BICYCLIC COMPOUNDS

Abstract
Provided herein are compounds of Formula (I), or pharmaceutically acceptable salts thereof, pharmaceutical compositions that include a compound described herein (including pharmaceutically acceptable salts of a compound described herein) and methods of synthesizing the same. Also provided herein are methods of treating diseases and/or conditions with a compound of Formula (I), or a pharmaceutically acceptable salt thereof.
Description
REFERENCE TO SEQUENCE LISTING

The present application is filed with a Sequence Listing in Electronic format. The Sequence Listing is provided as a file entitled ALIG056.txt, created Oct. 13, 2021, which is approximately 4 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.


BACKGROUND
Field

The present application relates to the fields of chemistry, biochemistry and medicine. Disclosed herein are compounds of Formula (I), or pharmaceutically acceptable salt thereof, pharmaceutical compositions that include a compound described herein (including pharmaceutically acceptable salts of a compound described herein) and methods of synthesizing the same. Also disclosed herein are methods of treating diseases and/or conditions with a compound of Formula (I), or a pharmaceutically acceptable salt thereof.


Description

The hepatitis B virus (HBV) is a DNA virus and a member of the Hepadnaviridae family. HBV infects more than 300 million worldwide, and is a causative agent of liver cancer and liver disease such as chronic hepatitis, cirrhosis, and hepatocellular carcinoma. Although there are approved drugs for treating HBV, by either boosting the immune system or slowing down the replication of the HBV virus, HBV continues to be a problem due to the drawbacks associated with each of the approved drugs.


SUMMARY

Some embodiments disclosed herein relate to a compound of Formula (I), or a pharmaceutically acceptable salt thereof.


Some embodiments disclosed herein relate to a pharmaceutical composition that can contain an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof.


Some embodiments described herein relate to a method of treating a HBV and/or HDV infection that can include administering to a subject identified as suffering from the HBV and/or HDV infection an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for the use of treating a HBV and/or HDV infection.


Some embodiments disclosed herein relate to a method of inhibiting replication of HBV and/or HDV that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for the use of inhibiting the replication HBV and/or HDV.


These are other embodiments are described in greater detail below.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 shows the plate map of compound treatment for the HBV-DNA Antiviral Assay described herein.





DETAILED DESCRIPTION

HBV is a partially double-stranded circular DNA of about 3.2 kilobase (kb) pairs, and is classified into eight genotypes, A to H. The HBV replication pathway has been studied in great detail. T. J. Liang, Hepatology (2009) 49(5 Suppl):S13-S21. On part of replication includes the formation of the covalently closed circular (cccDNA) form. The presence of the cccDNA gives rise to the risk of viral reemergence throughout the life of the host organism. HBV carriers can transmit the disease for many years. An estimated 300 million people are living with hepatitis B virus infection, and it is estimated that over 750,000 people worldwide die of hepatitis B each year. In addition, immunosuppressed individuals or individuals undergoing chemotherapy are especially at risk for reactivation of a HBV infection. HBV can be acute and/or chronic. Acute HBV infection can be either asymptomatic or present with symptomatic acute hepatitis.


HBV can be transmitted by blood, semen, and/or another body fluid. This can occur through direct blood-to-blood contact, unprotected sex, sharing of needles, and from an infected mother to her baby during the delivery process. The HBV surface antigen (HBsAg) is most frequently used to screen for the presence of this infection. Currently available medications do not cure a HBV and/or HDV infection. Rather, the medications suppress replication of the virus.


The hepatitis D virus (HDV) is a DNA virus, also in the Hepadnaviridae family of viruses. HDV can propagate only in the presence of HBV. The routes of transmission of HDV are similar to those for HBV. Transmission of HDV can occur either via simultaneous infection with HBV (coinfection) or in addition to chronic hepatitis B or hepatitis B carrier state (superinfection). Both superinfection and coinfection with HDV results in more severe complications compared to infection with HBV alone. These complications include a greater likelihood of experiencing liver failure in acute infections and a rapid progression to liver cirrhosis, with an increased risk of developing liver cancer in chronic infections. In combination with hepatitis B, hepatitis D has the highest fatality rate of all the hepatitis infections, at 20%. There is currently no cure for hepatitis D.


Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art. All patents, applications, published applications and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise. In the event that there are a plurality of definitions for a term herein, those in this section prevail unless stated otherwise.


Whenever a group is described as being “optionally substituted” that group may be unsubstituted or substituted with one or more of the indicated substituents. Likewise, when a group is described as being “unsubstituted or substituted” if substituted, the substituent(s) may be selected from one or more of the indicated substituents. If no substituents are indicated, it is meant that the indicated “optionally substituted” or “substituted” group may be substituted with one or more group(s) (such as 1, 2 or 3) individually and independently selected from deuterium, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl), heterocyclyl(alkyl), hydroalkyl, hydroxy, alkoxyalkyl, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, C-amido, N-amido, S-sulfonamido, N-sulfonamido, C-carboxy, O-carboxy, C-amido(alkyl), isocyanato, thiocyanato, nitro, azido, silyl, sulfenyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonamido, an amino, a mono-substituted amino group, a di-substituted amino group, an unsubstituted C-amido(C1-3 alkyl), —O-(an unsubstituted C1-4 alkyl)-OH, —O-(an unsubstituted C1-4 alkyl)-(an unsubstituted alkoxy), —O-(an unsubstituted C1-4 alkyl)-(an unsubstituted C-carboxy), —O-(C1-3 alkyl)-O-(an unsubstituted C-amido), —O-(an unsubstituted C1-4 alkyl)-NH2, —O-(an unsubstituted C1-4 alkyl)-NH(an unsubstituted C1-4 alkyl), —O-(an unsubstituted C1-4 alkyl)-N(an unsubstituted C1-4 alkyl)2 and an unsubstituted —O-(an unsubstituted C1-4 alkyl)-CN.


As used herein, “Ca to Cb” in which “a” and “b” are integers refer to the number of carbon atoms in an alkyl, alkenyl or alkynyl group, or the number of carbon atoms in the ring of a cycloalkyl, cycloalkenyl, aryl, heteroaryl or heterocyclyl group. That is, the alkyl, alkenyl, alkynyl, ring of the cycloalkyl, ring of the cycloalkenyl, ring of the aryl, ring of the heteroaryl or ring of the heterocyclyl can contain from “a” to “b”, inclusive, carbon atoms. Thus, for example, a “C1 to C4 alkyl” group refers to all alkyl groups having from 1 to 4 carbons, that is, CH3—, CH3CH2—, CH3CH2CH2—, (CH3)2CH—, CH3CH2CH2CH2—, CH3CH2CH(CH3)— and (CH3)3C—. If no “a” and “b” are designated with regard to an alkyl, alkenyl, alkynyl, cycloalkyl cycloalkenyl, aryl, heteroaryl or heterocyclyl group, the broadest range described in these definitions is to be assumed.


As used herein, “alkyl” refers to a straight or branched hydrocarbon chain that comprises a fully saturated (no double or triple bonds) hydrocarbon group. The alkyl group may have 1 to 20 carbon atoms (whenever it appears herein, a numerical range such as “1 to 20” refers to each integer in the given range; e.g., “1 to 20 carbon atoms” means that the alkyl group may consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and including 20 carbon atoms, although the present definition also covers the occurrence of the term “alkyl” where no numerical range is designated). The alkyl group may also be a medium size alkyl having 1 to 10 carbon atoms. The alkyl group could also be a lower alkyl having 1 to 6 carbon atoms. The alkyl group of the compounds may be designated as “C1-C4 alkyl” or similar designations. By way of example only, “C1-C4 alkyl” indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl and t-butyl. Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl and hexyl. The alkyl group may be substituted or unsubstituted.


As used herein, “alkenyl” refers to an alkyl group that contains in the straight or branched hydrocarbon chain one or more double bonds. The length of an alkenyl can vary. For example, the alkenyl can be a C2-4 alkenyl, C2-6 alkenyl or C2-8 alkenyl. Examples of alkenyl groups include allenyl, vinylmethyl and ethenyl. An alkenyl group may be unsubstituted or substituted.


As used herein, “alkynyl” refers to an alkyl group that contains in the straight or branched hydrocarbon chain one or more triple bonds. The length of an alkynyl can vary. For example, the alkynyl can be a C2-4 alkynyl, C2-6 alkynyl or C2-8 alkynyl. Examples of alkynyls include ethynyl and propynyl. An alkynyl group may be unsubstituted or substituted.


As used herein, “cycloalkyl” refers to a completely saturated (no double or triple bonds) mono- or multi-cyclic hydrocarbon ring system. When composed of two or more rings, the rings may be joined together in a fused fashion. Cycloalkyl groups can contain 3 to 10 atoms in the ring(s). 3 to 8 atoms in the ring(s) or 3 to 6 atoms in the ring(s). A cycloalkyl group may be unsubstituted or substituted. Typical cycloalkyl groups include, but are in no way limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.


As used herein, “cycloalkenyl” refers to a mono- or multi-cyclic hydrocarbon ring system that contains one or more double bonds in at least one ring; although, if there is more than one, the double bonds cannot form a fully delocalized pi-electron system throughout all the rings (otherwise the group would be “aryl,” as defined herein). When composed of two or more rings, the rings may be connected together in a fused fashion. A cycloalkenyl can contain 3 to 10 atoms in the ring(s) or 3 to 8 atoms in the ring(s). A cycloalkenyl group may be unsubstituted or substituted.


As used herein, “aryl” refers to a carbocyclic (all carbon) monocyclic or multicyclic aromatic ring system (including fused ring systems where two carbocyclic rings share a chemical bond) that has a fully delocalized pi-electron system throughout all the rings. The number of carbon atoms in an aryl group can vary. For example, the aryl group can be a C6-C14 aryl group, a C6-C10 aryl group, or a C6 aryl group. Examples of aryl groups include, but are not limited to, benzene, naphthalene and azulene. An aryl group may be substituted or unsubstituted.


As used herein, “heteroaryl” refers to a monocyclic, bicyclic and tricyclic aromatic ring system (a ring system with fully delocalized pi-electron system) that contain(s) one or more heteroatoms (for example, 1 to 5 heteroatoms), that is, an element other than carbon, including but not limited to, nitrogen, oxygen and sulfur. The number of atoms in the ring(s) of a heteroaryl group can vary. For example, the heteroaryl group can contain 4 to 14 atoms in the ring(s), 5 to 10 atoms in the ring(s) or 5 to 6 atoms in the ring(s). Furthermore, the term “heteroaryl” includes fused ring systems where two rings, such as at least one aryl ring and at least one heteroaryl ring, or at least two heteroaryl rings, share at least one chemical bond. Examples of heteroaryl rings include, but are not limited to, furan, furazan, thiophene, benzothiophene, phthalazine, pyrrole, oxazole, benzoxazole, 1,2,3-oxadiazole, 1,2,4-oxadiazole, thiazole, 1,2,3-thiadiazole, 1,2,4-thiadiazole, benzothiazole, imidazole, benzimidazole, indole, indazole, pyrazole, benzopyrazole, isoxazole, benzoisoxazole, isothiazole, triazole, benzotriazole, thiadiazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, quinoline, isoquinoline, quinazoline, quinoxaline, cinnoline and triazine. A heteroaryl group may be substituted or unsubstituted.


As used herein, “heterocyclyl” refers to a monocyclic, bicyclic and tricyclic ring system wherein carbon atoms together with from 1 to 5 heteroatoms constitute said ring system. A heterocycle may optionally contain one or more unsaturated bonds situated in such a way, however, that a fully delocalized pi-electron system does not occur throughout all the rings. The number of atoms in the ring(s) of a heterocyclyl group can vary. For example, the heterocyclyl group can contain 4 to 14 atoms in the ring(s), 5 to 10 atoms in the ring(s) or 5 to 6 atoms in the ring(s). The heteroatom(s) is an element other than carbon including, but not limited to, oxygen, sulfur and nitrogen. A heterocycle may further contain one or more carbonyl or thiocarbonyl functionalities, so as to make the definition include oxo-systems and thio-systems such as lactams, lactones, cyclic imides, cyclic thioimides and cyclic carbamates. When composed of two or more rings, the rings may be joined together in a fused fashion. Additionally, any nitrogens in a heterocyclyl may be quaternized. Heterocyclyl groups may be unsubstituted or substituted. Examples of such “heterocyclyl groups include but are not limited to, 1,3-dioxin, 1,3-dioxane, 1,4-dioxane, 1,2-dioxolane, 1,3-dioxolane, 1,4-dioxolane, 1,3-oxathiane, 1,4-oxathiin, 1,3-oxathiolane, 1,3-dithiole, 1,3-dithiolane, 1,4-oxathiane, tetrahydro-1,4-thiazine, 2H-1,2-oxazine, maleimide, succinimide, barbituric acid, thiobarbituric acid, dioxopiperazine, hydantoin, dihydrouracil, trioxane, hexahydro-1,3,5-triazine, imidazoline, imidazolidine, isoxazoline, isoxazolidine, oxazoline, oxazolidine, oxazolidinone, thiazoline, thiazolidine, morpholine, oxirane, piperidine N-Oxide, piperidine, piperazine, pyrrolidine, pyrrolidone, pyrrolidione, 4-piperidone, pyrazoline, pyrazolidine, 2-oxopyrrolidine, tetrahydropyran, 4H-pyran, tetrahydrothiopyran, thiamorpholine, thiamorpholine sulfoxide, thiamorpholine sulfone and their benzo-fused analogs (e.g., benzimidazolidinone, tetrahydroquinoline and 3,4-methylenedioxyphenyl).


As used herein, “aryl(alkyl)” refer to an aryl group connected, as a substituent, via a lower alkylene group. The lower alkylene and aryl group of an aryl(alkyl) may be substituted or unsubstituted. Examples include but are not limited to benzyl, 2-phenyl(alkyl), 3-phenyl(alkyl), and naphthyl(alkyl).


As used herein, “heteroaryl(alkyl)” refer to a heteroaryl group connected, as a substituent, via a lower alkylene group. The lower alkylene and heteroaryl group of heteroaryl(alkyl) may be substituted or unsubstituted. Examples include but are not limited to 2-thienyl(alkyl), 3-thienyl(alkyl), furyl(alkyl), thienyl(alkyl), pyrrolyl(alkyl), pyridyl(alkyl), isoxazolyl(alkyl), imidazolyl(alkyl), and their benzo-fused analogs.


A “heterocyclyl(alkyl)” refer to a heterocyclic group connected, as a substituent, via a lower alkylene group. The lower alkylene and heterocyclyl of a heterocyclyl(alkyl) may be substituted or unsubstituted. Examples include but are not limited tetrahydro-2H-pyran-4-yl(methyl), piperidin-4-yl(ethyl), piperidin-4-yl(propyl), tetrahydro-2H-thiopyran-4-yl(methyl) and 1,3-thiazinan-4-yl(methyl).


“Lower alkylene groups” are straight-chained —CH2— tethering groups, forming bonds to connect molecular fragments via their terminal carbon atoms. Examples include but are not limited to methylene (—CH2—), ethylene (—CH2CH2—), propylene (—CH2CH2CH2—) and butylene (—CH2CH2CH2CH2—). A lower alkylene group can be substituted by replacing one or more hydrogen of the lower alkylene group with a substituent(s) listed under the definition of “substituted.” Further, when a lower alkylene group is substituted, the lower alkylene can be substituted by replacing both hydrogens on the same carbon with a cycloalkyl group




embedded image


As used herein, “alkoxy” refers to the formula —OR wherein R is an alkyl, an alkenyl, an alkynyl, a cycloalkyl, a cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl) is defined herein. A non-limiting list of alkoxys are methoxy, ethoxy, n-propoxy, 1-methylethoxy (isopropoxy), n-butoxy, iso-butoxy, sec-butoxy, tert-butoxy, phenoxy and benzoxy. In some instances, an alkoxy can be —OR, wherein R is an unsubstituted C1-4 alkyl. An alkoxy may be substituted or unsubstituted.


As used herein, “acyl” refers to a hydrogen an alkyl, an alkenyl, an alkynyl, a cycloalkyl, a cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl) connected, as substituents, via a carbonyl group. Examples include formyl, acetyl, propanoyl, benzoyl, and acryl. An acyl may be substituted or unsubstituted.


As used herein, “hydroxyalkyl” refers to an alkyl group in which one or more of the hydrogen atoms are replaced by a hydroxy group. Exemplary hydroxyalkyl groups include but are not limited to, 2-hydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl and 2,2-dihydroxyethyl. A hydroxyalkyl may be substituted or unsubstituted.


As used herein, “alkoxyalkyl” refers to an alkyl group in which one or more of the hydrogen atoms are replaced by an alkoxy group. Exemplary alkoxyalkyl groups include but are not limited to, methoxymethyl, ethoxymethyl, methoxyethyl and ethoxyethyl. An alkoxyalkyl may be substituted or unsubstituted.


As used herein, “haloalkyl” refers to an alkyl group in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono-haloalkyl, di-haloalkyl and tri-haloalkyl). Such groups include but are not limited to, chloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, 1-chloro-2-fluoromethyl and 2-fluoroisobutyl. A haloalkyl may be substituted or unsubstituted.


As used herein, “haloalkoxy” refers to a O-alkyl group and O-monocyclic cycloalkyl group in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono-haloalkoxy, di-haloalkoxy and tri-haloalkoxy). Such groups include but are not limited to, chloromethoxy, fluoromethoxy, difluoromethoxy, trifluoro-2-ethoxy, trifluoromethoxy, 1-chloro-2-fluoromethoxy, 2-fluoroisobutoxy, chloro-substituted cyclopropyl, fluoro-substituted cyclopropyl, chloro-substituted cyclobutyl and fluoro-substituted cyclobutyl. In some instances, a haloalkoxy can be —OR, wherein R is a C1-4 alkyl substituted by 1, 2 or 3 halogens. A haloalkoxy may be substituted or unsubstituted.


A “sulfenyl” group refers to an “—SR” group in which R can be hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). A sulfenyl may be substituted or unsubstituted.


A “sulfinyl” group refers to an “—S(═O)—R” group in which R can be the same as defined with respect to sulfenyl. A sulfinyl may be substituted or unsubstituted.


A “sulfonyl” group refers to an “SO2R” group in which R can be the same as defined with respect to sulfenyl. A sulfonyl may be substituted or unsubstituted.


An “O-carboxy” group refers to a “RC(═O)O—” group in which R can be hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl), as defined herein. An O-carboxy may be substituted or unsubstituted.


The terms “ester” and “C-carboxy” refer to a “—C(═O)OR” group in which R can be the same as defined with respect to O-carboxy. An ester and C-carboxy may be substituted or unsubstituted.


A “thiocarbonyl” group refers to a “—C(═S)R” group in which R can be the same as defined with respect to O-carboxy. A thiocarbonyl may be substituted or unsubstituted.


A “trihalomethanesulfonyl” group refers to an “X3CSO2—” group wherein each X is a halogen.


A “trihalomethanesulfonamido” group refers to an “X3CS(O)2N(RA)—” group wherein each X is a halogen, and RA is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl).


The term “amino” as used herein refers to a —NH2 group.


As used herein, the term “hydroxy” refers to a —OH group.


A “cyano” group refers to a “—CN” group.


The term “azido” as used herein refers to a —N3 group.


An “isocyanato” group refers to a “—NCO” group.


A “thiocyanato” group refers to a “—CNS” group.


An “isothiocyanato” group refers to an “—NCS” group.


A “mercapto” group refers to an “—SH” group.


A “carbonyl” group refers to a C(═O) group.


An “S-sulfonamido” group refers to a “—SO2N(RARB)” group in which RA and RB can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An S-sulfonamido may be substituted or unsubstituted.


An “N-sulfonamido” group refers to a “RSO2N(RA)—” group in which R and RA can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An N-sulfonamido may be substituted or unsubstituted.


An “O-carbamyl” group refers to a “—OC(═O)N(RARB)” group in which RA and RB can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An O-carbamyl may be substituted or unsubstituted.


An “N-carbamyl” group refers to an “ROC(═O)N(RA)—” group in which R and RA can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An N-carbamyl may be substituted or unsubstituted.


An “O-thiocarbamyl” group refers to a “—OC(═S)—N(RARB)” group in which RA and RB can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An O-thiocarbamyl may be substituted or unsubstituted.


An “N-thiocarbamyl” group refers to an “ROC(═S)N(RA)—” group in which R and RA can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An N-thiocarbamyl may be substituted or unsubstituted.


A “C-amido” group refers to a “—C(═O)N(RARB)” group in which RA and RB can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). A C-amido may be substituted or unsubstituted.


An “N-amido” group refers to a “RC(═O)N(RA)—” group in which R and RA can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An N-amido may be substituted or unsubstituted.


A “mono-substituted amine” refers to a “—NHRA” in which RA can be independently alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). A mono-substituted amine may be substituted or unsubstituted. In some instances, a mono-substituted amine can be —NHRA, wherein RA can be an unsubstituted C1-6 alkyl or an unsubstituted or a substituted benzyl.


A “di-substituted amine” refers to a “—NRARB” in which RA and RB can be independently can be independently alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). A mono-substituted amine may be substituted or unsubstituted. In some instances, a mono-substituted amine can be —NRARB, wherein RA and RB can be independently an unsubstituted C1-6 alkyl or an unsubstituted or a substituted benzyl.


The term “halogen atom” or “halogen” as used herein, means any one of the radio-stable atoms of column 7 of the Periodic Table of the Elements, such as, fluorine, chlorine, bromine and iodine.


Where the numbers of substituents is not specified (e.g. haloalkyl), there may be one or more substituents present. For example “haloalkyl” may include one or more of the same or different halogens. As another example, “C1-C3 alkoxyphenyl” may include one or more of the same or different alkoxy groups containing one, two or three atoms.


As used herein, the abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (See, Biochem. 11:942-944 (1972)).


The term “pharmaceutically acceptable salt” refers to a salt of a compound that does not cause significant irritation to an organism to which it is administered and does not abrogate the biological activity and properties of the compound. In some embodiments, the salt is an acid addition salt of the compound. Pharmaceutical salts can be obtained by reacting a compound with inorganic acids such as hydrohalic acid (e.g., hydrochloric acid or hydrobromic acid), sulfuric acid, nitric acid and phosphoric acid. Pharmaceutical salts can also be obtained by reacting a compound with an organic acid such as aliphatic or aromatic carboxylic or sulfonic acids, for example formic, acetic, succinic, lactic, malic, tartaric, citric, ascorbic, nicotinic, methanesulfonic, ethanesulfonic, p-toluenesulfonic, salicylic or naphthalenesulfonic acid. Pharmaceutical salts can also be obtained by reacting a compound with a base to form a salt such as an ammonium salt, an alkali metal salt, such as a sodium or a potassium salt, an alkaline earth metal salt, such as a calcium or a magnesium salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, C1-C7 alkylamine, cyclohexylamine, triethanolamine, ethylenediamine, and salts with amino acids such as arginine and lysine.


Terms and phrases used in this application, and variations thereof, especially in the appended claims, unless otherwise expressly stated, should be construed as open ended as opposed to limiting. As examples of the foregoing, the term ‘including’ should be read to mean ‘including, without limitation,’ ‘including but not limited to,’ or the like; the term ‘comprising’ as used herein is synonymous with ‘including,’ ‘containing,’ or ‘characterized by,’ and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps; the term ‘having’ should be interpreted as ‘having at least;’ the term ‘includes’ should be interpreted as ‘includes but is not limited to;’ the term ‘example’ is used to provide exemplary instances of the item in discussion, not an exhaustive or limiting list thereof. In addition, the term “comprising” is to be interpreted synonymously with the phrases “having at least” or “including at least”. When used in the context of a compound or composition, the term “comprising” means that the compound or composition includes at least the recited features or components, but may also include additional features or components.


With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity. The indefinite article “a” or “an” does not exclude a plurality.


It is understood that, in any compound described herein having one or more chiral centers, if an absolute stereochemistry is not expressly indicated, then each center may independently be of (R)-configuration or (S)-configuration or a mixture thereof. Thus, the compounds provided herein may be enantiomerically pure, enantiomerically enriched, racemic mixture, diastereomerically pure, diastereomerically enriched, or a stereoisomeric mixture. In addition it is understood that, in any compound described herein having one or more double bond(s) generating geometrical isomers that can be defined as E or Z, each double bond may independently be E or Z a mixture thereof. Likewise, it is understood that, in any compound described, all tautomeric forms are also intended to be included.


It is to be understood that where compounds disclosed herein have unfilled valencies, then the valencies are to be filled with hydrogens or isotopes thereof, e.g., hydrogen-1 (protium) and hydrogen-2 (deuterium).


It is understood that the compounds described herein can be labeled isotopically. Substitution with isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, such as, for example, increased in vivo half-life or reduced dosage requirements. Each chemical element as represented in a compound structure may include any isotope of said element. For example, in a compound structure a hydrogen atom may be explicitly disclosed or understood to be present in the compound. At any position of the compound that a hydrogen atom may be present, the hydrogen atom can be any isotope of hydrogen, including but not limited to hydrogen-1 (protium) and hydrogen-2 (deuterium). Thus, reference herein to a compound encompasses all potential isotopic forms unless the context clearly dictates otherwise.


Where a range of values is provided, it is understood that the upper and lower limit, and each intervening value between the upper and lower limit of the range is encompassed within the embodiments.


Compounds

Some embodiments disclosed herein relate to a compound of Formula (I), or a pharmaceutically acceptable salt thereof:




embedded image


wherein: R1 can be 3,4-disubstituted phenyl or trisubstituted phenyl, wherein each substitution group on the phenyl can be independently selected from fluoro, chloro, bromo, —CHF2, —CF3, —CH3, —CN and —CCH; R2 can be —C(═O)R5; R3 can be selected from a substituted phenyl, a substituted monocyclic heteroaryl and a substituted bicyclic heteroaryl; R4 can be selected from —CHF2, —CH3, -cyclopropyl, an unsubstituted C1-4 hydroxyalkyl, an unsubstituted or substituted benzyl-O—CH2— and an unsubstituted or substituted monocyclic heterocyclyl-CH2—; R5 can be




embedded image


R6 can be an unsubstituted or a substituted 5- or 6-membered monocyclic heteroaryl comprising 1, 2 or 3 nitrogens, and optionally 1 or 2 heteroatoms selected from oxygen and sulfur, and when R6 is substituted, R6 can be substituted with one or more substituents selected from halogen, an unsubstituted C1-4 alkyl, an unsubstituted C1-4 haloalkyl, an unsubstituted —O—C1-4 alkyl, amino and mono-C1-6 alkyl amine; R7 can be selected from halogen, an unsubstituted C1-4 alkyl and an unsubstituted —O—C1-4 alkyl; and n can be 0 or 1; or R6 can be halogen; n can be 1; and R7 can be halogen.


Various substituted phenyl groups can be present for R1. In some embodiments, R1 can be 3,4-disubstituted phenyl. In other embodiments, R1 can be a trisubstituted phenyl, for example, a 3,4,5-trisubstituted phenyl. The substituted phenyl can be substituted by moieties independently selected from fluoro, chloro, bromo, —CHF2, —CF3, —CH3, —CN and —C≡CH. The moieties on the phenyl can be the same or different moieties. In some embodiments, at least one of moieties on the phenyl of R1 can be bromo. In some embodiments, at least one of moieties on the phenyl of R1 can be chloro. When R1 is a 3,4-disubstituted phenyl, in some embodiments, one moiety on the phenyl of R1 can be bromo and the other moiety on the phenyl of R1 can be chloro or —CF3. In some embodiments when R1 is a 3,4-disubstituted phenyl, one moiety on the phenyl of R1 can be bromo and the other moiety on the phenyl of R1 can be fluoro, chloro, —CHF2, —CF3, —CH3, —CN and —C≡CH. In other embodiments when R1 is a 3,4-disubstituted phenyl, one moiety on the phenyl of R1 can be chloro and the other moiety on the phenyl of R1 can be fluoro, chloro, —CHF2, —CF3, —CH3, —CN and —C≡CH. When R1 is a trisubstituted phenyl, in some embodiments, at least moiety on the phenyl can be bromo and another moiety can be chloro. In some embodiments when R1 is a trisubstituted phenyl, one moiety can be bromo, a second moiety can be chloro and a third moiety can be selected from fluoro, —CHF2, —CF3, —CH3, —CN and —C≡CH. In other embodiments when R1 is a trisubstituted phenyl, one moiety can be bromo, a second moiety can be fluoro, and a third moiety can be selected from fluoro, —CHF2, —CF3, —CH3, —CN and —C≡CH. Examples of suitable 3,4-disubstituted phenyl for R1 include the following:




embedded image


Examples of suitable trisubstituted phenyl for R1 include the following:




embedded image


As recited herein, R2 with R5 can be an amido group. In some embodiments, R2 can be —C(═O)R5, wherein R5 can be




embedded image


The phenyl ring of R5 can be substituted R6, where R6 can be an unsubstituted or a substituted 5- or 6-membered monocyclic heteroaryl comprising 1, 2 or 3 nitrogens, and optionally 1 or 2 heteroatoms selected from the group consisting of oxygen and sulfur. The 5- or 6-membered monocyclic heteroaryl comprising 1, 2 or 3 nitrogens can include 1 or 2 other heteroatoms, such as O (oxygen) and S (sulfur). In some embodiments, the unsubstituted or a substituted 5- or 6-membered monocyclic heteroaryl can include 1 nitrogen. In other embodiments, the unsubstituted or a substituted 5- or 6-membered monocyclic heteroaryl can include 2 nitrogens. In still other embodiments, the unsubstituted or a substituted 5- or 6-membered monocyclic heteroaryl can include 3 nitrogens. In yet still other embodiments, the unsubstituted or a substituted 5- or 6-membered monocyclic heteroaryl can include 1 nitrogen and 1 oxygen. In some embodiments, the unsubstituted or a substituted 5- or 6-membered monocyclic heteroaryl can include 2 nitrogens and 1 oxygen. Exemplary 5- and 6-membered monocyclic heteroaryls include, but are not limited to, an unsubstituted or a substituted pyrazole, an unsubstituted or a substituted imidazole, an unsubstituted or a substituted thiazole, an unsubstituted or a substituted oxazole, an unsubstituted or a substituted 1,3,4-oxadiazole, an unsubstituted or a substituted 1,3,4-thiadiazole an unsubstituted or a substituted pyridine, an unsubstituted or a substituted pyrimidine, an unsubstituted or a substituted pyrazine, an unsubstituted or a substituted pyridazine, an unsubstituted or a substituted 1,2,4-triazine and an unsubstituted or a substituted 1,2,4-triazole.


