.57 (d, J=7.5 Hz, 1H), 6.65 (d, J=8.85 Hz, 2H), 7.09 (d, J=7.63 Hz, 1H), 7.16 (td, J=7.40, 1.07 Hz, 1H), 7.25-7.32 (m, 2H), 7.48 (d, J=8.5 Hz, 2H), 7.63 (d, J=8.85 Hz, 2H), 7.87 (d, J=8.54 Hz, 2H), 8.10 (t, J=5.65 Hz, 1H), 8.61 (t, J=5.8 Hz, 1H).


Example 13i
tert-Butyl 2-((S)-2,3,9-trimethyl-4-(4-((3-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-3-oxopropyl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 13i)
(Step 1)

A crude product (0.180 g) of tert-butyl (3-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-3-oxopropyl)carbamate was obtained from 1-((2S*,4R*)-4-((4-aminophenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.100 g, 0.32 mmol) obtained in step 2 of reference example 7 and commercially available 3-((tert-butoxycarbonyl)amino)propanoic acid (0.061 g, 0.32 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 479.


(Step 2)

3-Amino-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propanamide hydrochloride (0.180 g, total yield of 2 steps 93%) was obtained from the crude product (0.240 g) of tert-butyl (3-((4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-3-oxopropyl)carbamate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 381.


(Step 3)

Compound 13i (0.025 g, 10%) was obtained from 3-amino-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)propanamide hydrochloride (0.130 g, 0.31 mmol) obtained in step 2 and (S)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (0.145 g, 0.31 mmol) obtained in reference example 3 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 829; 1H-NMR (DMSO-d6, δ) 0.92-1.04 (m, 6H), 1.10-1.21 (m, 1H), 1.43 (s, 9H), 1.59 (s, 3H), 2.20-2.33 (m, 1H), 2.41 (s, 3H), 2.52-2.67 (m, 7H), 3.34-3.38 (m, 2H), 3.50-3.55 (m, 2H), 4.07-4.13 (m, 1H), 4.42-4.45 (m, 1H), 4.70-4.73 (m, 1H), 5.84 (d, J=7.6 Hz, 1H), 6.57 (d, J=8.8 Hz, 2H), 7.16 (d, J=3.73 Hz, 2H), 7.23-7.30 (m, 4H), 7.48 (d, J=8.33 Hz, 2H), 7.87 (d, J=8.4 Hz, 2H), 8.63-8.64 (m, 1H), 9.58 (s, 1H).


Example 13j
tert-Butyl 2-((S)-2,3,9-trimethyl-4-(4-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)piperidine-1-carbonyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 13j)
(Step 1)

tert-Butyl (S)-2-(4-(4-(4-((benzyloxy)carbonyl)amino)piperidine-1-carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (0.12 g, 69%) was obtained from (S)-4-(6-(2-(tert-butoxy)-2-oxoethyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.12 g, 0.257 mmol) obtained in reference example 3 and commercially available benzylpiperidin-4-ylcarbamate hydrochloride (0.07 g, 0.25 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 683.


(Step 2)

tert-Butyl (S)-2-(4-(4-(4-((benzyloxy)carbonyl)amino)piperidine-1-carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (0.12 g, 0.17 mmol) obtained in step 1 was dissolved in methanol (5 mL), then 20% palladium hydroxide (0.06 g) was added to the solution, and the mixture was stirred at room temperature for 16 hours under a hydrogen atmosphere. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure to give tert-butyl (S)-2-(4-(4-(4-aminopiperidine-1-carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (0.09 g, 94%).


ESIMS, (M+H)+, m/z: 549.


(Step 3)

Compound 13j (0.033 g, 14%) was obtained from tert-butyl (S)-2-(4-(4-(4-aminopiperidine-1-carbonyl)phenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (0.046 g, 0.136 mmol) obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.075 g, 0.136 mmol) obtained in step 7 of reference example 1 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 869: 1H-NMR (DMSO-d6, δ) 0.95 (t, J=7.48 Hz, 3H), 1.03 (d, J=7.0 Hz, 2H), 1.17-1.24 (m, 2H), 1.43 (s, 9H), 1.49-1.53 (m, 1H), 1.66-1.70 (m, 4H), 1.86 (m, 1H), 2.22-2.27 (m, 1H), 2.43 (s, 3H), 2.56-2.63 (m, 5H), 2.93 (m, 1H), 3.12-3.16 (m, 1H), 3.38-3.40 (m, 2H), 3.48 (m, 1H), 4.01 (m, 1H), 4.21-4.32 (m, 1H), 4.42-4.46 (m, 2H), 4.73-4.74 (m, 1H), 4.73-4.75 (m, 1H), 6.57 (d, J=7.93 Hz, 1H), 6.64 (d, J=8.85 Hz, 2H), 7.08 (d, J=7.63 Hz, 1H), 7.16 (t, J=7.48 Hz, 1H), 7.25-7.32 (m, 2H), 7.41 (d, J=8.54 Hz, 2H), 7.50 (d, J=8.0 Hz, 2H), 7.63 (d, J=8.85 Hz, 2H), 7.85 (d, J=7.63 Hz, 1H)


Example 14a
2-(4-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)-N-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)acetamide (Compound 14a)

Compound 14a (0.029 g, 10%) was obtained from 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline (0.123 g, 0.38 mmol) obtained in reference example 22 and ethyl 2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)acetate (0.170 g, 0.38 mmol) obtained in step 1 of example 6n in the same manner as in step 2 of example 6b.


ESI-MS m/z: 724.43 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.99-1.06 (m, 6H), 1.13-1.24 (m, 1H), 1.63 (s, 3H), 2.18-2.31 (m, 1H), 2.40 (s, 3H), 2.54-2.64 (m, 5H), 4.09-4.19 (m, 2H), 4.68-4.80 (m, 1H), 5.00 (s, 2H), 5.20 (d, J=12.8 Hz, 1H), 6.04 (d, J=7.67 Hz, 1H), 6.66 (d, J=8.55 Hz, 2H), 7.17-7.20 (m, 2H), 7.22-7.35 (m, 4H), 7.43 (d, J=8.55 Hz, 2H), 7.64 (d, J=8.99 Hz, 2H), 7.72 (s, 1H), 7.95 (s, 1H), 10.51 (s, 1H).


Example 14b
N-(2-(4-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (Compound 14b)

Compound 14b (0.031 g, 20%) was obtained from 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.112 g, 0.25 mmol) obtained in step 1 of example 10d and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.075 g, 0.21 mmol) obtained in reference example 4 in the same manner as in step 1 of example 1a.


ESI-MS m/z: 738.43 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.05 (m, 6H), 1.13-1.21 (m, 1H), 1.56 (s, 3H), 2.19-2.28 (m, 1H), 2.38 (s, 3H), 2.54-2.67 (m, 5H), 3.66 (q, J=5.85 Hz, 2H), 4.12-4.18 (m, 2H), 4.27 (t, J=6.25 Hz, 2H), 4.66-4.81 (m, 1H), 5.28 (d, J=12.50 Hz, 1H), 6.03 (d, J=7.67 Hz, 1H), 6.62 (d, J=8.77 Hz, 2H), 7.16 (d, J=3.73 Hz, 2H), 7.25-7.31 (m, 4H), 7.52 (d, J=8.11 Hz, 2H), 7.70 (s, 1H), 7.84 (d, J=8.33 Hz, 2H), 7.91 (s, 1H), 8.71 (t, J=5.6 Hz, 1H).


Example 14c
N-(4-(((1R,4r)-4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)amino)-4-oxobut-2-yn-1-yl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (Compound 14c)
(Step 1)

A crude product (0.048 g) of tert-butyl (4-(((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino))cyclohexyl)amino)-4-oxobut-2-yn-1-yl)carbamate was obtained from 1-((2S*,4R*)-4-(((1r,4R)-4-aminocyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one dihydrochloride (0.02 g, 0.051 mmol) obtained in reference example 10 in the same manner as in step 1 of example 9d.


ESIMS, (M+H)+, m/z: 497.


(Step 2)

A crude product (34 mg) of 4-amino-N-((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)but-2-ynamide trifluoroacetate was obtained from the crude product (0.048 g) of tert-butyl (4-(((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino))cyclohexyl)amino)-4-oxobut-2-yn-1-yl)carbamate obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 397.


(Step 3)

Compound 14c (25 mg, total yield of 3 steps 66%) was obtained from the crude product (34 mg) of 4-amino-N-((1R,4r)-4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexyl)but-2-ynamide trifluoroacetate obtained in step and 4-(2,3-dimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (24 mg, 0.071 mmol) obtained in reference example 4 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 731 (M+H)+: 1H-NMR (CDCl3, δ): 1.05-1.15 (m, 6H), 1.19-1.41 (m, 3H), 1.60 (s, 3H), 1.91-2.11 (m, 7H), 2.21-2.33 (m, 1H), 2.42 (s, 3H), 2.46-2.64 (m, 2H), 2.64-2.74 (m, 4H), 3.52-3.62 (m, 1H), 3.66-3.81 (m, 1H), 4.13 (d, J=12.6 Hz, 1H), 4.26-4.33 (m, 2H), 4.77-4.95 (m, 1H), 5.52 (d, J=12.6 Hz, 1H), 6.52-6.63 (m, 1H), 7.09-7.13 (m, 1H), 7.21-7.35 (m, 2H), 7.44-7.54 (m, 3H), 7.75-7.84 (m, 3H).


Example 14d
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-2-(2-oxo-2-((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)amino)ethoxy)acetamide (Compound 14d)
(Step 1)

Methyl 2-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetra hydroquinolin-4-yl)amino)phenyl)amino)-2-oxyethoxy)acetate (0.130 g, 46%) was obtained from 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.2 g, 0.65 mmol) obtained in reference example 7 and 2-(2-methoxy-2-oxyethoxy)acetic acid (0.143 g, 0.97 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 440.25.


(Step 2)

Compound 14d (0.025 g, 11%) was obtained from 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline (0.095 g, 0.29 mmol) obtained in reference example 22 and methyl 2-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxyethoxy)acetate (0.13 g, 0.29 mmol) obtained in step 1 in the same manner as in step 2 of example 6b.


ESI-MS m/z: 731.45 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.99-1.05 (m, 6H), 1.12-1.19 (m, 1H), 1.63 (s, 3H), 2.21-2.26 (m, 1H), 2.40 (s, 3H), 2.55-2.62 (m, 5H), 4.10-4.15 (m, 2H), 4.20 (s, 2H), 4.25 (s, 2H), 4.68-4.78 (m, 1H), 5.22 (d, J=13.0 Hz, 1H), 5.96 (d, J=8.0 Hz, 1H), 6.62 (d, J=9.0 Hz, 2H), 7.16-7.18 (m, 2H), 7.24-7.30 (m, 2H), 7.35 (d, J=9.0 Hz, 2H), 7.43 (d, J=8.5 Hz, 2H), 7.71 (d, J=9.0 Hz, 2H), 9.72 (s, 1H), 10.33 (s, 1H).


Example 14e
N-(4-Oxo-4-((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)amino)but-2-yn-1-yl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (Compound 14e)
(Step 1)

tert-Butyl (4-oxo-4-((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)amino)but-2-yn-1-yl)carbamate (0.06 g, 25%) was obtained from 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline (0.150 g, 0.46 mmol) obtained in reference example 22 and 4-((tert-butoxycarbonyl)amino)but-2-ynoic acid (0.097 g, 0.49 mmol) in the same manner as in step 1 of example 1a.


ESI-MS (M+H)+: 505.29


(Step 2)

A crude product (0.05 g) of 4-amino-N-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)but-2-ynamide trifluoroacetate was obtained from tert-butyl (4-oxo-4-((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)amino)but-2-yn-1-yl)carbamate (0.05 g, 0.1 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESI-MS (M+H)+: 405.22


(Step 3)

Compound 14e (0.033 g, 40%) was obtained from the crude product (0.120 g) of 4-amino-N-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)but-2-ynamide trifluoroacetate obtained in step 2 and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.04 g, 0.11 mmol) obtained in reference example 4 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 739.63 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.58 (s, 3H), 1.62 (s, 3H), 2.40 (s, 6H), 2.59 (s, 3H), 2.61 (s, 3H), 4.09-4.20 (m, 2H), 4.32 (d, J=5.6 Hz, 2H), 5.19-5.30 (m, 2H), 7.42 (d, J=8.58 Hz, 2H), 7.56 (d, J=8.4 Hz, 2H), 7.63 (d, J=8.8 Hz, 2H), 7.91 (d, J=8.4 Hz, 2H), 9.20 (t, J=5.4 Hz, 1H), 10.92 (s, 1H).


Example 14f
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-2-(3-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)ureido)acetamide (Compound 14f)
(Step 1)

Ethyl glycinate hydrochloride (0.086 g, 0.62 mmol) and triphosgene (0.073 g, 0.25 mmol) were dissolved in dichloromethane (5 mL), then triethylamine (0.34 mL, 2.47 mmol) was added to the solution at −10° C., and the mixture was stirred at −10° C. for 1 hour. 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline (0.2 g, 0.62 mmol) obtained in reference example 22 was added to the reaction mixture at −10° C., and the mixture was stirred at room temperature for 48 hours. Ice water was added to the reaction mixture, and the mixture was extracted twice with dichloromethane. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% formic acid aqueous solution=1/1) to give ethyl ((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl))phenyl)carbamoyl)glycinate (0.1 g, 36%).


ESIMS, (M+H)+, m/z: 453.27.


(Step 2)

((4-(2,3,9-Trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)carbamoyl)glycine (0.080 g, 86%) was obtained from ethyl ((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl))phenyl)carbamoyl)glycinate (0.1 g, 0.22 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 425.31


(Step 3)

((4-(2,3,9-Trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)carbamoyl)glycine (0.08 g, 0.19 mmol) obtained in step 2 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.047 g, 0.15 mmol) obtained in reference example 7 were dissolved in DMF (2 mL), then DMAP (7 mg, 0.057 mmol) was added to the solution, and the mixture was stirred at room temperature for 5 minutes. DCC (0.054 g, 0.26 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 16 hours. Ice water was added to the reaction mixture, then the resulting solid was collected by filtration, and dried under reduced pressure. The obtained solid was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=60/40 to 10/90) to give compound 14f (0.030 g, 22%).