The phenyl ring of R5 can include another substitution, R7. For example, when n is 1, the phenyl ring of R5 can be further substituted by a halogen, an unsubstituted C1-4 alkyl or an unsubstituted —O—C1-4 alkyl. Examples of halogens include fluoro, chloro, bromo and iodo. In some embodiments, R7 can be fluoro. Unsubstituted C1-4 alkyls include methyl, ethyl, n-propyl, isopropyl, n-butyl, iso-butyl, sec-butyl and tert-butyl. Exemplary unsubstituted —O—C1-4 alkyl include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, iso-butoxy, sec-butoxy and tert-butoxy. In some embodiments, R7 can be methyl or methoxy. When n is 0, the phenyl ring of R5 can be substituted with R6 and not be further substituted.


The position of R7 can vary. For example, R7 can be positioned as shown below:




embedded image


In some embodiments, R5 can be selected from




embedded image


In some embodiments, R5 can be selected from




embedded image


As provided herein, R6 can be unsubstituted or substituted. When R6 is substituted, R6 can be substituted with one or more substituents selected from halogen, an unsubstituted C1-4 alkyl, an unsubstituted C1-4 haloalkyl, an unsubstituted —O—C1-4 alkyl, amino and mono-C1-6 alkyl amine. Examples of halogen, unsubstituted C1-4 alkyls and unsubstituted —O—C1-4 alkyls are provided herein. In some embodiments, R6 can be substituted with one or more substituents selected from fluoro, chloro, bromo, iodo, methyl, ethyl, n-propyl, isopropyl, n-butyl, iso-butyl, sec-butyl, tert-butyl, —CF3, —CCl3, —CHF2, —C(CH3)F2, —CHCl2, —CH2F, —CH(CH3)F, —CH2CF3, —CH2Cl, —CH2CH2F, —CH2CH2Cl, —CH2CH2CH2F, —CH2CH2CH2Cl, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, iso-butoxy, sec-butoxy, tert-butoxy, mono-methylamine, mono-ethylamine, mono-n-propylamine, mono-iso-propylamine, mono-n-butylamine, mono-sec-butylamine, mono-iso-butylamine, mono-pentylamine and mono-hexylamine, wherein the pentyl and hexyl of the mono-pentylamine and mono-hexylamine, respectively, can be straight-chained or branched). When R6 is substituted, R6 can be mono-substituted, di-substituted or tri-substituted.


Examples of R5 include the following:




embedded image


embedded image


embedded image


embedded image


embedded image


In some embodiments, when R6 is a 5-membered monocyclic heteroaryl, R5 can be selected from




embedded image


embedded image


In some embodiments, when R6 is a 6-membered monocyclic heteroaryl, R5 can be selected from




embedded image


As provided herein, R6 can be substituted with an amino. Exemplary R5 groups with an amino-substituted R6 include the following:




embedded image


In some embodiments, R6 can be halogen; n can be 1; and R7 can be halogen. For example, R6 can be F or Cl; n can be 1; and R7 can be F or Cl. As described herein, the position of R7 can vary. In some embodiments, R5 can be




embedded image


such as




embedded image


Various groups can be attached to the nitrogen of the 1,3-dihydro-2H-imidazol-2-one of Formula (I), R3. The R3 groups can include a phenyl substituted by an unsubstituted C1-4 alkoxy (such as an unsubstituted —O—C1-4 alkyl and an unsubstituted —O—C3-6 cycloalkyl, including methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, iso-butoxy, sec-butoxy, tert-butoxy, cyclopropoxy, cyclobutoxy, cyclopentoxy and/or cyclohexoxy), an unsubstituted C1-4 haloalkoxy (for example, —OCHF2, —OCF3, —OCH2F, —OCH2CHF2, —OCH2CF3 and/or —OCH2CH2F), hydroxy-substituted C1-4 alkoxy (such as




embedded image


a mono(an unsubstituted C1-4 alkyl)amine-substituted C1-4 alkoxy,(for example,




embedded image


a di(an unsubstituted C1-4 alkyl)amine-substituted C1-4 alkoxy (for example,




embedded image


a monocyclic heterocyclyl-substituted C1-4 alkoxy (such as




embedded image


hydroxy- and fluoro-substituted C1-4 alkoxy (for example,




embedded image


—O—CH2—C(═O)-(an unsubstituted C1-4 alkyl) (such as —O—CH2—C(═O)—CH2CH3), an unsubstituted or a substituted monocyclic heteroaryl, an unsubstituted or a substituted monocyclic heterocyclyl and/or an unsubstituted or a substituted bicyclic heterocyclyl. In some embodiments, R3 can be a phenyl that is mono-substituted, for example, a mono-substituted phenyl where the substitution is at the para-position. In some embodiments, R3 can be




embedded image


wherein R* can be a substitution described herein (such as in this paragraph and those paragraphs below).


Other examples of R3 groups can include a phenyl substituted by an unsubstituted monocyclic heterocyclyl (such as an unsubstituted 4-, 5- or 6-membered heterocyclyl), a substituted monocyclic heterocyclyl (such as a substituted 4-, 5- or 6-membered heterocyclyl), an unsubstituted fused-bicyclic heterocyclyl, a substituted fused-bicyclic heterocyclyl, an unsubstituted spiro-bicyclic heterocyclyl or a substituted spiro-bicyclic heterocyclyl. In some embodiments, a heterocyclyl described herein substituted on R3 can include 1, 2 or 3 heteroatoms independent selected from nitrogen (N), oxygen (O) and sulfur (S). Exemplary heterocyclyls include azetidine, pyrrolidine, morpholine, piperidine, piperazine, 2-azaspiro[3.3]heptane, 1,6-diazaspiro[3.3]heptane, 2,6-diazaspiro[3.3]heptane, 2-oxa-6-azaspiro[3.3]heptane, 2-oxa-5-azabicyclo[2.2.1]heptane, 4-oxa-7-azaspiro[2.5]octane, 2-oxa-5-azabicyclo[2.2.2]octane, 8-oxa-3-azabicyclo[3.2.1]octane, 2,6-diazaspiro[3.4]octane, 2,5-diazabicyclo[2.2.2]octane, 3,8-diazabicyclo[3.2.1]octane and 2,7-diazaspiro[3.5]nonane. The heterocyclyls described herein substituted on a phenyl of R3 can be unsubstituted or substituted. When substituted, the heterocyclyl attached to the phenyl of R3 can be substituted with one or more moieties (such as 1, 2 or 3 moieties) selected from halogen (for example, F and Cl), hydroxy, an unsubstituted C1-4 alkyl and an unsubstituted C1-4 haloalkyl (—CF3, —CCl3, —CHF2, —C(CH3)F2, —CHCl2, —CH2F, —CH(CH3)F, —CH2CF3, —CH2Cl, —CH2CH2F, —CH2CH2Cl, —CH2CH2CH2F and —CH2CH2CH2Cl).


Other cyclic groups that can be substituted on R3 when R3 is a phenyl include an unsubstituted monocyclic heteroaryl (such as an unsubstituted 4-, 5- or 6-membered heteroaryl) and a substituted monocyclic heteroaryl (such as a substituted 4-, 5- or 6-membered heterocyclyl). The monocyclic and bicyclic heteroaryl that can be substituted on a phenyl of R3 can include 1, 2 or 3 heteroatoms independent selected from nitrogen (N), oxygen (O) and sulfur (S). When R3 is substituted with a heteroaryl, the heteroaryl can be substituted with one or more moieties (such as 1, 2 or 3 moieties) selected from halogen (for example, F and Cl), hydroxy, an unsubstituted C1-4 alkyl and an unsubstituted C1-4 haloalkyl (such as those described herein). An example of a suitable unsubstituted or substituted heteroaryl that can be substituted on R3 when R3 is phenyl is pyrazole.


The R3 group can be an unsubstituted or a substituted 5- to 6-membered monocyclic heteroaryl or an unsubstituted or a substituted 9-membered bicyclic heteroaryl, for example, an unsubstituted or a substituted 5- to 6-membered bicyclic heteroaryl or an unsubstituted or a substituted 9-membered bicyclic heteroaryl, wherein the monocyclic and/or bicyclic heteroaryl can include 1, 2 or more than 2 nitrogens. Additional examples of R3 groups include pyridine, indole, indazole, benzo[d]oxazole, benzo[d]isoxazole and benzo[d][1,2,3]triazole, wherein each of the aforementioned groups can be unsubstituted or substituted.


When R3 is a substituted phenyl, a substituted monocyclic heteroaryl or a substituted bicyclic heteroaryl, such as those described herein, R3 can be substituted with one or more of the following moieties: halogen (for example, F or Cl), hydroxy, amino, —NH(an unsubstituted C1-4 alkyl), —N(an unsubstituted C1-4 alkyl)2, an unsubstituted C1-4 alkyl (such as methyl, ethyl, n-propyl, isopropyl, n-butyl, iso-butyl, sec-butyl and/or tert-butyl), an unsubstituted C1-4 alkoxy (for example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, iso-butoxy, sec-butoxy, tert-butoxy, cyclopropoxy, cyclobutoxy, cyclopentoxy and/or cyclohexoxy), an unsubstituted C1-4 haloalkyl (for example, —CF3, —CCl3, —CHF2, —C(CH3)F2, —CHCl2, —CH2F, —CH(CH3)F, —CH2CF3, —CH2Cl, —CH2CH2F, —CH2CH2Cl, —CH2CH2CH2F, —CH2CH2CH2Cl), an unsubstituted C1-4 haloalkoxy (such as —OCHF2, —OCF3, —OCH2F, —OCH2CHF2, —OCH2CF3 and/or —OCH2CH2F), hydroxy-substituted C1-4 alkoxy, an unsubstituted C1-4 hydroxyalkyl, C1-4 alkyl substituted by hydroxy and halogen (such as F), C1-4 alkoxy substituted by hydroxy and halogen (such as F), C1-4 alkoxy substituted by hydroxy and —NRZ1RZ2, wherein RZ1 and RZ2 are independently H or an unsubstituted C1-4 alkyl or wherein RZ1 and RZ2 along with the nitrogen to which RZ1 and RZ2 are attached are taken together to form a monocyclic heterocyclyl, —O—CH2—C(═O)-(an unsubstituted C1-4 alkyl) (such as —O—CH2—C(═O)—CH2CH3), an unsubstituted monocyclic heterocyclyl, a substituted monocyclic heterocyclyl, an unsubstituted bicyclic heterocyclyl, a substituted bicyclic heterocyclyl, an unsubstituted monocyclic heteroaryl, a substituted monocyclic heteroaryl, an unsubstituted bicyclic heteroaryl and a substituted bicyclic heteroaryl.


Examples of R3 groups include:




embedded image


embedded image


Additional examples of R3 groups include the following:




embedded image


embedded image


embedded image


embedded image


In some embodiments, R4 can be —CHF2. In other embodiments, R4 can be —CH3. In still other embodiments, R4 can be -cyclopropyl. In yet still other embodiments, R4 can be an unsubstituted C1-4 hydroxyalkyl, such as —(CH2)1-4—OH. In some embodiments, R4 can be an unsubstituted benzyl-O—CH2—. In other embodiments, R4 can be a substituted benzyl-O—CH2—. In still other embodiments, R4 can be an unsubstituted monocyclic heterocyclyl-CH2—. In yet still other embodiments, R4 can be a substituted monocyclic heterocyclyl-CH2—. The heterocyclyl of heterocyclyl-CH2— can be a 5- or 6-membered heterocyclyl that can include 1 or 2 heteroatoms selected from nitrogen (N), oxygen (O) and sulfur (S). Examples of suitable monocyclic heterocyclyls are described herein, and include an unsubstituted or a substituted morpholine.


When R4 is a substituent provided herein, a stereocenter may be formed. In some embodiments, the stereocenter that is formed can be in the (R)-configuration. In other embodiments, the stereocenter that is formed can be in the (S)-configuration. Compounds of Formula (I), along with pharmaceutically acceptable salts thereof, with a stereocenter at the carbon to which R4 is attached can include Formula (Ia) and Formula (Ib).




embedded image


In some embodiments, a compound of Formula (I), or a pharmaceutically acceptable salt thereof, can be where R1 can be 3,4-disubstituted phenyl or trisubstituted phenyl, wherein each substitution group on the phenyl can be independently selected from fluoro, chloro, bromo, —CHF2, —CF3, —CH3, —CN and —C≡CH; R2 can be —C(═O)R5; R3 can be selected from




embedded image


embedded image


embedded image


R4 can be selected from —CHF2, —CH3 and -cyclopropyl; R5 can be




embedded image


R6 can be an unsubstituted or a substituted 5- or 6-membered monocyclic heteroaryl comprising 1, 2 or 3 nitrogens, and optionally 1 or 2 heteroatoms selected from oxygen and sulfur, and when R6 is substituted, R6 can be substituted with one or more substituents selected from halogen, an unsubstituted C1-4 alkyl, an unsubstituted —O—C1-4 alkyl, amino and mono-C1-6 alkyl amine; R7 can be selected from halogen, an unsubstituted C1-4 alkyl and an unsubstituted —O—C1-4 alkyl; and n can be 0 or 1.


In some embodiments, a compound of Formula (I), or a pharmaceutically acceptable salt thereof, can be where R1 can be




embedded image


R2 can be —C(═O)R5, wherein R5 can be selected from




embedded image


R3 can be a substituted phenyl (such as




embedded image


and R4 can be —CH3. In some embodiments, a compound of Formula (I), or a pharmaceutically acceptable salt thereof, can be where R1 can be




embedded image


R2 can be —C(═O)R5, wherein R5 can be a substituted bicyclic heteroaryl (such as those described herein); R3 can be a substituted phenyl (such as




embedded image


and R4 can be —CH3.


Examples of compounds of Formula (I), including pharmaceutically acceptable salts thereof, include:




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


or a pharmaceutically acceptable salt of any of the foregoing.


Further examples of compounds of Formula (I), including pharmaceutically acceptable salts thereof, include the following:




embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


embedded image


or a pharmaceutically acceptable salt of any of the foregoing.


Additional examples of compounds of Formula (I), including pharmaceutically acceptable salts thereof, include the following:




embedded image


or a pharmaceutically acceptable salt of any of the foregoing.


In some embodiments, a compound can be selected from:




embedded image


embedded image


embedded image


embedded image


or a pharmaceutically acceptable salt of any of the foregoing.


In some embodiments, a compounds of Formula (I), or a pharmaceutically acceptable salt thereof, cannot be selected from rac-(6S)-7-(4-bromo-3-chloro-benzoyl)-2-[4-(cyclopropoxy)phenyl]-6-methyl-3-oxo-N-[(2-pyrazol-1-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6R)-7-(4-bromo-3-chloro-benzoyl)-2-[4-(cyclopropoxy)phenyl]-6-methyl-3-oxo-N-[(2-pyrazol-1-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6S)-7-(4-bromo-3-chloro-benzoyl)-2-[4-(cyclopropoxy)phenyl]-N-[[2-(4-fluoropyrazol-1-yl)phenyl]methyl]-6-methyl-3-oxo-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6R)-7-(4-bromo-3-chloro-benzoyl)-2-[4-(cyclopropoxy)phenyl]-N-[[2-(4-fluoropyrazol-1-yl)phenyl]methyl]-6-methyl-3-oxo-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6R)-7-(4-bromo-3-chloro-benzoyl)-2-[4-(cyclopropoxy)phenyl]-6-methyl-3-oxo-N-[[2-(1,2,4-triazol-1-yl)phenyl]methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6S)-7-(4-bromo-3-chloro-benzoyl)-2-[4-(cyclopropoxy)phenyl]-6-methyl-3-oxo-N-[[2-(1,2,4-triazol-1-yl)phenyl]methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6R)-7-(4-bromo-3-cyano-benzoyl)-2-[4-(cyclopropoxy)phenyl]-6-methyl-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6S)-7-(4-bromo-3-cyano-benzoyl)-2-[4-(cyclopropoxy)phenyl]-6-methyl-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6R)-7-(4-bromo-3-chloro-benzoyl)-6-methyl-3-oxo-2-(4-pyrazol-1-ylphenyl)-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6S)-7-(4-bromo-3-chloro-benzoyl)-6-methyl-3-oxo-2-(4-pyrazol-1-ylphenyl)-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, rac-(6R)-7-(4-bromo-3-cyano-benzoyl)-6-methyl-3-oxo-2-(4-pyrazol-1-ylphenyl)-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide, and rac-(6S)-7-(4-bromo-3-cyano-benzoyl)-6-methyl-3-oxo-2-(4-pyrazol-1-ylphenyl)-N-[(2-pyrimidin-2-ylphenyl)methyl]-6, 8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide.


In some embodiments, a compound of Formula (I), or a pharmaceutically acceptable salt thereof, cannot be a compound or a pharmaceutically acceptable salt of a compound provided in U.S. 2020/0361947 A1, which is hereby incorporated by reference. In some embodiments, R1 cannot be




embedded image


In other embodiments, R1 cannot be




embedded image


In some embodiments, R3 cannot be




embedded image


In other embodiments, R3 cannot be




embedded image


In some embodiments, R5 cannot be




embedded image


In other embodiments, R5 cannot be




embedded image


In still other embodiments, R5 cannot be




embedded image


In yet still other embodiments, R5 cannot be




embedded image


In some embodiments, when R3 is




embedded image


then R5 cannot be




embedded image


In some embodiments, when R3 is




embedded image


then R1 cannot be




embedded image


In some embodiments, when R3 is




embedded image


then R5 cannot be




embedded image


In some embodiments, when R3 is




embedded image


then R1 cannot be




embedded image


or




embedded image


In some embodiments, when R3 is




embedded image


then R4 cannot be —CH3. In some embodiments, when R5 is




embedded image


then R4 cannot be —CH3. In some embodiments, when R1 is




embedded image


then R4 cannot be —CH3.


Synthesis

Compounds of Formula (I) along with those described herein may be prepared in various ways. General synthetic routes for preparing compounds of Formula (I) are shown and described herein along with some examples of starting materials used to synthesize compounds described herein. The routes shown and described herein are illustrative only and are not intended, nor are they to be construed, to limit the scope of the claims in any manner whatsoever. Those skilled in the art will be able to recognize modifications of the disclosed syntheses and to devise alternate routes based on the disclosures herein; all such modifications and alternate routes are within the scope of the claims.




embedded image


Compounds of Formula (I), along with pharmaceutically acceptable salts thereof, can be prepared from an intermediate of Formula (II) by cleaving the Boc protecting group in acidic condition, for example, by using HCl in a suitable solvent or by using cupper triflate to provide an intermediate of Formula (III). Compounds of Formula (I), and pharmaceutically acceptable salts thereof, can be obtained by methods know in the art. As an example, acyls of Formula (I) can be obtained by coupling Formula (III) with an acyl chloride, such as an acyl chloride of the general formula R1—C(═O)—Cl, or by using an acid (such as R1—C(═O)—OH) in presence of a suitable coupling agent (for example TCFH in presence of N-methylimidazole), in a suitable solvent, such as acetonitrile.




embedded image


Compounds of Formula (I), along with pharmaceutically acceptable salts thereof, wherein R2 can be —C(═O)R5 can be prepared from an intermediate of Formula (VI) whose synthesis is shown in Scheme 2. The ester of Formula (IV) can be saponified using lithium hydroxide or another suitable agent (such as sodium hydroxide) in a suitable solvent such a mixture of water in ethanol, to give an intermediate of Formula (V). The coupling of Formula (V) with an amine of general formula




embedded image


can be achieved using a coupling agent, such as EDCI/HOAT, or another suitable coupling agent (such as HATU in presence of DIPEA) in a suitable solvent to provide an intermediate of Formula (VI). The intermediate of Formula (VI) can be treated as depicted in Scheme 1 to give a compound of Formula (I), along with pharmaceutically acceptable salts thereof, where R2 can be —C(═O)R5.




embedded image


embedded image


Compounds of Formula (IV) can be obtained from 2,5-dichloropyrazine as depicted in Scheme 3. 2,5-dichloropyrazine can be reacted with N-(diphenylmethylene)glycine ethyl ester in a suitable solvent in presence of a base (for example, potassium carbonate) to provide a compound of Formula (VII). Deprotection of Formula (VII) can be accomplished under acidic conditions, for example, in presence of HCl to provide a compound of Formula (VIII). Formula (VIII) can be cyclized to a compound of Formula (IX), for example, using triphosgen in a suitable solvent (such as THF), or CDI in presence of a suitable base (such DIEA) in a suitable solvent (such as THF). Introduction of a R3 substituent to a compound of Formula (IX) to give a compound of Formula (X) can be achieved by methods known to those skilled in the art. For instance, an intermediate of Formula (X) can be obtained from an intermediate of Formula (IX) by using an alkylating agent of general formula R3-Halo, where Halo can be chloro, bromo or iodo, in presence of a base (for example, potassium carbonate) in a suitable solvent. Alternatively, an intermediate of Formula (X) can be obtained by a Mitsunobu reaction using an alcohol of general formula R3—OH in a suitable solvent. Other compounds of Formula (X) can be prepared from Formula (IX), a boronic acid of general formula R3—B(OH)2, and a catalyst (such as Cu(OTf)2 or Cu(AcO)2), in presence of a suitable base. Other compounds of Formula (X) can be prepared from Formula (IX) using a halogenated aryl or heteroaryl R3-Halo, where Halo can be iodo, bromo or chloro, in the presence of copper iodide, potassium carbonate and N1,N2-dimethylethane-1,2-diamine, in a solvent, such as DMSO, under heating conditions. Other compounds of Formula (X) can be prepared from Formula (IX) using a halogenated aryl or heteroaryl R3-Halo, where Halo can be iodo, bromo or chloro, in the presence of a palladium catalyst (for example, Pd2dba3) a ligand (such as Xantphos), a base (for example, cesium carbonate) in a suitable solvent (such as dioxane) under heating conditions. Other methods known in the art to functionalize lactams can also be used.


The chloro of Formula (X) can be transformed to an alkyl or cycloalkyl, for example, methyl and cyclopropyl, using 2,4,6-trimethyl-1,3,5,2,4,6-trioxatriborinane and a cyclopropyl boronic acid, respectively, in the presence of a catalyst (for example, Pd(dppf)Cl2, K2CO3 in dioxane, or Pd(OAc)2 and SPhos in toluene/water). The obtained compound of Formula (XI), where R4 can be methyl or cyclopropyl, can be reduced under known conditions (such as hydrogenation on Pd/C in ethanol or using sodium borohydride in ethanol) to provide a compound a Formula (XII). Protection of a compound of Formula (XII) using a Boc protecting group can be achieved using conditions known in the art, such as Boc2O, in presence of TEA, in a suitable solvent (such as DCM), to give a compound a Formula (IV).




embedded image


A compound of Formula (IV) can be obtained following the route depicted in Scheme 4. A compound of Formula (IX) can be protected using a PMB group, and conditions known in the art. For example, PMB-Cl can be used in presence of a suitable base (such as K2CO3) in a suitable solvent (such as DMF) to provide a compound of Formula (Xa). The chloro can be transformed to an alkyl or a cycloalkyl (for example, methyl and cyclopropyl using 2,4,6-trimethyl-1,3,5,2,4,6-trioxatriborinane and cyclopropyl boronic acid, respectively) in the presence of a catalyst (such as Pd(dppf)Cl2, K2CO3 in dioxane, or Pd(OAc)2 and SPhos in toluene/water) to provide a compound of Formula (XIa). A compound of Formula (XIa), where R4 can be methyl or cyclopropyl, can be deprotected using conditions, such as hot TFA, to give a compound a Formula (XIII). Reduction and protection with a Boc protecting group of a compound a Formula (XIII) can be achieved in one pot under known conditions known to those skilled in the art (such as hydrogenation on Pd/C in ethanol, or using sodium borohydride in ethanol in presence of Boc2O) to obtain a compound a Formula (XIV), where R4 can be methyl or cyclopropyl. A R3 substituent can be introduced to a compound of Formula (XIII) using the conditions depicted in Scheme 3 for the synthesis of Formula (X). For example, compounds of Formula (IV) can be obtained by reacting a compound of Formula (XIII), a boronic acid of general formula R3—B(OH)2, and a catalyst (such as Cu(TfO)2), in presence of a suitable base (such as pyridine) and solvent (such as DMF). Other methods known in the art to functionalize lactams can also be used.


Pharmaceutical Compositions

Some embodiments described herein relate to a pharmaceutical composition, that can include an effective amount of a compound described herein (e.g., a compound, or a pharmaceutically acceptable salt thereof, as described herein) and a pharmaceutically acceptable carrier, excipient or combination thereof. A pharmaceutical composition described herein is suitable for human and/or veterinary applications.


As used herein, a “carrier” refers to a compound that facilitates the incorporation of a compound into cells or tissues. For example, without limitation, dimethyl sulfoxide (DMSO) is a commonly utilized carrier that facilitates the uptake of many organic compounds into cells or tissues of a subject.


As used herein, a “diluent” refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, a diluent may be used to increase the bulk of a potent drug whose mass is too small for manufacture and/or administration. It may also be a liquid for the dissolution of a drug to be administered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution such as, without limitation, phosphate buffered saline that mimics the composition of human blood.


As used herein, an “excipient” refers to an inert substance that is added to a pharmaceutical composition to provide, without limitation, bulk, consistency, stability, binding ability, lubrication, disintegrating ability etc., to the composition. A “diluent” is a type of excipient.


Proper formulation is dependent upon the route of administration chosen. Techniques for formulation and administration of the compounds described herein are known to those skilled in the art. Multiple techniques of administering a compound exist in the art including, but not limited to, oral, rectal, topical, aerosol, injection and parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal and intraocular injections. Pharmaceutical compositions will generally be tailored to the specific intended route of administration.


One may also administer the compound in a local rather than systemic manner, for example, via injection of the compound directly into the infected area, often in a depot or sustained release formulation. Furthermore, one may administer the compound in a targeted drug delivery system, for example, in a liposome coated with a tissue-specific antibody. The liposomes may be targeted to and taken up selectively by the organ.


The pharmaceutical compositions disclosed herein may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tableting processes. As described herein, compounds used in a pharmaceutical composition may be provided as salts with pharmaceutically compatible counterions.


Methods of Use

Some embodiments described herein relate to a method of treating a HBV and/or HDV infection that can include administering to a subject identified as suffering from the HBV and/or HDV infection an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for treating a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein or a pharmaceutical composition that includes a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating a HBV and/or HDV infection.


Some embodiments disclosed herein relate to a method of treating a HBV and/or HDV infection that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for treating a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating a HBV and/or HDV infection.


Some embodiments disclosed herein relate to a method of inhibiting replication of HBV and/or HDV that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for inhibiting replication of HBV and/or HDV. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, for inhibiting replication of HBV and/or HDV.


In some embodiments, the HBV infection can be an acute HBV infection. In some embodiments, the HBV infection can be a chronic HBV infection.


Some embodiments disclosed herein relate to a method of treating liver cirrhosis that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from liver cirrhosis and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from liver cirrhosis with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for treating liver cirrhosis with an effective amount of the compound, or a pharmaceutically acceptable salt thereof. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating liver cirrhosis.


Some embodiments disclosed herein relate to a method of treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from the liver cancer and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from the liver cancer with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for treating liver cancer (such as hepatocellular carcinoma). Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating liver cancer (such as hepatocellular carcinoma).


Some embodiments disclosed herein relate to a method of treating liver failure that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from liver failure and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from liver failure with an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable salt thereof, as described herein in the manufacture of a medicament for treating liver failure. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable salt thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein for treating liver failure.


Various indicators for determining the effectiveness of a method for treating an HBV and/or HDV infection are also known to those skilled in the art. Examples of suitable indicators include, but are not limited to, a reduction in viral load indicated by reduction in HBV DNA (or load) (e.g., reduction <105 copies/mL in serum), HBV surface antigen (HBsAg) and HBV e-antigen (HBeAg), a reduction in plasma viral load, a reduction in viral replication, a reduction in time to seroconversion (virus undetectable in patient serum), an increase in the rate of sustained viral response to therapy, an improvement in hepatic function, and/or a reduction of morbidity or mortality in clinical outcomes.


As used herein, the terms “treat,” “treating,” “treatment,” “therapeutic,” and “therapy” do not necessarily mean total cure or abolition of the disease or condition. Any alleviation of any undesired signs or symptoms of a disease or condition, to any extent can be considered treatment and/or therapy. Furthermore, treatment may include acts that may worsen the subject's overall feeling of well-being or appearance.


As used herein, a “subject” refers to an animal that is the object of treatment, observation or experiment. “Animal” includes cold- and warm-blooded vertebrates and invertebrates such as fish, shellfish, reptiles and, in particular, mammals. “Mammal” includes, without limitation, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates, such as monkeys, chimpanzees, and apes, and, in particular, humans. In some embodiments, the subject is human.


The term “effective amount” is used to indicate an amount of an active compound, or pharmaceutical agent, that elicits the biological or medicinal response indicated. For example, an effective amount of compound can be the amount needed to alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. This response may occur in a tissue, system, animal or human and includes alleviation of the signs or symptoms of the disease being treated. Determination of an effective amount is well within the capability of those skilled in the art, in view of the disclosure provided herein. The effective amount of the compounds disclosed herein required as a dose will depend on the route of administration, the type of animal, including human, being treated, and the physical characteristics of the specific animal under consideration. The dose can be tailored to achieve a desired effect, but will depend on such factors as weight, diet, concurrent medication and other factors which those skilled in the medical arts will recognize.


In some embodiments, an effective amount of a compound, or a pharmaceutically acceptable salt thereof, as described herein is an amount that is effective to achieve a sustained virologic response, for example, a sustained viral response 12 month after completion of treatment.


Subjects who are clinically diagnosed with a HBV and/or HDV infection include “naïve” subjects (e.g., subjects not previously treated for HBV and/or HDV) and subjects who have failed prior treatment for HBV and/or HDV (“treatment failure” subjects). Treatment failure subjects include “non-responders” (subjects who did not achieve sufficient reduction in ALT (alanine aminotransferase) levels, for example, subject who failed to achieve more than 1 log 10 decrease from base-line within 6 months of starting an anti-HBV and/or anti-HDV therapy) and “relapsers” (subjects who were previously treated for HBV and/or HDV whose ALT levels have increased, for example, ALT>twice the upper normal limit and detectable serum HBV DNA). Further examples of subjects include subjects with a HBV and/or HDV infection who are asymptomatic.


In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be provided to a treatment failure subject suffering from HBV and/or HDV. In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be provided to a non-responder subject suffering from HBV and/or HDV. In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be provided to a relapser subject suffering from HBV and/or HDV. In some embodiments, the subject can have HBeAg positive chronic hepatitis B. In some embodiments, the subject can have HBeAg negative chronic hepatitis B. In some embodiments, the subject can have liver cirrhosis. In some embodiments, the subject can be asymptomatic, for example, the subject can be infected with HBV and/or HDV but does not exhibit any symptoms of the viral infection. In some embodiments, the subject can be immunocompromised. In some embodiments, the subject can be undergoing chemotherapy.


Examples of agents that have been used to treat HBV and/or HDV include immunomodulating agents, and nucleosides/nucleotides. Examples of immunomodulating agents include interferons (such as IFN-α and pegylated interferons that include PEG-IFN-α-2a); and examples of nucleosides/nucleotides include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. However, some of the drawbacks associated with interferon treatment are the adverse side effects, the need for subcutaneous administration and high cost. Potential advantages of a compound of Formula (I), or a pharmaceutically acceptable salt of any of the foregoing, can be less adverse side effects, delay in the onset of an adverse side effect and/or reduction in the severity of an adverse side effect. A drawback with nucleoside/nucleotide treatment can be the development of resistance, including cross-resistance.


Resistance can be a cause for treatment failure. The term “resistance” as used herein refers to a viral strain displaying a delayed, lessened and/or null response to an anti-viral agent. In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be provided to a subject infected with an HBV and/or HDV strain that is resistant to one or more anti-HBV and/or anti-HDV agents. Examples of anti-viral agents wherein resistance can develop include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. In some embodiments, development of resistant HBV and/or HDV strains is delayed when a subject is treated with a compound, or a pharmaceutically acceptable salt thereof, as described herein compared to the development of HBV and/or HDV strains resistant to other HBV and/or HDV anti-viral agents, such as those described.


Combination Therapies

In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be used in combination with one or more additional agent(s) for treating and/or inhibiting replication HBV and/or HDV. Additional agents include, but are not limited to, an interferon, nucleoside/nucleotide analogs, a sequence specific oligonucleotide (such as anti-sense oligonucleotide and siRNA), nucleic acid polymers (NAPs, such as nucleic acid polymers that reduce HBsAg levels including STOPSTM compounds) an entry inhibitor and/or a small molecule immunomodulator. Examples of additional agents include recombinant interferon alpha 2b, IFN-α, PEG-IFN-α-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. Examples of NAPs include, but are not limited to, REP 2139, REP 2165 and those STOPS™ compounds described in U.S. Publication No. 2020/0147124 A1, which is hereby incorporated by reference for the purpose of describing the STOPS™ compounds provided therein. In some embodiments, the additional agent can be 5′mApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsrA psln(5m)CpsmApsln(5m)CpsmApsln(5m)CpsrApsln(5m)CpsmApsln(5m)CpsmApsln(5m)C psrApsln(5m)CpsmApsln(5m)CpsmApsln(5m)C 3′ (SEQ ID NO: 4), wherein mA is 2′-O-methyladenosine, ps is phosphorothioate, ln(5m)C is locked 5-methylcytidine, and rA is ribo-adenosine.


In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, as described herein can be administered with one or more additional agent(s) together in a single pharmaceutical composition. In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, can be administered with one or more additional agent(s) as two or more separate pharmaceutical compositions. Further, the order of administration of a compound, or a pharmaceutically acceptable salt thereof, as described herein with one or more additional agent(s) can vary.


EXAMPLES

Additional embodiments are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the claims.


Example 1
7-tert-butyl 1-ethyl 2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (Intermediate 1)



embedded image


Intermediate 1



embedded image


embedded image


To a stirred solution of 2,5-dichloro-pyrazine (30.0 g, 201 mmol, 1.00 eq.) and ethyl 2-[(diphenylmethylidene)amino]acetate (53.8 g, 201 mmol, 1.00 eq.) in N,N-dimethylformamide (300 mL) was added cesium carbonate (65.6 g, 201 mmol, 1.00 eq.) at room temperature (rt). The mixture was stirred overnight at rt, and the reaction was quenched with water (500 mL). The mixture was extracted with ethyl acetate (3×200 mL)/The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with 0-20% ethyl acetate in petroleum ether to afford ethyl 2-(5-chloropyrazin-2-yl)-2-[(diphenylmethylidene)amino]acetate (48.9 g, 64%) as a yellow solid. LCMS (ESI, m/z): 380 [M+H]+. 1H NMR (400 MHz, DMSO-d6) δ ppm 8.75-8.73 (m, 2H), 7.64-7.62 (m, 2H), 7.57-7.55 (m, 3H), 7.48-7.50 (m, 1H), 7.42-7.45 (m, 2H), 7.20-7.22 (m, 2H), 5.31 (s, 1H), 4.11-4.07 (q, J=6.2 Hz, 2H), 1.12 (t, J=6.2 Hz, 3H).


To a stirred solution of ethyl 2-(5-chloropyrazin-2-yl)-2-[(diphenylmethylidene) amino]acetate (40.0 g, 105 mmol, 1.00 eq.) in ether (400) was added 1N hydrochloric acid (150 mL, 150 mmol, 1.42 eq.) at rt. The mixture was stirred overnight at rt and then extracted with ether (2×20 mL). The combined water layers were concentrated under reduced pressure to afford ethyl 2-amino-2-(5-chloropyrazin-2-yl)acetate hydrochloric acid salt (20.0 g, crude) as a white solid and used directly into next step without further purification. LCMS (ESI, m/z): 216 [M+H—HCl]+. 1H NMR (300 MHz, DMSO-d6) δ ppm 9.33 (s, 3H), 8.93-8.85 (m, 2H), 5.71 (s, 1H), 4.22-4.17 (q, J=6.2 Hz, 2H), 1.15 (t, J=6.2 Hz, 3H).


To a stirred solution of ethyl 2-amino-2-(5-chloropyrazin-2-yl)acetate hydrochloric acid salt (19.0 g, 75.4 mmol, 1.00 eq.) in tetrahydrofuran (200 mL) was added N,N-diisopropylethylamine (30.8 g, 238 mmol, 3.16 eq.) and N,N′-carbonyldiimidazole (12.9 g, 79.3 mmol, 1.05 eq.) at 60° C. The mixture was stirred for 4 h at 60° C. and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with 0-5% methanol in dichloromethane to afford ethyl 6-chloro-3-oxo-2H-imidazo[1,5-a]pyrazine-1-carboxylate (11.0 g, 60%) as a yellow solid. LCMS (ESI, m/z): 242 [M+H]+. 1H NMR (300 MHz, DMSO-d6) δ ppm 12.49 (s, 1H), 8.82 (s, 1H), 7.95 (s, 1H), 4.33-4.27 (q, J=6.2 Hz, 2H), 1.31 (t, J=6.2 Hz, 3H).


A 250 mL of round bottom flask was charged with ethyl 6-chloro-3-oxo-2H-imidazo[1,5-a]pyrazine-1-carboxylate (3.00 g, 12.4 mmol, 1.00 eq.), 4-cyclopropoxyphenylboronic acid (2.65 g, 14.9 mmol, 1.20 eq.), pyridine (2.94 g, 37.1 mmol, 2.99 eq.), copper(II) trifluoromethanesulfonate (4.49 g, 12.4 mmol, 1.00 eq.) and N,N-dimethylformamide (100 mL). The mixture was stirred for 2 h at 60° C. under oxygen atmosphere. The mixture was added ethyl acetate (100 mL) and washed with water (3×100 mL). The organic layers were combined, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with 0-50% ethyl acetate in petroleum ether to afford ethyl 6-chloro-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (3.40 g, 73%) as a yellow solid. LCMS (ESI, m/z): 374 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 9.08 (d, J=1.6 Hz, 1H), 7.75 (d, J=1.6 Hz, 1H), 7.30-7.20 (m, 2H), 7.17-7.11 (m, 2H), 4.25 (q, J=7.1 Hz, 2H), 3.76 (tt, J=4.8, 3.8 Hz, 1H), 2.95 (s, 1H), 2.88 (s, 1H), 1.24 (t, J=7.1 Hz, 3H), 0.80 (s, 2H).


A 250 mL of round bottom flask was charged with ethyl 6-chloro-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (3.40 g, 9.10 mmol, 1.00 eq.), [1,1′-bis(diphenylphosphino)ferrocene] dichloropalladium(II) (0.700 g, 0.957 mmol, 0.11 eq.), potassium carbonate (3.77 g, 27.3 mmol, 3.00 eq.) and 1,4-dioxane (100 mL). Trimethyl-1,3,5,2,4,6-trioxatriborinane (4.57 g, 18.2 mmol, 2.00 eq., 50% in THF) was then added at rt under nitrogen atmosphere. The mixture was stirred overnight at 110° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with water (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with 0-50% ethyl acetate in petroleum ether to afford ethyl 2-(4-cyclopropoxyphenyl)-6-methyl-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (2.20 g, 68%) as a yellow solid. LCMS (ESI, m/z): 354 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 9.23 (d, J=1.6 Hz, 1H), 7.52 (t, J=1.5 Hz, 1H), 7.30-7.24 (m, 2H), 7.19-7.13 (m, 2H), 4.27 (q, J=7.1 Hz, 2H), 4.14 (q, J=7.1 Hz, 2H), 3.85-3.72 (m, 1H), 2.41 (s, 3H), 1.27 (td, J=7.2, 2.4 Hz, 3H), 0.82 (d, J=4.5 Hz, 2H).


A 250 mL of round bottom flask was charged with ethyl 2-(4-cyclopropoxyphenyl)-6-methyl-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (2.20 g, 6.23 mmol, 1.00 eq.) and methanol (100 mL). Sodium borohydride (1.18 g, 31.2 mmol, 5.01 eq.) was added at 0° C. The mixture was stirred for 2 h at rt. The reaction was quenched with water (10 mL). To the mixture was added sodium bicarbonate (2.62 g, 31.1 mmol, 5.00 eq.) and di-tert-butyl dicarbonate (6.79 g, 31.1 mmol, 5.00 eq.) at rt. The mixture was stirred overnight at rt. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with water (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with 0-50% ethyl acetate in petroleum ether to afford 7-tert-butyl 1-ethyl 2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (2.00 g, 70%) as a yellow solid. LCMS (ESI, m/z): 458 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 7.21-7.16 (m, 2H), 7.10-7.04 (m, 2H), 5.31-5.20 (m, 1H), 4.82 (dd, J=13.6, 1.7 Hz, 1H), 4.33 (d, J=19.4 Hz, 1H), 4.21-4.08 (m, 2H), 3.85 (dd, J=12.7, 1.4 Hz, 1H), 3.76-3.70 (m, 1H), 3.63 (dd, J=12.8, 4.7 Hz, 1H), 1.51 (s, 9H), 1.26 (d, J=6.9 Hz, 3H), 1.19 (t, J=7.1 Hz, 3H), 0.87-0.84 (m, 2H), 0.78 (d, J=4.5 Hz, 2H).


Example 2
(6S*)-7-tert-butyl 1-ethyl 2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (Intermediate 1a) and (6R*)-7-tert-butyl 1-ethyl 2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (Intermediate 1b)



embedded image


Intermediate 1 was dissolved in ethanol and then was separated into its two enantiomers intermediate 1a (first eluting enantiomer) and intermediate 1b (second eluting enantiomer) by SFC, using a column Lux A2 (21.2 mm×250 mm, 5 um), at 40° C., with a flow rate of 50 mL/min and 100 bar, under isochratic conditions (30:70 EtOH:CO2 (0.2% v/v NH3).


Example 3
7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxylic acid (Intermediate 2)



embedded image


A solution of NaOH (4 eq., 357 mg, 8.92 mmol) in H2O (1.5 mL) was added to a solution of Intermediate 1 (1 eq., 1020 mg, 2.23 mmol) in EtOH (15 mL). The mixture was stirred at rt for 3 h. The mixture was concentrated to remove ethanol. Water (15 mL) was added, and the aqueous layer was extracted with Et2O (2×20 mL). The aqueous layer was acidified with HCl 1 N to pH 2 and extracted with DCM (3×30 mL). The combined organic layers were dried with magnesium sulfate, filtered and evaporated to dryness to afford 7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxylic acid (Intermediate 2) (830 mg, 78%).


Example 4
(6S*)-7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxylic acid (Intermediate 2a) and (6R*)-7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxylic acid (Intermediate 2b)



embedded image


Intermediates 2a and 2b were synthetized according to the procedures for the synthesis of 7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxylic acid (Intermediate 2), starting from Intermediate 1a and Intermediate 1b, respectively.


Example 5
(6R*)-7-(4-bromo-3-chlorobenzoyl)-2-(4-cyclopropoxyphenyl)-6-methyl-N-(2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (1b)



embedded image




embedded image


Methyl 2-(((tert-butoxycarbonyl)amino)methyl)benzoate

A solution of Boc2O (1.1 eq., 2.29 g, 10.47 mmol) in anhydrous DCM (12.8 mL) was added to a solution of methyl 2-(aminomethyl)benzoate hydrochloride (1 eq., 1.92 g, 9.52 mmol), Et3N (2.5 eq., 3.31 mL, 23.8 mmol) and DMAP (0.1 eq., 0.12 g, 0.95 mmol) in anhydrous DCM (38.4 mL). The mixture was stirred at rt for 1 h. Sat. NH4Cl (50 mL) was added, and the aqueous layer was extracted with AcOEt (3×50 mL). The combined organic layers were washed with HCl 1M (40 mL), brine (30 mL), dried with magnesium sulfate, filtered and evaporated to dryness. The crude product was purified by filtration on a short pad of silica gel using 30% of AcOEt in CyH to provide methyl 2-(((tert-butoxycarbonyl)amino)methyl)benzoate (2.26 g, 89%) as a colorless oil. LCMS (ESI, m/z): 166.1 [M-Boc+H]+.


Tert-butyl (2-(hydrazinecarbonyl)benzyl)carbamate

Hydrazine monohydrate (10 eq., 4.13 mL, 85.2 mmol) was added to a solution of methyl 2-(((tert-butoxycarbonyl)amino)methyl)benzoate (1 eq., 2.26 g, 8.52 mmol) in MeOH (58.3 mL) under N2. The mixture was heated at 65° C. for 24 h. The mixture was then evaporated to dryness to afford tert-butyl (2-(hydrazinecarbonyl)benzyl)carbamate (3.78 g, quant.) as a white solid, which was used as such. LCMS (ESI, m/z): 210.1 [M-tBu+H]+.


Tert-butyl (2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)carbamate

PTSA.H2O (0.1 eq., 0.18 g, 0.94 mmol) was added to a suspension of tert-butyl (2-(hydrazinecarbonyl)benzyl)carbamate (1 eq., 2.49 g, 9.38 mmol) in trimethyl orthoacetate (16.7 eq., 20 mL, 156 mmol) under N2. The mixture was heated at 100° C. for 1 h. Sat. NaHCO3 (10 mL) was added, and the aqueous layer was extracted with AcOEt (3×10 mL). The combined organic layers were washed with brine (30 mL), dried with magnesium sulfate, filtered and evaporated to dryness. The crude mixture was purified by flash chromatography on silica gel (from 0% to 50% of AcOEt in CyH) to give tert-butyl (2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)carbamate (1.76 g, 65%) as a white solid. LCMS (ESI, m/z): 290.1 [M+H]+. 1H-NMR (CDCl3, 300 MHz, 25° C.) δ ppm 1.40 (s, 9H), 2.64 (s, 3H), 4.58 (d, J=6.6 Hz, 2H), 6.14 (br s, 1H), 7.39-7.44 (m, 1H), 7.46-7.51 (m, 1H), 7.63 (d, J=7.2 Hz, 1H), 7.89 (d, J=7.8 Hz, 1H).


(2-(5-methyl-1,3,4-oxadiazol-2-yl)phenyl)methanamine hydrochloride

A solution of tert-butyl (2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)carbamate (1 eq., 400 mg, 1.38 mmol) in HCl 4N in dioxane (20 eq., 6.91 mL, 27.65 mmol) was stirred under N2 at rt for 1 h. The mixture was evaporated to dryness to afford (2-(5-methyl-1,3,4-oxadiazol-2-yl)phenyl)methanamine hydrochloride (328 mg, quant.) as a white solid. LCMS (ESI, m/z): 190.1 [M+H]+. 1H-NMR (DMSO-d6, 300 MHz, 25° C.) δ ppm 2.62 (s, 3H), 4.46 (q, J=2.4 Hz, 2H), 7.61-7.77 (m, 3H), 7.99 (d, J=6.9 Hz, 1H), 8.46 (br s, 3H).


Tert-butyl (R*)-2-(4-cyclopropoxyphenyl)-6-methyl-1-((2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)carbamoyl)-3-oxo-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-7(3H)-carboxylate

HATU (1.2 eq., 106.2 mg, 0.28 mmol), (2-(5-methyl-1,3,4-oxadiazol-2-yl)phenyl)methanamine hydrochloride (1.1 eq., 57.8 mg, 0.26 mmol) and DIPEA (5 eq., 0.19 mL, 1.16 mmol) were added to a suspension of Intermediate 2b (1 eq., 100 mg, 0.23 mmol) in anhydrous DCM (4 mL) under N2. The mixture was stirred at rt for 30 min. Sat. Na2CO3 (15 mL) was added to the mixture, and the aqueous phase was extracted with EtOAc (3×15 mL). The combined organic phases were washed with water (4×15 mL) and brine (15 mL), dried over MgSO4, filtered and evaporated to dryness to afford the title compound (134 mg, 96%) as a brown solid, which was used without further purification. LCMS (ESI, m/z): 601.2 [M+H]+.


(R*)-2-(4-cyclopropoxyphenyl)-6-methyl-N-(2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide hydrochloride

A solution of tert-butyl (R*)-2-(4-cyclopropoxyphenyl)-6-methyl-1-((2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)carbamoyl)-3-oxo-2,5 ,6,8-tetrahydroimidazo[1,5-a]pyrazine-7(3H)-carboxylate (1 eq., 134 mg, 0.22 mmol) in HCl 4N in dioxane (20 eq., 1.12 mL, 4.46 mmol) was stirred under N2 at rt for 1 h. The mixture was evaporated to dryness to afford the title compound (125 mg, quant.) as a red solid, which was used as such. LCMS (ESI, m/z): 501.1 [M+H]+.


(R*)-7-(4-bromo-3-chlorobenzoyl)-2-(4-cyclopropoxyphenyl)-6-methyl-N-(2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (1b)

TCFH (1.2 eq., 89.6 mg, 0.32 mmol) and N-methylimidazole (5 eq., 0.106 mL, 1.33 mmol) were added to a suspension of (R*)-2-(4-cyclopropoxyphenyl)-6-methyl-N-(2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide hydrochloride (0.84 eq., 120 mg, 0.22 mmol) and 4-bromo-3-chlorobenzoic acid (1.1 eq., 69.0 mg, 0.29 mmol) in anhydrous MeCN (2.55 mL) under N2. The mixture was stirred at rt for 1 h. Sat. Na2CO3 (10 mL) was added to the mixture, and the aqueous phase was extracted with EtOAc (3×15 mL). The combined organic phases were washed with water (3×15 mL), brine (20 mL), dried over MgSO4, filtered and evaporated to dryness. The crude mixture was purified by flash chromatography on silica gel (from 0% to 10% of MeOH in DCM). The resulting solid was triturated in Et2O to give the title compound (1b) (86 mg, 54%) as a white solid. LCMS (ESI, m/z): 716.9/718.9/720.9 [M+H]+. 1H-NMR (DMSO-d6, 600 MHz, 80° C.) δ ppm 0.63-0.73 (m, 2H), 0.77-0.87 (m, 2H), 1.27 (d, J=6.9 Hz, 3H), 2.58 (s, 3H), 3.64-3.71 (m, 2H), 3.83 (hept., J=3.0 Hz, 1H), 4.50 (d, J=18.3 Hz, 1H), 4.54-4.77 (m, 3H), 5.06-5.32 (m, 1H), 6.95-7.00 (m, 2H), 7.12-7.20 (m, 3H), 7.31 (d, J=7.1 Hz, 1H), 7.37 (dd, J=8.1, 1.7 Hz, 1H), 7.45-7.51 (m, 2H), 7.73 (d, J=1.7 Hz, 1H), 7.85 (d, J=7.9 Hz, 2H).


Example 6
(S*)-7-(4-bromo-3-chlorobenzoyl)-2-(4-cyclopropoxyphenyl)-6-methyl-N-(2-(5-methyl-1,3,4-oxadiazol-2-yl)benzyl)-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (1a)



embedded image


(S*)-7-(4-bromo-3-chlorobenzoyl)-2-(4-cyclopropoxyphenyl)-6-methyl-N-(2-(5-methyl-1,3 ,4-oxadiazol-2-yl)benzyl)-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (1a) was synthetized following the procedure as depicted for (1b), using Intermediate 2a in step 5 in place of Intermediate 2b. LCMS (ESI, m/z): 716.9/718.9/720.9 [M+H]+. 1H-NMR (DMSO-d6, 600 MHz, 80° C.) δ ppm 0.63-0.73 (m, 2H), 0.77-0.87 (m, 2H), 1.27 (d, J=6.9 Hz, 3H), 2.58 (s, 3H), 3.64-3.71 (m, 2H), 3.83 (hept., J=3.0 Hz, 1H), 4.50 (d, J=18.3 Hz, 1H), 4.54-4.77 (m, 3H), 5.06-5.32 (m, 1H), 6.95-7.00 (m, 2H), 7.12-7.20 (m, 3H), 7.31 (d, J=7.1 Hz, 1H), 7.37 (dd, J=8.1, 1.7 Hz, 1H), 7.45-7.51 (m, 2H), 7.73 (d, J=1.7 Hz, 1H), 7.85 (d, J=7.9 Hz, 2H).


Example 7
(R*)-7-(4-bromo-3-chlorobenzoyl)-2-(4-cyclopropoxyphenyl)-N-(2-fluoro-6-(pyrimidin-4-yl)benzyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (2b)



embedded image




embedded image


Tert-butyl (2-bromo-6-fluorobenzyl)carbamate

A solution of Boc2O (1.2 eq., 1.28 g, 5.88 mmol) in anhydrous DCM (5 mL) was added at 0° C. to a solution of Et3N (1.2 eq., 0.82 mL, 5.88 mmol) and 2-bromo-6-fluorobenzylamine (1 eq., 1.0 g, 4.90 mmol) in anhydrous DCM (15 mL) under N2. The mixture was stirred at rt for 1 h and evaporated to dryness. Water (50 mL) and HCl 1M (10 mL) were added. The aqueous solution was extracted with AcOEt (3×20 mL). The combined organic layers were and washed with HCl 1M (20 mL), brine (20 mL), dried over MgSO4, filtered and evaporated to dryness to give tert-butyl (2-bromo-6-fluorobenzyl)carbamate (1.39 g, 93%) as a yellow oil, which was used without further purification. LCMS (ESI, m/z): 247.9/249.9 [M-tBu +H]+. 1H-NMR (DMSO-d6, 400 MHz, 25° C.) δ ppm 1.37 (s, 9H), 4.26 (d, J=4.0 Hz, 2H), 7.14 (br s, 1H), 7.20-7.31 (m, 2H), 7.45 (d, J=8.0 Hz, 1H).


Tert-butyl (2-fluoro-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzyl)carbamate

A mixture of tert-butyl (2-bromo-6-fluorobenzyl)carbamate (1 eq., 1.1 g, 3.62 mmol), potassium acetate (2.5 eq., 0.89 g, 9.04 mmol), bis(pinacolato)diboron (1.2 eq., 1.10 g, 4.34 mmol) and Pd(dppf)Cl2.DCM (0.1 eq., 0.3 g, 0.36 mmol) in anhydrous dioxane (11 mL) under N2 was heated to 80° C. for 4 h. After cooling to rt, water (50 mL) was added. The solution was extracted with EtOAc (3×30 mL). The combined organic layers were washed with brine (50 mL), dried over MgSO4, filtered and evaporated to dryness. The crude mixture was purified by flash chromatography on silica gel (from 0% to 30% AcOEt in CyH) to give tert-butyl (2-fluoro-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzyl)carbamate (852 mg, 67%) as a colorless oil. LCMS (ESI, m/z): 252.1 [M-Boc+H]+.


Tert-butyl (2-fluoro-6-(pyrimidin-4-yl)benzyl)carbamate

A mixture of tert-butyl (2-fluoro-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzyl)carbamate (1 eq., 883 mg, 2.52 mmol), 4-chloropyrimidine hydrochloride (1 eq., 380 mg, 2.52 mmol), sodium carbonate 2.4 M in water (5 eq., 5 mL, 12.6 mmol) and Pd(dppf)Cl2.DCM (0.05 eq., 102.7 mg, 0.13 mmol) in dioxane (11 mL) was heated at 100° C. for 1 h. After cooling to rt, the mixture was diluted with water and extracted with AcOEt (3×70 mL). The combined organic layers were washed with brine, dried over MgSO4, filtered and evaporated to dryness. The crude mixture was purified by flash chromatography on silica gel (from 0% to 65% AcOEt in CyH) to give tert-butyl (2-fluoro-6-(pyrimidin-4-yl)benzyl)carbamate (657 mg, 86%) as a colorless oil. LCMS (ESI, m/z): 304.1 [M+H]+. 1H-NMR (DMSO-d6, 300 MHz, 25° C.) δ ppm 1.29 (s, 9H), 4.31 (d, J=4.5 Hz, 2H), 6.91 (br s, 1H), 7.31-7.39 (m, 2H), 7.45-7.52 (m, 1H), 7.73 (d, J=5.1 Hz, 1H), 8.90 (d, J=5.1 Hz, 1H), 9.26 (s, 1H).


(2-fluoro-6-(pyrimidin-4-yl)phenyl)methanamine.TFA

TFA (20 eq., 1.62 mL, 21.8 mmol) was added to a solution of tert-butyl (2-fluoro-6-(pyrimidin-4-yl)benzyl)carbamate (1 eq., 330 mg, 1.09 mmol) in DCM (7 mL) under N2. The mixture was stirred at rt for 1 h. The mixture was evaporated to dryness and the residue was triturated in Et2O to give (2-fluoro-6-(pyrimidin-4-yl)phenyl)methanamine.TFA (227 mg, 66%) as a black solid. LCMS (ESI, m/z): 204.1 [M+H]+.


Tert-butyl (R*)-2-(4-cyclopropoxyphenyl)-1-((2-fluoro-6-(pyrimidin-4-yl)benzyl)carbamoyl)-6-methyl-3-oxo-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-7(3H)-carboxylate

A solution of Intermediate 2b (1 eq., 108.3 mg, 0.25 mmol), (2-fluoro-6-(pyrimidin-4-yl)phenyl)methanamine.TFA (1.1 eq., 88 mg, 0.28 mmol), HATU (1.2 eq., 115 mg, 0.303 mmol) and DIPEA (10 eq., 0.42 mL, 2.52 mmol) in anhydrous DCM (3.8 mL) was stirred at rt under N2 for 1 h. Sat. Na2CO3 (20 mL) was added to the mixture, and the aqueous phase was extracted with EtOAc (3×30 mL). The combined organic layers were washed with water (3×15 mL), brine (30 mL), dried over MgSO4, filtered and evaporated to dryness. The crude product was purified by flash chromatography on silica gel (from 0% to 10% MeOH in DCM) to give the title product (117 mg, 76%) as a red oil. LCMS (ESI, m/z): 615.1 [M+H]+.


(R*)-2-(4-cyclopropoxyphenyl)-N-(2-fluoro-6-(pyrimidin-4-yl)benzyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide hydrochloride

A solution of tert-butyl (R*)-2-(4-cyclopropoxyphenyl)-1-((2-fluoro-6-(pyrimidin-4-yl)benzyl)carbamoyl)-6-methyl-3-oxo-2,5 ,6,8-tetrahydroimidazo[1,5-a]pyrazine-7(3H)-carboxylate (1 eq., 129 mg, 0.21 mmol) in HCl 4N in dioxane (20 eq., 1.05 mL, 4.2 mmol) was stirred at rt under N2 for 1 h. The mixture was evaporated to dryness to afford the title compound (129 mg, quant.) as a dark red sticky solid, which was used as such. LCMS (ESI, m/z): 515.1 [M+H]+.


(R*)-7-(4-bromo-3-chlorobenzoyl)-2-(4-cyclopropoxyphenyl)-N-(2-fluoro-6-(pyrimidin-4-yl)benzyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (2b)

TCFH (1.2 eq., 35.69 mg, 0.13 mmol) and N-methylimidazole (5 eq., 0.042 mL, 0.53 mmol) were added to a suspension of (R*)-2-(4-cyclopropoxyphenyl)-N-(2-fluoro-6-(pyrimidin-4-yl)benzyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide hydrochloride (1 eq., 61 mg, 0.11 mmol) and 4-bromo-3-chlorobenzoic acid (1.1 eq., 27.45 mg, 0.12 mmol) in anhydrous MeCN (0.5 mL) under N2. The mixture was stirred at rt for 2 h. Sat. Na2CO3 (10 mL) was added to the mixture, and the aqueous phase was extracted with EtOAc (3×20 mL). The combined organic layers were washed with water (3×10 mL), brine (30 mL), dried over MgSO4, filtered and evaporated to dryness. The crude mixture was purified by flash chromatography on silica gel (from 0% to 10% MeOH in DCM). The resulting solid was purified by reverse phase flash chromatography (from 0% to 100% MeCN in water+0.1% TFA). The tubes containing the product were combined and MeCN was evaporated. The resulting aqueous solution was neutralized with sat. NaHCO3 and extracted with EtOAc (4×10 mL). The combined organic layers were washed with water (20 mL), dried over MgSO4, filtered and evaporated to dryness to give (2b) (31 mg, 36 mg) as a tan solid. LCMS (ESI, m/z): 728.9/730.9/732.9 [M+H]+. 1H-NMR (DMSO-d6, 600 MHz, 80° C.) δ ppm 0.52-0.59 (m, 2H), 0.71-0.77 (m, 2H), 1.26 (d, J=6.6 Hz, 3H), 3.66 (d, J=2.9 Hz, 2H), 3.72 (hept, J=3.0 Hz, 1H), 4.32-4.42 (m, 2H), 4.47 (d, J=18.3 Hz, 1H), 4.59 (br. s, 1H), 5.08-5.21 (m, 1H), 6.86 (br. s, 1H), 6.90 (d, J=8.8 Hz, 2H), 7.13 (d, J=8.8 Hz, 2H), 7.31 (t, J=9.0 Hz, 1H), 7.35-7.37 (m, 2H), 7.48-7.54 (m, 1H), 7.65 (d, J=5.1 Hz, 1H), 7.72 (d, J=1.5 Hz, 1H), 7.84 (d, J=8.2 Hz, 1H), 8.86 (d, J=5.2 Hz, 1H), 9.11 (s, 1H).