ESI-MS m/z: 716.39 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.00 (t, J=7.4 Hz, 3H), 1.03 (d, J=6.0 Hz, 3H), 1.11-1.19 (m, 1H), 1.66 (s, 3H), 2.20-2.26 (m, 1H), 2.40 (s, 3H), 2.53-2.63 (m, 5H), 3.88 (d, J=5.26 Hz, 2H), 4.06-4.15 (m, 2H), 4.70-4.76 (m, 1H), 5.18 (d, J=12.72 Hz, 1H), 5.88 (d, J=7.89 Hz, 1H), 6.51 (t, J=5.26 Hz, 1H), 6.60 (d, J=8.77 Hz, 2H), 7.16 (d, J=3.51 Hz, 2H), 7.23-7.35 (m, 6H), 7.42-7.45 (m, 2H), 9.10 (s, 1H), 9.65 (s, 1H).


Example 14g
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(4-oxo-4-((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)amino)but-2-yn-1-yl)benzamide (Compound 14g)

Compound 14g (0.016 g, 25%) was obtained from the crude product (0.05 g) of 4-amino-N-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)but-2-ynamide trifluoroacetate obtained in step 2 of example 14e and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.03 g, 0.09 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 725.36 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.01 (t, J=7.32 Hz, 3H), 1.05 (d, J=6.41 Hz, 3H), 1.21-1.25 (m, 1H), 1.62 (s, 3H), 2.22-2.27 (m, 1H), 2.39 (s, 3H), 2.58-2.64 (m, 5H), 4.10 (d, J=12.51 Hz, 1H), 4.25-4.32 (m, 3H), 4.73-4.75 (m, 1H), 5.21 (d, J=12.82 Hz, 1H), 6.66-6.69 (m, 3H), 7.09 (d, J=7.63 Hz, 1H), 7.17 (t, J=7.5 Hz, 1H), 7.26-7.32 (m, 2H), 7.41 (d, J=8.54 Hz, 2H), 7.62 (d, J=8.5 Hz, 2H), 7.67 (d, J=8.85 Hz, 2H), 8.63 (t, J=5.5 Hz, 1H), 10.90 (s, 1H)


Example 14h
2-(3-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)-N-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)acetamide (Compound 14h)
(Step 1)

1-{(2S,4R)-4-[(4-Aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.1 g, 0.32 mmol) obtained in reference example 7 and ethyl glycinate hydrochloride (0.058 g, 0.42 mmol) were dissolved in THF (5 mL), then N,N-diisopropylethylamine (0.28 mL, 1.61 mmol) and DMAP (0.209 g, 1.71 mmol) were added to the solution at 0° C., and the mixture was stirred at 0° C. for 5 minutes. Triphosgene (0.048 g, 0.16 mmol) was added to the reaction mixture at 0° C., the mixture was stirred at 0° C. for 0.5 hour, and then stirred under reflux for 16 hours. Ice water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase column chromatography (acetonitrile/0.1% formic acid aqueous solution=40/60 to 50/50) to give ethyl ((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)glycinate (0.065 g, 46%).


ESIMS, (M+H)+, m/z: 439.24.


(Step 2)

((4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)glycine (0.050 g, 83%) was obtained from ethyl ((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)glycinate (0.065 g, 0.15 mmol) obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 411.23


(Step 3)

((4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)glycine (0.05 g, 0.12 mmol) obtained in step 2 and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline (0.039 g, 0.12 mmol) obtained in reference example 22 were dissolved in dichloromethane (2 mL), then DMAP (0.004 g, 0.04) and DCC (0.035 g, 0.17 mmol) were added to the solution, and the mixture was stirred at room temperature for 16 hours. Ice water was added to the reaction mixture, and the mixture was extracted twice with dichloromethane. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=70/30 to 10/90) to give compound 14h (0.015 g, 17%).


ESI-MS m/z: 716.43 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.98-1.04 (m, 6H), 1.13-1.15 (m, 1H), 1.63 (s, 3H), 2.22-2.26 (m, 1H), 2.40 (s, 3H), 2.54-2.59 (m, 5H), 3.90 (d, J=5.48 Hz, 2H), 4.09-4.12 (m, 2H), 4.66-4.75 (m, 1H), 5.20 (d, J=12.50 Hz, 1H), 5.70 (d, J=7.6 Hz, 1H), 6.23 (t, J=5.6 Hz, 1H), 6.56 (d, J=6.8 Hz, 2H), 7.10 (d, J=8.77 Hz, 2H), 7.16-7.19 (m, 2H), 7.23-7.29 (m, 2H), 7.41 (d, J=8.55 Hz, 2H), 7.63 (d, J=8.99 Hz, 2H), 8.31 (s, 1H), 10.17 (s, 1H).


Example 14i
N-(4-((4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (Compound 14i)
(Step 1)

tert-Butyl (4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)carbamate (0.180 g, 76%) was obtained from 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.150 g, 0.48 mmol) obtained in reference example 7 and 4-((tert-butoxycarbonyl)amino)but-2-ynoic acid (0.097 g, 0.48 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 491.29.


(Step 2)

4-Amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)but-2-ynamide trifluoroacetate (0.180 g, 97%) was obtained from tert-butyl (4-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-4-oxobut-2-yn-1-yl)carbamate (0.180 g, 0.37 mmol) obtained in step 1 in the same manner as in step 2 of example 1k.


ESIMS, (M+H)+, m/z: 391.22.


(Step 3)

Compound 14i (0.035 g, 16%) was obtained from 4-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)but-2-ynamide trifluoroacetate (0.150 g, 0.30 mmol) obtained in step 2 and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.094 g, 0.27 mmol) obtained in reference example 4 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 725.43 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.99 (t, J=7.2 Hz, 3H), 1.03 (d, J=6.5 Hz, 3H), 1.14-1.16 (m, 1H), 1.58 (s, 3H), 2.22-2.25 (m, 1H), 2.40 (s, 3H), 2.54-2.61 (m, 2H), 2.63 (s, 3H), 4.09-4.12 (m, 1H), 4.18 (d, J=12.82 Hz, 1H), 4.29 (d, J=5.49 Hz, 2H), 4.67-4.77 (m, 1H), 5.29 (d, J=12.51 Hz, 1H), 6.01 (d, J=7.63 Hz, 1H), 6.58 (d, J=8.85 Hz, 2H), 7.12-7.17 (m, 2H), 7.23-7.31 (m, 4H), 7.56 (d, J=8.24 Hz, 2H), 7.92 (d, J=8.54 Hz, 2H), 9.18 (t, J=5.49 Hz, 1H), 10.33 (s, 1H).


Example 14j
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((5-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)thiophen-2-yl)methyl)benzamide (Compound 14j)
(Step 1)

4-(4-Bromophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine (0.150 g, 0.39 mmol) obtained in step 3 of reference example 4 was dissolved in a mixed solvent (5 mL) of 1,4-dioxane and water (4:1), then (5-(((tert-butoxycarbonyl)amino)methyl)thiophen-2-yl)boronic acid (0.109 g, 0.43 mmol), cesium carbonate (0.379 g, 1.16 mmol) and Pd(PPh3)4 (0.045 g, 0.04 mmol) were added to the solution, and the mixture was stirred at 120° C. for 1 hour under an argon atmosphere under microwave irradiation. The reaction mixture was diluted with ice water and extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was washed with diethyl ether to give a crude product (0.160 g) of tert-butyl ((5-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)thiophen-2-yl)methyl)carbamate.


ESIMS, (M+H)+, m/z: 520.25.


(Step 2)

A crude product (0.160 g) of (5-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)thiophen-2-yl)methanamine hydrochloride was obtained from the crude product (0.160 g) of tert-butyl ((5-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)thiophen-2-yl)methyl)carbamate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 420.82


(Step 3)

Compound 14j (0.055 g, total yield of 3 steps 19%) was obtained from the crude product (0.144 g) of (5-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)thiophen-2-yl)methanamine hydrochloride obtained in step 2 and 4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzoic acid (0.107 g, 0.32 mmol) obtained in reference example 1 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 740.36 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.01 (t, J=7.2 Hz, 3H), 1.05 (d, J=6.4 Hz, 3H), 1.17-1.25 (m, 1H), 1.65 (s, 3H), 2.21-2.27 (m, 1H), 2.40 (s, 3H), 2.54-2.67 (m, 5H), 4.13 (d, J=12.50 Hz, 1H), 4.25-4.31 (m, 1H), 4.58 (d, J=5.70 Hz, 2H), 4.71-4.77 (m, 1H), 5.25 (d, J=12.50 Hz, 1H), 6.59 (d, J=7.89 Hz, 1H), 6.66 (d, J=8.77 Hz, 2H), 7.01 (d, J=3.51 Hz, 1H), 7.09 (d, J=7.6 Hz, 1H), 7.16 (td, J=7.34, 1.32 Hz, 1H), 7.24-7.31 (m, 2H), 7.41-7.47 (m, 3H), 7.66 (dd, J=16.99, 8.66 Hz, 4H), 8.73 (t, J=6.0 Hz, 1H).


Example 14k
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(1-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoyl)azetidin-3-yl)benzamide (compound 14k)

Compound 14k (0.050 g, 20%) was obtained from 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate (0.180 g, 0.35 mmol) obtained in step 2 of example in and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.125 g, 0.35 mmol) obtained in step 4 of reference example 4 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 727; 1H-NMR (DMSO-d6, δ): 0.98-1.06 (m, 6H), 1.19-1.23 (m, 1H), 1.60 (s, 3H), 2.23-2.25 (m, 1H), 2.40 (s, 3H), 2.54-2.67 (m, 5H), 4.04-4.07 (m, 1H), 4.16-4.20 (m, 2H), 4.28-4.34 (m, 2H), 4.57 (q, J=8.48 Hz, 1H), 4.69-4.74 (m, 2H), 5.28 (d, J=12.72 Hz, 1H), 6.63-6.67 (m, 3H), 7.08 (d, J=7.58 Hz, 1H), 7.16 (t, J=7.34 Hz, 1H), 7.25-7.32 (m, 2H), 7.54 (d, J=8.31 Hz, 2H), 7.66 (t, J=8.44 Hz, 4H), 8.61 (d, J=6.85 Hz, 1H).


Example 14l
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(2-oxo-3-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide)propyl)benzamide (compound 141)
(Step 1)

N-(2-Hydroxy-3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (0.150 g, 59%) was obtained from the crude product (0.152 g) of N-(3-amino-2-hydroxypropyl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide hydrochloride obtained in step 2 of example 7r and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.120 g, 0.34 mmol) obtained in reference example 3 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 745.


(Step 2)

Compound 141 (0.040 g, 26%) was obtained from N-(2-hydroxy-3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (0.150 g, 0.20 mmol) obtained in step 1 in the same manner as in step 4 of example 7r.


ESIMS, (M+H)+, m/z: 743; 1H-NMR (DMSO-d6, δ) 0.99-1.06 (m, 6H), 1.21-1.26 (m, 1H), 1.59 (s, 3H), 2.22-2.33 (m, 1H), 2.40 (s, 3H), 2.55-2.67 (m, 5H), 4.12 (d, J=5.70 Hz, 2H), 4.16-4.20 (m, 3H), 4.27-4.30 (m, 1H), 4.70-4.78 (m, 1H), 5.29 (d, J=8.4 Hz, 1H), 6.62 (d, J=7.67 Hz, 1H), 6.68 (d, J=8.77 Hz, 2H), 7.10 (d, J=7.6 Hz, 1H), 7.17 (td, J=7.34, 1.32 Hz, 1H), 7.25-7.32 (m, 2H), 7.55 (d, J=8.33 Hz, 2H), 7.67 (d, J=8.77 Hz, 2H), 7.90 (d, J=8.55 Hz, 2H), 8.43 (t, J=5.59 Hz, 1H), 8.88 (t, J=5.59 Hz, 1H).


Example 14m
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(3-oxo-3-((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)amino)propyl)benzamide (Compound 14m)
(Step 1)

tert-Butyl (3-oxo-3-((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)amino)propyl)carbamate (0.11 g, 72%) was obtained from 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline obtained in reference example 22 and commercially available 3-((tert-butoxycarbonyl)amino)propanoic acid (0.058 g, 0.30 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 495.


(Step 2) 3-Amino-N-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)propanamide hydrochloride (0.09 g, 95%) was obtained from tert-butyl (3-oxo-3-((4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)amino)propyl)carbamate (0.11 g, 0.22 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M−(HCl)+H)+, m/z: 395.


(Step 3)

Compound 14m (0.055 g, 37%) was obtained from 3-amino-N-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)propanamide hydrochloride (0.09 g, 0.20 mmol) obtained in step 2 and 1-{(2S,4R)-4-[(4-aminophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.07 g, 0.20 mmol) obtained in step 7 of reference example 1 based on the manner in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 715; 1H-NMR (DMSO-d6, δ) 0.99-1.05 (m, 6H), 1.16-1.25 (m, 1H), 1.63 (s, 3H), 2.21-2.29 (m, 1H), 2.40 (m, 3H), 2.60-2.70 (m, 7H), 3.48-3.52 (m, 2H), 4.09 (d, J=12.8 Hz, 1H), 4.23-4.29 (m, 1H), 4.71-4.76 (m, 1H), 5.20 (d, J=12.4 Hz, 1H), 6.54 (d, J=8.0 Hz, 1H), 6.64 (d, J=8.8 Hz, 2H), 7.09 (d, J=7.2 Hz, 1H), 7.16 (t, J=7.6 Hz, 1H), 7.24-7.31 (m, 2H), 7.39 (d, J=8.4 Hz, 2H), 7.63 (dd, J=8.55, 6.80 Hz, 4H), 8.14 (t, J=5.4 Hz, 1H), 10.14 (brs, 1H).


Example 14n
N-((1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (Compound 14n)
(Step 1)

N-(Prop-2-yn-1-yl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (0.1 g, 90%) was obtained from 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.1 g, 0.28 mmol) obtained in step 4 of reference example 4 and commercially available prop-2-yn-1-amine (0.019 mL, 0.31 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 390.


(Step 2)

Compound 14n (0.038 g, 19%) was obtained from N-(prop-2-yn-1-yl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (0.1 g, 0.25 mmol) obtained in step and the crude product (0.086 g) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 725; 1H-NMR (DMSO-d6, δ): 0.99-1.06 (m, 6H), 1.08-1.25 (m, 1H), 1.57 (s, 3H), 2.22-2.27 (m, 1H), 2.39 (s, 3H), 2.64-2.67 (m, 5H), 4.17 (d, J=12.5 Hz, 1H), 4.22-4.28 (m, 1H), 4.57 (d, J=5.2 Hz, 2H), 4.72-4.78 (m, 1H), 5.28 (d, J=12.4 Hz, 1H), 6.47 (d, J=7.6 Hz, 1H), 6.78 (d, J=8.8 Hz, 2H), 7.14-7.20 (m, 2H), 7.25-7.32 (m, 2H), 7.52-7.56 (m, 4H), 7.92 (d, J=8.4 Hz, 2H), 8.41 (s, 1H), 9.11 (t, J=5.6 Hz, 1H).


Example 14o
N,N′-(2-Oxopropane-1,3-diyl)bis(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide) (Compound 14o)
(Step 1)

4-(2,3,9-Trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.2 g, 0.56 mmol) obtained in step 4 of reference example 4 was dissolved in DMF (5 mL), then benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP) (0.88 g, 1.70 mmol) and N,N-diisopropylethylamine (0.50 mL, 2.84 mmol) were added to the solution, and the mixture was stirred at room temperature for 15 minutes. Commercially available 1,3-diaminopropan-2-ol (0.025 g, 0.28 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by reverse phase HPLC (water/acetonitrile=7/3) to give N,N′-(2-hydroxypropane-1,3-diyl)bis(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide) (0.12 g, 28%).


ESIMS, (M+H)+, m/z: 759.


(Step 2)

Compound 140 (0.1 g, 9%) was obtained from N,N′-(2-hydroxypropane-1,3-diyl)bis(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide) (0.12 g, 0.15 mmol) obtained in step 1 in the same manner as in step 4 of example 7r.


ESIMS, (M+H)+, m/z: 725; 1H-NMR (DMSO-d6, δ): 1.58 (s, 6H), 2.40 (s, 6H), 2.61 (m, 6H), 4.17-4.23 (m, 6H), 5.29 (d, J=13.0 Hz, 2H), 7.56 (d, J=8.5 Hz, 4H), 7.90 (d, J=8.54 Hz, 4H), 8.94 (t, J=5.80 Hz, 2H).


Example 14p
tert-Butyl (S)-2-(2,3,9-trimethyl-4-(4-((1-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoyl)piperidin-4-yl)carbamoyl)phenyl)-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate (Compound 14p)
(Step 1)

A crude product (0.14 g) of tert-butyl 1-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoyl)piperidin-4-ylcarbamate was obtained from 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.1 g, 0.28 mmol) obtained in step 4 of reference example 4 and commercially available tert-butyl piperidin-4-ylcarbamate (0.059 g, 0.29 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 535.


(Step 2)

A crude product (0.12 g) of (4-aminopiperidin-1-yl)(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)methanone hydrochloride was obtained from the crude product (0.14 g) of tert-butyl 1-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoyl)piperidin-4-ylcarbamate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 435.


(Step 3)

Compound 14p (0.043 g, total yield of 3 steps 26%) was obtained from the crude product (0.12 g, 0.25 mmol) of (4-aminopiperidin-1-yl)(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)methanone hydrochloride obtained in step 2 and (S)-4-{6-[2-(tert-butoxy)-2-oxoethyl]-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl}benzoic acid (0.118 g, 0.25 mmol) obtained in reference example 3 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 883; 1H-NMR (DMSO-d6, δ): 1.44-1.64 (m, 17H), 1.77-1.90 (m, 2H), 2.40 (s, 3H), 2.41 (s, 3H), 2.61 (s, 3H), 2.63 (s, 3H), 2.96-3.18 (m, 2H), 3.32-3.39 (m, 2H), 3.51 (s, 1H), 4.08 (brs, 1H), 4.18 (d, J=12.72 Hz, 1H), 4.43 (t, J=7.23 Hz, 2H), 5.27 (d, J=12.72 Hz, 1H), 7.41 (d, J=8.33 Hz, 2H), 7.48 (d, J=8.33 Hz, 2H), 7.54 (d, J=8.11 Hz, 2H), 7.87 (d, J=8.33 Hz, 2H), 8.38 (d, J=7.45 Hz, 1H).


Example 14q
4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((1-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)-1H-1,2,3-triazol-4-yl)methyl)benzamide (Compound 14q)
(Step 1)

A crude product (0.5 g) of 4-(4-azidophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine was obtained from 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline (0.3 g, 0.92 mmol) obtained in reference example 22 in the same manner as in step 2 of example 3a.


ESIMS, (M+H)+, m/z: 350.


(Step 2)

Compound 14q (0.035 g, total yield of 2 steps 6%) was obtained from the crude product (0.418 g) of 4-(4-azidophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine obtained in step 1 and 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)benzamide (0.3 g, 0.8 mmol) obtained in step 2 of example 15h in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 725: 1H-NMR (DMSO-d6, δ) 0.99-1.06 (m, 6H), 1.64 (s, 3H), 2.22-2.27 (m, 1H), 2.41 (s, 3H), 2.55-2.64 (m, 5H), 2.94 (s, 1H), 4.18 (d, J=12.4 Hz, 1H), 4.22-4.31 (m, 1H), 4.56 (d, J=5.2 Hz, 2H), 4.65-4.80 (m, 1H), 5.28 (d, J=12.4 Hz, 1H), 6.58 (d, J=7.89 Hz, 1H), 6.66 (d, J=8.77 Hz, 2H), 7.09 (d, J=7.67 Hz, 1H), 7.16 (t, J=7.4 Hz, 1H), 7.25-7.31 (m, 2H), 7.66 (dd, J=18.96, 8.66 Hz, 4H), 7.98 (d, J=8.77 Hz, 2H), 8.62 (t, J=5.26 Hz, 1H), 8.68 (s, 1H).


Example 14r
1-((2S,4R)-2-Methyl-4-((4-(7-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-2-yl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 14r)

Compound 14r (0.03 g, 13%) was obtained from 1-((2S,4R)-2-methyl-4-{[4-(5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-2-yl)phenyl]amino}-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.14 g, 0.309 mmol) obtained in step 3 of example 3f and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.23 g, 0.30 mmol) obtained in reference example 4 in the same manner, as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 750. 1H-NMR (DMSO-d6, δ): 0.99-1.05 (m, 6H), 1.13-1.22 (m, 1H), 1.65 (s, 3H), 2.22-2.27 (m, 1H), 2.41 (s, 3H), 2.61 (s, 6H), 3.70 (s, 1H), 4.03 (s, 2H), 4.17-4.21 (m, 2H), 4.55-4.85 (m, 3H), 5.29 (d, J=12.72 Hz, 1H), 6.00 (d, J=7.6 Hz, 1H), 6.62 (d, J=7.89 Hz, 2H), 7.17-7.18 (m, 2H), 7.24-7.31 (m, 3H), 7.44 (s, 2H), 7.50-7.58 (m, 4H).


Example 14s
N-(2-((4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thio)ethyl)-4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzamide (Compound 14s)
(Step 1)

1-{(2S,4R)-4-[(4-Bromophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one (0.1 g, 0.26 mmol) obtained in reference example 2 was dissolved in 1,4-dioxane (6 mL), then xantphos (0.062 g, 0.107 mmol), N,N-diisopropylethylamine (0.14 mL, 0.806 mmol), Pd2(dba)3 (0.05 g, 0.053 mmol) and tert-butyl (2-mercaptoethyl)carbamate (0.137 mL, 0.80 mmol) were added to the solution, and the mixture was stirred at 90° C. for 90 minutes. The reaction mixture was filtered through Celite, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol/dichloromethane=1/9) to give a crude product (0.18 g) of tert-butyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thio)ethyl)carbamate.


ESIMS, (M+H)+, m/z: 470.


(Step 2)

A crude product (0.16 g) of 1-((2S,4R)-4-((4-((2-aminoethyl)thio)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride was obtained from the crude product (0.18 g) of tert-butyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)thio)ethyl)carbamate obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M−HCl+H)+, m/z: 370.


(Step 3)

Compound 13s (0.03 g, 16%) was obtained from the crude product (0.12 g, 0.29 mmol) of 1-((2S,4R)-4-((4-((2-aminoethyl)thio)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride obtained in step 2 and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)benzoic acid (0.105 g, 0.29 mmol) obtained in reference example 4 in the same manner as in step 3 of example 1b.


ESIMS (M+H)+, m/z: 704: 1H-NMR (DMSO-d6, δ): 0.98-1.05 (m, 6H), 1.16-1.19 (m, 1H), 1.57 (m, 3H), 2.20-2.26 (m, 1H), 2.39 (s, 3H), 2.55-2.63 (m, 5H), 2.90 (t, J=7.2 Hz, 2H), 3.39 (q, J=6.0 Hz, 2H), 4.17 (d, J=12.8 Hz, 2H), 4.73 (d, J=8.4 Hz, 1H), 5.28 (d, J=12.4 Hz, 1H), 6.23 (d, J=7.6 Hz, 1H), 6.63 (d, J=8.4 Hz, 2H), 7.13-7.19 (m, 2H), 7.22-7.30 (m, 4H), 7.52 (d, J=8.4 Hz, 2H), 7.83 (d, J=8.4 Hz, 2H), 8.65 (t, J=5.6 Hz, 1H).


Example 14t
N1-(4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-N5-(4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)phenyl)glutaramide (Compound 14t)

Compound 14t (0.04 g, 15%) was obtained from 5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoic acid (0.15 g, 0.35 mmol) obtained in step 2 of example 4a and 4-(2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)aniline (0.114 g, 0.35 mmol) obtained in reference example 22 in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 729: 1H-NMR (DMSO-d6, δ): 0.98-1.04 (m, 6H), 1.10-1.16 (m, 1H), 1.63 (s, 3H), 1.86-1.89 (m, 2H), 2.20-2.33 (m, 3H), 2.36-2.40 (m, 5H), 2.53-2.61 (m, 5H), 4.09 (dd, J=12.06, 3.95 Hz, 2H), 4.66-4.79 (m, 1H), 5.20 (d, J=11.4 Hz, 1H), 5.83 (d, J=8.0 Hz, 1H), 6.58 (d, J=9.2 Hz, 2H), 7.16 (d, J=3.2 Hz, 2H), 7.23-7.30 (m, 4H), 7.39 (d, J=8.4 Hz, 2H), 7.64 (d, J=8.8 Hz, 2H), 9.51 (s, 1H), 10.09 (s, 1H).


Example 15a
2-(Dimethylamino)ethyl 1-(4-(5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanamide)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (Compound 15a)
(Step 1)

A crude product (2.0 g) of methyl 1-(4-((tert-butoxycarbonyl)amino)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate was obtained from methyl 4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (1.80 g, 9.33 mmol) obtained in step 2 of reference example 32 and tert-butyl (4-(bromomethyl)phenyl)carbamate (2.66 g, 9.33 mmol) in the same manner as in step 3 of reference example 32.


ESIMS, (M+H)+, m/z: 399.26.


(Step 2)

A crude product (1.5 g) of 1-(4-((tert-butoxycarbonyl)amino)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylic acid was obtained from the crude product (2.0 g) of methyl 1-(4-((tert-butoxycarbonyl)amino)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate obtained in step 1 in the same manner as in step 2 of example 2f.


ESIMS, (M+H)+, m/z: 385.26.


(Step 3)

A crude product (1.1 g) of 2-(dimethylamino)ethyl 1-(4-((tert-butoxycarbonyl)amino)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate was obtained from the crude product (1.5 g) of 1-(4-((tert-butoxycarbonyl)amino) benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylic acid obtained in step 2 in the same manner as in step 5 of reference example 32.


ESIMS, (M+H)+, m/z: 456.37.


(Step 4)

A crude product (0.8 g) of 2-(dimethylamino)ethyl 1-(4-aminobenzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate hydrochloride was obtained from the crude product (1.1 g) of 2-(dimethylamino)ethyl 1-(4-((tert-butoxycarbonyl)amino)benzyl)-4-oxo-4,5,6,7-tetra hydro-1H-indole-2-carboxylate obtained in step 3 in the same manner as in step 2 of example 1a.


ESIMS, (M+H)+, m/z: 356.24.


(Step 5)

Compound 15a (0.054 g, total yield of 5 steps 6%) was obtained from the crude product (0.100 g) of 2-(dimethylamino)ethyl 1-(4-aminobenzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate hydrochloride obtained in step 4 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.108 g, 0.25 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESI-MS m/z: 761.57 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.96-1.06 (m, 6H), 1.14 (td, J=12.04, 9.06 Hz, 1H), 1.86 (quin, J=7.27 Hz, 2H), 1.98-2.06 (m, 2H), 2.17 (s, 6H), 2.19-2.40 (m, 7H), 2.52-2.62 (m, 4H), 2.77 (t, J=6.08 Hz, 2H), 4.05-4.15 (m, 1H), 4.23 (t, J=5.60 Hz, 2H), 4.67-4.78 (m, 1H), 5.55 (s, 2H), 5.85 (d, J=7.87 Hz, 1H), 6.57 (d, J=9.06 Hz, 2H), 6.98 (d, J=8.58 Hz, 2H), 7.11 (s, 1H), 7.13-7.18 (m, 2H), 7.20-7.32 (m, 4H), 7.54 (d, J=8.58 Hz, 2H), 9.51 (s, 1H), 9.91 (s, 1H).