Example 8
(S*)-7-(4-bromo-3-chlorobenzoyl)-2-(4-cyclopropoxyphenyl)-N-(2-fluoro-6-(pyrimidin-4-yl)benzyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (2a)



embedded image


(S*)-7-(4-bromo-3-chlorobenzoyl)-2-(4-cyclopropoxyphenyl)-N-(2-fluoro-6-(pyrimidin-4-yl)benzyl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (2a) was synthetized following the procedure as depicted for (2b), using Intermediate 2a in step 5, in place of Intermediate 2b. LCMS (ESI, m/z): 728.9/730.9/732.9 [M+H]+. 1H-NMR (DMSO-d6, 600 MHz, 80° C.) δ ppm 0.52-0.59 (m, 2H), 0.71-0.77 (m, 2H), 1.26 (d, J=6.6 Hz, 3H), 3.66 (d, J=2.9 Hz, 2H), 3.72 (hept, J=3.0 Hz, 1H), 4.32-4.42 (m, 2H), 4.47 (d, J=18.3 Hz, 1H), 4.59 (br. s, 1H), 5.08-5.21 (m, 1H), 6.86 (br. s, 1H), 6.90 (d, J=8.8 Hz, 2H), 7.13 (d, J=8.8 Hz, 2H), 7.31 (t, J=9.0 Hz, 1H), 7.35-7.37 (m, 2H), 7.48-7.54 (m, 1H), 7.65 (d, J=5.1 Hz, 1H), 7.72 (d, J=1.5 Hz, 1H), 7.84 (d, J=8.2 Hz, 1H), 8.86 (d, J=5.2 Hz, 1H), 9.11 (s, 1H).


Example 9
(6S *)-7-(4-bromo-3-chloro-benzoyl)-2-[4-(cyclopropoxy)phenyl]-6-methyl-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide (3a) and (6R*)-7-(4-bromo-3-chloro-benzoyl)-2-[4-(cyclopropoxy)phenyl]-6-methyl-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6, 8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide (3b)



embedded image


Compounds (3a) and (3b) were synthetized following the pathway described to synthetize (2b), using Intermediate 2 in place of Intermediate 2b, and (2-(pyrimidin-2-yl)phenyl)methanamine in place of (2-fluoro-6-(pyrimidin-4-yl)phenyl)methanamine in step 5. The resulting racemic compound (3) was then further separated into its two enantiomers (3a) (first eluting enantiomer) and (3b) (second eluting enantiomer) by SFC, using a column Lux C3 (20mm×250 mm, 5 um) at 40° C., with a flow rate of 50 mL/min and 100 bar, under isochratic conditions (35:65 EtOH:CO2 (0.1% v/v NH3). LCMS (ESI, m/z): 713/715/717 [M+H]+. 1H-NMR (DMSO, 600 MHz, 80° C.) δ ppm 0.57-0.61 (m, 2H), 0.73-0.79 (m, 2H), 1.28 (d, J=6.5 Hz, 3H), 3.64-3.69 (m, 2H), 3.70-3.75 (m, 1H), 4.47-4.55 (m, 3H), 4.56-4.69 (m, 1H), 5.12-5.29 (m, 1H), 6.91 (d, J=8.8 Hz, 2H), 7.09-7.18 (m, 3H), 7.26-7.30 (m, 1H), 7.38 (dd, J=8.2 Hz, 1.8 Hz, 1H), 7.39-7.45 (m, 3H), 7.73 (d, J=1.7 Hz, 1H), 7.85 (d, J=8.1 Hz, 1H), 7.95-7.99 (m, 1H), 8.81 (d, J=4.6 Hz, 2H).


Example 10
(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (55a) and (6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (55b)



embedded image


Tert-butyl (2-(pyrimidin-4-yl)benzyl)carbamate



embedded image


A 100 mL round bottom flask was charged with 2-{[(tert-butoxycarbonyl)amino]methyl}phenylboronic acid (5.00 g, 19.9 mmol, 1.00 eq.), 4-chloropyrimidine (2.96 g, 25.9 mmol, 1.30 eq.), K2CO3 (8.26 g, 59.7 mmol, 3.00 eq.), Pd(PPh3)4 (0.920 g, 0.797 mmol, 0.04 eq.) and 1,4-dioxane (100 mL). The solution was stirred overnight at 100° C. under a nitrogen atmosphere and then concentrated under reduced pressure. The reaction was quenched with water (200 mL), and the mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:5) to afford tert-butyl N-{[2-(pyrimidin-4-yl)phenyl]methyl}carbamate (5.00 g, 88% yield) as a white solid. LCMS (ESI, m/z): 286 [M+H]+.


1-[2-(pyrimidin-4-yl)phenyl]methanamine hydrochloride



embedded image


A 100 mL round-bottom flask was charged with tert-butyl N-{[2-(pyrimidin-4-yl)phenyl]methyl}carbamate (1.50 g, 5.26 mmol, 1.00 eq.) and hydrogen chloride (20 mL, 4M in 1,4-dioxane). The mixture was stirred for 2 h at rt and then concentrated under reduced pressure to afford 1-[2-(pyrimidin-4-yl)phenyl]methanamine hydrochloride (0.85 g, crude) as an off-white solid. LCMS (ESI, m/z): 186 [M+H—HCl]+.


7-tert-butyl 1-ethyl 2-{4-[(tert-butyldimethylsilyl)oxy]phenyl}-6-methyl-3-oxo-5H,6H, 8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate)



embedded image


A 100 mL round-bottom flask was charged with 7-tert-butyl 1-ethyl 6-methyl-3-oxo-2H,5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (3.00 g, 9.22 mmol, 1.00 eq.), 4-[(tert-butyldimethylsilyl)oxy] phenylboronic acid (2.56 g, 10.1 mmol, 1.10 eq.), Cu(OTf)2 (3.33 g, 9.22 mmol, 1.00 eq.), pyridine (2.19 g, 27.660 mmol, 3.00 eq.) and DMF (30 mL). The mixture was stirred for 3 h at 60° C. under an O2 atmosphere and then diluted with ethyl acetate (300 mL). The mixture was washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:2) to afford to afford 7-tert-butyl 1-ethyl 2-{4-[(tert-butyldimethylsilyl) oxy]phenyl}-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (4.20 g, 87% yield) as a yellow oil. LCMS (ESI, m/z): 532 [M+H]+.


7-(tert-butoxycarbonyl)-2-(4-hydroxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid



embedded image


A 100 mL round-bottom flask was charged with 7-tert-butyl 1-ethyl 2-{4-[(tert-butyldimethylsilyl)oxy]phenyl}-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (4.26 g, 8.01 mmol, 1.00 eq.), NaOH (0.640 g, 16.0 mmol, 2.00 eq.), EtOH (40 mL) and water (10 mL). The mixture was stirred for 3 h at 60° C. and then concentrated under reduced pressure. The mixture was diluted with water (50 mL) and the pH value of the mixture was adjusted to about 6 with 1 mol/L HCl (aq.). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to afford 7-(tert-butoxycarbonyl)-2-(4-hydroxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (2.20 g, 71% yield) as a red solid. LCMS (ESI, m/z): 390 [M+H]+.


tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl} carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 250 mL round-bottom flask was charged with 7-(tert-butoxycarbonyl)-2-(4-hydroxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (500 mg, 1.28 mmol, 1.00 eq.), 1-[2-(pyrimidin-4-yl)phenyl]methanamine hydrochloride (342 mg, 1.54 mmol, 1.20 eq.), DIEA (829 mg, 6.42 mmol, 5.00 eq.), HOBT (208 mg, 1.54 mmol, 1.20 eq.), EDCI (295 mg, 1.54 mmol, 1.20 eq.) and DMF (10 mL). The mixture was stirred for overnight at rt. The reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (9:1) to afford tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamyl)-5H,6H, 8H-imidazo[1,5-a]pyrazine-7-carboxylate (650 mg, 91% yield) as purple oil. LCMS (ESI, m/z): 557 [M+H]+.


2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl] methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 250 mL round-bottom flask was charged with tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (350 mg, 0.629 mmol, 1.00 eq.), (R)-propylene oxide (2 mL), K2CO3 (260 mg, 1.88 mmol, 3.00 eq.) and CH3CN (10 mL). The mixture was stirred overnight at 80° C. and then concentrated under reduced pressure. The residue was diluted with water (30 mL). The organic layers were combined, washed with water (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with CH2Cl2:MeOH (9:1) to afford tert-butyl 2-{4-[(2R)-2-hydroxypropoxyl]phenyl}-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (200 mg, 52% yield) as a yellow oil. LCMS (ESI, m/z): 615 [M+H]+.


2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl] methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoracetic acid salt



embedded image


A 100 mL round-bottom flask was charged with tert-butyl 2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (200 mg, 0.325 mmol, 1.00 eq.), TFA (2 mL) and DCM (10 mL). The mixture was stirred for 2 h at rt and then concentrated under reduced pressure to afford 2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoracetic acid salt (205 mg, crude) as a yellow oil. LCMS (ESI, m/z): 515 [M-TFA+H]+.


(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (55a) and (6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (55b)



embedded image


A 100 mL round bottom flask was charged with 2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (205 mg, 0.326 mmol, 1.00 eq.), 4-bromo-3-(trifluoromethyl)benzoic acid (105 mg, 0.391 mmol, 1.20 eq.), EDCI (75.1 mg, 0.391 mmol, 1.20 eq.), HOBT (52.9 mg, 0.391 mmol, 1.20 eq.), DIEA (210 mg, 1.630 mmol, 5.00 eq.) and DMF (10 mL). The mixture was stirred overnight at rt. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with CH2Cl2:MeOH (10:1) to afford the crude product. The crude product was purified by prep-CHIRAL-HPLC with the following conditions: Column: Column: CHIRALPAK IE, 2×25 cm, 5 μm; Mobile Phase A: MtBE (0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: EtOH-HPLC; Flow rate: 14 mL/min; Gradient: 20% B to 20% B in 30 min; Wave Length: 220/254 nm to afford the final products.


(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (55a) (the first eluting diastereoisomer, 31.7 mg, 13% yield) as a white solid. LCMS (ESI, m/z): 765 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 8.77-8.74 (m, 2H), 7.82 (d, J=4.0 Hz, 2H), 7.54-7.41 (m, 6H), 7.15 (d, J=4.0 Hz, 2H), 6.84-6.81 (m, 1H), 6.64 (d, J=4.0 Hz, 2H), 5.23 (s, 1H), 4.65 (d, J=8.0 Hz, 1H), 4.45-4.32 (m, 2H), 4.09-3.84 (m, 2H), 3.74-3.69 (m, 2H), 3.58-3.54 (m, 1H), 2.50 (s, 1H), 1.65 (s, 1H), 1.41 (d, J=4.0 Hz, 3H), 1.26 (d, J=2.0 Hz, 3H).


(6S *)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{4-[(2R)-2-hydroxypropoxy]phenyl}-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (55b) (the second eluting diastereoisomer, 39.7 mg, 16% yield) as a white solid. LCMS (ESI, m/z): 765 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 8.77-8.74 (m, 2H), 7.82 (d, J=4.0 Hz, 2H), 7.54-7.41 (m, 6H), 7.15 (d, J=4.0 Hz, 2H), 6.84-6.81 (m, 1H), 6.64 (d, J=4.0 Hz, 2H), 5.23 (s, 1H), 4.65 (d, J=8.0 Hz, 1H), 4.45-4.32 (m, 2H), 4.09-3.84 (m, 2H), 3.74-3.69 (m, 2H), 3.58-3.54 (m, 1H), 1.41 (d, J=4.0 Hz, 3H), 1.26 (d, J=2.0 Hz, 3H).


Example 11
(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-2-{4-[(2R)-3,3,3-trifluoro-2-hydroxypropoxy]phenyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (71a) and (6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-2-{4-[(2R)-3,3,3-trifluoro-2-hydroxypropoxy]phenyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (71b)



embedded image


tert-butyl N-{[2-(pyrimidin-2-yl)phenyl]methyl}carbamate



embedded image


A 100 mL round bottom flask was charged with 2-{[(tert-butoxycarbonyl) amino] methyl}phenylboronic acid (3.00 g, 11.9 mmol, 1.00 eq.), 2-chloro-pyrimidine (1.64 g, 14.3 mmol, 1.20 eq.), K2CO3 (4.95 g, 35.8 mmol, 3.00 eq.), Pd(PPh3)4 (0.690 g, 0.597 mmol, 0.05 eq.) and 1,4-dioxane (20 mL). The solution was stirred overnight at 100° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:5) to afford tert-butyl N-{[2-(pyrimidin-2-yl)phenyl] methyl}carbamate (2.50 g, 73% yield) as a white solid. LCMS (ESI, m/z): 286 [M+H]+.


1-[2-(pyrimidin-2-yl)phenyl]methanamine hydrochloride



embedded image


A 100 mL round-bottom flask was charged with tert-butyl N-{[2-(pyrimidin-2-yl)phenyl]methyl}carbamate (1.00 g, 3.51 mmol, 1.00 eq.) and hydrogen chloride (20 mL, 4M in 1,4-dioxane). The solution was stirred for 2 h at rt and then concentrated under reduced pressure to afford 1-[2-(pyrimidin-2-yl)phenyl]methanamine hydrochloride (0.770 g, crude) as a white solid. LCMS (ESI, m/z): 186 [M+H—HCl]+.


tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-((2-(pyrimidin-2-yl)benzyl)carbamoyl)-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-7(3H)-carboxylate



embedded image


A 100 mL round-bottom flask was charged with 7-(tert-butoxycarbonyl)-2-(4-hydroxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (500 mg, 1.28 mmol, 1.00 eq.), 1-[2-(pyrimidin-2-yl)phenyl]methanamine hydrochloride (285 mg, 1.284 mmol, 1.00 eq.), EDCI (320 mg, 1.67 mmol, 1.03 eq.), HOBT (226 mg, 1.67 mmol, 1.30 eq.), DIEA (830 mg, 6.42 mmol, 5.00 eq.) and DMF (8 mL). The mixture was stirred for overnight at rt and then diluted with ethyl acetate (150 mL). The mixture was washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (9:1) to afford tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (550 mg, 77% yield) as a yellow solid. LCMS (ESI, m/z): 557 [M+H]+.


tert-butyl 6-methyl-3-oxo-1-((2-(pyrimidin-2-yl)benzyl)carbamoyl)-2-(4-((R)-3,3,3-trifluoro-2-hydroxypropoxy)phenyl)-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-7(3H)-carboxylate



embedded image


A 250 mL round-bottom flask was charged with tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (280 mg, 0.503 mmol, 1.00 eq.), (2R)-2-(trifluoromethyl)oxirane (84.6 mg, 0.754 mmol, 1.50 eq.), K2CO3 (208 mg, 1.51 mmol, 3.00 eq.) and CH3CN (10 mL). The mixture was stirred for overnight at 80° C. and then concentrated under reduced pressure. The residue was diluted with water (30 mL). The aqueous layer was extracted with ethyl acetate (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with CH2Cl2:MeOH (9:1) to afford tert-butyl 6-methyl-3-oxo-1-((2-(pyrimidin-2-yl)benzyl)carbamoyl)-2-(4-((R)-3,3,3-trifluoro-2-hydroxypropoxy)phenyl)-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-7(3H)-carboxylate (230 mg, 68% yield) as a yellow solid. LCMS (ESI, m/z): 669 [M+H]+.


6-methyl-3-oxo-N-(2-(pyrimidin-2-yl)benzyl)-2-(4-((R)-3,3,3-trifluoro-2-hydroxypropoxy)phenyl)-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt



embedded image


A 100 mL round-bottom flask was charged with tert-butyl 6-methyl-3-oxo-1-((2-(pyrimidin-2-yl)benzyl)carbamoyl)-2-(4-((R)-3,3,3-trifluoro-2-hydroxypropoxy)phenyl)-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-7(3H)-carboxylate (230 mg, 0.325 mmol, 1.00 eq.), TFA (2 mL)and DCM (10 mL) at rt. The mixture was stirred for 2 h at rt under air atmosphere and then concentrated under reduced pressure to afford 6-methyl-3-oxo-N-(2-(pyrimidin-2-yl)benzyl)-2-(4-((R)-3,3,3-trifluoro-2-hydroxypropoxy)phenyl)-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (250 mg, crude) as a yellow oil. LCMS (ESI, m/z): 569 [M-TFA+H]+.


(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-2-{4-[(2R)-3,3,3-trifluoro-2-hydroxypropoxy]phenyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (71a) and (6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-2-{4-[(2R)-3,3,3-trifluoro-2-hydroxypropoxy]phenyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (71b)



embedded image


A 100 mL round-bottom flask was charged with 6-methyl-3-oxo-N-(2-(pyrimidin-2-yl)benzyl)-2-(4-((R)-3,3,3-trifluoro-2-hydroxypropoxy)phenyl)-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (205 mg, 0.300 mmol, 1.00 eq.), 4-bromo-3-(trifluoromethyl)benzoic acid (96.9 mg, 0.360 mmol, 1.20 eq.), EDCI (69.0 mg, 0.360 mmol, 1.20 eq.), HOBT (48.7 mg, 0.360 mmol, 1.20 eq.), DIEA (194 mg, 1.500 mmol, 5.00 eq.) and DMF (5 mL). The mixture was stirred for overnight at rt. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with CH2Cl2:MeOH (10:1) to afford the crude product. The crude product was purified by prep-CHIRAL-HPLC with the following conditions: Column: Chiral ART Cellulose-SA, 2×25 cm, 5 μm; Mobile Phase A: MtBE (0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: EtOH-HPLC; Flow rate: 20 mL/min; Gradient: 13% B to 13% B in 18 min; Wave Length: 254/220 nm to afford the final products.


(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-2-{4-[(2R)-3,3,3-trifluoro-2-hydroxypropoxy]phenyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (71a) (the first eluting diastereoisomer, 16.7 mg, 6.8% yield) as a white solid. LCMS (ESI, m/z): 819 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 8.59 (d, J=4.0 Hz, 2H), 8.16-8.12 (m, 1H), 7.84-7.82 (m, 2H), 7.52-7.43 (m, 4H), 7.18-7.16 (m, 1H), 7.05 (d, J=4.0 Hz, 2H), 6.84 (s, 1H), 6.47 (d, J=4.0 Hz, 2H), 5.34 (s, 2H), 4.68-4.56 (m, 2H), 4.48-4.46 (m, 1H) 4.26-4.18 (m, 1H), 3.94-3.90 (m, 1H), 3.85-3.81 (m, 2H), 3.71 (d, J=6.0 Hz, 1H), 3.45 (s, 1H), 1.41 (d, J=2.0 Hz, 3H).


(6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-2-{4-[(2R)-3,3,3-trifluoro-2-hydroxypropoxy]phenyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (71b) (the second eluting diastereoisomer, 22.3 mg, 9.1% yield). LCMS (ESI, m/z): 819 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 8.59 (d, J=4.0 Hz, 2H), 8.16-8.12 (m, 1H), 7.84-7.82 (m, 2H), 7.52-7.43 (m, 4H), 7.18-7.16 (m, 1H), 7.05 (d, J=4.0 Hz, 2H), 6.84 (s, 1H), 6.47 (d, J=4.0 Hz, 2H), 5.34 (s, 2H), 4.68-4.56 (m, 2H), 4.48-4.46 (m, 1H) 4.26-4.18 (m, 1H), 3.94-3.90 (m, 1H), 3.85-3.81 (m, 2H), 3.71 (d, J=6.0 Hz, 1H), 3.45 (s, 1H), 1.41 (d, J=2.0 Hz, 3H).


Example 12
(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (73a) and (6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (73b)



embedded image


7-tert-butyl 1-ethyl 2-(4-iodophenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate



embedded image


A 40 ml vial was charged with 7-tert-butyl 1-ethyl 6-methyl-3-oxo-2H,5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (500 mg, 1.54 mmol, 1.00 eq.), 4-iodophenylboronic acid (457 mg, 1.84 mmol, 1.20 eq.), pyridine (267 mg, 3.38 mmol, 2.20 eq.), Cu(OTf)2 (111 mg, 0.307 mmol, 0.200 eq.) and DMF (20 mL). The mixture was stirred overnight at 60° C. under an O2 atmosphere. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:3) to afford 7-tert-butyl 1-ethyl 2-(4-iodophenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (730 mg, 90% yield) as an off-white solid. LCMS (ESI, m/z): 528 [M+H]+.


tert-butyl 1-(benzylcarbamoyl)-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 250 mL round-bottom flask was charged with 7-tert-butyl 1-ethyl 2-(4-iodophenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (900 mg, 1.71 mmol, 1.00 eq.), 2-methyl -2,6-diazaspiro[3.3]heptane dihydrochloride (631 mg, 3.41 mmol, 2.00 eq.), Pd(OAc)2 (38.3 mg, 0.171 mmol, 0.10 eq.), XPhos (163 mg, 0.341 mmol, 0.20 eq.), Cs2CO3 (3.34 g, 10.2 mmol, 6.00 eq.) and toluene (20 mL) The mixture was stirred for overnight at 90° C. under a nitrogen atmosphere. The reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with brine (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (10:1) to afford tert-butyl 1-(benzylcarbamoyl)-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (660 mg, 69% yield) as a light yellow solid. LCMS (ESI, m/z): 512 [M+H]+.


1-(ethoxycarbonyl)-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylic acid



embedded image


A 40 mL vial was charged with 7-tert-butyl 1-ethyl 6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (650 mg, 1.27 mmol, 1.00 eq.), MeOH (16 mL), NaOH (102 mg, 2.55 mmol, 2.00 eq.) and water (4 mL) at rt. The mixture was stirred 3 h at 60° C. The reaction was quenched with water (20 mL). The mixture was adjusted to pH 7 with HCl (1 mol/L aq.). The mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with brine (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to afford 1-(ethoxycarbonyl)-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylic acid (770 mg, crude) as an off-white solid. LCMS (ESI, m/z): 484 [M+H]+.


tert-butyl 6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 40 mL vial was charged with 7-(tert-butoxycarbonyl)-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (200 mg, 0.414 mmol, 1.00 eq.), 1-[2-(pyrimidin-4-yl)phenyl]methanamine hydrochloride (110 mg, 0.497 mmol, 1.20 eq.), DIEA (267 mg, 2.07 mmol, 5.00 eq.), HOBT (83.8 mg, 0.621 mmol, 1.50 eq.), EDCI (119 mg, 0.621 mmol, 1.50 eq.) and DMF (20 mL). The mixture was stirred overnight at rt. The reaction was quenched with water (20 mL). The mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with brine (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (10:1) to afford tert-butyl 6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (110 mg, 41% yield) as a yellow solid. LCMS (ESI, m/z): 651 [M+H]+.


6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt



embedded image


A 100 mL round-bottom flask was charged with tert-butyl 6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (110 mg, 0.169 mmol, 1.00 eq.), TFA (4 mL) and DCM (20 mL). The mixture was stirred for 2 h at rt and then concentrated under reduced pressure to afford 6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (118 mg, crude) as a light yellow oil. LCMS (ESI, m/z): 550 [M+H-TFA]+.


(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (73a) and (6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (73b)



embedded image


A 40 mL vial was charged with 6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (118 mg, 0.177 mmol, 1.00 eq.), 4-bromo-3-(trifluoromethyl)benzoic acid (57.2 mg, 0.212 mmol, 1.20 eq.), EDCI (51.0 mg, 0.265 mmol, 1.50 eq.), DIEA (68.7 mg, 0.531 mmol, 3.00 eq.), HOBT (35.9 mg, 0.265 mmol, 1.50 eq.) and DMF (5 mL). The mixture was stirred for overnight at rt. The reaction was quenched with water (20 mL). The mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with brine (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (8:1) to afford the crude product. The crude product was purified by purified by prep-CHIRAL-HPLC with the following conditions: Column: CHIRALPAK IE, 2×25 cm, 5 μm; Mobile Phase A: MtBE (0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: MeOH-HPLC; Flow rate: 20 mL/min; Gradient: 50% B to 50% B in 18 min; Wave Length: 254/220 nm to afford the final products.


(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (73a) (the first elution, 17.3 mg, 12% yield) as a white solid. LCMS (ESI, m/z): 801 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 8.83 (d, J=1.4 Hz, 1H), 8.75 (d, J=5.2 Hz, 1H), 7.83 (d, J=8.2 Hz, 2H), 7.58-7.39 (m, 6H), 7.09-6.99 (m, 2H), 6.77 (t, J=6.2 Hz, 1H), 6.22-6.12 (m, 2H), 5.35 (s, 2H), 4.66 (d, J=18.9 Hz, 1H), 4.38 (qd, J=13.8, 6.2 Hz, 2H), 3.87 (d, J=12.7 Hz, 1H), 3.74 (s, 5H), 3.40 (s, 4H), 2.37 (s, 3H), 1.41 (d, J=6.9 Hz, 3H).


(6S *)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-2-(4-{6-methyl-2,6-diazaspiro[3.3]heptan-2-yl}phenyl)-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (73b) (17.2 mg, 12% yield) as a white solid. LCMS (ESI, m/z): 801 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 8.83 (d, J=1.4 Hz, 1H), 8.75 (d, J=5.3 Hz, 1H), 7.83 (d, J=8.1 Hz, 2H), 7.56-7.39 (m, 6H), 7.10-7.00 (m, 2H), 6.77 (t, J=6.2 Hz, 1H), 6.17 (d, J=8.6 Hz, 2H), 5.32 (s, 1H), 4.66 (d, J=18.9 Hz, 1H), 4.38 (qd, J=13.8, 6.2 Hz, 2H), 3.87 (d, J=12.8 Hz, 1H), 3.75 (s, 5H), 3.43 (s, 4H), 2.38 (s, 3H), 1.42 (d, J=6.9 Hz, 3H).


Example 13
7-(4-bromo-3-(trifluoromethyl)benzoyl)-6-methyl-3-oxo-N-(2-(pyridazin-3-yl)benzyl)-2-(4-(3,3,3-trifluoro-2-hydroxy-2-methylpropoxy)phenyl)-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (85) and Separation into its 4 Diastereoisomers (85a), (85b), (85c) and (85d)



embedded image


tert-butyl (2-(pyridazin-3-yl)benzyl)carbamate



embedded image


A 250 mL round-bottom flask was charged with 2-{[(tert-butoxycarbonyl)amino]methyl}phenylboronic acid (2.00 g, 7.96 mmol, 1.00 eq.), 3-chloropyridazine (1.37 g, 11.9 mmol, 1.50 eq.), K2CO3 (3.30 g, 23.9 mmol, 3.00 eq.), Pd(PPh3)4 (0.460 g, 0.398 mmol, 0.05 eq.), H2O (2 mL) and 1,4-dioxane (20 mL). The mixture was stirred for 2 h at 100° C. under a nitrogen atmosphere. The reaction was quenched with water (100 mL). The mixture was extracted with dichloromethane (3×100 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl N-{[2-(pyridazin-3-yl)phenyl]methyl}carbamate (2.10 g, 92% yield) as an off-white solid. LCMS (ESI, m/z):286 [M+H]+.


(2-(pyridazin-3-yl)phenyl)methanamine hydrochloride



embedded image


A mixture of tert-butyl N-{[2-(pyridazin-3-yl)phenyl]methyl}carbamate (2.00 g, 7.02 mmol, 1.00 eq.) and HCl (gas) (50 mL, 4M in dioxane) was stirred for 2 h at rt and then concentrated under reduced pressure to afford (2-(pyridazin-3-yl)phenyl)methanamine hydrochloride (1.55, crude) as an off-white solid. LCMS (ESI, m/z): 186 [M+H—HCl]+.


tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyridazin-3-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 100 mL round-bottom flask was charged with 7-(tert-butoxycarbonyl)-2-(4-hydroxyphenyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (0.800 g, 2.05 mmol, 1.00 eq.), (2-(pyridazin-3-yl)phenyl)methanamine hydrochloride (0.455 g, 2.05 mmol, 1.00 eq.), EDCI (0.512 g, 2.67 mmol, 1.30 eq.), HOBT (0.361 g, 2.67 mmol, 1.30 eq.), DIEA (1.33 g, 10.3 mmol, 5.00 eq.) and DMF (20 mL). The mixture was stirred for overnight at rt under a nitrogen atmosphere and then diluted with ethyl acetate (200 mL). The mixture was washed with water (3×100 mL), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with MeOH:CH2Cl2 (1:10) to afford tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyridazin-3-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (400 mg, 35% yield) as a yellow solid. LCMS (ESI, m/z): 557 [M+H]+.


tert-butyl 6-methyl-3-oxo-1-({[2-(pyridazin-3-yl)phenyl]methyl}carbamoyl)-2-[4-(3,3,3-trifluoro-2-hydroxy-2-methylpropoxy)phenyl]-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 100 mL round-bottom flask was charged with tert-butyl 2-(4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyridazin-3-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (400 mg, 0.719 mmol, 1.00 eq.), 2-methyl-2-(trifluoromethyl)oxirane (109 mg, 0.863 mmol, 1.20 eq.), K2CO3 (199 mg, 1.44 mmol, 2.00 eq.) and CH3CN (10 mL). The mixture was stirred for overnight at 80° C. under a nitrogen atmosphere. The reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with brine (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with ethyl acetate to afford tert-butyl 6-methyl-3-oxo-1-({[2-(pyridazin-3-yl)phenyl]methyl}carbamoyl)-2-[4-(3,3,3-trifluoro-2-hydroxy-2-methylpropoxy)phenyl]-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (305 mg, 62% yield) as a brown solid. LCMS (ESI, m/z): 683 [M+H]+.


6-methyl-3-oxo-N-{[2-(pyridazin-3-yl)phenyl]methyl}-2-[4-(3,3,3-trifluoro-2-hydroxy-2-methylpropoxy)phenyl]-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt



embedded image


A 100 mL vial was charged with tert-butyl 6-methyl-3-oxo-1-({[2-(pyridazin-3-yl)phenyl]methyl}carbamoyl)-2-[4-(3,3,3-trifluoro-2-hydroxy-2-methylpropoxy)phenyl]-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (305 mg, 0.447 mmol, 1.00 eq.), TFA (1 mL) and DCM (5 mL). The mixture was stirred for 2 h at rt and then concentrated under reduced pressure to afford 6-methyl-3-oxo-N-{[2-(pyridazin-3-yl)phenyl]methyl}-2-[4-(3,3,3-trifluoro-2-hydroxy-2-methylpropoxy)phenyl]-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (315 mg, crude) as a brown oil. LCMS (ESI, m/z): 583 [M+H-TFA]+.