Example 15b
2-(Dimethylamino)ethyl 1-(4-(((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1,3,4-oxadiazol-2-yl)methyl)carbamoyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (Compound 15b)

Compound 15b (0.050 g, 19%) was obtained from 1-[(2S,4R)-4-({4-[5-(aminomethyl)-1,3,4-oxadiazol-2-yl]phenyl}amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one hydrochloride (0.150 g, 0.35 mmol) obtained in step 1 of example 12a and 4-((2-((2-(dimethylamino)ethoxy)carbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid (0.135 g, 0.35 mmol) obtained in reference example 32 in the same manner as in step 3 of example 1b.


ESI-MS m/z: 758.44 (M+H)+; 1H-NMR (DMSO-d6, δ): 0.99-1.06 (m, 6H), 1.22-1.24 (m, 1H), 2.02-2.05 (m, 2H), 2.16 (s, 6H), 2.17-2.27 (m, 1H), 2.36-2.42 (m, 2H), 2.56-2.68 (m, 4H), 2.71-2.78 (m, 2H), 4.21 (t, J=5.6 Hz, 2H), 4.26-4.32 (m, 1H), 4.70-4.75 (m, 3H), 5.67 (s, 2H), 6.77-6.86 (m, 3H), 7.09-7.19 (m, 5H), 7.25-7.32 (m, 2H), 7.67 (d, J=8.77 Hz, 2H), 7.84 (d, J=8.33 Hz, 2H), 9.16 (t, J=5.6 Hz, 1H).


Example 15c
2-(Dimethylamino)ethyl 1-(4-((2-(1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)ethyl)carbamoyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (Compound 15c)
(Step 1)

A crude product (0.280 g) of 2-(dimethylamino)ethyl 1-(4-(but-3-yn-1-ylcarbamoyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate was obtained from 4-((2-((2-(dimethylamino)ethoxy)carbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid (0.250 g, 0.65 mmol) obtained in reference example 32 and but-3-yn-1-amine hydrochloride (0.068 g, 0.65 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 436.33.


(Step 2)

The crude product (0.150 g, 0.34 mmol) of 2-(dimethylamino)ethyl 1-(4-(but-3-yn-1-ylcarbamoyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate obtained in step 1 was dissolved in t-butanol (5 mL), then the crude product (0.114 g) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a, sodium L-ascorbate (0.027 g, 0.14 mmol), copper sulfate pentahydrate (0.017 g, 0.07 mmol) and water (2 mL) were added to the solution at room temperature, and the mixture was stirred at 60° C. for 16 hours. The reaction mixture was concentrated under reduced pressure, the obtained residue was diluted with water, and the mixture was stirred for 15 minutes. The resulting solid was collected by filtration and dried under reduced pressure. The obtained solid was purified by reverse phase HPLC (10 mmol/L aqueous ammonium bicarbonate solution/acetonitrile=60/40) to give compound 15c (0.055 g, 21%).


ESIMS, (M+H)+, m/z: 771.46 1H-NMR (DMSO-d6, δ): 1.00-1.07 (m, 6H), 1.17-1.26 (m, 1H), 2.01-2.04 (m, 2H), 2.15 (s, 6H), 2.20-2.32 (m, 1H), 2.39 (t, J=6.03 Hz, 2H), 2.55-2.69 (m, 4H), 2.74 (t, J=5.92 Hz, 2H), 2.93 (t, J=7.13 Hz, 2H), 3.57 (q, J=6.2 Hz, 2H), 4.17-4.29 (m, 3H), 4.69-4.80 (m, 1H), 5.66 (s, 2H), 6.46 (d, J=7.67 Hz, 1H), 6.78 (d, J=8.55 Hz, 2H), 7.08 (d, J=8.11 Hz, 2H), 7.14-7.21 (m, 3H), 7.26-7.32 (m, 2H), 7.51 (d, J=8.55 Hz, 2H), 7.77 (d, J=7.89 Hz, 2H), 8.34 (s, 1H), 8.56 (t, J=5.6 Hz, 1H).


Example 15d
2-(Dimethylamino)ethyl 1-(4-((2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)carbamoyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (Compound 15d)

Compound 15d (0.062 g, 26%) was obtained from 4-((2-((2-(dimethylamino)ethoxy)carbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid (0.120 g, 0.31 mmol) obtained in step 6 of reference example 32 and 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.137 g, 0.31 mmol) obtained in step 1 of example 10d in the same manner as in step 3 of example 1b.


ESI-MS m/z: 770.45 (M+H)+: 1H-NMR (DMSO-d6, δ): 0.97-1.07 (m, 6H), 1.11-1.22 (m, 1H), 1.98-2.06 (m, 2H), 2.15 (s, 6H), 2.21-2.28 (m, 1H), 2.33-2.40 (m, 2H), 2.45-2.48 (m, 2H), 2.55-2.65 (m, 2H), 2.74 (t, J=5.8 Hz, 2H), 3.66 (q, J=6.08 Hz, 2H), 4.15-4.26 (m, 5H), 4.70-4.78 (m, 1H), 5.65 (s, 2H), 6.02 (d, J=7.6 Hz, 1H), 6.62 (d, J=8.8 Hz, 2H), 7.07 (d, J=8.34 Hz, 2H), 7.14-7.17 (m, 3H), 7.21-7.24 (m, 4H), 7.69 (s, 1H), 7.75 (d, J=8.4 Hz, 2H), 7.90 (s, 1H), 8.56 (t, J=5.6 Hz, 1H).


Example 15e
2-(Dimethylamino)ethyl 1-(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)carbamoyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (Compound 15e)

Compound 15e (0.060 g, 20%) was obtained from 4-((2-((2-(dimethylamino)ethoxy)carbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid (0.1 g, 0.19 mmol) obtained in step 6 of reference example 32 and N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.082 g, 0.19 mmol) obtained in step 2 of example 1h in the same manner as in step 3 of example 1b.


ESI-MS m/z: 761.54 (M+H)+: 1H-NMR (DMSO-d6, δ): 1.01 (t, J=7.2 Hz, 3H), 1.05 (d, J=6.4 Hz, 3H), 1.17-1.25 (m, 1H), 1.71 (quin, J=6.80 Hz, 2H), 2.03 (quin, J=6.80 Hz, 2H), 2.16 (s, 6H), 2.22-2.28 (m, 1H), 2.39 (t, J=6.25 Hz, 2H), 2.52-2.63 (m, 4H), 2.75 (t, J=5.92 Hz, 2H), 3.24-3.27 (m, 4H), 4.19-4.29 (m, 3H), 4.69-4.79 (m, 1H), 5.66 (s, 2H), 6.54 (d, J=7.67 Hz, 1H), 6.65 (d, J=8.77 Hz, 2H), 7.08-7.11 (m, 3H), 7.15-7.18 (m, 2H), 7.25-7.31 (m, 2H), 7.63 (d, J=8.77 Hz, 2H), 7.78 (d, J=8.33 Hz, 2H), 8.06 (t, J=5.70 Hz, 1H), 8.41 (t, J=5.6 Hz, 1H).


Example 15f
4-((2-Ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)benzamide (Compound 15f)
(Step 1)

4-((2-Ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)-N-(prop-2-yn-1-yl)benzamide (0.105 g, 94%) was obtained from 4-[(2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl]benzoic acid (0.1 g, 0.33 mmol) obtained in step 2 of reference example 5 and commercially available propargylamine (0.023 mL, 0.37 mmol) in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 335.


(Step 2)

Compound 15f (0.085 g, 42%) was obtained from 4-((2-ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)-N-(prop-2-yn-1-yl)benzamide (0.105 g, 0.31 mmol) obtained in step 1 and the crude product (0.105 g) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 670; 1H-NMR (DMSO-d6, δ): 0.99-1.10 (m, 9H), 1.14-1.25 (m, 1H), 1.97-2.02 (m, 2H), 2.21-2.33 (m, 3H), 2.38-2.45 (m, 2H), 2.55-2.67 (m, 4H), 4.22-4.28 (m, 1H), 4.57 (d, J=5.2 Hz, 2H), 4.72-4.78 (m, 1H), 5.28 (s, 2H), 6.12 (s, 1H), 6.47 (d, J=7.6 Hz, 1H), 6.78 (d, J=8.8 Hz, 2H), 7.04 (d, J=8.4 Hz, 2H), 7.14-7.20 (m, 2H), 7.25-7.32 (m, 2H), 7.54 (d, J=8.8 Hz, 2H), 7.85 (d, J=8.0 Hz, 2H), 8.37 (s, 1H), 8.98 (t, J=5.8 Hz, 1H).


Example 15g
Methyl 1-(4-((3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide)propyl)carbamoyl)benzyl)-4-oxo-4,5,6,7-tetrahydro-1H-indole-2-carboxylate (Compound 15g)

Compound 15g (0.075 g, 35%) was obtained from 4-((2-(methoxycarbonyl)-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)benzoic acid (0.1 g, 0.30 mmol) obtained in reference example 34 and N-(3-aminopropyl)-4-{[(2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}benzamide hydrochloride (0.144 g, 0.33 mmol) obtained in step 2 of example 1h in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 704; 1H-NMR (DMSO-d6, δ) 0.99-1.06 (m, 6H), 1.20-1.25 (m, 1H), 1.71 (t, J=7.0 Hz, 2H), 2.03 (t, J=7.0 Hz, 2H), 2.22-2.28 (m, 1H), 2.40 (t, J=6.25 Hz, 2H), 2.54-2.63 (m, 2H), 2.75 (t, J=6.03 Hz, 2H), 3.25-3.26 (m, 4H), 3.71 (s, 3H), 4.21-4.31 (m, 1H), 4.66-4.79 (m, 1H), 5.67 (s, 2H), 6.54 (d, J=7.89 Hz, 1H), 6.65 (d, J=8.77 Hz, 2H), 7.09 (t, J=7.2 Hz, 3H), 7.15-7.18 (m, 2H), 7.25-7.31 (m, 2H), 7.63 (d, J=8.77 Hz, 2H), 7.78 (d, J=8.4 Hz, 2H), 8.06 (t, J=5.48 Hz, 1H), 8.45 (t, J=5.48 Hz, 1H).


Example 15h
N-((1-(4-((2-Ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)phenyl)-1H-1,2,3-triazol-4-yl)methyl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide (Compound 15h)
(Step 1)

A crude product (0.18 g) of 1-(4-azidobenzyl)-2-ethyl-1,5,6,7-tetrahydro-4H-indol-4-one was obtained from 1-(4-aminobenzyl)-2-ethyl-1,5,6,7-tetrahydro-4H-indol-4-one (0.2 g, 0.74 mmol) obtained in step 2 of reference example 23 in the same manner as in step 2 of example 3a.


ESIMS, (M+H)+, m/z: 295.


(Step 2)

4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)benzamide (0.15 g, 68%) was obtained from 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzoic acid (0.2 g, 0.59 mmol) obtained in step 7 of reference example 1 in the same manner as in step 2 of example 3b.


ESIMS, (M+H)+, m/z: 376.


(Step 3)

Compound 15h (0.03 g, total yield of 2 steps 6.1%) was obtained from the crude product (0.18 g) of 1-(4-azidobenzyl)-2-ethyl-1,5,6,7-tetrahydro-4H-indol-4-one obtained in step 1 and 4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)benzamide (0.23 g, 0.61 mmol) obtained in step 2 in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 670: 1H-NMR (DMSO-d6, δ) 0.99-1.12 (m, 9H), 1.20-1.22 (m, 1H), 1.99-2.02 (m, 2H), 2.23-2.32 (m, 3H), 2.44 (q, J=7.6 Hz, 2H), 2.56-2.63 (m, 2H), 2.68 (t, J=6.2 Hz, 2H), 4.21-4.32 (m, 1H), 4.54 (d, J=5.6 Hz, 2H), 4.65-4.80 (m, 1H), 5.23 (s, 2H), 6.14 (s, 1H), 6.58 (d, J=7.89 Hz, 1H), 6.66 (d, J=8.77 Hz, 2H), 7.09 (d, J=7.67 Hz, 1H), 7.16 (dd, J=12.4, 8.0 Hz, 3H), 7.24-7.31 (m, 2H), 7.68 (dd, J=18.96, 8.66 Hz, 2H), 7.86 (d, J=12.4 Hz, 2H), 8.56 (s, 1H), 8.61 (t, J=5.26 Hz, 1H).


Example 15i
N1-(4-((2-Ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)phenyl)-N5-(4-(((2S,4R))-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 15i)

Compound 15i (0.027 g, 8%) was obtained from 5-[(4-{[(2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl]amino}phenyl)amino]-5-oxopentanoic acid (0.1 g, 0.23 mmol) obtained in step 2 of example 4a and 1-(4-aminobenzyl)-2-ethyl-1,5,6,7-tetrahydro-4H-indol-4-one (0.071 g, 0.23 mmol) obtained in reference example 23 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 674; 1H-NMR (DMSO-d6, δ) 0.98-1.11 (m, 9H), 1.13-1.19 (m, 1H), 1.86 (quin, J=3.8 Hz, 2H), 2.00 (quin, J=6.0 Hz, 2H), 2.20-2.35 (m, 7H), 2.42 (q, J=7.6 Hz, 2H), 2.53-2.61 (m, 2H), 2.67 (t, J=6.03 Hz, 2H), 4.07-4.13 (m, 1H), 4.67-4.79 (m, 1H), 5.06 (s, 2H), 5.83 (d, J=7.89 Hz, 1H), 6.09 (s, 1H), 6.58 (d, J=8.77 Hz, 2H), 6.91 (d, J=8.55 Hz, 2H), 7.16 (d, J=3.51 Hz, 2H), 7.23-7.30 (m, 4H), 7.55 (d, J=8.55 Hz, 2H), 9.50 (s, 1H), 9.90 (s, 1H).


Example 15j
2-(4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexylidene)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)acetamide (Compound 15j)
(Step 1)

4-(((2S*,4R*)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexan-1-one (418 mg, 60%) was obtained from 1-((2S*,4R*)-4-(((1s,4S)-4-hydroxycyclohexyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (70.3 mg, 2.22 mmol) obtained in step 1 of example 7d in the same manner as in step 4 of example 7r.