7-(4-bromo-3-(trifluoromethyl)benzoyl)-6-methyl-3-oxo-N-(2-(pyridazin-3-yl)benzyl)-2-(4-(3,3,3-trifluoro-2-hydroxy-2-methylpropoxy)phenyl)-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxamide (85) and Separation into its 4 Diastereoisomers (85a), (85b), (85c) and (85d)



embedded image


A 100 mL round-bottom flask was charged with 6-methyl-3-oxo-N-{[2-(pyridazin-3-yl)phenyl]methyl}-2-[4-(3,3,3-trifluoro-2-hydroxy-2-methylpropoxy)phenyl]-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (311 mg, 0.446 mmol, 1.00 eq.), 4-bromo-3-(trifluoromethyl)benzoic acid (156 mg, 0.580 mmol, 1.30 eq.), EDCI (1110 mg, 0.580 mmol, 1.30 eq.), HOBT (78.4 mg, 0.580 mmol, 1.30 eq.), DIEA (2880 mg, 2.23 mmol, 5.00 eq.) and DMF (8 mL). The mixture was stirred for overnight at rt. The reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (3×150 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with CH2Cl2:MeOH (10:1) to afford the crude product. The crude product was purified by prep-Chiral-HPLC with the following conditions: Column: CHIRALPAK IF, 2×25 cm, 5 μm; Mobile Phase A: MtBE(0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: EtOH-HPLC; Flow rate: 20 mL/min; Gradient: 20% B to 20% B in 16 min; Wave Length: 220/254 nm to afford the product (85-1) (the first elution) and (85-2) (the second elution). The product (85-1) was purified by Prep-Chiral-HPLC with the following conditions Column: CHIRALPAK IG, 2×25 cm, 5 μm; Mobile Phase A: Hex: DCM=3: 1(0.5% 2M NH3-MeOH), Mobile Phase B: EtOH; Flow rate: 20 mL/min; Gradient: 15% B to 15% B in 21 min; Wave Length: 220/254 nm to afford the final products


(85a) (the first elution, 13.0 mg, 3.5% yield) as a white solid. LCMS (ESI, m/z): 833 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 9.09 (d, J=4.8 Hz, 1H), 7.90-7.70 (m, 2H), 7.65-7.30 (m, 7H), 7.20-7.05 (m, 2H), 6.85 (d, J=5.1 Hz 1H), 6.53 (d, J=8.7 Hz 2H), 5.11 (s, 1H), 4.66 (d, J=18.6 Hz, 1H), 4.45-4.20 (m, 2H), 4.00-3.80 (m, 2H), 3.75-3.60 (m, 2H), 3.60-3.30 (m, 1H), 1.41 (d, J=4.5 Hz, 6H).


(85b) (the second elution, 13.0 mg, 3.5% yield) as a white solid. LCMS (ESI, m/z): 833 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 9.15-8.90 (m, 1H), 7.90-7.70 (m, 2H), 7.65-7.30 (m, 7H), 7.20-7.05 (m, 2H), 6.85 (d, J=5.1 Hz 1H), 6.53 (d, J=8.7 Hz, 2H), 5.11 (s, 2H), 4.66 (d, J=18.6 Hz 1H), 4.45-4.20 (m, 2H), 4.00-3.80 (m, 2H), 3.75-3.60 (m, 2H), 3.50-3.35 (m, 1H), 1.41 (d, J=5.4 Hz, 6H).


The product (85-2) was purified by prep-Chiral-HPLC with the following conditions Column: Lux Sum Cellulose-2, 2.12*25 cm, 5 μm; Mobile Phase A: Hex (0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: MeOH: EtOH=1: 1-HPLC; Flow rate: 20 mL/min; Gradient: 40% B to 40% B in 54 min; Wave Length: 220/254 nm to afford the final products.


(85c) (the first elution, 9 mg) as a white solid. LCMS (ESI, m/z): 833 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 9.15-8.90 (m, 1H), 7.90-7.70 (m, 2H), 7.65-7.30 (m, 7H), 7.20-7.05 (m, 2H), 6.85 (d, J=5.1 Hz 1H), 6.53 (d, J=8.7 Hz 2H), 5.11 (s, 2H), 4.66 (d, J=18.6 Hz 1H), 4.45-4.20 (m, 2H), 4.00-3.80 (m, 2H), 3.75-3.60 (m, 2H), 3.50-3.20 (m, 1H), 1.41 (d, J=4.5 Hz, 6H).


(85d) (the second elution, 10.5) as a white solid. LCMS (ESI, m/z): 833 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 9.15-8.90 (m, 1H), 7.90-7.70 (m, 2H), 7.65-7.30 (m, 7H), 7.20-7.05 (m, 2H), 6.85 (d, J=5.1 Hz 1H), 6.53 (d, J=8.7 Hz 2H), 5.11 (s, 2H), 4.66 (d, J=18.6 Hz 1H), 4.45-4.20 (m, 2H), 4.00-3.80 (m, 2H), 3.75-3.15 (m, 3H), 1.41 (d, J=3.6 Hz, 6H).


Example 14
(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (91a) and (6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (91b)



embedded image


(R)-1-(5-bromo-1H-indazol-1-yl)propan-2-ol



embedded image


A 100 mL round-bottom flask was charged with the 5-bromo-1H-indazole (500 mg, 2.54 mmol, 1.00 eq.), (R)-2-methyloxirane (177 mg, 3.05 mmol, 1.20 eq.), Cs2CO3 (2.48 g, 7.61 mmol, 3.00 eq.) and DMF (10 mL). The mixture was stirred for overnight at 90° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford (R)-1-(5-bromo-1H-indazol-1-yl)propan-2-ol (450 mg, 69% yield) as a light yellow solid. LCMS (ESI, m/z): 255 [M+H]+.


(R)-1-(5-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-1H-indazol-1-yl)propan-2-ol



embedded image


A 250 mL round-bottom flask was charged with (R)-1-(5-bromo-1H-indazol-1-yl)propan-2-ol (500 mg, 1.960 mmol, 1.00 eq.), 2-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-5,5-dimethyl-1,3,2-dioxaborinane (885 mg, 3.92 mmol, 2.00 eq.), KOAc (577 mg, 5.88 mmol, 3.00 eq.), Pd(PPh3)2Cl2 (137 mg, 0.196 mmol, 0.10 eq.) and DMSO (10 mL). The mixture was stirred for overnight at 60° C. under a nitrogen atmosphere. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford (R)-1-(5-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-1H-indazol-1-yl)propan-2-ol (570 mg, crude) as a yellow oil. LCMS (ESI, m/z): 289 [M+H]+.


7-(tert-butyl) 1-ethyl 2-(1-((R)-2-hydroxypropyl)-1H-indazol-5-yl)-6-methyl-3-oxo-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-1,7(3H)-dicarboxylate



embedded image


A 100 mL round-bottom flask was charged with (R)-1-(5-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-1H-indazol-1-yl)propan-2-ol (0.570 g, 2.59 mmol, 1.00 eq.), 7-tert-butyl 1-ethyl 6-methyl-3-oxo-2H,5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (1.01 g, 3.11 mmol, 1.20 eq.), Cu(OTf)2 (0.940 g, 2.59 mmol, 1.00 eq.), pyridine (0.610 g, 7.77 mmol, 3.00 eq.) and DMF (10 mL). The mixture was stirred for overnight at 60° C. under an oxygen atmosphere. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (10:1) to afford 7-(tert-butyl) 1-ethyl 2-(1-((R)-2-hydroxypropyl)-1H-indazol-5-yl)-6-methyl-3-oxo-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-1,7(3H)-dicarboxylate (400 mg, 31% yield) as a light yellow solid. LCMS (ESI, m/z):500 [M+H]+.


7-(tert-butoxycarbonyl)-2-{1-[(2S)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-5H, 6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid



embedded image


A 100 mL vial was charged with 7-(tert-butyl) 1-ethyl 2-(1-((R)-2-hydroxypropyl)-1H-indazol-5-yl)-6-methyl-3-oxo-2,5,6,8-tetrahydroimidazo[1,5-a]pyrazine-1,7(3H)-dicarboxylate (400 mg, 0.800 mmol, 1.00 eq.), NaOH (80 mg, 2.00 mmol, 2.50 eq.), H2O (5 mL) and EtOH (20 mL). The mixture was stirred for overnight at 60° C. and then concentrated under reduced pressure. The mixture was diluted with water (50 mL) and neutralized to pH 7 with hydrochloric acid (1.0 mol/L). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to afford 7-(tert-butoxycarbonyl)-2-(1-((R)-2-hydroxypropyl)-1H-indazol-5-yl)-6-methyl-3-oxo-2,3,5,6,7,8-hexahydroimidazo[1,5-a]pyrazine-1-carboxylic acid (350 mg, crude) as a yellow oil. LCMS (ESI, m/z): 472 [M+H]+.


tert-butyl 2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 100 mL vial were added 7-(tert-butoxycarbonyl)-2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (350 mg, 0.742 mmol, 1.00 eq.), 1-[2-(pyrimidin-2-yl)phenyl]methanamine hydrochloride (198 mg, 0.890 mmol, 1.20 eq.), EDCI (171 mg, 0.890 mmol, 1.20 eq.), HOBT (120 mg, 0.890 mmol, 1.20 eq.), DIEA (480 mg, 3.71 mmol, 5.00 eq.) and DMF (20 mL). The mixture was stirred for overnight at rt. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with CH2Cl2:MeOH (10:1) to afford tert-butyl 2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (200 mg, 42% yield) as a yellow solid. LCMS (ESI, m/z):639 [M+H]+.


2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt



embedded image


A 100 mL round bottom flask was charged with tert-butyl 2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (200 mg, 0.313 mmol, 1.00 eq.), TFA (1 mL) and DCM (5 mL). The mixture was stirred for 2 h at rt under an air atmosphere and then concentrated under reduced pressure to afford 2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (205 mg, crude) as a yellow oil. LCMS (ESI, m/z): 539 [M-TFA+H]+.


(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (91a) and (6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (91b)



embedded image


A 40 mL vial were added 2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (182 mg, 0.278 mmol, 1.00 eq.), 4-bromo-3-(trifluoromethyl)benzoic acid (89.9 mg, 0.334 mmol, 1.20 eq.), EDCI (64.1 mg, 0.334 mmol, 1.20 eq.), HOBT (45.2 mg, 0.334 mmol, 1.20 eq.), DIEA (180 mg, 1.39 mmol, 5.00 eq.) and DMF (10 mL) at rt. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with CH2Cl2:MeOH (10:1) to afford the crude product. The crude product was purified by prep-CHIRAL-HPLC with the following conditions: Column: CHIRALPAK IF, 2×25 cm, 5 μm; Mobile Phase A: MtBE(0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: IPA-HPLC; Flow rate: 11.5 mL/min; Gradient: 50% B to 50% B in 26 min; Wave Length: 220/254 nm to afford the final products.


(6R*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (91a) (the first elution, 16.0 mg, 7.3% yield) as a white solid. LCMS (ESI, m/z): 789 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 8.29 (d, J=8.0 Hz, 2H), 8.03-8.01 (m, 1H), 7.90-7.83 (m, 2H), 7.75 (s, 1H), 7.65 (d, J=8.0 Hz, 1H), 7.50-7.43 (m, 4H), 6.99-6.92 (m, 4H), 5.22 (s, 1H), 4.70 (d, J=8.0 Hz, 1H), 4.53 (s, 1H), 4.36 (d, J=6.0 Hz, 1H), 4.22-4.12 (m, 2H), 4.03-3.97 (m, 1H), 3.87 (d, J=6.0 Hz, 1H), 3.74 (d, J=4.0 Hz, 1H), 2.33 (s, 1H), 1.43 (d, J=4.0 Hz, 3H), 1.28-1.24 (m, 3H).


(6S*)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-{1-[(2R)-2-hydroxypropyl]indazol-5-yl}-6-methyl-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (91b) (the second elution, 19.7 mg, 9.0% yield) as a white solid. LCMS (ESI, m/z):789 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 8.29 (d, J=8.0 Hz, 2H), 8.03-8.01 (m, 1H), 7.90-7.83 (m, 2H), 7.75 (s, 1H), 7.65 (d, J=8.0 Hz, 1H), 7.50-7.43 (m, 4H), 6.99-6.92 (m, 4H), 5.22 (s, 1H), 4.70 (d, J=8.0 Hz, 1H), 4.53 (s, 1H), 4.36 (d, J=6.0 Hz, 1H), 4.22-4.12 (m, 2H), 4.03-3.97 (m, 1H), 3.87 (d, J=6.0 Hz, 1H), 3.74 (d, J=4.0 Hz, 1H), 2.33 (s, 1H), 1.43 (d, J=4.0 Hz, 3H), 1.28-1.24 (m, 3H).


Example 15
(6R*)-2-(2-amino-1,3-benzoxazol-5-yl)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (93a) and (6S*)-2-(2-amino-1,3-benzoxazol-5-yl)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (93b)



embedded image


benzyl N-(5-bromo-2-hydroxyphenyl)carbamate



embedded image


A 250 mL round-bottom flask was charged with 2-amino-4-bromophenol (5.00 g, 26.6 mmol, 1.00 eq.), benzyl chloroformate (5.44 g, 31.9 mmol, 1.20 eq.), sodium bicarbonate (6.70 g, 79.8 mmol, 3.00 eq.), water (50 mL) and tetrahydrofuran (100 mL) at 0° C. The mixture was stirred for overnight at rt. The reaction was quenched with water (150 mL). The mixture was extracted with ethyl acetate (3×250 mL). The organic layers were combined, washed with saturated sodium chloride solution (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:5) to afford benzyl N-(5-bromo-2-hydroxyphenyl)carbamate (5.11 g, 60% yield) as a pink solid. LCMS (ESI, m/z): 322 [M+H]+.


benzyl N-[2-(benzyloxy)-5-bromophenyl]carbamate



embedded image


A 250 mL round-bottom flask was charged with benzyl N-(5-bromo-2-hydroxyphenyl)carbamate (5.00 g, 15.5 mmol, 1.00 eq.), BnBr (3.19 g, 18.6 mmol, 1.20 eq.), potassium carbonate (6.43 g, 46.6 mmol, 3.00 eq.) and acetonitrile (130 mL) at 0° C. The mixture was stirred for 18 h at rt and then concentrated under reduced pressure. The reaction was quenched with water (150 mL). The mixture was extracted with ethyl acetate (3×250 mL). The organic layers were combined, washed with saturated sodium chloride solution (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:6) to afford benzyl N-[2-(benzyloxy)-5-bromophenyl]carbamate (4.79 g, 75% yield) as a pink solid. LCMS (ESI, m/z): 412 [M+H]+.


4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenylboronic acid



embedded image


A 250 mL round bottom flask was charged with benzyl N-[2-(benzyloxy)-5-bromophenyl]carbamate (5.00 g, 12.1 mmol, 1.00 eq.), 2-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-5,5-dimethyl-1,3,2-dioxaborinane (5.48 g, 24.3 mmol, 2.00 eq.), Pd(dppf)Cl2 (0.890 g, 1.21 mmol, 0.10 eq.), potassium acetate (3.57 g, 36.4 mmol, 3.00 eq.) and 1,4-dioxane (150 mL). The mixture was stirred for overnight at 80° C., concentrated under reduced pressure and diluted with water (150 mL). The mixture was extracted with ethyl acetate (3×250 mL). The organic layers were combined, washed with saturated sodium chloride solution (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by reverse phase chromatography with following condition: Column: Agela C18 Column, 120 g; Mobile Phase A: Water (0.05% TFA), Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 0% B to 100% B in 40 min; Wave Length: 220 nm to afford 4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenylboronic acid (2.11 g, 46% yield) as a white solid. LCMS (ESI, m/z): 378 [M+H]+.


7-tert-butyl 1-ethyl 2-[4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenyl]-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate



embedded image


A 100 mL round bottom flask was charged with 7-tert-butyl 1-ethyl 6-methyl-3-oxo-2H,5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (1.00 g, 3.07 mmol, 1.00 eq.), 4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenylboronic acid (1.39 g, 3.69 mmol, 1.20 eq.), Cu(OTf)2 (1.11 g, 3.07 mmol, 1.00 eq.), pyridine (0.729 g, 9.22 mmol, 3.00 eq.) and DMF (50 mL). The mixture was stirred for 3 h at 70° C. under an oxygen atmosphere. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×150 mL). The organic layers were combined, washed with saturated sodium chloride solution (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford 7-tert-butyl 1-ethyl 2-[4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenyl]-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (1.34 g, 66% yield) as a pink solid. LCMS (ESI, m/z): 657 [M+H]+.


2-[4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenyl]-7-(tert-butoxycarbonyl)-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid



embedded image


A 100 mL round bottom flask was charged with 7-tert-butyl 1-ethyl 2-[4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenyl]-6-methyl-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (1.00 g, 1.52 mmol, 1.00 eq.), sodium hydroxide (0.120 g, 3.05 mmol, 2.00 eq.), water (20 mL) and MeOH (40 mL) at rt. The mixture was stirred for 2 h at 60° C. and acidified to pH 6 with a hydrochloric acid aqueous solution (1 mol/L). The precipitated solids were collected by filtration and washed with water (3×50 mL). The resulting solid was dried to afford 2-[4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenyl]-7-(tert-butoxycarbonyl)-6-methyl-3-oxo-5H,6H, 8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (312 mg, 33% yield) as an orange solid. LCMS (ESI, m/z): 629 [M+H]+.


tert-butyl 2-[4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenyl]-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 100 mL round bottom flask was charged with 2-[4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenyl]-7-(tert-butoxycarbonyl)-6-methyl-3-oxo-5H,6H, 8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (1.00 g, 1.59 mmol, 1.00 eq.), 1-[2-(pyrimidin-4-yl)phenyl]methanamine hydrochloride (424 mg, 1.91 mmol, 1.20 eq.), EDCI (457 mg, 2.39 mmol, 1.50 eq.), HOBT (322 mg, 2.39 mmol, 1.50 eq.), DIEA (1.03 g, 7.96 mmol, 5.00 eq.) and DMF (40 mL). The mixture was stirred for overnight at rt. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×150 mL). The organic layers were combined, washed with saturated sodium chloride solution (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (3:2) to afford tert-butyl 2-[4-(benzyloxy)-3-{[(benzyloxy)carbonyl]amino}phenyl]-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (605 mg, 48% yield) as a brown solid. LCMS (ESI, m/z): 796 [M+H]+.


tert-butyl 2-(3-amino-4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 100 mL round bottom flask was charged with tert-butyl 2-(3-{benzyl[(benzyloxy)carbonyl]amino}-4-(benzyloxy)phenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H, 8H-imidazo[1,5-a]pyrazine-7-carboxylate (500 mg, 0.564 mmol, 1.00 eq.), 10% Pd/C (60 mg) and ethyl acetate (50 mL). The mixture was stirred for 2 days at 60° C. under a hydrogen atmosphere (2-3 atm). The solids were filtered off, and the filter cake was washed with ethyl acetate (3×50 mL). The filtrate was concentrated under reduced pressure to afford tert-butyl 2-(3-amino-4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (173 mg, 54% yield) as a yellow solid. LCMS (ESI, m/z): 572 [M+H]+.


tert-butyl 2-(2-amino-1,3-benzoxazol-5-yl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate



embedded image


A 100 mL round bottom flask was charged with tert-butyl 2-(3-amino-4-hydroxyphenyl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (110 mg, 0.192 mmol, 1.00 eq.), 1-(imidazole-1-carboximidoyl)imidazole (62.0 mg, 0.384 mmol, 2.00 eq.), ZnCl2 (13.1 mg, 0.10 mmol, 0.50 eq.) and tetrahydrofuran (50 mL). The solution was refluxed overnight under a nitrogen atmosphere. The reaction was quenched with water (10 mL). The mixture was concentrated under reduced pressure and then diluted with water (100 mL). The mixture was extracted with ethyl acetate (3×150 mL). The organic layers were combined, washed with saturated sodium chloride solution (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC with dichloromethane:methyl alcohol (10:1) to afford tert-butyl 2-(2-amino-1,3-benzoxazol-5-yl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (83.0 mg, 72% yield) as a yellow solid. LCMS (ESI, m/z): 597 [M+H]+.


2-(2-amino-1,3-benzoxazo1-5-yl)-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt



embedded image


A 100 mL round bottom flask was charged with tert-butyl 2-(2-amino-1,3-benzoxazol-5-yl)-6-methyl-3-oxo-1-({[2-(pyrimidin-4-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (83.0 mg, 0.139 mmol, 1.00 eq.), dichloromethane (30 mL) and trifluoroacetic acid (6 mL). The solution was stirred for 2 h at rt and then concentrated under reduced pressure to afford 2-(2-amino-1,3-benzoxazol-5-yl)-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (88.6 mg, crude) as a yellow oil. LCMS (ESI, m/z): 497 [M+H-TFA]+.


(6R*)-2-(2-amino-1,3-benzoxazol-5-yl)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (93a) and (6S*)-2-(2-amino-1,3-benzoxazol-5-yl)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (93b)



embedded image


A 100 mL round bottom flask was charged with 2-(2-amino-1,3-benzoxazol-5-yl)-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (88.6 mg, 0.145 mmol, 1.00 eq.), 4-bromo-3-(trifluoromethyl)benzoic acid (46.8 mg, 0.174 mmol, 1.20 eq.), EDCI (41.7 mg, 0.217 mmol, 1.50 eq.), HOBT (29.4 mg, 0.217 mmol, 1.50 eq.), DIEA (93.7 mg, 0.725 mmol, 5.00 eq.) and DMF (20 mL). The mixture was stirred for overnight at 60° C. The reaction was quenched with water (60 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with saturated sodium chloride solution (3×30 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (9:1) to afford the crude product. The product was separated by prep-CHIRAL HPLC: Column: Column: CHIRALPAK IF, 2×25 cm, 5 μm; Mobile Phase A: MtBE (0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: EtOH-HPLC; Flow rate: 11 mL/min; Gradient: 50% B to 50% B in 32 min; Wave Length: 220/254 nm to afford the final products.


(6R*)-2-(2-amino-1,3-benzoxazol-5-yl)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (93a) (the first elution, 5.9 mg, 5.5% yield) as a brown solid. LCMS (ESI, m/z): 747 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 8.77-8.62 (m, 2H), 7.82 (d, J=8.0 Hz, 2H), 7.55-7.34 (m, 6H), 7.22 (d, J=1.7 Hz, 1H), 6.88 (q, J=8.5 Hz, 2H), 6.71 (s, 1H), 5.71 (s, 2H), 5.34 (s, 1H), 4.66 (d, J=19.1 Hz, 1H), 4.14-4.22 (m, 2H), 3.87 (d, J=12.8 Hz, 1H), 3.73 (d, J=12.9 Hz, 1H), 1.43 (d, J=6.9 Hz, 3H).


(6S*)-2-(2-amino-1,3-benzoxazol-5-yl)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-6-methyl-3-oxo-N-{[2-(pyrimidin-4-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (93b) (the second elution, 4.7 mg, 4.3% yield) as a brown solid. LCMS (ESI, m/z): 747 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 8.78-8.63 (m, 2H), 7.82 (d, J=8.0 Hz, 2H), 7.56-7.33 (m, 6H), 7.22 (s, 1H), 7.01-6.81 (m, 2H), 6.71 (s, 1H), 5.74 (s, 2H), 5.76 (s, 1H), 4.66 (d, J=18.8 Hz, 1H), 4.29 (td, J=14.0, 6.1 Hz, 2H), 3.87 (d, J=12.9 Hz, 1H), 3.73 (d, J=12.3 Hz, 1H), 1.43 (d, J=6.9 Hz, 3H).


Example 16
6-(benzyloxymethyl)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-[4-(cyclopropoxy)phenyl]-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide (130)



embedded image


embedded image


Ethyl 6-chloro-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate

A mixture of ethyl 6-chloro-3-oxo-2H-imidazo[1,5-a]pyrazine-1-carboxylate (5.00 g, 20.7 mmol, 1.00 eq.), 4-cyclopropoxyphenylboronic acid (3.68 g, 20.7 mmol, 1.00 eq.), pyridine (8.18 g, 103 mmol, 5.00 eq.) and Cu(OAc)2 (3.76 g, 20.7 mmol, 1.00 eq.) in DMF (50 mL) was stirred for 2 h at 60° C. under an O2 atmosphere. The reaction was quenched with water (500 mL). The mixture was extracted with ethyl acetate (3×200 mL). The organic layers were combined, washed with water (3×200 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford ethyl 6-chloro-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (2.1 g, 27% yield) as a yellow solid. LCMS (ESI, m/z): 374 [M+H]+.


Ethyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate

A mixture of ethyl 6-chloro-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (1.60 g, 4.28 mmol, 1.00 eq.), [(benzyloxy)methyl]trifluoro-λ4-borane potassium (1.27 g, 5.56 mmol, 1.30 eq.), bis(adamantan-1-yl)(butyl)phosphane (0.310 g, 0.856 mmol, 0.20 eq.), Pd(OAc)2 (0.190 g, 0.856 mmol, 0.20 eq.), Cs2CO3 (4.18 g, 12.8 mmol, 3.00 eq.), H2O (3 mL) and 1,4-dioxane (15 mL) was irradiated with microwave radiation for 3 h at 130° C. under a nitrogen atmosphere and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (10:1) to afford ethyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (330 mg, 17% yield) as a yellow solid. LCMS (ESI, m/z): 460 [M+H]+.


7-tert-butyl 1-ethyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate

To a stirred mixture of ethyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (330 mg, 0.718 mmol, 1.00 eq.) in MeOH (10 mL) was added NaBH4 (272 mg, 7.18 mmol, 10.0 eq.) in portions at 0° C. under a nitrogen atmosphere. The mixture was stirred for overnight at rt. To the mixture was added NaHCO3 (302 mg, 3.59 mmol, 5.00 eq.) and (Boc)2O (784 mg, 3.59 mmol, 5.00 eq.). The mixture was stirred overnight at rt and then concentrated under reduced pressure. The residue was quenched with water (50 mL). The mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with water (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (ethyl acetate:petroleum ether=2:3) to afford 7-tert-butyl 1-ethyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (200 mg, 49% yield) as a yellow solid. LCMS (ESI, m/z): 564 [M+H]+.


6-[(benzyloxy)methyl]-7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid

A 100 mL round-bottom flask was charged with 7-tert-butyl 1-ethyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (200 mg, 0.355 mmol, 1.00 eq.), H2O (10 mL) and NaOH (28.4 mg, 0.710 mmol, 2.00 eq.) at rt. The mixture was stirred for overnight at 60° C. The mixture was acidified to pH 4 with acetic acid. The mixture was extracted with ethyl acetate (3×20 mL). The organic layers were combined, washed with water (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (ethyl acetate:petroleum ether=1:1) to afford 6-[(benzyloxy)methyl]-7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (150 mg, 79% yield) as a yellow solid. LCMS (ESI, m/z): 536 [M+H]+.


tert-butyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate

A 50 mL round-bottom flask was charged with 6-[(benzyloxy)methyl]-7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (150 mg, 0.280 mmol, 1.00 eq.), 1-[2-(pyrimidin-2-yl)phenyl]methanamine hydrochloride (62.1 mg, 0.280 mmol, 1.00 eq.), EDCI (69.9 mg, 0.364 mmol, 1.30 eq.), HOBT (49.2 mg, 0.364 mmol, 1.30 eq.), DIEA (109 mg, 0.841 mmol, 3.00 eq.) and DMF (5 mL). The mixture was stirred for overnight at rt. The reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with water (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (CH2Cl2:MeOH=10:1) to afford tert-butyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H, 8H-imidazo[1,5-a]pyrazine-7-carboxylate (122 mg, 62% yield) as a white solid. LCMS (ESI, m/z): 703 [M+H]+.


6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide

A 40 mL vial was charged with tert-butyl 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (122 mg, 0.174 mmol, 1.00 eq.), TBSOTf (459 mg, 1.74 mmol, 10.0 eq.), 2,6-lutidine (186 mg, 1.74 mmol, 10.0 eq.) and DCM (5 mL) at rt. The mixture was stirred for 30 min at rt and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (10:1) to afford 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (90 mg, 86% yield) as a yellow solid. LCMS (ESI, m/z): 603 [M+H]+.


6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide

A mixture of 6-[(benzyloxy)methyl]-2-(4-cyclopropoxyphenyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (90.0 mg, 0.149 mmol, 1.00 eq.), 4-bromo-3-(trifluoromethyl)benzoic acid (48.2 mg, 0.179 mmol, 1.20 eq.), HATU (68.1 mg, 0.179 mmol, 1.20 eq.) and DIEA (57.9 mg, 0.447 mmol, 3.00 eq.) in DMF (5 mL) was stirred for overnight at rt. The reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (3×50 mL). The organic layers were combined, washed with water (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The crude product was purified by prep-HPLC with the following conditions: Column: XBridge Prep Phenyl OBD Column, 19×150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3+0.1% NH3.H2O), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 55% B to 68% B in 7 min; Wave Length: 220 nm to afford 6-[(benzyloxy)methyl]-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-(4-cyclopropoxyphenyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (42.0 mg, 33% yield) as a white solid. LCMS (ESI, m/z): 853 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 8.59 (s, 2H), 8.10 (d, J=4.2 Hz, 1H), 7.84-7.70 (m, 2H), 7.43 (d, J=8.3 Hz, 4H), 7.31 (t, J=8.4 Hz, 4H), 7.18 (d, J=5.0 Hz, 1H), 7.05 (d, J=8.4 Hz, 3H), 6.72 (d, J=8.4 Hz, 2H), 4.64-4.36 (m, 6H), 3.98-3.43 (m, 6H), 0.71 (d, J=6.0 Hz, 2H), 0.58 (s, 2H).


Example 17
7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-[4-(cyclopropoxy)phenyl]-6-(hydroxymethyl)-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide (131)



embedded image


A mixture of 6-[(benzyloxy)methyl]-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-(4-cyclopropoxyphenyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (130) (13.0 mg, 0.0150 mmol, 1.00 eq.) and CF3COOH (1 mL) was stirred for overnight at 60° C. and then concentrated under reduced pressure. The crude product was purified by prep-HPLC with the following conditions: Column: XSelect CSH Prep C18 OBD Column, 19×250 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 55% B to 68% B in 10 min; Wave Length: 254 nm to afford 7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-(4-cyclopropoxyphenyl)-6-(hydroxymethyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (131) (4.40 mg, 37% yield) as a white solid. LCMS (ESI, m/z): 763 [M+H]+. 1H NMR (300 MHz, CDCl3) δ 8.64-8.51 (m, 2H), 8.09 (s, 1H), 7.89-7.73 (m, 2H), 7.85-7.79 (m, 4H), 7.16 (t, J=4.8 Hz, 2H), 7.06 (d, J=8.6 Hz, 4H), 6.70 (d, J=8.5 Hz, 2H), 4.51-4.39 (m, 4H), 3.98-3.43 (m, 9H), 1.25 (s,5H), 0.88 (s,1H), 0.71-0.69 (m, 2H), 0.57 (s, 2H).


Example 18
7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-[4-(cyclopropoxy)phenyl]-6-(morpholinomethyl)-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide (132) and Separation into its Enantiomers rac-(6S)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-[4-(cyclopropoxy)phenyl]-6-(morpholinomethyl)-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide (132a) and rac-(6R)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-[4-(cyclopropoxy)phenyl]-6-(morpholinomethyl)-3-oxo-N-[(2-pyrimidin-2-ylphenyl)methyl]-6,8-dihydro-5H-imidazo[1,5-a]pyrazine-1-carboxamide (132b)



embedded image




embedded image


embedded image


7-tert-butyl 1-ethyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate

A 100 mL microwave tube was charged with ethyl 6-chloro-2-(4-cyclopropoxyphenyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (600 mg, 1.60 mmol, 1.00 eq.), 4-[(trifluoro-λ4-boranyl)methyl] morpholine potassium (664 mg, 3.21 mmol, 2.00 eq.), 1,4-dioxane (30 mL), Cs2CO3 (1046 mg, 3.21 mmol, 2.00 eq.), Pd(OAc)2 (18.0 mg, 0.0800 mmol, 0.05 eq.), water (10 mL) and bis(adamantan-1-yl)(butyl)phosphane (57.6 mg, 0.161 mmol, 0.10 eq.) under nitrogen. The mixture was irradiated with microwave radiation for 3 h at 130° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford ethyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (300 mg, 42% yield) as a yellow solid. LCMS (ESI, m/z): 439 [M+H]+.


7-tert-butyl 1-ethyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate

A 100 mL round bottom flask was charged with ethyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxoimidazo[1,5-a]pyrazine-1-carboxylate (300 mg, 0.684 mmol, 1.00 eq.), Boc2O (298 mg, 1.37 mmol, 2.00 eq.) and methanol (50 mL). NaBH4 (77.7 mg, 2.05 mmol, 3.00 eq.) was added in portions at 0° C. The solution was stirred for 2 h at rt. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford 7-tert-butyl 1-ethyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-5H,6H, 8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (200 mg, 53% yield) as a white solid. LCMS (ESI, m/z): 543 [M+H]+.


7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid

A 40 mL vial was charged with 7-tert-butyl 1-ethyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-5H,6H, 8H-imidazo[1,5-a]pyrazine-1,7-dicarboxylate (200 mg, 0.369 mmol, 1.00 eq.), NaOH (29.5 mg, 0.738 mmol, 2.00 eq.), water (10 mL) and methanol (10 mL). The solution was stirred for 2 h at 60° C. and then diluted with water (50 mL). The pH value of the mixture was adjusted to 4 with HCl (aq. 1 mol/L). The aqueous phase was extracted with ethyl acetate (3×50 mL). The organic layers were combined, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to afford 7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (150 mg, crude) as a white solid. LCMS (ESI, m/z): 515 [M+H]+.


tert-butyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate

A 40 mL vial was charged with 7-(tert-butoxycarbonyl)-2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxylic acid (150 mg, 0.292 mmol, 1.00 eq.), 1-[2-(pyrimidin-2-yl)phenyl]methanamine hydrochloride (71.1 mg, 0.321 mmol, 1.10 eq.), HOBT (59.1 mg, 0.438 mmol, 1.50 eq.), EDCI (83.8 mg, 0.438 mmol, 1.50 eq.), DIEA (151 mg, 1.17 mmol, 4.00 eq.) and DMF (10 mL). The solution was stirred for overnight at rt. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with water (3×100mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford tert-butyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (100 mg, 50% yield) as a white solid. LCMS (ESI, m/z): 682 [M+H]+.


2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt

A 100 mL round bottom flask was charged with tert-butyl 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-1-({[2-(pyrimidin-2-yl)phenyl]methyl}carbamoyl)-5H,6H,8H-imidazo[1,5-a]pyrazine-7-carboxylate (100 mg, 0.147 mmol, 1.00 eq.), dichloromethane (20 mL) and trifluoroacetic acid (5 mL). The solution was stirred for 3 h at rt and then concentrated under reduced pressure to afford 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (100 mg, crude) as a light yellow solid. LCMS (ESI, m/z): 582 [M+H-TFA]+.


rac-(6R)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide and rac-(6S)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide

A 40 mL vial was charged with 2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,7H,8H-imidazo[1,5-a]pyrazine-1-carboxamide trifluoroacetic acid salt (100 mg, 0.144 mmol, 1.00 eq.), 4-bromo-3-(trifluoromethyl)benzoic acid (47.5 mg, 0.176 mmol, 1.22 eq.), HOBT (23.9 mg, 0.176 mmol, 1.22 eq.), EDCI (33.8 mg, 0.176 mmol, 1.22 eq.), DIEA (76.0 mg, 0.588 mmol, 4.08 eq.) and DMF (10 mL). The solution was stirred for overnight at rt. The reaction was quenched with water (100 mL). The mixture was extracted with EA (3×100 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (ethyl acetate:petroleum ether=3:1) to afford the crude product. The crude product was purified by prep-HPLC with the following conditions: Column: CHIRAL ART Amylose-SA, 2×25 cm, 5 μm; Mobile Phase A: MtBE (0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: EtOH-HPLC; Flow rate: 20 mL/min; Gradient: 25% B to 25% B in 16 min; Wave Length: 220/254 nm to afford


rac-(6R)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (132a) (the first elution, 22.5 mg, 18% yield) as a light yellow solid. LCMS (ESI, m/z): 832 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 8.59 (d, J=4.8 Hz, 2H), 8.18-8.06 (m, 1H), 7.98-7.80 (m, 2H), 7.45 (d, J=4.2 Hz, 4H), 7.17 (t, J=4.9 Hz, 1H), 7.13-6.93 (m, 3H), 6.70 (d, J=8.3 Hz, 2H), 5.50 (s, 1H), 5.13 (s, 1H), 4.47 (m 3H), 3.98 (d, J=13.1 Hz, 1H), 3.71 (s, 5H), 3.43 (s, 1H), 2.70-2.50 (m, 5H), 0.71 (d, J=6.3 Hz, 2H), 0.57 (s, 2H).


rac-(6S)-7-[4-bromo-3-(trifluoromethyl)benzoyl]-2-(4-cyclopropoxyphenyl)-6-(morpholin-4-ylmethyl)-3-oxo-N-{[2-(pyrimidin-2-yl)phenyl]methyl}-5H,6H,8H-imidazo[1,5-a]pyrazine-1-carboxamide (132b) (the second elution, 23.8 mg, 19% yield) as a white solid. LCMS (ESI, m/z): 832 [M+H]+. 1H NMR (400 MHz, CDCl3) δ 8.59 (d, J=4.8 Hz, 2H), 8.18-8.05 (m, 1H), 7.96-7.78 (m, 2H), 7.45 (d, J=3.8 Hz, 4H), 7.17 (t, J=4.9 Hz, 1H), 7.13-6.90 (m, 3H), 6.70 (d, J=8.4 Hz, 2H), 5.53 (s, 1H), 5.12 (s, 1H), 4.87-4.32 (m, 3H), 3.98 (d, J=13.0 Hz, 1H), 3.75 (s, 5H), 3.43 (s, 1H), 3.02-2.33 (m, 5H), 0.71 (d, J=6.4 Hz, 2H), 0.58 (s, 2H).


Example 19
Intermediates I-1 to I-8
Synthesis of Intermediate I-1



embedded image


A 40 mL vial was charged with 5-bromo-1H-indazole (500 mg, 2.54 mmol, 1.00 eq.), 2,2,2-trifluoroethyl trifluoromethanesulfonate (706 mg, 3.05 mmol, 1.20 eq.), K2CO3 (701 mg, 5.08 mmol, 2.00 eq.) and DMF (20 mL). The mixture was stirred for overnight at 60° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:9) to afford 5-bromo-1-(2,2,2-trifluoroethyl)indazole (520 mg, 73% yield) as a white solid. LCMS (ESI, m/z): 279 [M+H]+.


A 40 mL vial was charged with 5-bromo-1-(2,2,2-trifluoroethyl)indazole (400 mg, 1.43 mmol, 1.00 eq.), 2-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-5,5-dimethyl-1,3,2-dioxaborinane (971 mg, 4.30 mmol, 3.00 eq.), Pd(dppf)Cl2 (105 mg, 0.143 mmol, 0.100 eq.), DMSO (20 mL) and AcOK (422 mg, 4.30 mmol, 3.00 eq.). The mixture was stirred for overnight at 60° C. under a nitrogen atmosphere. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:8) to afford 5-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-1-(2,2,2-trifluoroethyl)indazole (280 mg, 63% yield) as a white solid. LCMS (ESI, m/z): 313 [M+H]+.


Synthesis of Intermediate I-2



embedded image


A 250 mL round-bottom flask was charged with 2-{[(tert-butoxycarbonyl)amino]methyl}phenylboronic acid (3.00 g, 11.9 mmol, 1.00 eq.), 2-chloro-4-(trifluoromethyl)pyrimidine (3.27 g, 17.9 mmol, 1.50 eq.), Pd(PPh3)4 (0.69 g, 0.597 mmol, 0.05 eq.), potassium carbonate (3.30 g, 23.9 mmol, 2.00 eq.) and 1,4-dioxane (150 mL). The mixture was stirred for overnight at 100° C. under a nitrogen atmosphere and then concentrated under reduced pressure. The reaction was quenched with water (100 mL) and extracted with ethyl acetate (3×150 mL). The organic layers were combined, washed with brine (3×50 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:5) to afford tert-butyl N-({2-[4-(trifluoromethyl)pyrimidin-2-yl]phenyl}methyl)carbamate (1.80 g, 42% yield) as a white solid. LCMS (ESI, m/z): 354 [M+H]+.


A 100 mL round-bottom flask was charged with tert-butyl N-({2-[4-(trifluoromethyl)pyrimidin-2-yl]phenyl}methyl)carbamate (1.80 g, 5.09 mmol, 1.00 eq.), hydrogen chloride solution 4.0 M in 1,4-diethylene oxide (60 mL). The solution was stirred for 2 h at rt and then concentrated under reduced pressure to afford 1-{2-[4-(trifluoromethyl)pyrimidin-2-yl]phenyl}methanamine hydrochloride (1.45 g, crude) as a white solid. LCMS (ESI, m/z): 254 [M+H—HCl]+.


Synthesis of Intermediate I-3



embedded image


A mixture of 3-bromo-1H-pyrazole (5.00 g, 34.0 mmol, 1.00 eq.), 2,2,2-trifluoroethyl trifluoromethanesulfonate (11.8 g, 51.0 mmol, 1.50 eq.) and potassium carbonate (9.40 g, 68.0 mmol, 2.00 eq.) in DMF (50 mL) was stirred for overnight at 60° C. The reaction was quenched with water (300 mL). The mixture was extracted with dichloromethane (3×200 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with dichloromethane:methanol (5:1) to afford 3-bromo-1-(2,2,2-trifluoroethyl) pyrazole (3.80 g, 49% yield) as a light yellow oil. LCMS (ESI, m/z): 229 [M+H]+.


A 100 mL round-bottom flask 3-bromo-1-(2,2,2-trifluoroethyl)pyrazole (3.80 g, 16.6 mmol, 1.50 eq.), 2-{[(tert-butoxycarbonyl)amino]methyl}phenylboronic acid (2.78 g, 11.1 mmol, 1.00 eq.), Pd(PPh3)4 (1.28 g, 1.11 mmol, 0.100 eq.) and K2CO3 (3.06 g, 22.1 mmol, 2.00 eq.), 1,4-dioxane (20 mL) and water (1 mL). The mixture was stirred for overnight at 100° C. under a nitrogen atmosphere. The reaction was quenched with water (80 mL). The mixture was extracted with dichloromethane (3×200 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with dichloromethane:methanol (5:1) to afford tert-butyl N-({2-[1-(2,2,2-trifluoroethyl)pyrazol-3-yl]phenyl}methyl)carbamate (3.08 g, 78% yield) as a yellow oil. LCMS (ESI, m/z): 356 [M+H]+.


A mixture of tert-butyl N-({2-[1-(2,2,2-trifluoroethyl)pyrazol-3-yl]phenyl}methyl)carbamate (980 mg, 0.844 mmol, 1.00 eq.) and HCl (gas) (10 mL, 4M in 1,4-dioxane) was stirred for 2 h at rt and then concentrated under reduced pressure to afford 1-{2-[1-(2,2,2-trifluoroethyl)pyrazol-3-yl]phenyl}methanamine hydrochloride (1.06 g, crude) as a light yellow oil. LCMS (ESI, m/z): 256 [M+H—HCl]+.


Synthesis of Intermediate I-4



embedded image


A 100 mL round-bottom flask was charged with 5-bromo-1H-indazole (880 mg, 4.47 mmol, 1.00 eq.), (2R)-2-(trifluoromethyl)oxirane (500 mg, 4.47 mmol, 1.00 eq.), K2CO3 (1.85 g, 13.4 mmol, 3.00 eq.) and DMF (20 mL). The mixture was stirred for overnight at 90° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford (2R)-3-(5-bromoindazol-1-yl)-1,1,1-trifluoropropan-2-ol (750 mg, 54% yield) as a light yellow solid. LCMS (ESI, m/z): 309 [M+H]+.


A 250 mL round-bottom flask was charged with (2R)-3-(5-bromoindazol-1-yl)-1,1,1-trifluoropropan-2-ol (550 mg, 1.78 mmol, 1.00 eq.), 2-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-5,5-dimethyl-1,3,2-dioxaborinane (804 mg, 3.56 mmol, 2.00 eq.), Pd(pph3)2Cl2 (125 mg, 0.178 mmol, 0.10 eq.), KOAc (524 mg, 5.34 mmol, 3.0 eq.) and DMSO (10 mL). The mixture was stirred for overnight at 60° C. under a nitrogen atmosphere. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×300 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford (R)-3-(5-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-1H-indazol-1-yl)-1,1,1-trifluoropropan-2-ol (450 mg, 74% yield) as a yellow oil. LCMS (ESI, m/z): 343 [M+H]+.


Synthesis of Intermediate I-5



embedded image


A 100 mL round-bottom flask was charged with 4-bromo-1-fluoro-2-nitrobenzene (6.00 g, 27.2 mmol, 1.00 eq.), DMF (24 mL) and 2,2,2-trifluoroethylamine (8.10 g, 81.7 mmol, 3.00 eq.) at rt. The mixture was stirred for 2 days at 100° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×50 mL). The combined organic layers were washed with water (3×10 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford 4-bromo-2-nitro-N-(2,2,2-trifluoroethyl)aniline (8.00 g, 98% yield) as a yellow solid. LCMS (ESI, m/z): 299 [M+H]+.


A mixture of 4-bromo-2-nitro-N-(2,2,2-trifluoroethyl) aniline (8.00 g, 26.7 mmol, 1.00 eq.), iron (14.9 g, 267 mmol, 10.0 eq.) and ammonium chloride (5.72 g, 107 mmol, 4.00 eq.) in EtOH (80 mL) and water (10 mL) was stirred for overnight at 80° C. and then concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, Agela C18 Column, 120 g; mobile phase, acetonitrile in water, 0% to 100% gradient in 50 min; detector, UV 254 nm to afford 4-bromo-N1-(2,2,2-trifluoroethyl)benzene-1,2-diamine (6.50 g, 90% yield) as a yellow solid. LCMS (ESI, m/z): 269 [M+H]+.


To a stirred mixture of 4-bromo-N1-(2,2,2-trifluoroethyl) benzene-1,2-diamine (4.50 g, 16.7 mmol, 1.00 eq.) in DMF (50 mL) was added tert-butyl nitrite (3.45 g, 33.4 mmol, 2.00 eq.) at 0° C. The mixture was stirred for 2 h at 80° C. The reaction was quenched with water (250 mL). The mixture was extracted with ethyl acetate (3×250 mL). The combined organic layers were washed with water (3×200 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with methanol:dichloromethane (1:10) to afford 5-bromo-1-(2,2,2-trifluoroethyl)-1,2,3-benzotriazole (3.20 g, 68% yield) as a yellow solid. LCMS (ESI, m/z): 280 [M+H]+.


A mixture of 5-bromo-1-(2,2,2-trifluoroethyl)-1,2,3-benzotriazole (3.20 g, 11.4 mmol, 1.00 eq.), 2-(5,5-dimethyl-1,3 ,2-dioxaborinan-2-yl)-5 ,5-dimethyl-1,3,2-dioxaborinane (12.9 g, 57.2 mmol, 5.00 eq.), Pd(PPh3)2Cl2 (0.800 g, 1.14 mmol, 0.10 eq.), potassium acetate (3.36 g, 34.2 mmol, 3.00 eq.) and DMSO (100 mL) was stirred for overnight at 60° C. under a nitrogen atmosphere. The reaction was quenched with water (500 mL). The mixture was extracted with ethyl acetate (3×500 mL). The combined organic layers were washed with water (3×200 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with dichloromethane:methanol (10:1) to afford 5-(5,5-dimethyl-1,3,2-dioxaborinan-2-yl)-1-(2,2,2-trifluoroethyl)-1H-benzo[d][1,2,3]triazole (2.10 g, 58% yield) as a white solid. LCMS (ESI, m/z): 314 [M+H]+.


Synthesis of Intermediate I-6



embedded image


A 100 mL round-bottom flask was charged with 2-fluorobenzonitrile (1.00 g, 8.26 mmol, 1.00 eq.), 4-(trifluoromethyl)-1H-pyrazole (1.12 g, 8.26 mmol, 1.00 eq.), cesium carbonate (5.38 g, 16.5 mmol, 2.00 eq.) and DMF (10 mL). The mixture was stirred for overnight at 60° C. The reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (3×150 mL). The organic layers were combined, washed with water (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with petroleum ether:ethyl acetate (1:1) to afford 2-(4-(trifluoromethyl)-1H-pyrazol-1-yl)benzonitrile (1.50 g, 76% yield) as a white solid. LCMS (ESI, m/z): 238 [M+H]+.


A 100 mL round-bottom flask was charged with 2-[3-(trifluoromethyl)pyrazol-1-yl]benzonitrile (1.10 g, 4.64 mmol, 1.00 eq.), Rany Ni (100 mg) and EtOH (50 mL) at rt. The mixture was stirred for overnight at 60° C. under a hydrogen atmosphere (2-3 atm). The solids were filtered off, and the filter cake was washed with EtOH (3×50 mL). The filtrate was concentrated under reduced pressure to afford (2-(3-(trifluoromethyl)-1H-pyrazol-1-yl)phenyl)methanamine (1.00 g, 89% yield) as a colorless oil. LCMS (ESI, m/z): 242 [M+H]+.


Synthesis of Intermediate I-7



embedded image


A 100 mL round-bottom flask was charged with methyl 2-(aminomethyl)benzoate (2.00 g, 12.1 mmol, 1.00 eq.), Et3N (2.45 g, 24.2 mmol, 2.00 eq.), Boc2O (5.28 g, 24.2 mmol, 2.00 eq.) and DCM (20 mL). The mixture was stirred for overnight at rt. The reaction was quenched with water (100 mL). The mixture was extracted with EtOAc (3×100 mL). The combined organic layers were washed with water (3×50 mL), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:5) to afford methyl 2-{[(tert-butoxycarbonyl)amino]methyl}benzoate (1.02 g, 32% yield) as a white solid. LCMS (ESI, m/z): 266 [M+H]+.


A 100 mL round-bottom flask was charged with methyl 2-{[(tert-butoxycarbonyl)amino]methyl} benzoate (1.50 g, 5.65 mmol, 1.00 eq.), hydrazine hydrate (0.448 g, 8.96 mmol, 1.58 eq.) and MeOH (10 mL). The mixture was stirred for overnight at 60° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:2) afford tert-butyl N-{[2-(hydrazinecarbonyl) phenyl]methyl} carbamate (1.02 g, 67% yield) as a colorless oil. LCMS (ESI, m/z): 266 [M+H]+.


A 100 mL round-bottom flask was charged with tert-butyl N-{[2-(hydrazinecarbonyl)phenyl]methyl} carbamate (1.10 g, 4.15 mmol, 1.00 eq.) and diethoxy(methoxy)methane (5 mL). The mixture was stirred for overnight at 130° C. The reaction was quenched with water (20 mL). The mixture was extracted with ethyl acetate (3×100 mL). The organic layers were combined, washed with brine (3×100 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:2) afford tert-butyl N-{[2-(1,3,4-oxadiazol-2-yl)phenyl]methyl}carbamate (500 mg, 44% yield) as a colorless oil. LCMS (ESI, m/z): 276 [M+H]+.


A 100 mL round-bottom flask were added tert-butyl N-{[2-(1,3,4-oxadiazol-2-yl)phenyl]methyl} carbamate (300 mg, 1.09 mmol, 1.00 eq.), TFA (4 mL) and DCM (20 mL) at rt. The mixture was stirred for 3 h at rt and then concentrated under reduced pressure to afford 1-[2-(1,3,4-oxadiazol-2-yl)phenyl]methanamine trifluoroacetic acid salt (310 mg, crude) as a colorless oil. LCMS (ESI, m/z): 266 [M+H-TFA]+.


Synthesis of Intermediate I-8



embedded image


A 100 mL round-bottom flask was charged with 2-bromobenzoylhydrazine (10.0 g, 46.5 mmol, 1.00 eq.), phenyl chloroformate (10.9 g, 69.8 mmol, 1.50 eq.), Et3N (9.42 g, 93.0 mmol, 2.00 eq.) and THF (100 mL) at rt. The mixture was stirred for 4 h at 0° C. and then concentrated under reduced pressure. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×500 mL). The combined organic layers were washed with water (3×200 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford N′-(2-bromobenzoyl)-1-phenoxyformohydrazide (15.0 g, 96% yield) as a yellow solid. LCMS (ESI, m/z): 335 [M+H]+.


A 250 mL round-bottom flask was charged with N′-(2-bromobenzoyl)-1-phenoxyformohydrazide (15.0 g, 44.8 mmol, 1.00 eq.), CH3NH2 (16.8 g, 179 mmol, 4.00 eq., 33% w/w in MeOH) and MeOH (50 mL). The mixture was stirred for overnight at 60° C. and then concentrated under reduced pressure. The reaction was quenched with water (200 mL). The mixture was extracted with ethyl acetate (3×200 mL). The combined organic layers were washed with water (3×200 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford 2-bromo-N-[(methylcarbamoyl)amino]benzamide (4.60 g, 38% yield) as a white solid. LCMS (ESI, m/z): 272 [M+H]+.


A 250 mL round-bottom flask was charged with 2-bromo-N-[(methylcarbamoyl)amino]benzamide (4.60 g, 16.8 mmol, 1.00 eq.),NaOH (1.34 g, 33.6 mmol, 2.00 eq.) and H2O (50 mL). The mixture was stirred for overnight at 100° C. and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (1:1) to afford 5-(2-bromophenyl)-4-methyl-2H-1,2,4-triazol-3-one (3.80 g, 88% yield) as a white solid. LCMS (ESI, m/z): 254 [M+H]+.


A 100 mL vial was charged with 5-(2-bromophenyl)-4-methyl-2H-1,2,4-triazol-3-one (3.80 g, 15.0 mmol, 1.00 eq.), Pd(PPh3)4 (867 mg, 0.75 mmol, 0.05 eq.), Zn(CN)2 (3.51 g, 30.0 mmol, 2.00 eq.) and DMF (10 mL). The mixture was irradiated with microwave radiation for 2 h at 180° C. The reaction was quenched with water (100 mL). The mixture was extracted with ethyl acetate (3×500 mL). The combined organic layers were washed with water (3×200 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl2:MeOH (10:1) to afford 2-(4-methyl-5-oxo-1H-1,2,4-triazol-3-yl)benzonitrile (1.01 g, 34% yield) as a white solid. LCMS (ESI, m/z): 201 [M+H]+.


A 250 mL round-bottom flask was charged with 2-(4-methyl-5-oxo-1H-1,2,4-triazol-3-yl)benzonitrile (1.01 g, 5.05 mmol, 1.00 eq.), LiAlH4 (960 mg, 25.3 mmol, 5.00 eq.) and THF (100 mL) at rt. The mixture was stirred for overnight at rt. The reaction was quenched with ice/water (960 mg), 30% NaOH (aq., 2.88 g) and water (960 mg). The solids were filtered off, and the filter cake was washed with THF (3×100 mL). The filtrate was concentrated under reduced pressure to afford 5-[2-(aminomethyl)phenyl]-4-methyl-2H-1,2,4-triazol-3-one (600 mg, crude) as a white solid. LCMS (ESI, m/z): 205 [M+H]+.


A 100 mL round-bottom flask was charged with 5-[2-(aminomethyl)phenyl]-4-methyl-2H-1,2,4-triazol-3-one (600 mg, 2.94 mmol, 1.00 eq.), (Boc)2O (1.28 g, 5.88 mmol, 2.00 eq.), Et3N (595 mg, 5.88 mmol, 2.00 eq.) and DCM (50 mL). The mixture was stirred for 2 h at rt. The reaction was quenched with water (50 mL). The mixture was extracted with DCM (3×200 mL). The combined organic layers were washed with water (3×200 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate:petroleum ether (3:1) to afford tert-butyl N-{[2-(4-methyl-5-oxo-1H-1,2,4-triazol-3-yl)phenyl]methyl}carbamate (300 mg, 34% yield) as a white solid. LCMS (ESI, m/z): 305 [M+H]+.


A 100 mL round bottom flask was charged with tert-butyl N-{[2-(4-methyl-5-oxo-1H-1,2,4-triazol-3-yl)phenyl]methyl}carbamate (300 mg, 0.984 mmol, 1.00 eq.), TFA (5 mL) and DCM (20 mL). The mixture was stirred for 2h at rt under an air atmosphere and then concentrated under reduced pressure to provide 5-[2-(aminomethyl)phenyl]-4-methyl-2H-1,2,4-triazol-3-one trifluoroacetic acid salt (310 mg, crude) as a yellow oil. LCMS (ESI, m/z): 205 [M-TFA+H]+.


Example 20

Compounds 4-18 provided in Table A were synthetized using the intermediates and/or protocols of Examples 1-9, using methods and conditions known to those skilled in the art. Enantiomers were obtained from racemic mixtures by preparative chiral HPLC using conditions C1 to C14 described in table B. Enantiomer (a) is the first eluting enantiomer, enantiomer (b) is the second eluting compound.













TABLE A








LCMS



Cmpd
Structure
Name
[M + H]+

1H NMR




















 4


embedded image


7-(4-bromo-3-chloro- benzoyl)-6-methyl- 3-oxo-2-(4-pyrazol- 1-ylphenyl)-N- [(2-pyrimidin-4- ylphenyl)methyl]- 6,8-dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
725.1
(300 MHz, CDCl3) δ 8.82 (s, 1H), 8.61 (s, 1H), 7.77-7.64 (m, 3H), 7.61-7.31 (m, 8H), 7.28-7.19 (m, 3H), 7.10 (s, 1H), 6.51-6.37 (m, 1H), 5.37 (s, 2H), 4.65 (d, J = 19.0 Hz, 1H), 4.53-4.28 (m, 2H), 3.88 (d, J = 12.7 Hz, 1H), 3.79-3.65 (m, 1H), 1.43 (d, J = 7.0 Hz, 3H)





 5a


embedded image


(6S*)-7-(4-bromo-3- cyano-benzoyl)-2- [4-(cyclo- propoxy)phenyl]- 6-methyl-N-[[2- (5-methyl-1,3,4- oxadiazol-2- yl)phenyl]methyl]- 3-oxo-6,8-dihydro- 5H-imidazo[1,5- a]pyrazine-1- carboxamide
710
(DMSO-d6, 600 MHz, 80° C.) δ ppm 0.65-0.70 (m, 2H), 0.78-0.83 (m, 2H), 1.27 (d, J = 6.8 Hz, 3H), 2.58 (s, 3H), 3.62-3.73 (m, 2H), 3.83 (hept, J = 3.0 Hz, 1H), 4.41-4.68 (m, 4H), 5.16 (brs, 1H), 6.95-7.02 (m, 2H), 7.09-7.20 (m, 3H), 7.31 (d, J = 7.0 Hz, 1H), 7.44-7.52 (m, 2H), 7.72 (dd, J = 8.0, 1.9 Hz, 1H), 7.82- 7.88 (m, 1H), 7.96 (d, J = 8.5 Hz, 1H), 8.05 (d, J = 1.9 Hz, 1H)





 6


embedded image


7-(4-bromo-3- chloro-benzoyl)-2- [4-(cyclo- propoxy)phenyl]- 6-methyl-N-[[2- (4-methylpyrazol-1- yl)phenyl]methyl]- 3-oxo-6,8- dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
716.95
(300 MHz, CDCl3) δ 7.71 (d, J = 8.1 Hz 1H), 7.65-7.56 (m, 1H), 7.49 (d, J = 7.5 Hz 1H), 7.42-7.30 (m, 3H), 7.26-7.12 (m, 5H), 6.99 (d, J = 9.0 Hz 2H), 6.78 (t, J = 5.7 Hz 1H), 5.86-4.79 (m, 2H), 4.60 (d, J = 18.0 Hz 1H), 4.23 (d, J = 6.0 Hz 2H), 3.86 (d, J = 12.3 Hz 1H), 3.79- 3.60 (m, 2H), 2.14 (s, 3H), 1.39 (t, J = 9.15 Hz 3H), 0.86-0.68 (m, 4H).