ESIMS, (M+H)+, m/z: 315.


(Step 2)

Triethyl phosphonoacetate (48.1 mg, 0.215 mmol) was dissolved in THF (0.22 mL), then sodium hydride (60% w/w (mineral oil mixture), 8.6 mg, 0.215 mmol) was added to the solution, and the mixture was stirred at 0° C. for 30 minutes. A THF solution (3 mL) of 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexan-1-one (45.0 mg, 0.143 mmol) obtained in step 1 was added to the reaction mixture, and the mixture was stirred at room temperature for 30 minutes. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=7/3 to 1/1) to give ethyl 2-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexylidene)acetate (38.9 mg, 71%).


ESIMS, (M+H)+, m/z: 385.


(Step 3)

Compound 15j (29.1 mg, 42%) was obtained from ethyl 2-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexylidene)acetate (38 mg, 0.099 mmol) obtained in step 2 and 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride (80.0 mg, 0.198 mmol) obtained in step 3 of example 7d in the same manner as in step 2 of example 8b.


ESIMS, (M+H)+, m/z: 705; 1H-NMR (CDCl3, δ) 1.07-1.43 (m, 17H), 1.94-2.13 (m, 2H), 2.15-2.43 (m, 5H), 2.46-2.72 (m, 4H), 2.89-3.04 (m, 1H), 3.54 (dd, J=12.0, 4.0 Hz, 1H), 3.63-3.74 (m, 1H), 3.79-3.86 (m, 1H), 4.08 (d, J=5.6 Hz, 2H), 4.12-4.20 (m, 1H), 4.78-5.02 (m, 2H), 5.64 (s, 1H), 6.18-6.32 (m, 1H), 6.59 (d, J=8.4 Hz, 2H), 7.04-7.34 (m, 9H), 7.43-7.56 (m, 1H), 7.97-8.12 (m, 1H).


Example 15k
2-Fluoro-2-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexylidene)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)acetamide (Compound 15k)
(Step 1)

Ethyl 2-fluoro-2-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexylidene)acetate (66.7 mg, 95%) was obtained from 4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexan-1-one (55.0 mg, 0.175 mmol) obtained in step 1 of example 15j and triethyl 2-fluoro-2-phosphonoacetate (63.6 mg, 0.262 mmol) in the same manner as in step 2 of example 15j.


ESIMS, (M+H)+, m/z: 403.


(Step 2)

Compound 15k (16.4 mg, 71%) was obtained from ethyl 2-fluoro-2-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexylidene)acetate (13 mg, 0.032 mmol) obtained in step 1 and 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride (26 mg, 0.064 mmol) obtained in step 3 of example 7d in the same manner as in step 2 of example 8b.


ESIMS, (M+H)+, m/z: 723; 1H-NMR (CDCl3, δ) 1.03-1.49 (m, 16H), 1.94-2.14 (m, 3H), 2.20-2.44 (m, 3H), 2.46-2.72 (m, 4H), 2.78-3.01 (m, 2H), 3.54 (dd, J=12.4, 4.0 Hz, 1H), 3.69 (d, J=14.8 Hz, 1H), 3.84 (d, J=6.4 Hz, 2H), 4.07-4.22 (m, 1H), 4.12 (d, J=5.2 Hz, 2H), 4.78-5.21 (m, 1H), 6.60 (d, J=8.8 Hz, 2H), 6.96-7.34 (m, 10H), 7.44-7.57 (m, 1H), 7.76-7.86 (m, 1H).


Example 16a
1-(4-(2-((R)-2,4-Dimethyl-3-oxopiperazin-1-yl)ethoxy)benzoyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 16a)

Methyl (R)-4-(2-(2,4-dimethyl-3-oxopiperazin-1-yl)ethoxy)benzoate (27.0 mg, 0.088 mmol) obtained in reference example 41 was dissolved in a mixed solvent of THF and DMF (1.5 mL, 2:1), then potassium trimethylsilanolate (22.6 mg, 0.176 mmol) was added to the solution, and the mixture was stirred at 60° C. for 3 hours. The reaction mixture was concentrated under reduced pressure. The obtained residue was dissolved in DMF (1.5 mL), then N,N-diisopropylethylamine (0.077 mL, 0.440 mmol), COMU (56.5 mg, 0.132 mmol) and the crude product (37.7 mg) of 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate obtained in step 2 of example 1n were added to the solution, and the mixture was stirred at 60° C. for 15 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with chloroform. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L ammonium bicarbonate aqueous solution/acetonitrile=70/30 to 60/40) to give compound 16a (11.3 mg, total yield of 2 steps 19%).


ESIMS, (M+H)+, m/z: 667. 1H NMR (CHCl3, δ): 0.76-0.94 (m, 1H), 1.08-1.17 (m, 6H), 1.19-1.34 (m, 1H), 1.41 (d, J=6.8 Hz, 3H), 2.29-2.43 (m, 1H), 2.52-2.68 (m, 5H), 2.73-2.82 (m, 1H), 2.84-2.92 (m, 1H), 2.95 (s, 3H), 2.99-3.09 (m, 1H), 3.11-3.19 (m, 1H), 3.22-3.51 (m, 4H), 3.76-3.91 (m, 1H), 4.07-4.20 (m, 3H), 4.34-4.46 (m, 2H), 4.62-4.76 (m, 1H), 4.84-5.01 (m, 1H), 6.60 (d, J=9.2 Hz, 2H), 6.91 (d, J=9.2 Hz, 2H), 7.11-7.23 (m, 2H), 7.33 (d, J=9.2 Hz, 2H), 7.63 (d, J=9.2 Hz, 2H).


Example 16b
4-(2-((R)-2,4-Dimethyl-3-oxopiperazin-1-yl)ethoxy)-N-((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1,3,4-oxadiazol-2-yl)methyl)benzamide (Compound 16b)

Compound 16b (20.0 mg, 46%) was obtained from methyl (R)-4-(2-(2,4-dimethyl-3-oxopiperazin-1-yl)ethoxy)benzoate (20.1 mg, 0.066 mmol) obtained in reference example 41 and 1-((2S,4R)-4-((4-(5-(aminomethyl)-1,3,4-oxadiazol-2-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (25.8 mg, 0.066 mmol) obtained in step 3 of example 5g in the same manner as in example 16a.


ESIMS, (M+H)+, m/z: 666. 1H NMR (CHCl3, δ): 1.09-1.19 (m, 6H), 1.23-1.39 (m, 1H), 1.41 (d, J=6.8 Hz, 3H), 2.31-2.42 (m, 1H), 2.53-2.72 (m, 2H), 2.73-2.82 (m, 1H), 2.84-2.94 (m, 1H), 2.94 (s, 3H), 3.02-3.17 (m, 2H), 3.23-3.42 (m, 3H), 4.07-4.18 (m, 2H), 4.22-4.32 (m, 1H), 4.35-4.44 (m, 1H), 4.91 (d, J=5.6 Hz, 2H), 4.92-5.03 (m, 1H), 6.67 (d, J=9.2 Hz, 2H), 6.93 (d, J=9.2 Hz, 2H), 7.14-7.33 (m, 5H), 7.78-7.93 (m, 4H).


Example 16c
4-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)-N-((5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1,3,4-oxadiazol-2-yl)methyl)piperazine-1-carboxamide (Compound 16c)

The crude product (0.1 g) of 3-(3,5-dimethylisoxazol-4-yl)-5-(piperazin-1-ylmethyl)phenol trifluoroacetate obtained in step 2 of reference example 37 was dissolved in DMF (10 mL), then triethylamine (0.18 mL, 1.31 mmol) and 4-nitrophenylchloroformate (0.079 g, 0.39 mmol) were added to the solution, and the mixture was stirred at 70° C. for 16 hours. To the reaction mixture were added 1-((2S,4R)-4-((4-(5-(aminomethyl)-1,3,4-oxadiazol-2-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.133 g, 0.26 mmol) obtained in step 3 of example 5g and DMAP (0.08 g, 0.66 mmol), and the mixture was stirred at 70° C. for 5 hours. The resulting reaction mixture was diluted with water and extracted 3 times with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by reverse phase HPLC (10 mmol/L ammonium bicarbonate aqueous solution/acetonitrile=100/0 to 72/28) to give compound 16c (0.021 g, total yield of 2 steps 11%).


ESIMS, (M+H)+, m/z: 707. 1H NMR (DMSO-d6, δ): 1.01 (t, J=7.32 Hz, 3H), 1.06 (d, J=6.41 Hz, 3H), 1.20-1.28 (m, 1H), 2.17-2.27 (m, 4H), 2.31-2.42 (m, 7H), 2.55-2.67 (m, 2H), 3.32 (brs, 4H), 3.44 (s, 2H), 4.29-4.33 (m, 1H), 4.44 (d, J=5.49 Hz, 2H), 4.64-4.80 (m, 1H), 6.61-6.64 (m, 1H), 6.70 (s, 1H), 6.74 (s, 1H), 6.77-6.82 (m, 2H), 6.87 (d, J=7.63 Hz, 1H), 7.11 (d, J=7.32 Hz, 1H), 7.16-7.20 (m, 1H), 7.25-7.34 (m, 3H), 7.68 (d, J=8.85 Hz, 2H), 9.58 (s, 1H).


Example 16d
1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)piperidine-4-carboxamide (Compound 16d)
(Step 1)

1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)-N-(prop-2-yn-1-yl)piperidine-4-carboxamide (0.140 g, 74%) was obtained from 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylic acid (0.1 g, 0.30 mmol) obtained in step 3 of reference example 24 in the same manner as in step 3 of example 12f.


ESIMS, (M+H)+, m/z: 369


(Step 2)

Compound 16d (0.033 g, total yield of 2 steps 13%) was obtained from 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)-N-(prop-2-yn-1-yl)piperidine-4-carboxamide (0.130 g, 0.35 mmol) obtained in step 1 and the crude product (0.178 g) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 704. 1H NMR (DMSO-d6, δ): 0.98-1.09 (m, 6H), 1.14-1.27 (m, 1H), 1.81-1.93 (m, 4H), 2.24 (s, 4H), 2.42 (s, 3H), 2.57-2.65 (m, 2H), 2.84-2.99 (m, 2H), 3.14-3.24 (m, 1H), 3.36-3.42 (m, 2H), 4.18-4.41 (m, 5H), 4.70-4.79 (m, 1H), 6.52 (d, J=7.93 Hz, 1H), 6.70 (d, J=8.85 Hz, 2H), 6.80-6.87 (m, 1H), 6.98-7.04 (m, 2H), 7.13-7.21 (m, 2H), 7.25-7.35 (m, 2H), 7.52 (d, J=9.16 Hz, 2H), 8.33 (s, 1H), 8.48 (brs, 1H), 9.94 (brs, 1H).


Example 16e
N1-(4-(2-((R)-2,4-Dimethyl-3-oxopiperazin-1-yl)ethoxy)phenyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16e)

Compound 16e (21.9 mg, total yield of 2 steps 44%) was obtained from the crude product (20 mg) of (R)-4-(2-(4-aminophenoxy)ethyl)-1,3-dimethylpiperazin-2-one trifluoroacetate obtained in step 3 of reference example 40 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (31.8 mg, 0.075 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 669. 1H NMR (CHCl3, δ): 0.77-0.95 (m, 6H), 1.02-1.47 (m, 5H), 1.51-1.69 (m, 2H), 1.72 (d, J=7.6 Hz, 3H), 2.45-2.69 (m, 5H), 3.01 (s, 3H), 3.42-3.83 (m, 5H), 3.97-4.08 (m, 1H), 4.09-4.18 (m, 1H), 4.25-4.42 (m, 2H), 4.65-4.98 (m, 2H), 6.62 (d, J=9.2 Hz, 2H), 6.81 (d, J=9.2 Hz, 2H), 7.09-7.33 (m, 4H), 7.45 (d, J=9.2 Hz, 2H), 7.76 (s, 1H), 8.02 (d, J=7.6 Hz, 1H), 8.23 (s, 1H).


Example 16f
N1-(1-(4-(Ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-3-yl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16f)

Compound 16f (0.030 g, total yield of 2 steps 15%) was obtained from the crude product (0.111 g) of N-(4-((3-aminopiperidin-1-yl)methyl)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide hydrochloride obtained in step 7 of reference example 43 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.100 g, 0.23 mmol) obtained in step 2 of example 6k in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 840. 1H NMR (DMSO-d6, δ): 0.98-1.02 (m, 6H), 1.04-1.11 (m, 1H), 1.15-1.21 (m, 3H), 1.28-1.41 (m, 1H), 1.56-1.78 (m, 5H), 2.06 (t, J=7.2 Hz, 2H), 2.18-2.28 (m, 3H), 2.41-2.49 (m, 2H), 2.55-2.67 (m, 4H), 3.06-3.13 (m, 2H), 3.16-3.22 (m, 2H), 3.38 (s, 3H), 3.60 (brs, 1H), 3.66 (s, 3H), 4.06-4.15 (m, 1H), 4.69-4.73 (m, 1H), 5.83-5.87 (m, 2H), 6.57 (d, J=8.8 Hz, 2H), 6.95 (s, 1H), 7.11-7.14 (m, 3H), 7.21-7.31 (m, 4H), 7.36 (d, J=8.4 Hz, 1H), 7.56-7.60 (m, 2H), 9.48 (s, 1H), 9.76 (s, 1H).


Example 16g
N1-(2-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)-2-azaspiro[3.3]heptan-6-yl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16g)

Compound 16g (0.060 g, total yield of 2 steps 17%) was obtained from the crude product (0.2 g) of 2-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)-2-azaspiro[3.3]hepta n-6-aminium trifluoroacetate obtained in step 2 of reference example 38 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.197 g, 0.47 mmol) obtained in step 2 of example 6k in the same manner as in step 1 of example 1a.