 7


embedded image


7-(4-bromo-3- chloro-benzoyl)- 2-[4-(cyclo- propoxy)phenyl]-6- methyl-3-oxo-N- [(2-pyridazin-3- ylphenyl)methyl]- 6,8-dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
715.2
(300 MHz, CDCl3) δ 9.15 (d, J = 4.8 Hz, 1H), 7.74-7.54 (m, 4H), 7.52-7.36 (m, 4H), 7.24-7.09 (m, 3H), 6.85 (s, 1H), 6.74 (d, J = 8.8 Hz, 2H), 5.65-4.90 (m, 2H), 4.65 (d, J = 18.9 Hz, 1H), 4.33 (q, J = 8.6, 7.9 Hz, 2H), 3.88 (d, J = 12.8 Hz, 1H), 3.79-3.63 (m, 1H), 3.47 (dq, J = 6.1, 3.0 Hz, 1H), 1.41 (d, J = 7.0 Hz, 3H), 0.77- 0.64 (m, 2H), 0.62-0.51 (m, 2H)





 8


embedded image


N-[[2-(6-amino- pyrimidin-4- yl)phenyl]methyl]- 7-(4-bromo-3- chloro-benzoyl)-2- [4-(cyclo- propoxy)phenyl]- 6-methyl-3-oxo- 6,8-dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
729.95
(300 MHz, CDCl3) δ 8.20 (s, 1H), 7.71 (d, J = 8.1 Hz 1H), 7.58 (d, J = 1.8 Hz 1H), 7.50-7.35 (m, 4H), 7.24-7.04 (m, 4H), 6.84 (d, J = 8.7 Hz 2H), 6.54 (s, 1H), 5.62-5.15 (m, 1H), 5.00 (s, 2H), 4.62 (d, J = 19.2 Hz 1H), 4.44-4.20 (m, 2H), 3.86 (d, J = 12.9 Hz 1H), 3.80-3.65 (m, 1H), 3.65-3.50 (m, 1H), 1.40 (d, J = 6.9 Hz 3H), 0.80-0.60 (m, 4H)





 9


embedded image


7-(4-bromo-3- chloro-benzoyl)- 2-[4-(cyclo- propoxy)phenyl]- 6-methyl-3-oxo- N-[(2-pyrimidin- 4-ylphenyl)methyl]- 6,8-dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
715.25
(400 MHz, CDCl3) δ 8.89- 8.72 (m, 2H), 7.71 (d, J = 8.2 Hz, 1H), 7.60-7.40 (m, 6H), 7.22-7.08 (m, 3H), 6.90-6.75 (m, 3H), 6.29- 4.88 (m, 2H), 4.75-4.55 (m, 1H), 4.50-4.30 (m, 2H), 3.84 (d, J = 12.7 Hz, 1H), 3.78-3.64 (m, 1H), 3.59-3.40 (m, 1H), 1.39 (d, J = 6.9 Hz, 3H), 0.80-0.68 (m, 2H), 0.61- 0.50 (m, 2H)





10


embedded image


N-[[2-(6-amino- pyridazin-3- yl)phenyl]methyl]- 7-(4-bromo-3- chloro-benzoyl)-2- [4-(cyclo- propoxy)phenyl]-6- methyl-3-oxo-6,8- dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
730.2
(300 MHz, CDCl3) δ 7.67 (d, J = 8.2 Hz, 1H), 7.58 (d, J = 2.0 Hz, 1H), 7.46-7.30 (m, 5H), 7.23-7.08 (m, 3H), 6.90 (q, J = 9.3, 8.1 Hz, 2H), 6.76 (d, J = 8.8 Hz, 2H), 5.60-4.88 (m, 4H), 4.63 (d, J = 18.6 Hz, 1H), 4.33 (d, J = 5.9 Hz, 2H), 3.87 (d, J = 12.8 Hz, 1H), 3.71 (dd, J = 13.0, 4.4 Hz, 1H), 3.53 (tt, J = 6.2, 2.9 Hz, 1H), 1.40 (d, J = 7.0 Hz, 3H), 0.79-0.52 (m, 4H)





11


embedded image


N-[[2-(2-amino- pyrimidin-4- yl)phenyl]methyl]- 7-(4-bromo-3- chloro-benzoyl)-2- [4-(cyclo- propoxy)phenyl]-6- methyl-3-oxo-6,8- dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
730.1
(300 MHz, CDCl3) δ 8.32 (s, 1H), 7.74 (d, J = 8.4 Hz 1H), 7.60 (d, J = 1.8 Hz 1H), 7.50-7.31 (m, 4H), 7.29-7.20 (m, 1H), 7.10 (t, J = 4.3 Hz 2H), 6.77 (t, J = 4.5 Hz 3H), 6.31 (t, J = 5.7 Hz 1H), 5.70- 5.10 (m, 1H), 4.90 (s, 2H), 4.75-4.32 (m, 3H), 3.86 (d, J = 12.9 Hz 1H), 3.80-3.62 (m, 1H), 3.59-3.46 (m, 1H), 1.42 (d, J = 7.2 Hz 3H), 0.80-0.54 (m, 4H).





12


embedded image


7-(4-bromo-3- methyl-benzoyl)- 2-[4-(cyclo- propoxy)phenyl]-6- methyl-3-oxo-N- [(2-pyrimidin-4- ylphenyl)methyl]- 6,8-dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
695.15
(400 MHz, CDCl3) δ 8.77 (t, J = 11.1 Hz 2H), 7.60 (d, J = 8.1 Hz 1H), 7.59-7.40 (m, 5H), 7.34 (d, J = 1.4 Hz 1H), 7.20-7.10 (m, 3H), 6.90-6.70 (m, 3H), 6.20-4.80 (m, 2H), 4.60 (d, J = 17.5 Hz, 1H), 4.45-4.21 (m, 2H), 3.83 (d, J = 12.6 Hz 1H), 3.69 (t, J = 6.5 Hz 1H), 3.60- 3.40 (m, 1H), 2.44 (s, 3H), 1.38 (d, J = 6.8 Hz 3H), 0.80-0.50 (m, 4H).





13


embedded image


7-[4-bromo- 3-(trifluoro- methyl)benzoyl]-2- [4-(cyclo- propoxy)phenyl]-6- methyl-3-oxo-N- [(2-pyrimidin-4- ylphenyl)methyl]- 6,8-dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
748.95
(300 MHz, CDCl3) δ 8.77 (t, J = 6.0 Hz 2H), 7.82 (d, J = 7.8 Hz 2H), 7.60-7.40 (m, 6H), 7.12 (d, J = 8.7 Hz 2H), 6.87 (t, J = 6.0 Hz 1H), 6.78 (d, J = 9.0 Hz 2H), 5.74-4.80 (m, 2H), 4.65 (d, J = 18.9 Hz 1H), 4.60-4.26 (m, 2H), 3.86 (d, J = 12.9 Hz 1H), 3.78- 3.68 (m, 1H), 3.52-3.40 (m, 1H), 1.41 (d, J = 6.9 Hz 3H), 0.76-0.66 (m, 2H), 0.62-0.50 (m, 2H)





14a


embedded image


(6R*)-7-(4-bromo- 3-chloro-benzoyl)- N-[[2-(4- fluoropyrazol-1- yl)phenyl]methyl]- 6-methyl-2-[4- [(2R)-2-methyl- morpholin-4- yl]phenyl]-3-oxo- 6,8-dihydro- 5H-imidazo[1,5- a]pyrazine-1- carboxamide
764.3
(300 MHz, CDCl3) δ 7.72 (d, J = 8.2 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.56-7.45 (m, 2H), 7.42-7.33 (m, 2H), 7.30 (s, 1H), 7.25 C 7.11 (m, 4H), 6.82 (d, J = 8.9 Hz, 2H), 6.40 (d, J = 6.6 Hz, 1H), 5.37 (s, 1H), 4.61 (d, J = 19.0 Hz, 1H), 4.25 (d, J = 6.2 Hz, 2H), 4.05 (dd, J = 11.7, 2.6 Hz, 1H), 3.93-3.57 (m, 4H), 3.49- 3.25 (m, 2H), 2.80 (td, J = 11.8, 3.4 Hz, 1H), 2.53- 2.34 (m, 1H), 1.40 (d, J = 7.0 Hz, 3H), 1.29 (d, J = 6.2 Hz, 3H)





14b

(6S*)-7-(4-bromo-
764.1
(300 MHz, CDCl3) δ 7.72 (d,




3-chloro-benzoyl)-

J = 8.2 Hz, 1H), 7.58 (d, J =




N-[[2-(4-

1.9 Hz, 1H), 7.55-7.45 (m,




fluoropyrazol-1-

2H), 7.42-7.31 (m, 2H), 7.30




yl)phenyl]methyl]-

(s, 1H), 7.25-7.12 (m, 4H),




6-methyl-2-[4-

6.82 (d, J = 8.9 Hz, 2H), 6.41




[(2R)-2-methyl-

(t, J = 6.2 Hz, 1H), 5.37 (s,




morpholin-4-

1H), 4.61 (d, J = 19.1 Hz,




yl]phenyl]-3-oxo-

1H), 4.25 (d, J = 6.2 Hz, 2H),




6,8-dihydro-5H-

4.05 (dd, J = 11.2, 3.0 Hz,




imidazo[1,5-

1H), 3.96-3.58 (m, 4H), 3.58-




a]pyrazine-1-

3.29 (m, 2H), 2.80 (td, J =




carboxamide

11.8, 3.5 Hz, 1H), 2.45






(dd, J = 11.7, 10.4 Hz, 1H),






1.40 (d, J = 7.0 Hz,






3H), 1.28 (d, J = 6.2 Hz, 3H)





15a


embedded image


(6R*)-7-(4-bromo- 3-chloro-benzoyl)- 6-methyl-2-[4-[(2R)- 2-methyl- morpholin-4- yl]phenyl]-3-oxo- N-[(2-pyrimidin-4- ylphenyl)methyl]- 6,8-dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
758.25
(300 MHz, , CDCl3) δ 8.84 (s, 1H), 8.77 (d, J = 5.3 Hz, 1H), 7.73 (d, J = 8.2 Hz, 1H), 7.62-7.43 (m, 6H), 7.22 (dd, J = 8.2, 2.0 Hz, 1H), 7.11 (d, J = 8.9 Hz, 2H), 6.89 (t, J = 6.2 Hz, 1H), 6.60 (d, J = 8.8 Hz, 2H), 4.65 (d, J = 19.0 Hz, 1H), 5.82-4.89 (s, 2H), 4.53-4.22 (m, 2H), 4.10-3.79 (m, 2H), 3.67 (td, J = 16.1, 15.3, 6.4 Hz, 3H), 3.19 (t, J = 13.3 Hz, 2H), 2.55 (td, J = 11.8, 3.5 Hz, 1H), 2.28-2.12 (m, 1H), 1.41 (d, J = 7.0 Hz, 3H), 1.24 (d, J = 6.2 Hz, 3H)





15b

(6S*)-7-(4-bromo-
758.25
(300 MHz, , CDCl3) δ 8.84 (s,




3-chloro-benzoyl)-

1H), 8.77 (d, J = 5.3 Hz, 1H),




6-methyl-2-[4-[(2R)-

7.73 (d, J = 8.2 Hz, 1H),




2-methyl-

7.62-7.40 (m, 6H), 7.22 (dd,




morpholin-4-

J = 8.2, 2.0 Hz, 1H), 7.11 (d,




yl]phenyl]-3-oxo-

J = 8.8 Hz, 2H), 6.89 (t, J =




N-[(2-pyrimidin-4-

6.2 Hz, 1H), 6.61 (d, J =




ylphenyl)methyl]-

8.7 Hz, 2H), 4.65 (d, J = 18.9




6,8-dihydro-5H-

Hz, 1H), 5.57-5.12 (s, 2H),




imidazo[1,5-

4.49-4.27 (m, 2H), 4.01-3.93




a]pyrazine-1-

(m, 1H), 3.87 (d, J = 12.8 Hz,




carboxamide

1H), 3.68 (t, J = 11.4 Hz, 3H),






3.27-3.12 (m, 2H), 2.64-2.50






(m, 1H), 2.25-2.14 (m, 1H),






1.41 (d, J = 7.0 Hz, 3H),






1.23 (d, J = 6.2 Hz, 3H)





16


embedded image


7-[4-bromo- 3-(difluoro- methyl)benzoyl]-2- [4-(cyclo- propoxy)phenyl]-6- methyl-3-oxo-N- [(2-pyrimidin- 4-ylphenyl)methyl]- 6,8-dihydro- 5H-imidazo[1,5- a]pyrazine-1- carboxamide
730.95
(400 MHz, , CDCl3) δ 8.77 (t, J = 11.2 Hz 2H), 7.73 (t, J = 12.2 Hz 2H), 7.60-7.40 (m, 6H), 7.13 (d, J = 8.8 Hz 2H), 7.09-6.74 (m, 4H), 6.20-4.76 (m, 2H), 4.64 (d, J = 19.6 Hz 1H), 4.50-4.26 (m, 2H), 3.85 (d, J = 12.5 Hz 1H), 3.70 (t, J = 6.5 Hz 1H), 3.58-3.40 (m, 1H), 1.40 (d, J = 6.9 Hz 3H), 0.80-0.68 (m, 2H), 0.64-0.55 (m, 2H)





17


embedded image


7-(4-bromo-3- chloro-benzoyl)- 2-[4-(cyclo- propoxy)phenyl]-N- [[2-(4-methoxy- pyrazol-1- yl)phenyl]methyl]- 6-methyl-3- oxo-6,8-dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
733.15
(400 MHz, , CDCl3) δ 7.69 (d, J = 8.2 Hz 1H), 7.56 (d, J = 1.9 Hz 1H), 7.48 (d, J = 6.5 Hz 1H), 7.38-7.29 (m, 3H), 7.24- 7.16 (m, 4H), 7.11 (s, 1H), 6.98 (t, J = 6.0 Hz 2H), 6.62 (t, J = 6.0 Hz 1H), 5.95-4.88 (m, 2H), 4.59 (d, J = 18.6 Hz 1H), 4.23 (d, J = 5.8 Hz 2H), 3.90-3.74 (m, 4H), 3.72-3.52 (m, 2H), 1.38 (d, J = 6.9 Hz 3H), 0.85-0.60 (m, 4H)





18


embedded image


7-(4-bromo-3- chloro-benzoyl)- 2-[4-(cyclo- propoxy)phenyl]-6- methyl-N-[[2-(1- methylimidazol-4- yl)phenyl]methyl]- 3-oxo-6,8- dihydro-5H- imidazo[1,5- a]pyrazine-1- carboxamide
717.1
(300 MHz, , CDCl3) δ 7.71 C 7.56 (m, 2H), 7.39 (dd, J = 7.0, 2.1 Hz, 2H), 7.31 (d, J = 1.6 Hz, 1H), 7.27 C 7.10 (m, 6H), 7.07 C 6.88 (m, 3H), 5.54 C 5.01 (m, 1H), 4.59 (d, J = 18.8 Hz, 1H), 4.41 (d, J = 6.1 Hz, 2H), 3.90 C 3.57 (m, 6H), 1.38 (d, J = 6.9 Hz, 3H), 0.84 C 0.65 (m, 4H)
















TABLE B







Conditions used for the chiral separation of racemic mixtures











Method




Compound
Name
Method Description
Retention time





 4a
C1
Column: CHIRALPAK IG, 2*25 cm, 5 μm,
RT1: 16.8


 4b

Mobile Phase A: Hex:DCM = 1:1
RT2: 24.3




(0.5% 2M NH3-MeOH)--HPLC, Mobile





Phase B: EtOH--HPLC; Flow rate: 20





mL/min; Gradient: 20 B to 20 B in 30 min



 6a
C2
Column: CHIRALPAK IE, 2*25 cm, 5 μm;
RT1: 12.078


 6b

Mobile Phase A: MTBE (0.5% 2M
RT2: 15.939




NH3-MeOH)--HPLC, Mobile Phase





B:EtOH--HPLC; Flow rate: 18 mL/min;





Gradient: 50 B to 50 B in 18 min



 7a
C3
Column: CHIRALPAK IA, 2*25 cm, 5 μm;
RT1: 10.156


 7b

Mobile Phase A: Hex:DCM = 3.1
RT2: 12.623




(0.5% 2M NH3-MeOH)--HPLC, Mobile





Phase B: EtOH--HPLC; Flow rate: 18





mL/min; Gradient: 10 B to 10 B in 15 min



 8a
C4
Column: CHIRALPAK ID, 3*25 cm, 5 μm;
RT1: 9.8


 8b

Mobile Phase A: Hex:DCM = 1.1
RT2: 12.2




(0.5% 2M NH3-MeOH)--HPLC, Mobile





Phase B: EtOH--HPLC; Flow rate: 35





mL/min; Gradient: 50 B to 50 B in 14 min



 9a
C5
Column: CHIRALPAK ID, 2*25 cm, 5 μm;



 9b

Mobile Phase A: Hex:DCM = 3:1





(0.5% 2M NH3-MeOH)--HPLC, Mobile





Phase B: EtOH; Flow rate: 18 mL/min;





Gradient: 50 B to 50 B in 15 min



10a
C6
Column: CHIRALPAK IF, 5*25 cm, 5 μm;
RT1: 18.568


10b

Mobile Phase A: MTBE (0.5% 2M
RT2: 25.367;




NH3-MeOH)--HPLC, Mobile Phase B:





EtOH--HPLC; Flow rate: 15 mL/min;





Gradient: 25 B to 25 B in 44 min



11a
C7
Column: CHIRAL ART Cellulose-SB,
RT1: 7.116


11b

2*25 cm, 5 μm; Mobile Phase A: MTBE
RT2: 8.048;




(0.5% 2M NH3-MeOH)--HPLC, Mobile





Phase B: MeOH--HPLC; Flow rate: 20





mL/min; Gradient: 50 B to 50 B in 10 min



12a
C8
Column: CHIRALPAK IA, 2*25 cm, 5 μm;
RT1: 10.941


12b

Mobile Phase A: MTBE (0.5% 2M
RT2: 13.071




NH3-MeOH)--HPLC, Mobile Phase B:





EtOH--HPLC; Flow rate: 18 mL/min;





Gradient: 50 B to 50 B in 15 min



13a
C9
Column: CHIRALPAK IF, 2*25 cm, 5 μm;
RT1: 11.516


13b

Mobile Phase A: MTBE (0.5% 2M
RT2: 14.745




NH3-MeOH)--HPLC, Mobile Phase .B:





EtOH--HPLC; Flow rate: 16 mL/mm;





Gradient: 30 B to 30 B in 17 min



14a
C10
Column: CHIRALPAK ID, 3*25 cm, 5 μm;
RT1: 9.5


14b

Mobile Phase A: Hex:DCM = 1.1
RT2: 12.8




(0.5% 2M NH3-MeOH)--HPLC, Mobile





Phase B: EtOH--HPLC; Flow rate: 40





mL/min; Gradient: 50 B to 50 B in 16 min



15a
C11
Column: CHIRALPAK ID, 3*25 cm, 5 μm;
RT1: 16.093


15b

Mobile Phase A: Hex:DCM = 1.1
RT2: 21.392




(0.5% 2M NH3-MeOH)--HPLC, Mobile





Phase B: EtOH--HPLC; Flow rate: 29





mL/min; Gradient: 50 B to 50 B in 25 min



16a
C12
Column: CHIRALPAK ID, 2*25 cm, 5 μm;
RT1: 13.89


16b

Mobile Phase A: MTBE (0.5% 2M
RT2: 19.413




NH3-MeOH)--HPLC, Mobile Phase B:





EtOH--HPLC; Flow rate: 14 mL/mm;





Gradient: 50 B to 50 B in 21 min



17a
C13
Column: CHIRALPAK ID, 2*25 cm, 5 μm;
RT1: 7.634


17b

Mobile Phase A: Hex:DCM = 1.1
RT2: 10.997




(0.5% 2M NH3-MeOH)--HPLC, Mobile





Phase B: EtOH--HPLC; Flow rate: 17





mL/min; Gradient: 50 B to 50 B in 14 min



18a
C14
Column: CHIRALPAK IF, 2*25 cm, 5 μm;
RT1: 14.095


18b

Mobile Phase A: MTBE (0.5% 2M
RT2: 18.279




NH3-MeOH)--HPLC, Mobile Phase B:





EtOH--HPLC; Flow rate: 20 mL/min;





Gradient: 40 B to 40 B in 20 min









Example 17

Compounds 19-54, 56-70, 72, 74-84, 86-90, 92 and 94-129 provided in Tables C and D were synthetized using the intermediates and/or protocols of Examples 1-16, using methods and conditions known to those skilled in the art. Enantiomers were obtained from racemic mixtures by preparative chiral HPLC or SFC using conditions provided in Table C. Enantiomer (a) is the first eluting enantiomer, enantiomer (b) is the second eluting compound. The chiral centers referred to as rac-(R) or rac-(S) in the compound name have been chosen arbitrarily.













TABLE C









Separation


Compound
Name

1H NMR

[M + H]+
Method







114
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.25 (s,
655
NA



benzoyl)-2-[4-(2-hydroxy-2-methyl-
6H), 3.68-3.70 (m, 2H), 3.76 (s, 2H),





propoxy)phenyl]-3-oxo-6,8-dihydro-
3.84 (br s, 2H), 4.26 (d, J = 5.4 Hz, 2H),





5H-imidazo[1,5-a]pyrazine-1-
4.37 (s, 1H), 4.86 (s, 2H), 6.97 (d, J = 8.4





carboxamide
Hz, 2H), 7.04 (d, J = 6.6 Hz, 2H), 7.19






(d, J = 9.0 Hz, 2H), 7.20-7.26 (m, 4H),






7.40 (dd, J = 7.8, 1.8 Hz, 1H), 7.75 (d, J =






1.8 Hz, 1H), 7.86 (d, J = 7.8 Hz, 1H).




115a
N-benzyl-7-(4-bromo-3-chloro-
(DMSO d6, 600 MHz, 80° C.) δ 1.40 (s,
665
SFC column: chiral



benzoyl)-3-oxo-2-[4-[rac-(3S)-3-
3H), 1.91-1.96 (m, 1H), 1.99-2.03 (m,

ART 21.2 mm × 250



hydroxy-3-methyl-pyrrolidin-1-
1H), 2.20 (dd, J = 13.2, 9.6 Hz, 2H), 3.30

mm, 5 μm; isochratic



yl]phenyl]-6,8-dihydro-5H-
(td, J = 8.4, 3.6 Hz, 1H), 3.41 (dd, J =

conditions 50; 50



imidazo[1,5-a]pyrazine-1-
16.2, 8.4 Hz, 1H), 3.67-3.69 (m, 2H),

EtOH:CO2, 40° C., 50



carboxamide
3.84 (br s, 2H), 4.23 (d, J = 4.8 Hz, 2H)

mL/min, 100 bar, Wave




4.60 (s, 1H), 4.87 (s, 2H), 6.48 (d, J = 9.0

Length: 210 nm




Hz, 2H), 6.70 (br s, 1H), 6.99 (d, J = 6.6






Hz, 2H), 7.07 (d, J = 9.0 Hz, 2H), 7.19-






7.24 (m, 3H), 7.40 (dd, J = 8.4, 1.8 Hz,






1H), 7.75 (d, J = 1.8 Hz, 1H), 7.86 (d, J =






8.4 Hz, 1H).




115b
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.40 (s,
665
SFC column: chiral



benzoyl)-3-oxo-2-[4-[rac-(3R)-3-
3H), 1.91-1.96 (m, 1H), 1.99-2.03 (m,

ART 21.2 mm × 250



hydroxy-3-methyl-pyrrolidin-1-
1H), 2.20 (dd, J = 13.2, 9.6 Hz, 2H), 3.30

mm, 5 μm; isochratic



yl]phenyl]-6,8-dihydro-5H-
(td, J = 8.4, 3.6 Hz, 1H), 3.41 (dd, J =

conditions 50; 50



imidazo[1,5-a]pyrazine-1-
16.2, 8.4 Hz, 1H), 3.67-3.69 (m, 2H),

EtOH:CO2, 40° C., 50



carboxamide
3.84 (br s, 2H), 4.23 (d, J = 4.8 Hz, 2H)

mL/min, 100 bar, Wave




4.60 (s, 1H), 4.87 (s, 2H), 6.48 (d, J = 9.0

Length: 210 nm




Hz, 2H), 6.70 (br s, 1H), 6.99 (d, J = 6.6






Hz, 2H), 7.07 (d, J = 9.0 Hz, 2H), 7.19-






7.24 (m, 3H), 7.40 (dd, J = 8.4, 1.8 Hz,






1H), 7.75 (d, J = 1.8 Hz, 1H), 7.86 (d, J =






8.4 Hz, 1H).




 19a
rac-(6R)-N-[[2-(4-aminopyrazol-1-
(400 MHz, CDCl3) δ 7.69 (d, J = 4.0 Hz,
716
Column: CHIRALPAK



yl)phenyl]methyl]-7-(4-bromo-3-
1H), 7.57 (d, J = 2.0 Hz, 1H), 7.46 (d, J =

IF, 2*25 cm, 5 μm;



chloro-benzoyl)-2-[4-
4.0 Hz, 1H), 7.34-7.28 (m, 2H), 7.25-

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
7.14 (m, 4H), 7.13(d, J = 2.0 Hz, 1H)

MTBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
7.04 (s, 1H), 6.96 (d, J = 4.0 Hz, 2H),

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
6.69 (s, 1H), 5.31 (s, 2H), 4.58 (d, J = 8.0

Phase B: EtOH--HPLC;




Hz, 1H), 4.23 (d, J = 4.0 Hz, 2H), 3.85-

Flow rate: 12 mL/min;




3.82 (m, 1H), 3.68-3.63 (m, 2H), 3.01 (s,

Gradient: 60% B to 60%




2H), 1.38 (d, J = 4.0 Hz, 3H), 0.80-0.69

B in 25 min; Wave




(m, 4H).

Length: 220/254 nm


 19b
rac-(6S)-N-[[2-(4-aminopyrazol-1-
(400 MHz, CDCl3) δ 7.69 (d, J = 4.0 Hz,
716
Column: CHIRALPAK



yl)phenyl]methyl]-7-(4-bromo-3-
1H), 7.57 (d, J = 2.0 Hz, 1H), 7.46 (d, J =

IF, 2*25 cm, 5 μm;



chloro-benzoyl)-2-[4-
4.0 Hz, 1H), 7.34-7.28 (m, 2H), 7.25-

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
7.14 (m, 4H), 7.13(d, J = 2.0 Hz, 1H)

MTBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
7.04 (s, 1H), 6.96 (d, J = 4.0 Hz, 2H),

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
6.69 (s, 1H), 5.31 (s, 2H), 4.58 (d, J = 8.0

Phase B: EtOH--HPLC;




Hz, 1H), 4.23 (d, J = 4.0 Hz, 2H), 3.85-

Flow rate: 12 mL/min;




3.82 (m, 1H), 3.68-3.63 (m, 2H), 3.01 (s,

Gradient: 60% B to 60%




2H), 1.38 (d, J = 4.0 Hz, 3H), 0.80-0.69

B in 25 min; Wave




(m, 4H).

Length: 220/254 nm


116
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.07 (d,
677
NA



benzoyl)-3-oxo-2-[4-[(3R)-3,4-
J = 6.2 Hz, 3H), 2.15-2.21 (m, 1H), 2.24





dimethylpiperazin-1-yl]phenyl]-6,8-
(s, 3H), 2.25-2.31 (m, 1H), 2.43-2.48 (m,





dihydro-5H-imidazo[1,5-a]pyrazine-1-
1H), 2.79-2.87 (m, 2H), 3.45-3.56 (m,





carboxamide
2H), 3.65-3.70 (m, 2H), 3.83 (br. s, 2H),






4.21-4.28 (m, 2H), 4.86 (s, 2H), 6.91 (d,






J = 9.0 Hz, 2H), 6.94 (br. s, 1H), 7.01 (d,






J = 6.6 Hz, 2H), 7.11 (d, J = 9.0 Hz, 2H),






7.18-7.27 (m, 3H), 7.39 (dd, J = 8.2 Hz,






1.8 Hz, 1H), 7.74 (d, J = 1.8 Hz, 1H),






7.85 (d, J = 8.3 Hz, 1H).




117
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.48 (s,
650
NA



benzoyl)-2-[4-(3-hydroxy-3-methyl-
3H), 3.64-3.69 (m, 4H), 3.76 (d, J = 7.4





azetidin-1-yl)phenyl]-3-oxo-6,8-
Hz, 2H), 3.83 (br. s., 2H), 4.23 (d, J = 5.9





dihydro-5H-imidazo[1,5-a]pyrazine-1-
Hz, 2H), 4.85 (br. s., 2H), 5.30 (s, 1H),





carboxamide
6.42 (d, J = 8.4 Hz, 2H), 6.87 (br. s., 1H),






7.02 (d, J = 6.9 Hz, 2H), 7.06 (d, J = 7.9






Hz, 2H), 7.18-7.27 (m, 3H), 7.39 (dd, J =






8.0 Hz, 2.0 Hz, 1H), 7.74 (d, J = 1.7 Hz,






1H), 7.85 (d, J = 8.4 Hz, 1H).




118
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 3.63-3.71
704
NA



benzoyl)-2-[4-[3-hydroxy-3-
(m, 2H), 3.83 (br. s, 2H), 3.86 (d, J = 9.0





(trifluoromethyl)azetidin-1-yl]phenyl]-
Hz, 2H), 4.16 (d, J = 9.0 Hz, 2H), 4.24





3-oxo-6,8-dihydro-5H-imidazo[1,5-
(d, J = 5.5 Hz, 2H), 4.85 (s, 2H), 6.51 (d,





a]pyrazine-1-carboxamide
J = 8.8 Hz, 2H), 6.92-7.07 (m, 3H), 7.11






(m, 3H), 7.18-7.29 (m, 3H), 7.39 (dd, J =






8.1 Hz, 1.8 Hz, 1H), 7.74 (d, J = 1.8 Hz,






1H), 7.85 (d, J = 8.2 Hz, 1H).




 20a
rac-(6R)-7-(4-bromo-3-ethynyl-
(300 MHz, CDCl3) δ 8.77 (t, J = 8.1 Hz
703
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
2H), 7.75-7.60 (m, 2H), 7.58-7.40 (m,

ID, 2*25 cm, 5 μm;



6-methyl-3-oxo-N-[(2-pyrimidin-4-
5H),7.29 (d, J = 2.1 Hz 1H), 7.13 (d, J =

Mobile Phase A: Hex:



ylphenyl)methyl]-6,8-dihydro-5H-
8.7 Hz 2H), 6.90-6.70 (m, 3H), 5.80-4.70

DCM = 1: 1(0.5% 2M



imidazo[1,5-a]pyrazine-1-
(m, 2H), 4.60 (d, J = 17.4 Hz 1H), 4.48-

NH3-MeOH)--HPLC,



carboxamide
4.24 (m, 2H), 3.84 (d, J = 12.3 Hz 1H),

Mobile Phase B: EtOH--




3.76-3.60 (m, 1H), 3.50-3.30 (m, 2H),

HPLC; Flow rate: 16




1.38 (t, J = 12.4 Hz 3H), 0.80-0.50 (m,

mL/min; Gradient: 50%




4H).

B to 50% B in 15 min;






Wave Length: 220/254 nm


 20b
rac-(6S)-7-(4-bromo-3-ethynyl-
(300 MHz, CDCl3) δ 8.77 (t, J = 8.1 Hz
703
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
2H), 7.70-7.60 (m, 2H), 7.60-7.40 (m,

ID, 2*25 cm, 5 μm;



6-methyl-3-oxo-N-[(2-pyrimidin-4-
5H), 7.29 (d, J = 2.1 Hz 1H), 7.13 (d, J =

Mobile Phase A: Hex:



ylphenyl)methyl]-6,8-dihydro-5H-
9.0 Hz 2H), 6.95-6.70 (m, 3H), 5.90-4.70

DCM=1: 1(0.5% 2M



imidazo[1,5-a]pyrazine-1-
(m, 2H), 4.60 (d, J = 19.8 Hz 1H), 4.48-

NH3-MeOH)--HPLC,



carboxamide
4.24 (m, 2H), 3.84 (d, J = 12.9 Hz 1H),

Mobile Phase B: EtOH--




3.75-3.60 (m, 1H), 3.50-3.35 (m, 2H),

HPLC; Flow rate: 16




1.38 (t, J = 6.9 Hz 3H), 0.78-0.50 (m,

mL/min; Gradient: 50%




4H).