ESIMS, (M+H)+, m/z: 719. 1H NMR (DMSO-d6, δ): 0.98-1.04 (m, 6H), 1.09-1.19 (m, 1H), 1.68-1.75 (m, 2H), 1.93-1.97 (m, 2H), 2.03-2.06 (m, 2H), 2.18 (s, 6H), 2.31-2.36 (m, 2H), 2.37 (s, 3H), 2.56-2.59 (m, 2H), 3.07 (s, 2H), 3.17 (s, 2H), 3.45 (s, 2H), 4.04-4.12 (m, 2H), 4.65-4.72 (m, 1H), 5.84 (d, J=8.0 Hz, 1H), 6.56-6.77 (m, 5H), 7.15 (d, J=2.0 Hz, 2H), 7.23-7.29 (m, 4H), 7.98 (d, J=7.5 Hz, 1H), 9.48 (brs, 2H).


Example 16h
N1-(1-(2-(4-Methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)benzyl)piperidin-4-yl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16h)

Compound 16h (0.040 g, 23%) was obtained from 5-(2-((4-aminopiperidin-1-yl)methyl)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one dihydrochloride (0.094 g, 0.23 mmol) obtained in step 6 of reference example 42 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.100 g, 0.23 mmol) obtained in step 2 of example 6k in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 733. 1H NMR (DMSO-d6, δ): 0.96-1.06 (m, 6H), 1.13-1.15 (m, 1H), 1.21-1.33 (m, 2H), 1.54-1.64 (m, 2H), 1.74-1.78 (m, 2H), 1.89 (t, J=10.53 Hz, 2H), 2.05-2.09 (m, 2H), 2.20 (t, J=7.48 Hz, 3H), 2.51-2.66 (m, 4H), 3.23 (s, 2H), 3.38 (s, 3H), 3.45-3.52 (m, 1H), 3.66 (s, 3H), 4.06-4.15 (m, 1H), 4.67-4.77 (m, 1H), 5.82-5.89 (m, 2H), 6.57 (d, J=8.85 Hz, 2H), 7.10-7.17 (m, 3H), 7.20-7.34 (m, 6H), 7.39-7.45 (m, 1H), 7.52 (s, 1H), 7.69 (d, J=7.63 Hz, 1H), 9.48 (s, 1H).


Example 16i
N1-(3-((3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)amino)bicyclo[1.1.1]pentan-1-yl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16i)

Compound 16i (0.050 g, total yield of 2 steps 30%) was obtained from the crude product (0.079 g) of 3-(((3-aminobicyclo[1.1.1]pentan-1-yl)amino)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol hydrochloride obtained in step 2 of reference example 52 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.100 g, 0.24 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 705. 1H NMR (DMSO-d6, δ): 0.97-1.06 (m, 6H), 1.09-1.19 (m, 1H), 1.69-1.75 (m, 2H), 1.86 (s, 6H), 2.03 (t, J=7.48 Hz, 2H), 2.13-2.28 (m, 6H), 2.37 (s, 3H), 2.54-2.65 (m, 2H), 2.90 (t, J=6.41 Hz, 1H), 3.62 (d, J=6.41 Hz, 2H), 4.07-4.14 (m, 1H), 4.65-4.77 (m, 1H), 5.85 (d, J=8.0 Hz, 1H), 6.57 (d, J=8.85 Hz, 3H), 6.69-6.77 (m, 2H), 7.12-7.20 (m, 2H), 7.23-7.30 (m, 4H), 8.23 (s, 1H), 9.48 (s, 2H).


Example 16j
N1-(3-(4-(Ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16j)

Compound 16j (0.030 g, 22%) was obtained from N-(4-(3-aminophenoxy)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide hydrochloride (0.085 g, 0.18 mmol) obtained in step 7 of reference example 46 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.07 g, 0.16 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 835. 1H NMR (DMSO-d6, δ): 0.98-1.04 (m, 6H), 1.10-1.17 (m, 1H), 1.23 (t, J=7.32 Hz, 3H), 1.85 (quin, J=7.32 Hz, 2H), 2.24-2.29 (m, 3H), 2.32 (t, J=7.32 Hz, 2H), 2.54-2.62 (m, 2H), 3.07-3.12 (m, 2H), 3.36 (s, 3H), 3.54 (s, 3H), 4.11 (ddd, J=12.05, 7.63, 4.12 Hz, 1H), 4.72 (dd, J=12.21, 6.10 Hz, 1H), 5.77 (s, 1H), 5.85 (d, J=7.93 Hz, 1H), 6.51-6.60 (m, 3H), 6.92 (d, J=8.54 Hz, 1H), 7.10 (d, J=2.75 Hz, 1H), 7.15-7.21 (m, 4H), 7.22-7.31 (m, 6H), 7.55 (s, 1H), 9.52 (s, 1H), 9.77 (brs, 1H), 9.92 (s, 1H).


Example 16k
N1-(4-(2-(4-Methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16k)

Compound 16k (0.040 g, 23%) was obtained from 5-(2-(4-aminophenoxy)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one (0.076 g, 0.23 mmol) obtained in step 4 of reference example 49 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.100 g, 0.23 mmol) obtained in step 2 of example 6k in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 728. 1H NMR (DMSO-d6, δ): 0.97-1.07 (m, 6H), 1.11-1.18 (m, 1H), 1.83-1.94 (m, 2H), 2.21-2.37 (m, 5H), 2.55-2.63 (m, 2H), 3.35-3.38 (m, 3H), 3.59 (s, 3H), 4.06-4.16 (m, 1H), 4.68-4.73 (m, 1H), 5.81 (s, 1H), 5.86 (d, J=7.85 Hz, 1H), 6.58 (d, J=8.94 Hz, 2H), 6.82 (d, J=8.4 Hz, 1H), 6.88 (d, J=9.2 Hz, 2H), 7.10-7.19 (m, 3H), 7.22-7.35 (m, 6H), 7.52-7.60 (m, 3H), 9.53 (s, 1H), 9.88 (s, 1H).


Example 16 l
N1-((1r,4r)-4-(4-(Ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)cyclohexyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16l)

Compound 16l (0.016 g, total yield in 2 steps 24%) was obtained from the crude product (0.040 g) of N-(4-(((1r,4r)-4-aminocyclohexyl)oxy)-3-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenyl)ethanesulfonamide hydrochloride obtained in step 6 of reference example 48 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.033 g, 0.08 mmol) obtained in step 2 of example 6k in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 841. 1H NMR (DMSO-d6, δ): 0.98-1.04 (m, 6H), 1.13-1.30 (m, 8H), 1.74-1.77 (m, 4H), 1.93-1.94 (m, 2H), 2.08 (t, J=7.5 Hz, 2H), 2.19-2.24 (m, 3H), 2.56-2.59 (m, 2H), 2.98-3.02 (m, 2H), 3.37 (s, 3H), 3.51-3.59 (m, 1H), 3.67 (s, 3H), 4.06-4.15 (m, 2H), 4.68-4.78 (m, 1H), 5.82-5.89 (m, 2H), 6.57 (d, J=9.0 Hz, 2H), 6.98-7.03 (m, 2H), 7.11-7.16 (m, 3H), 7.23-7.29 (m, 4H), 7.48 (s, 1H), 7.71 (d, J=8.0 Hz, 1H), 9.48 (brs, 2H).


Example 16m
N1-(3-(2-(4-Methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)phenyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16m)

Compound 16m (0.035 g, total yield of 2 steps 25%) was obtained from the crude product (0.07 g) of 5-(2-(3-aminophenoxy)phenyl)-4-methoxy-1-methylpyridin-2(1H)-one hydrochloride obtained in step 4 of reference example 44 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.083 g, 0.19 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 728. 1H NMR (DMSO-d6, δ): 0.97-1.06 (m, 6H), 1.09-1.18 (m, 1H), 1.79-1.89 (m, 2H), 2.25-2.34 (m, 5H), 2.53-2.62 (m, 2H), 3.36 (s, 3H), 3.55 (s, 3H), 4.09-4.12 (m, 2H), 5.78 (s, 1H), 5.85 (d, J=8.0 Hz, 1H), 6.57 (d, J=8.80 Hz, 3H), 6.91 (d, J=8.80 Hz, 1H), 7.15-7.35 (m, 12H), 7.55 (s, 1H), 9.52 (s, 1H), 9.93 (s, 1H).


Example 16n
3-(4-(Ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)benzamide (Compound 16n)
(Step 1)

tert-Butyl ((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)carbamate (252 mg, total yield of 2 steps 53%) was obtained from the crude product (325 mg) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a and commercially available tert-butyl prop-2-yn-1-ylcarbamate (166 mg, 1.07 mmol) in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 491.


(Step 2)

A crude product (253 mg) of 1-((2S,4R)-4-((4-(4-(aminomethyl)-1H-1,2,3-triazol-1-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride was obtained from tert-butyl ((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)carbamate (476 mg, 0.970 mmol) obtained in step 1 in the same manner as in step 2 of example 1a.


ESIMS, (M+H−HCl), m/z: 427.


(Step 3)

Compound 16n (22 mg, total yield of 2 steps 21%) was obtained from the crude product (33 mg, 0.076 mmol) of 1-((2S,4R)-4-((4-(4-(aminomethyl)-1H-1,2,3-triazol-1-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride obtained in step 2 and 3-(4-(ethylsulfonamide)-2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoic acid (35 mg, 0.076 mmol) obtained in step 6 of reference example 47 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 831. 1H NMR (CHCl3,δ): 1.04-1.19 (m, 6H), 1.25-1.33 (m, 1H), 1.38 (t, J=7.4 Hz, 3H), 2.30-2.47 (m, 1H), 2.52-2.76 (m, 2H), 3.14 (q, J=7.4 Hz, 2H), 3.41 (s, 3H), 3.52 (s, 3H), 4.14-4.25 (m, 1H), 4.67-4.78 (m, 2H), 4.84-5.05 (m, 1H), 5.93 (s, 1H), 6.67 (d, J=8.6 Hz, 2H), 6.87 (d, J=8.6 Hz, 1H), 7.00-7.08 (m, 1H), 7.14-7.38 (m, 8H), 7.39-7.47 (m, 3H), 7.47-7.55 (m, 1H), 7.69-7.78 (m, 1H), 7.98 (s, 1H), 8.40 (br s, 1H).


Example 16o

N1-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-N5-(4-(4-oxo-2,3,4,5-tetra hydro-1H-benzo[b][1,4]diazepine-1-carbonyl)phenyl)glutaramide (Compound 160)


(Step 1)

Commercially available 4-((tert-butoxycarbonyl)amino)benzoic acid (88.0 mg, 0.370 mmol) was dissolved in dichloromethane (3 mL), then oxalyl dichloride (0.054 mL, 0.617 mmol) and DMF (50 μL, mmol) were added to the solution, and the mixture was stirred at room temperature for 15 minutes. The reaction mixture was concentrated under reduced pressure to give a crude product (184 mg) of tert-butyl (4-(4-oxo-2,3,4,5-tetrahydro-1H-benzo[b][1,4]diazepine-1-carbonyl)phenyl)carbamate.


ESIMS, (M+H)+, m/z: 382.


(Step 2)

The crude product (80.0 mg) of tert-butyl (4-(4-oxo-2,3,4,5-tetrahydro-1H-benzo[b][1,4]diazepine-1-carbonyl)phenyl)carbamate obtained in step 1 was dissolved in dichloromethane (1.5 mL), then trifluoroacetic acid (1.5 mL) was added to the solution, the mixture was stirred at room temperature for 4 hours, and the reaction mixture was concentrated under reduced pressure. The obtained residue was dissolved in DMF (1.5 mL) and N,N-diisopropylethylamine (0.154 mL, 0.880 mmol), COMU (113 mg, 0.264 mmol) and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (74.5 mg, 0.176 mmol) obtained in step 2 of example 6k were added to the solution, and the mixture was stirred at room temperature for 18 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution, and the aqueous layer was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by SFC (CHIRALPAK IB, CO2/methanol=40/40, 30 mL/min, rt=6.79 min) to give compound 160 (18.5 mg, total yield of 2 steps 15%).


ESIMS, (M+H)+, m/z: 687. 1H NMR (DMSO-d6, δ) 0.81-0.96 (m, 1H), 1.06-1.43 (m, 6H), 1.91-2.10 (m, 4H), 2.31-2.51 (m, 7H), 2.72-2.90 (m, 2H), 3.53-3.66 (m, 1H), 3.77-3.95 (m, 1H), 4.02-4.23 (m, 1H), 4.59-4.79 (m, 1H), 6.54-6.65 (m, 4H), 6.75-6.98 (m, 5H), 7.05-7.47 (m, 8H), 7.91 (s, 1H).


Example 16p
N1-((1r,4r)-4-((5-(3,5-Dimethylisoxazol-4-yl)-2-oxopyridin-1(2H)-yl)methyl)cyclohexyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 16p)

Compound 16p (0.035 g, total yield of 2 steps 25%) was obtained from the crude product (0.120 g) of 1-(((1r,4r)-4-aminocyclohexyl)methyl)-5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one hydrochloride obtained in step 2 of reference example 51 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.150 g, 0.35 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 708. 1H NMR (DMSO-d6, δ): 0.98-1.18 (m, 11H), 1.54-1.62 (m, 2H), 1.69-1.84 (m, 5H), 2.05 (t, J=7.4 Hz, 2H), 2.18-2.26 (m, 6H), 2.36 (s, 3H), 2.54-2.63 (m, 2H), 3.48-3.52 (m, 1H), 3.77 (d, J=6.8 Hz, 2H), 4.07-4.13 (m, 1H), 4.71-4.75 (m, 1H), 5.85 (d, J=7.6 Hz, 1H), 6.46 (d, J=9.2 Hz, 1H), 6.57 (d, J=8.8 Hz, 2H), 7.15 (d, J=4.0 Hz, 2H), 7.23-7.29 (m, 4H), 7.46 (d, 3=9.2, 2.4 Hz, 1H), 7.67-7.71 (m, 2H), 9.48 (s, 1H).


Example 17a
N1-(4-((5-(3,5-Dimethylisoxazol-4-yl)-2-oxopyridin-1(2H)-yl)methyl)phenyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 17a)

Compound 17a (0.070 g, total yield of 2 steps 15%) was obtained from the crude product (0.150 g) of 1-(4-aminobenzyl)-5-(3,5-dimethylisoxazol-4-yl)pyridin-2(1H)-one hydrochloride obtained in step 4 of reference example 50 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.191 g, 0.45 mmol) obtained in step 2 of example 6k in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 701. 1H NMR (DMSO-d6, δ): 0.96-1.07 (m, 6H), 1.08-1.21 (m, 1H), 1.86 (quin, J=7.34 Hz, 2H), 2.18 (s, 3H), 2.19-2.38 (m, 8H), 2.53-2.64 (m, 2H), 4.11 (ddd, J=11.86, 7.70, 3.91 Hz, 1H), 4.66-4.80 (m, 1H), 5.06 (s, 2H), 5.85 (d, J=7.83 Hz, 1H), 6.49 (d, J=9.29 Hz, 1H), 6.58 (d, J=8.80 Hz, 2H), 7.16 (d, J=3.91 Hz, 2H), 7.22-7.33 (m, 6H), 7.45-7.49 (m, 1H), 7.56 (d, J=8.31 Hz, 2H), 7.87-7.91 (m, 1H), 9.52 (s, 1H), 9.92 (s, 1H).


Example 17b

N1-((1r,4r)-4-((2-Ethyl-4-oxo-4,5,6,7-tetrahydro-1H-indol-1-yl)methyl)cyclohexyl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 17b)


Compound 17b (0.048 g, total yield of 2 steps 20%) was obtained from the crude product (0.110 g) of 1-(((1r,4r)-4-aminocyclohexyl)methyl)-2-ethyl-1,5,6,7-tetrahydro-4H-indol-4-one hydrochloride obtained in step 2 of reference example 39 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (0.150 g, 0.35 mmol) obtained in step 2 of example 6k in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 681. 1H NMR (DMSO-d6, δ): 0.94-1.12 (m, 11H), 1.17 (t, J=7.34 Hz, 3H), 1.53 (d, J=6.85 Hz, 3H), 1.69-1.84 (m, 4H), 1.93-2.09 (m, 4H), 2.17-2.31 (m, 5H), 2.42-2.48 (m, 2H), 2.53-2.64 (m, 2H), 2.72 (t, J=5.87 Hz, 2H), 3.49-3.51 (m, 1H), 3.66 (d, J=7.34 Hz, 2H), 4.05-4.18 (m, 1H), 4.63-4.78 (m, 1H), 5.85 (d, J=7.83 Hz, 1H), 6.04 (s, 1H), 6.57 (d, J=8.80 Hz, 2H), 7.16 (d, J=3.91 Hz, 2H), 7.21-7.34 (m, 4H), 7.66 (d, J=7.83 Hz, 1H), 9.48 (s, 1H).


Example 17c
N1-(4-((3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)amino)bicyclo[2.2.2]octan-1-yl)-N5-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)glutaramide (Compound 17c)
(Step 1)

tert-Butyl (4-((3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)amino)bicyclo[2.2.2]octa n-1-yl)carbamate (44.2 mg, 54%) was obtained from 3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzaldehyde (40.0 mg, 0.184 mmol) obtained in step 1 of reference example 24 and commercially available tert-butyl (4-aminobicyclo[2.2.2]octan-1-yl)carbamate (89.0 mg, 0.368 mmol) in the same manner as in step 3 of example 6d.


ESIMS, (M+H)+, m/z: 442.


(Step 2)

Compound 17c (21.3 mg, 28%) was obtained from tert-butyl (4-((3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)amino)bicyclo[2.2.2]octa n-1-yl)carbamate (44.2 mg, 0.100 mmol) obtained in step 1 and 5-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-5-oxopentanoic acid (42.4 mg, 0.100 mmol) obtained in step 2 of example 6k in the same manner as in step 2 of example 16o.


ESIMS, (M+H)+, m/z: 747. 1H NMR (CHCl3, δ): 0.79-0.94 (m, 1H), 1.04-1.37 (m, 6H), 1.63-1.78 (m, 4H), 1.92-2.07 (m, 5H), 2.14-2.49 (m, 7H), 2.24 (s, 3H), 2.37 (s, 3H), 2.51-2.77 (m, 6H), 3.65 (s, 2H), 3.77-3.87 (m, 1H), 4.09-4.19 (m, 1H), 4.85-5.01 (m, 1H), 5.54 (brs, 1H), 6.56 (d, J=8.4 Hz, 2H), 6.61 (s, 1H), 6.68 (s, 1H), 6.85 (s, 1H), 7.11-7.37 (m, 6H), 7.78 (brs, 1H).


Example 17d
3-(2-(4-Methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)-N-((1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)methyl)benzamide (Compound 17d)
(Step 1)

A crude product (0.160 g) of 3-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)-N-(prop-2-yn-1-yl)benzamide was obtained from 3-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)benzoic acid (0.150 g, 0.43 mmol) obtained in step 4 of reference example 45 and commercially available prop-2-yn-1-amine (0.026 g, 0.47 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 390.


(Step 2)

Compound 17d (0.031 g, total yield of 2 steps 10%) was obtained from the crude product (0.150 g) of 3-(2-(4-methoxy-1-methyl-6-oxo-1,6-dihydropyridin-3-yl)phenoxy)-N-(prop-2-yn-1-yl)benzamide obtained in step 2 and the crude product (0.100 g) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 725. 1H NMR (DMSO-d6, δ): 0.96-1.10 (m, 6H), 1.14-1.26 (m, 1H), 2.19-2.28 (m, 1H), 2.54-2.70 (m, 2H), 3.31 (s, 3H), 3.49 (s, 3H), 4.17-4.32 (m, 1H), 4.54 (d, J=5.87 Hz, 2H), 4.68-4.81 (m, 1H), 5.76 (s, 1H), 6.49 (d, J=7.83 Hz, 1H), 6.78 (d, J=8.80 Hz, 2H), 6.96 (d, J=7.83 Hz, 1H), 7.07 (dd, J=8.07, 2.20 Hz, 1H), 7.12-7.45 (m, 9H), 7.51-7.63 (m, 4H), 8.39 (s, 1H), 9.05 (t, J=5.6 Hz, 1H).


Example 17e
1-((2S,4R)-2-Methyl-4-((4-((((1-(6-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)amino)-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (Compound 17e)
(Step 1)

A crude product (0.160 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((prop-2-yn-1-ylamino)methyl)phenyl)carbamate was obtained from tert-butyl (4-formylphenyl)((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)carbamate (0.150 g, 0.35 mmol) obtained in reference example 8 and commercially available prop-2-yn-1-amine (0.039 g, 0.71 mmol) in the same manner as in step 3 of example 5b.


ESIMS, (M+H)+, m/z: 462.


(Step 2)

1-((2S,4R)-4-((5-Azidopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.180 g, 69%) was obtained from 1-((2S,4R)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.240 g, 0.77 mmol) obtained in step 2 of reference example 17 in the same manner as in step 2 of example 3a.


LC-MS (M+H): 337.


(Step 3)

A crude product (0.180 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((((1-(6-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)carbamate was obtained from the crude product (0.137 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl) obtained in step 1 and 1-((2S,4R)-4-((5-azidopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.100 g, 0.30 mmol) obtained in step 2 in the same manner as in step 3 of example 3a.


LC-MS (M+H): 799.


(Step 4)

Compound 17e (0.020 g, total yield of 2 steps 10%) was obtained from the crude product (0.180 g) of tert-butyl ((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)(4-((((1-(6-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)phenyl)carbamate obtained in step 3 in the same manner as in step 2 of example 1a.


LC-MS (M+H): 699. 1H NMR (DMSO-d6, δ): 0.98-1.07 (m, 12H), 1.11-1.31 (m, 2H), 2.16-2.31 (m, 2H), 2.55-2.69 (m, 4H), 3.59 (s, 2H), 3.76 (s, 2H), 4.09-4.15 (m, 2H), 4.68-4.92 (m, 3H), 5.94 (d, J=7.83 Hz, 1H), 6.59 (d, J=8.31 Hz, 2H), 6.81 (d, J=8.80 Hz, 1H), 7.08 (d, J=8.31 Hz, 2H), 7.13-7.35 (m, 8H), 7.42 (d, J=7.83 Hz, 1H), 7.90 (dd, J=9.05, 2.69 Hz, 1H), 8.37-8.41 (m, 2H).


Example 17g
N-(4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-2-((2-((6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)amino)-2-oxoethyl)amino)acetamide (Compound 17g)
(Step 1)

A crude product (0.300 g) of (9H-fluoren-9-yl)methyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)(2-((6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)amino)-2-oxoethyl)carbamate was obtained from the crude product (0.250 g) of N-(((9H-fluoren-9-yl)methoxy)carbonyl)-N-(2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)glycine obtained in step 2 of example 5d and 1-((2S*,4R*)-4-((5-aminopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one (0.120 g, 0.39 mmol) obtained in reference example 16 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 939.


(Step 2)

Compound 17g (0.042 g, total yield of 2 steps 15%) was obtained from the crude product (0.280 g) of (9H-fluoren-9-yl)methyl (2-((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)amino)-2-oxoethyl)(2-((6-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)amino)-2-oxoethyl)carbamate obtained in step 1 in the same manner as in step 3 of example 5d.


ESIMS, (M+H)+, m/z: 717. 1H NMR (DMSO-d6, δ): 0.98-1.05 (m, 12H), 1.11-1.25 (m, 2H), 2.18-2.32 (m, 2H), 2.57-2.64 (m, 4H), 3.01 (brs, 1H), 3.32 (d, J=7.34 Hz, 4H), 4.09-4.15 (m, 1H), 4.70-4.75 (m, 3H), 5.90 (d, J=8.0 Hz, 1H), 6.61 (t, J=9.05 Hz, 3H), 6.79 (d, J=8.8 Hz, 1H), 7.11-7.22 (m, 4H), 7.25-7.36 (m, 6H), 7.69 (dd, J=8.80, 2.45 Hz, 1H), 8.13 (d, J=2.45 Hz, 1H), 9.64 (s, 1H), 9.77 (s, 1H).


Example 17h
(1R,4S)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-((1-(6-(((2R*,4S*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)pyridin-3-yl)-1H-1,2,3-triazol-4-yl)methyl)cyclohexane-1-carboxamide (Compound 17h)
(Step 1)

(1R,4r)-4-(((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)cyclohexane-1-carboxamide (0.100 g, 76%) was obtained from (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.120 g, 0.35 mmol) obtained in step 3 of reference example 11 and prop-2-yn-1-amine (0.019 g, 0.35 mmol) in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 382.


(Step 2)

Compound 17h (0.032 g, total yield of 2 steps 17%) was obtained from (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)-N-(prop-2-yn-1-yl)cyclohexane-1-carboxamide (0.100 g, 0.26 mmol) obtained in step 1 and the crude product (0.088 g) of 1-((2S*,4R*)-4-((5-azidopyridin-2-yl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one obtained in step 2 of example 10j in the same manner as in step 3 of example 3a.


ESIMS, (M+H)+, m/z: 719. 1H NMR (DMSO-d6,δ): 0.76-0.87 (m, 1H), 0.93-1.14 (m, 14H), 1.24-1.26 (m, 1H), 1.39-1.45 (m, 2H), 1.76 (d, J=12.72 Hz, 3H), 1.89-2.26 (m, 5H), 2.54-2.68 (m, 4H), 3.40-3.51 (m, 1H), 4.34 (d, J=5.87 Hz, 2H), 4.62-4.85 (m, 3H), 6.84 (d, J=9.6 Hz, 1H), 7.16-7.33 (m, 7H), 7.43-7.48 (m, 2H), 7.89 (dd, J=8.80, 2.45 Hz, 1H), 8.27 (t, J=5.62 Hz, 1H), 8.34 (s, 1H), 8.38 (d, J=3.4 Hz, 1H).


Example 17i
1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)-N-(2-(4-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-pyrazol-1-yl)ethyl)piperidine-4-carboxamide (Compound 17i)

Compound 17i (0.048 g, 27%) was obtained from 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylic acid (0.082 g, 0.25 mmol) obtained in step 3 of reference example 24 and 1-((2S,4R)-4-((4-(1-(2-aminoethyl)-1H-pyrazol-4-yl)phenyl)amino)-2-methyl-3,4-dihydroquinolin-1(2H)-yl)propan-1-one hydrochloride (0.110 g, 0.25 mmol) obtained in step 2 of example 6q in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 717. 1H NMR (DMSO-d6, δ): 0.96-1.07 (m, 6H), 1.11-1.22 (m, 1H), 1.51-1.68 (m, 4H), 1.86-2.10 (m, 3H), 2.20 (s, 3H), 2.23-2.30 (m, 1H), 2.37 (s, 3H), 2.59 (dd, J=8.72, 6.98 Hz, 2H), 2.83 (dd, J=7.52, 4.69 Hz, 2H), 3.39-3.46 (m, 4H), 4.06-4.19 (m, 3H), 4.69-4.79 (m, 1H), 6.02 (d, J=7.85 Hz, 1H), 6.59-6.76 (m, 5H), 7.16 (d, J=3.71 Hz, 2H), 7.22-7.31 (m, 4H), 7.69 (d, J=0.65 Hz, 1H), 7.80-7.93 (m, 2H), 9.55 (brs, 1H).


Example 17j
N-(1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidin-4-yl)-2-(3-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)ureido)acetamide (Compound 17j)

Compound 17j (0.019 g, 13%) was obtained from ((4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)carbamoyl)glycine (0.085 g, 0.21 mmol) obtained in step 2 of example 14h and 3-((4-aminopiperidin-1-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol dihydrochloride (0.062 g, 0.21 mmol) obtained in step 2 of reference example 25 in the same manner as in step 3 of example 1b.


ESIMS, (M+H)+, m/z: 695. 1H NMR (DMSO-d6, δ): 0.96-1.06 (m, 6H), 1.09-1.18 (m, 1H), 1.37-1.46 (m, 2H), 1.68-1.76 (m, 2H), 1.97-2.06 (m, 2H), 2.21 (s, 3H), 2.23-2.28 (m, 1H), 2.36-2.41 (m, 3H), 2.53-2.62 (m, 2H), 2.72-2.82 (m, 2H), 3.38-3.46 (m, 2H), 3.52-3.59 (m, 1H), 3.67 (d, J=5.23 Hz, 2H), 4.07-4.11 (m, 1H), 4.67-4.77 (m, 1H), 5.69-5.73 (m, 1H), 6.08 (t, J=5.34 Hz, 1H), 6.55 (d, J=9.2 Hz, 2H), 6.62 (brs, 1H), 6.72 (d, J=15.48 Hz, 2H), 7.08 (d, J=8.72 Hz, 2H), 7.15-7.21 (m, 2H), 7.22-7.30 (m, 2H), 7.84 (d, J=7.2 Hz, 1H), 8.28 (s, 1H), 9.54 (s, 1H).


Example 17k
2-(3-(1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidin-4-yl)ureido)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide (Compound 17k)

Compound 17k (0.025 g, total yield in 2 steps 18%) was obtained from the crude product (0.080 mg) of 2-amino-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)acetamide hydrochloride obtained in step 3 of example 7d and 3-((4-aminopiperidin-1-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol dihydrochloride (0.060 g, 0.19 mmol) obtained in step 2 of reference example 25 in the same manner as in example 7c.


ESIMS, (M+H)+, m/z: 695. 1H NMR (DMSO-d6, δ): 0.96-1.06 (m, 6H), 1.15 (td, J=12.10, 9.16 Hz, 1H), 1.26-1.39 (m, 2H), 1.75 (d, J=9.59 Hz, 2H), 2.04 (t, J=10.25 Hz, 2H), 2.21 (s, 3H), 2.23-2.28 (m, 1H), 2.38 (s, 3H), 2.55-2.63 (m, 2H), 2.68-2.74 (m, 2H), 3.41 (s, 3H), 3.75 (d, J=5.2 Hz, 2H), 4.09-4.13 (m, 1H), 4.55-4.86 (m, 1H), 5.89 (d, J=7.85 Hz, 1H), 6.00 (t, J=5.4 Hz, 1H), 6.18 (d, J=7.41 Hz, 1H), 6.54-6.61 (m, 3H), 6.69-6.79 (m, 2H), 7.15 (d, J=4.0 Hz, 2H), 7.23-7.29 (m, 4H), 9.51 (s, 1H), 9.56 (s, 1H).


Example 17l
1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)-N-(2-(1-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)-1H-1,2,3-triazol-4-yl)ethyl)piperidine-4-carboxamide formate (Compound 17l)
(Step 1)

N-(But-3-yn-1-yl)-1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxamide (0.110 g, 80%) was obtained from 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylic acid (0.120 g, 0.36 mmol) obtained in step 3 of reference example 24 and commercially available but-3-yn-1-amine hydrochloride (0.038 g, 0.36 mmol) in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 382.


(Step 2)

N-(But-3-yn-1-yl)-1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxamide (0.022 g, total yield of 2 steps 10%) was obtained from N-(but-3-yn-1-yl)-1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxamide (0.110 g, 0.29 mmol) obtained in step 1 and the crude product (0.0960 g) of 1-{(2S,4R)-4-[(4-azidophenyl)amino]-2-methyl-3,4-dihydroquinolin-1(2H)-yl}propan-1-one obtained in step 2 of example 3a in the same manner as in step 3 of example 3a.


ESIMS, (M+H−HCOOH)+, m/z: 718. 1H NMR (DMSO-d6, δ): 1.00-1.06 (m, 6H), 1.17-1.25 (m, 1H), 1.55-1.62 (m, 4H), 1.87-1.91 (m, 2H), 2.04-2.07 (m, 1H), 2.20 (s, 3H), 2.22-2.27 (m, 1H), 2.36 (s, 3H), 2.61-2.64 (m, 2H), 2.78-2.83 (m, 4H), 3.36-3.37 (m, 2H), 3.39 (s, 2H), 4.21-4.29 (m, 1H), 4.71-4.78 (m, 1H), 6.48 (d, J=7.93 Hz, 1H), 6.60 (s, 1H), 6.67 (s, 1H), 6.73 (s, 1H), 6.78 (d, J=9.16 Hz, 2H), 7.14-7.20 (m, 2H), 7.26-7.32 (m, 2H), 7.51 (d, J=8.85 Hz, 2H), 7.87 (t, J=5.8 Hz, 1H), 8.24 (brs, 1H), 8.29 (s, 1H), 9.50 (brs, 1H).


Example 17m
N-((5-(1-(3-(3,5-Dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidin-4-yl)-1,3,4-oxadiazol-2-yl)methyl)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)benzamide (Compound 17m)
(Step 1)

tert-Butyl (2-(2-(1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carbonyl)hydrazinyl)-2-oxoethyl)carbamate (0.195 g, 64%) was obtained from 1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidine-4-carboxylic acid (0.20 g, 0.61 mmol) obtained in step 3 of reference example 24 and tert-butyl (2-hydrazinyl-2-oxoethyl)carbamate (0.114 g, 0.61 mmol) in the same manner as in step 1 of example 14o.


ESIMS, (M+H)+, m/z: 503.


(Step 2)

tert-Butyl ((5-(1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidin-4-yl)-1,3,4-oxadiazol-2-yl)methyl)carbamate (0.130 g, 77%) was obtained from tert-butyl (2-(2-(1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl) piperidine-4-carbonyl) hydrazinyl)-2-oxoethyl)carbamate (0.175 g, 0.35 mmol) obtained in step 1 in the same manner as in step 2 of example 3c.


ESIMS, (M+H)+, m/z: 485.


(Step 3)

A crude product (0.09 g) of 3-((4-(5-(aminomethyl)-1,3,4-oxadiazol-2-yl)piperidin-1-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol hydrochloride was obtained from tert-butyl ((5-(1-(3-(3,5-dimethylisoxazol-4-yl)-5-hydroxybenzyl)piperidin-4-yl)-1,3,4-oxadiazol-2-yl)methyl)carbamate (0.110 g, 0.23 mmol) obtained in step 2 in the same manner as in step 2 of example 1a.


ESIMS, (M+H−HCl)+, m/z: 384.


(Step 4)

Compound 17m (0.021 g, total yield of 2 steps 15%) was obtained from the crude product (0.096 g) of 3-((4-(5-(aminomethyl)-1,3,4-oxadiazol-2-yl)piperidin-1-yl)methyl)-5-(3,5-dimethylisoxazol-4-yl)phenol hydrochloride obtained in step 3 and (1R,4r)-4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)cyclohexane-1-carboxylic acid (0.065 g, 0.19 mmol) obtained in step 2 of reference example 11 in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 705. 1H NMR (DMSO-d6, δ): 0.98-1.08 (m, 6H), 1.14-1.26 (m, 1H), 1.66-1.76 (m, 2H), 1.96 (d, J=10.68 Hz, 2H), 2.10 (t, J=10.38 Hz, 2H), 2.20 (s, 3H), 2.22-2.27 (m, 1H), 2.38 (s, 3H), 2.56-2.65 (m, 2H), 2.82 (d, J=11.29 Hz, 2H), 2.90-2.96 (m, 1H), 3.44 (s, 2H), 4.28-4.31 (m, 1H), 4.60 (d, J=5.80 Hz, 2H), 4.69-4.79 (m, 1H), 6.59-6.76 (m, 6H), 7.09 (d, J=7.63 Hz, 1H), 7.16 (t, J=7.0 Hz, 1H), 7.25-7.32 (m, 2H), 7.66 (d, J=8.85 Hz, 2H), 8.74 (t, J=5.80 Hz, 1H), 9.51 (s, 1H).


Example 17n
1-(3-((((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[1.1.1]pentane-1-carbonyl)-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 17n)

Compound 170 (0.030 g, total yield of 2 steps 10%) was obtained from 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[2.2.2]octane-1-carboxylic acid (0.09 g, 0.26 mmol) obtained in step 2 of reference example 35 and the crude product (0.133 g) of 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate obtained in step 2 of example 1n in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 718. 1H NMR (DMSO-d6, δ): 0.77-0.89 (m, 1H), 0.92-0.95 (m, 3H), 0.98-1.04 (m, 9H), 1.11-1.16 (m, 1H), 1.91-1.93 (m, 7H), 2.04-2.15 (m, 1H), 2.17-2.27 (m, 1H), 2.43-2.47 (m, 1H), 2.54-2.62 (m, 3H), 2.69 (d, J=12.5 Hz, 1H), 2.79 (d, J=13.0 Hz, 1H), 3.27 (brs, 1H), 3.41-3.47 (m, 1H), 3.89-3.90 (m, 1H), 3.91-4.01 (m, 1H), 4.09-4.15 (m, 1H), 4.28-4.31 (m, 1H), 4.32-4.41 (m, 1H), 4.56-4.66 (m, 1H), 4.69-4.79 (m, 1H), 5.92 (d, J=8.0 Hz, 1H), 6.60 (d, J=9.0 Hz, 2H), 7.14-7.17 (m, 2H), 7.24-7.33 (m, 7H), 7.43-7.45 (m, 1H), 9.70 (s, 1H).


Example 17o
1-(4-((((2S,4R)-2-Methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[2.2.2]octane-1-carbonyl)-N-(4-(((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 17o)
(Step 1)

Compound 17p (0.030 g, total yield of 2 steps 10%) was obtained from the crude product (0.160 g) of 4-((((2S*,4R*)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)methyl)bicyclo[2.2.2]octane-1-carboxylic acid obtained in step 2 of reference example 36 and the crude product (0.210 g) of 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate obtained in step 2 of example 1n in the same manner as in step 1 of example 140.


ESIMS, (M+H)+, m/z: 760. 1H NMR (DMSO-d6, δ): 0.77-0.88 (m, 1H), 0.94 (t, J=7.48 Hz, 3H), 0.97-1.06 (m, 9H), 1.10-1.17 (m, 1H), 1.40-1.48 (m, 6H), 1.52-1.61 (m, 1H), 1.71 (t, J=7.78 Hz, 6H), 2.06-2.16 (m, 1H), 2.20-2.26 (m, 1H), 2.30-2.37 (m, 1H), 2.44-2.49 (m, 1H), 2.54-2.66 (m, 4H), 3.22 (dd, J=12.21, 3.66 Hz, 1H), 3.39-3.45 (m, 1H), 3.61 (brs, 1H), 3.81-3.97 (m, 1H), 4.07-4.17 (m, 1H), 4.35-4.50 (m, 2H), 4.56-4.64 (m, 1H), 4.68-4.76 (m, 1H), 5.92 (d, J=7.63 Hz, 1H), 6.60 (d, J=8.85 Hz, 2H), 7.14-7.17 (m, 2H), 7.20-7.34 (m, 7H), 7.43-7.49 (m, 1H), 9.69 (s, 1H).


Example 17p
1-(4-(1-(3-Chloro-[1,2,4]triazolo[4,3-b]pyridazin-6-yl)piperidin-4-yl)benzoyl)-N-(4-(((2S,4R)-2-methyl-1-propionyl-1,2,3,4-tetrahydroquinolin-4-yl)amino)phenyl)azetidine-3-carboxamide (Compound 17p)
(Step 1)

Commercially available 3,6-dichloro-[1,2,4]triazolo[4,3-b]pyridazine (80.0 mg, 0.423 mmol) was dissolved in DMF (4 mL), then N,N-diisopropylethylamine (0.237 ml, 1.36 mmol) and commercially available methyl 4-(piperidin-4-yl)benzoate (97.0 mg, 0.444 mmol) were added to the solution, the mixture was stirred at room temperature for 10 hours, and the reaction mixture was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (heptane/ethyl acetate=50/50 to 0/100) to give methyl 4-(1-(3-chloro-[1,2,4]triazolo[4,3-b]pyridazin-6-yl)piperidin-4-yl)benzoate (99.5 mg, 63%).


ESIMS, (M+H)+, m/z: 372.


(Step 2)

Compound 17p (8.6 mg, 18%) was obtained from methyl 4-(1-(3-chloro-[1,2,4]triazolo[4,3-b]pyridazin-6-yl)piperidin-4-yl)benzoate (24.8 mg, 0.067 mmol) obtained in step 1 and the crude product (26.0 mg) of 1-[(2S,4R)-4-{[4-(3-aminoazetidine-1-carbonyl)phenyl]amino}-2-methyl-3,4-dihydroquinolin-1(2H)-yl]propan-1-one trifluoroacetate obtained in step 2 of example 1n in the same manner as in example 16a.


ESIMS, (M+H)+, m/z: 732. 1H NMR (CHCl3, δ): 0.79-0.93 (m, 1H), 1.09-1.18 (m, 6H), 1.69-1.88 (m, 2H), 1.96-2.08 (m, 2H), 2.29-2.42 (m, 1H), 2.50-2.69 (m, 2H), 2.82-2.93 (m, 1H), 3.12 (dd, J=11.2, 11.2 Hz, 2H), 3.44-3.56 (m, 1H), 3.79-3.91 (m, 1H), 4.09-4.18 (m, 1H), 4.34-4.47 (m, 5H), 4.62-4.73 (m, 1H), 4.83-4.97 (m, 1H), 6.59 (d, J=8.0 Hz, 2H), 7.05 (d, J=10.4 Hz, 1H), 7.13-7.24 (m, 1H), 7.18 (dd, J=7.2, 7.2 Hz, 1H), 7.21-7.31 (m, 4H), 7.35 (d, J=8.0 Hz, 2H), 7.62 (d, J=8.0 Hz, 2H), 7.74 (m, 1H), 7.83 (d, J=10.4 Hz, 1H).

Claims
  • 1. A BET degrader, comprising as an active ingredient a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof:
Priority Claims (1)
Number Date Country Kind
2019-180349 Sep 2019 JP national
PCT Information
Filing Document Filing Date Country Kind
PCT/JP2020/037074 9/30/2020 WO