B to 50% B in 15 min;






Wave Length: 220/254 nm


119
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 3.37-3.39
688
NA



benzoyl)-2-[4-(2,2-difluoromorpholin-
(m, 2H), 3.62 (t, J = 8.4 Hz, 2H), 3.68-





4-yl)phenyl]-3-oxo-6,8-dihydro-5H-
3.70 (m, 2H), 3.84 (br s, 2H), 4.20-4.22





imidazo[1,5-a]pyrazine-1-
(m, 2H), 4.25 (d, J = 5.4 Hz, 2H), 4.86 (s,





carboxamide
2H), 7.00 (d, J = 9.0 Hz, 2H), 7.03-7.06






(m, 2H), 7.16 (br s, 1 H), 7.17 (d, J = 9.0






Hz, 2H), 7.20-7.26 (m, 3H), 7.40 (dd, J =






7.8, 1.8 Hz, 1H), 7.7




120
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 0.61-0.68
676
NA



benzoyl)-2-[4-(4-oxa-7-
(m, 2H), 0.74-0.81 (m, 2H), 3.14 (s, 2H),





azaspiro[2.5]octan-7-yl)phenyl]-3-
3.21-3.25 (m, 2H), 3.66-3.71 (m, 2H),





oxo-6,8-dihydro-5H-imidazo[1,5-
3.78-3.91 (m, 4H), 4.25 (d, J = 5.3 Hz,





a]pyrazine-1-carboxamide
2H), 4.86 (s, 2H), 6.92 (d, J = 9.0 Hz,






2H), 6.95-7.07 (m, 3H), 7.13 (d, J = 9.0






Hz, 2H), 7.19-7.28 (m, 3H), 7.40 (dd, J =






8.1 Hz, 1.8 Hz, 1H), 7.75 (d, J = 1.8 Hz,






1H), 7.86 (J = 8.1 Hz, 1H).




 21a
rac-(6S)-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.27 (d,
757
SFC column: Lux C3



benzoyl)-6-methyl-2-[4-(4-
J = 6.6 Hz, 3H), 2.80 (br s, 4H), 3.15 (br s,

21.2 mm × 250 mm, 5



methylpiperazin-1-yl)phenyl]-3-oxo-
4H), 3.67 (d, J = 3.3 Hz, 2H), 4.50 (d, J =

μm; isochratic



N-[(2-pyrimidin-2-ylphenyl)methyl]-
5.6 Hz, 2H), 4.52 (br s, 1H), 4.61 (br s,

conditions 25:75



6,8-dihydro-5H-imidazo[1,5-
1H), 5.22 (br s, 1H), 6.71 (d, J = 9.0 Hz,

EtOH:CO2 (0.2% v/v



a]pyrazine-1-carboxamide
2H), 6.98-7.02 (m, 3H), 7.27-7.31 (m,

NH3), 40° C., 50




1H), 7.37-7.43 (m, 4H), 7.73 (d, J= 1.9

mL/min, 125 bar, Wave




Hz, 1H), 7.85 (d, J = 8.2 Hz, 1H), 7.98-

Length: 210 nm




8.01 (m, 1H), 8.78 (d, J = 4.8 Hz, 2H).




 21b
rac-(6R)-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.27 (d,
757
SFC column: Lux C3



benzoyl)-6-methyl-2-[4-(4-
J = 6.6 Hz, 3H), 2.82 (s, 3H), 2.50-2.53

21.2 mm × 250 mm, 5



methylpiperazin-1-yl)phenyl]-3-oxo-
(m, 4H), 3.04-3.08 (m, 4H), 3.67 (d, J =

μm; isochratic



N-[(2-pyrimidin-2-ylphenyl)methyl]-
3.3 Hz, 2H), 4.50 (d, J = 5.6 Hz, 2H), 4.52

conditions 25:75



6,8-dihydro-5H-imidazo[1,5-
(br s, 1H), 4.61 (br s, 1H), 5.22 (br s,

EtOH:CO2 (0.2% v/v



a]pyrazine-1-carboxamide
1H), 6.71 (d, J = 9.0 Hz, 2H), 6.98-7.02

NH3), 40° C., 50




(m, 3H), 7.27-7.31 (m, 1H), 7.37-7.43

mL/min, 125 bar, Wave




(m, 4H), 7.73 (d, J = 1.9 Hz, 1H), 7.85

Length: 210 nm




(d, J = 8.2 Hz, 1H), 7.98-8.01 (m, 1H),






8.78 (d, J = 4.8 Hz, 2H).




121
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.81-1.92
678
NA



benzoyl)-2-[4-(8-oxa-3-
(m, 4H), 2.86 (dd, J = 11.2 Hz, 2.9 Hz,





azabicyclo[3.2.1]octan-3-yl)phenyl]-3-
2H), 3.39 (d, J = 12.0 Hz, 2H), 3.67 (t,





oxo-6,8-dihydro-5H-imidazo[1,5-
J = 5.9 Hz, 2H), 3.83 (s, 2H), 4.24 (d, J =





a]pyrazine-1-carboxamide
5.4 Hz, 2H), 4.45 (s, 2H), 4.85 (s, 2H),






6.83 (d, J = 9.8 Hz, 2H), 6.96 (s, 1H), 7.0






(d, J = 6.3 Hz, 2H), 7.1 (d, J = 8.9 Hz,






2H), 7.18-7.25 (m, 3H), 7.39 (dd, J = 8.0






Hz, 2.1 Hz, 1H), 7.74 (d, J = 1.9 Hz, 1H),






7.85 (d, J = 7.9 Hz, 1H).




 22a
rac-(6R)-7-(4-bromo-3-chloro-
(400 MHz, DMSO-d6) δ 7.87 (d, J = 4.0
715
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
Hz, 1H), 7.78-7.72 (m, 2H), 7.53-7.38

IF, 2*25 cm, 5 μm;



6-methyl-N-[[2-(1-methylpyrazol-3-
(m, 3H), 7.28-7.31 (m, 1H), 7.30-6.94

Mobile Phase A:



yl)phenyl]methyl]-3-oxo-6,8-dihydro-
(m, 6H), 6.49 (s, 1H), 5.48 (s, 1H), 4.48

MTBE(0.5% 2M NH3-



5H-imidazo[1,5-a]pyrazine-1-
(d, J = 4.0 Hz, 4H), 3.84 (s, 3H), 3.78-

MeOH)--HPLC, Mobile



carboxamide
3.75 (m, 1H), 3.65 (s, 2H), 1.24 (s, 3H),

Phase B: EtOH--HPLC;




0.78-0.75 (m, 2H), 0.64 (s, 2H).

Flow rate: 20 mL/min;






Gradient: 20% B to 20%






B in 21 min; Wave






Length: 220/254 nm


 22b
rac-(6S)-7-(4-bromo-3-chloro-
(400 MHz, DMSO-d6) δ 7.87 (d, J = 4.0
715
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
Hz, 1H), 7.78-7.72 (m, 2H), 7.53-7.38

IF, 2*25 cm, 5 μm;



6-methyl-N-[[2-(1-methylpyrazol-3-
(m, 3H), 7.28-7.31 (m, 1H), 7.30-6.94

Mobile Phase A:



yl)phenyl]methyl]-3-oxo-6,8-dihydro-
(m, 6H), 6.49 (s, 1H), 5.48 (s, 1H), 4.48

MTBE(0.5% 2M NH3-



5H-imidazo[1,5-a]pyrazine-1-
(d, J = 4.0 Hz, 4H), 3.84 (s, 3H), 3.78-

MeOH)--HPLC, Mobile



carboxamide
3.75 (m, 1H), 3.65 (s, 2H), 1.24 (s, 3H),

Phase B: EtOH--HPLC;




0.78-0.75 (m, 2H), 0.64 (s, 2H).

Flow rate: 20 mL/min;






Gradient: 20% B to 20%






B in 21 min; Wave






Length: 220/254 nm


 23a
rac-(6R)-N-[[2-(6-amino-2-
(300 MHz, CDCl3) δ 7.70 (d, J = 8.1 Hz
727
Column: CHIRAL ART



pyridyl)phenyl]methyl]-7-(4-bromo-3-
1H), 7.60-7.50 (m, 2H), 7.50-7.30 (m,

Cellulose-SC, 2*25 cm,



chloro-benzoyl)-2-[4-
3H), 7.24-7.04 (m, 4H), 6.90-6.76 (m,

5 μm; Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
2H), 6.70 (d, J = 7.5 Hz 1H), 6.60-6.35

MTBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
(m, 2H), 5.62-4.82 (m, 2H), 4.80-4.55

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
(m, 1H), 4.50-4.30 (m, 2H), 4.00-3.70

Phase B: EtOH--HPLC;




(m, 1H), 3.67 (d, J = 4.2 Hz 1H), 3.53 (d,

Flow rate: 20 mL/min;




J = 3.0 Hz 1H), 1.40 (d, J = 6.9 Hz 3H),

Gradient: 50% B to 50%




0.80-0.50 (m, 4H).

B in 18 min; Wave






Length: 220/254 nm


 23b
rac-(6S)-N-[[2-(6-amino-2-
(300 MHz, CDCl3) δ 7.70 (t, J = 8.4 Hz
727
Column: CHIRAL ART



pyridyl)phenyl]methyl]-7-(4-bromo-3-
1H), 7.60-7.50 (m, 1H), 7.48 (t, J = 7.8

Cellulose-SC, 2*25 cm,



chloro-benzoyl)-2-[4-
Hz 1H), 7.40-7.30 (m, 3H), 7.28-7.18 (m,

5 μm; Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
2H), 7.16-7.05 (m, 2H), 6.82-6.65 (m,

MTBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
3H), 6.60-6.40 (m, 2H), 5.60-4.95 (m,

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
1H), 4.70-4.20 (m, 4H), 3.90-3.60 (m,

Phase B: EtOH--HPLC;




2H), 3.58-3.40 (m, 1H), 1.40 (d, J = 7.5

Flow rate: 20 mL/min;




Hz, 3H), 0.75-0.55 (m, 4H).

Gradient: 50% B to 50%






B in 18 min; Wave






Length: 220/254 nm


 24a
rac-(6R)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 7.72 (d, J = 8.1 Hz,
719
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
1H), 7.68-7.56 (m, 2H), 7.46 (s, 1H),

ID, 2*25 cm, 5 μm;



N-[(2-fluoro-6-pyrazol-1-yl-
7.37 (dt, J = 8.8, 6.4 Hz, 1H), 7.25-7.16

Mobile Phase A: Hex:



phenyl)methyl]-6-methyl-3-oxo-6,8-
(m, 3H), 7.04 (d, J = 8.0 Hz, 1H), 6.87 (d,

DCM = 3: 1(0.5% 2M



dihydro-5H-imidazo[1,5-a]pyrazine-1-
J = 8.4 Hz, 2H), 6.49 (t, J = 5.9 Hz, 1H),

NH3-MeOH)--HPLC,



carboxamide
6.42 (d, J = 2.1 Hz, 1H), 5.27 (s, 2H),

Mobile Phase B: EtOH--




4.65 (d, J = 18.9 Hz, 1H), 4.44 (dd, J =

HPLC; Flow rate: 20




13.7, 6.2 Hz, 1H), 4.23 (d, J = 13.2 Hz,

mL/min; Gradient: 50%




1H), 3.87 (d, J = 12.8 Hz, 1H), 3.71 (d,

B to 50% B in 20 min;




J = 12.8 Hz, 1H), 3.57 (d, J = 6.1 Hz, 1H),

Wave Length: 254/220




1.41 (d, J = 7.0 Hz, 3H), 0.73 (t, J = 6.0

nm




Hz, 2H), 0.68-0.52 (m, 2H).




 24b
rac-(6S)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 7.72 (d, J = 8.1 Hz,
719
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
1H), 7.64 (d, J = 2.4 Hz, 1H), 7.59 (d, J =

ID, 2*25 cm, 5 μm;



N-[(2-fluoro-6-pyrazol-1-yl-
2.0 Hz, 1H), 7.46 (s, 1H), 7.41-7.32 (m,

Mobile Phase A: Hex:



phenyl)methyl]-6-methyl-3-oxo-6,8-
1H), 7.25-7.17 (m, 3H), 7.16-7.08 (m,

DCM = 3: 1(0.5% 2M



dihydro-5H-imidazo[1,5-a]pyrazine-1-
1H), 7.04 (d, J = 8.0 Hz, 1H), 6.87 (d, J =

NH3-MeOH)--HPLC,



carboxamide
8.8 Hz, 2H), 6.49 (t, J = 6.0 Hz, 1H), 6.42

Mobile Phase B: EtOH--




(t, J = 2.2 Hz, 1H), 5.20 (s, 2H), 4.65 (d,

HPLC; Flow rate: 20




J = 18.8 Hz, 1H), 4.44 (dd, J = 14.0, 6.3

mL/min; Gradient: 50%




Hz, 1H), 4.23 (dd, J = 13.7, 5.3 Hz, 1H),

B to 50% B in 20 min;




3.87 (d, J = 12.9 Hz, 1H), 3.71 (d, J =

Wave Length: 254/220




10.3 Hz, 1H), 3.60-3.52 (m, 1H), 1.41 (d,

nm




J = 7.0 Hz, 3H), 0.85-0.55 (m, 4H).




 25a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 7.91-7.74 (m, 2H),
753
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
7.64 (s, 1H), 7.57-7.42 (m, 2H), 7.37 (td,

ID, 2*25 cm, 5 μm;



(cyclopropoxy)phenyl]-N-[(2-fluoro-
J = 8.7, 8.2, 6.0 Hz, 1H), 7.24-7.15 (m,

Mobile Phase A: Hex:



6-pyrazol-1-yl-phenyl)methyl]-6-
2H), 7.12 (t, J = 8.6 Hz, 1H), 7.04 (d, J =

DCM = 3: 1(0.5% 2M



methyl-3-oxo-6,8-dihydro-5H-
8.0 Hz, 1H), 6.87 (d, J = 8.3 Hz, 2H),

NH3-MeOH)--HPLC,



imidazo[1,5-a]pyrazine-1-
6.56-6.35 (m, 2H), 5.26 (s, 2H), 4.68 (d,

Mobile Phase B: EtOH--



carboxamide
J = 18.8 Hz, 1H), 4.43 (d, J = 14.7 Hz,

HPLC; Flow rate: 20




1H), 4.28-4.16 (m, 1H), 3.88 (d, J = 12.8

mL/min; Gradient: 50%




Hz, 1H), 3.73 (d, J = 12.0 Hz, 1H), 3.57 (d,

B to 50% B in 25 min;




J = 7.5 Hz, 1H), 1.43 (d, J = 7.0

Wave Length: 254/220




Hz, 3H), 0.87-0.49 (m, 4H).

nm


 25b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 7.99-7.76 (m, 2H),
753
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
7.64 (d, J = 2.6 Hz, 1H), 7.55-7.42 (m,

ID, 2*25 cm, 5 μm;



(cyclopropoxy)phenyl]-N-[(2-fluoro-
2H), 7.36 (td, J = 8.2, 5.8 Hz, 1H), 7.18

Mobile Phase A: Hex:



6-pyrazol-1-yl-phenyl)methyl]-6-
(d, J = 2.0 Hz, 2H), 7.16-6.99 (m, 2H),

DCM = 3: 1(0.5% 2M



methyl-3-oxo-6,8-dihydro-5H-
6.87 (d, J = 9.2 Hz, 2H), 6.50 (s, 1H),

NH3-MeOH)--HPLC,



imidazo[1,5-a]pyrazine-1-
6.47-6.38 (m, 1H), 5.29 (s, 2H), 4.68 (d,

Mobile Phase B: EtOH--



carboxamide
J = 18.7 Hz, 1H), 4.42 (s, 1H), 4.23 (d, J =

HPLC; Flow rate: 20




14.3 Hz, 1H), 3.88 (d, J = 12.6 Hz, 1H),

mL/min; Gradient: 50%




3.74 (s, 1H), 3.56 (dd, J = 7.5, 4.6 Hz,

B to 50% B in 25 min;




1H), 1.43 (d, J = 6.6 Hz, 3H), 0.82-0.52

Wave Length: 254/220




(m, 4H).

nm


 26a
rac-(6R)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 8.10-8.00 (m, 1H),
742
Column: CHIRALPAK



benzoyl)-2[4-(cyclopropoxy)phenyl]-
8.00-7.89 (m, 1H), 7.70 (d, J = 8.4 Hz,

ID, 2*25 cm, 5 μm;



6-methyl-N-[[2-[4-
1H), 7.57 (d, J = 2.1 Hz, 1H), 7.42-7.31

Mobile Phase A: Hex:



(methylamino)pyrimidin-2-
(m, 3H), 7.21-7.18 (m, 1H), 7.18-7.10

DCM = 3: 1(0.5% 2M



yl]phenyl]methyl]-3-oxo-6,8-dihydro-
(m, 1H), 7.04 (d, J = 9.0 Hz, 2H), 6.72 (d,

NH3-MeOH)--HPLC,



5H-imidazo[1,5-a]pyrazine-1-
J = 9.0 Hz, 2H), 6.20 (d, J = 6.0 Hz, 1H),

Mobile Phase B: EtOH--



carboxamide
5.55-5.25 (m, 1H), 5.18-4.89 (m, 1H),

HPLC; Flow rate: 20




4.75-4.23 (m, 3H), 3.83 (d, J = 12.6 Hz,

mL/min; Gradient: 50%




1H), 3.75-3.60 (m, 1H), 3.58-3.41 (m,

B to 50% B in 13 min;




1H), 2.96 (d, J = 5.1 Hz, 3H), 1.38 (d, J =

Wave Length: 254/220




6.9 Hz, 3H), 0.79-0.51 (m, 4H).

nm


 26b
(4rac-(6S)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 8.11-8.00 (m, 1H),
742
Column: CHIRALPAK



benzoyl)-2[4-(cyclopropoxy)phenyl]-
8.00-7.90 (m, 1H), 7.71 (d, J = 8.1 Hz,

ID, 2*25 cm, 5 μm;



6-methyl-N-[[2-[4-
1H), 7.57 (d, J = 1.8 Hz, 1H), 7.45-7.31

Mobile Phase A: Hex:



(methylamino)pyrimidin-2-
(m, 3H), 7.21-7.18 (m, 1H), 7.18-7.10

DCM = 3: 1(0.5% 2M



yl]phenyl]methyl]-3-oxo-6,8-dihydro-
(m, 1H), 7.05 (d, J = 9.0 Hz, 2H), 6.72 (d,

NH3-MeOH)--HPLC,



5H-imidazo[1,5-a]pyrazine-1-
J = 8.7 Hz, 2H), 6.20 (d, J = 5.7 Hz, 1H),

Mobile Phase B: EtOH--



carboxamide
5.50-5.18 (m, 1H), 5.12-4.91 (m, 1H),

HPLC; Flow rate: 20




4.72-4.30 (m, 3H), 3.83 (d, J = 12.6 Hz,

mL/min; Gradient: 50%




1H), 3.76-3.60 (m, 1H), 3.59-3.43 (m,

B to 50% B in 13 min;




1H), 2.96 (d, J = 5.1 Hz, 3H), 1.38 (d, J =

Wave Length: 254/220




6.9 Hz, 3H), 0.79-0.55 (m, 4H).

nm


122
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 2.79-2.81
733
NA



benzoyl)-3-oxo-2-[4-[4-(2,2,2-
(m, 4H), 3.19-3.21 (m, 4H), 3.24 (q, J =





trifluoroethyl)piperazin-1-yl]phenyl]-
10.2 Hz, 2H), 3.68-3.70 (m, 2H), 3.84 (br





6,8-dihydro-5H-imidazo[1,5-
s, 2H), 4.25 (d, J = 5.4 Hz, 2H), 4.86 (s,





a]pyrazine-1-carboxamide
2H), 6.94 (d, J = 9.0 Hz, 2H), 7.02-7.04






(m, 2H), 7.12 (d, J = 9.0 Hz, 2H), 7.21-






7.26 (m, 3H), 7.40 (dd, J = 7.8, 1.8 Hz,






1H), 7.75 (d, J = 1.8 Hz, 1H), 7.86 (d, J =






7.8 Hz, 1H).




123
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 3.71 (m,
620
NA



benzoyl)-2-(1-methylbenzimidazol-5-
2H), 3.85 (br. s., 2H), 3.87 (s, 3H), 4.19





yl)-3-oxo-6,8-dihydro-5H-
(d, J = 5.4 Hz, 2H), 4.88 (s, 2H), 6.92 (d,





imidazo[1,5-a]pyrazine-1-
J = 7.0 Hz, 2H), 7.04-7.19 (m, 5H), 7.41





carboxamide
(dd, J = 8.6 Hz, 1.6 Hz, 1H), 7.55 (d, J =






8.6 Hz, 1H), 7.59 (d, J = 1.6 Hz, 1H),






7.76 (d, J = 1.8 Hz, 1H), 7.86 (d, J = 8.3






Hz, 1H), 8.21 (s, 1H).




124
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 3.71 (m,
620
NA



benzoyl)-2-(3-methylbenzimidazol-5-
2H), 3.77 (s, 3H), 3.88 (br. s., 2H), 4.20





yl)-3-oxo-6,8-dihydro-5H-
(d, J = 5.5 Hz, 2H), 4.90 (s, 2H), 6.91 (d,





imidazo[1,5-a]pyrazine-1-
J = 7.2 Hz, 2H), 7.04 (br. s., 1H), 7.07-





carboxamide
7.19 (m, 4H), 7.41 (dd, J = 8.3 Hz, 1.9






Hz, 1H), 7.49 (d, J = 1.8 Hz, 1H), 7.66






(d, J = 8.5 Hz, 1H), 7.76 (d, J = 1.8 Hz,






1H), 7.86 (d, J = 8.1 Hz, 1H), 8.20 (s,






1H)




125a
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.67-1.75
676
SFC column: Lux C3 20



benzoyl)-3-oxo-2-[4-[rac-(1S,4S)-2-
(m, 1H), 1.89-1.99 (m, 2H), 2.03-2.10

mm × 250 mm, 5 μm;



oxa-5-azabicyclo[2.2.2]octan-5-
(m, 1H), 3.34 (d, J = 10.1 Hz, 1H), 3.64-

isochratic conditions



yl]phenyl]-6,8-dihydro-5H-
3.71 (m, 3H), 3.84 (br. s, 2H), 3.91-4.05

20:80 EtOH:CO2 (0.2%



imidazo[1,5-a]pyrazine-1-
(m, 4H), 4.24 (d, J = 5.5 Hz, 2H), 4.87 (s,

v/v NH3), 40° C., 50



carboxamide
2H), 6.66 (d, J = 9.0 Hz, 2H), 6.78 (br. s,

mL/min, 100 bar, Wave




1H), 7.01 (d, J = 7.0 Hz, 2H), 7.09 (d, J =

Length: 210 nm




9.0 Hz, 2H), 7.14-7.28 (m, 3H), 7.40 (dd,






J = 8.1 Hz, 2.0 Hz, 1H), 7.74 (d, J = 2.0






Hz, 1H), 7.85 (d, J = 8.1 Hz, 1H).




125b
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 1.67-1.76
676
SFC column: Lux C3 20



benzoyl)-3-oxo-2-[4-[rac-(1R,4R)-2-
(m, 1H), 1.88-1.99 (m, 2H), 2.02-2.14

mm × 250 mm, 5 μm;



oxa-5-azabicyclo[2.2.2]octan-5-
(m, 1H), 3.33 (d, J = 10.1 Hz, 1H), 3.63-

isochratic conditions



yl]phenyl]-6,8-dihydro-5H-
3.72 (m, 3H), 3.83 (br. s, 2H), 3.92-4.03

20:80 EtOH:CO2 (0.2%



imidazo[1,5-a]pyrazine-1-
(m, 4H), 4.24 (d, J = 5.5 Hz, 2H), 4.86 (s,

v/v NH3), 40° C., 50



carboxamide
2H), 6.66 (d, J = 9.0 Hz, 2H), 6.78 (br. s,

mL/min, 100 bar, Wave




1H), 7.01 (d, J = 7.0 Hz, 2H), 7.09 (d, J =

Length: 210 nm




9.0 Hz, 2H), 7.17-7.27 (m, 3H), 7.40 (dd,






J = 8.1 Hz, 2.0 Hz, 1H), 7.74 (d, J = 2.0






Hz, 1H), 7.86 (d, J = 8.1 Hz, 1H).




 27a
rac-(6R)-N-[[2-(6-amino-2-
(300 MHz, CDCl3) δ 7.80 (t, J = 6.9 Hz
761
Column: CHIRALPAK



pyridyl)phenyl]methyl]-7-[4-bromo-3-
2H), 7.54 (t, J = 12.9 Hz 1H), 7.50-7.40

ID, 2*25 cm, 5 μm;



(trifluoromethyl)benzoyl]-2-[4-
(m, 1H), 7.40-7.30 (m, 3H), 7.25-7.10

Mobile Phase A: Hex:



(cyclopropoxy)phenyl]-6-methyl-3-
(m, 3H), 6.84 (t, J = 13.9 Hz 2H), 6.70 (t,

DCM = 3: 1(0.5% 2M



oxo-6,8-dihydro-5H-imidazo[1,5-
J = 11.7 Hz 2H), 6.51 (d, J = 6.9 Hz 1H),

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
5.70-4.92 (m, 2H), 4.70 (d, J = 18.0 Hz

Mobile Phase B: EtOH--




2H), 4.50-4.38 (m, 1H), 4.38-4.20 (m,

HPLC; Flow rate: 20




1H), 3.86 (d, J = 12.3 Hz 1H), 3.73 (t, J =

mL/min; Gradient: 20%




6.5 Hz 1H), 3.54 (s, 1H), 1.42 (d, J = 6.9

B to 20% B in 17 min;




Hz 3H), 0.80-0.65 (m, 2H), 0.62 (s, 2H).

Wave Length: 220/254






nm


 27b
rac-(6S)-N-[[2-(6-amino-2-
(300 MHz, CDCl3) δ 7.80 (d, J = 10.5 Hz
761
Column: CHIRALPAK



pyridyl)phenyl]methyl]-7-[4-bromo-3-
2H), 7.55-7.42 (m, 2H), 7.40-7.28 (m,

ID, 2*25 cm, 5 μm;



(trifluoromethyl)benzoyl]-2-[4-
3H), 7.25-7.18 (m, 1H), 7.11 (d, J = 8.7

Mobile Phase A: Hex:



(cyclopropoxy)phenyl]-6-methyl-3-
Hz 2H), 6.88-6.62 (m, 3H), 6.52-6.32 (m,

DCM = 3: 1(0.5% 2M



oxo-6,8-dihydro-5H-imidazo[1,5-
2H), 6.40-4.80 (m, 2H), 4.70-4.22 (m,

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
4H), 3.88 (t, J = 11.3 Hz 1H), 3.69 (t, J =

Mobile Phase B: EtOH--




6.5 Hz 1H), 3.51 (t, J = 4.2 Hz 1H), 1.50-

HPLC; Flow rate: 20




1.30 (m, 3H), 0.75-0.50 (m, 4H).

mL/min; Gradient: 20%






B to 20% B in 17 min;






Wave Length: 220/254






nm


 28a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.10-7.99 (m, 1H),
776
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
7.99-7.88 (m, 1H), 7.88-7.72 (m, 2H),

ID, 2*25 cm, 5 μm;



(cyclopropoxy)phenyl]-6-methyl-N-
7.52-7.43 (m, 1H), 7.42-7.30 (m, 3H),

Mobile Phase A: Hex:



[[2-[4-(methylamino)pyrimidin-2-
7.20-7.10 (m, 1H), 7.05 (d, J = 8.7 Hz,

DCM = 3: 1(0.5% 2M



yl]phenyl]methyl]-3-oxo-6,8-dihydro-
2H), 6.73 (d, J = 8.7 Hz, 2H), 6.20 (d, J =

NH3-MeOH)--HPLC,



5H-imidazo[1,5-a]pyrazine-1-
6.0 Hz, 1H), 5.62-5.22 (m, 1H), 5.22-

Mobile Phase B: IPA--



carboxamide
4.85 (m, 1H), 4.65 (d, J = 18.6 Hz, 1H),

HPLC; Flow rate: 20




4.59-4.31 (m, 2H), 3.84 (d, J = 12.3 Hz,

mL/min; Gradient: 20%




1H), 3.79-3.60 (m, 1H), 3.60-3.41 (m,

B to 20% B in 19 min;




1H), 2.96 (d, J = 5.1 Hz, 3H), 1.40 (d, J =

Wave Length: 254/220




6.9 Hz, 3H), 0.80-0.66 (m, 2H), 0.66-

nm




0.50 (m, 2H).




 28b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.09-7.98 (m, 1H),
776
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
7.98-7.86 (m, 1H), 7.86-7.73 (m, 2H),

ID, 2*25 cm, 5 μm;



(cyclopropoxy)phenyl]-6-methyl-N-
7.55-7.41 (m, 1H), 7.41-7.30 (m, 3H),

Mobile Phase A: Hex:



[[2-[4-(methylamino)pyrimidin-2-
7.21-7.10 (m, 1H), 7.05 (d, J = 8.7 Hz,

DCM = 3: 1(0.5% 2M



yl]phenyl]methyl]-3-oxo-6,8-dihydro-
2H), 6.72 (d, J = 8.7 Hz, 2H), 6.19 (d, J =

NH3-MeOH)--HPLC,



5H-imidazo[1,5-a]pyrazine-1-
6.0 Hz, 1H), 5.68-5.15 (m, 1H), 5.15-

Mobile Phase B: IPA--



carboxamide
4.85 (m, 1H), 4.65 (d, J = 18.0 Hz, 1H),

HPLC; Flow rate: 20




4.59-4.30 (m, 2H), 3.84 (d, J = 12.3 Hz,

mL/min; Gradient: 20%




1H), 3.78-3.60 (m, 1H), 3.55-3.41 (m,

B to 20% B in 19 min;




1H), 2.96 (d, J = 4.8 Hz, 3H), 1.40 (d, J =

Wave Length: 254/220 nm




6.9 Hz, 3H), 0.80-0.65 (m, 2H), 0.65-






0.51 (m, 2H).




 29a
rac-(6R)-N-[[2-(4-aminopyrimidin-2-
(400 MHz, CDCl3) δ 7.99-7.95 (m, 2H),
762
Column: CHIRALPAK



yl)phenyl]methyl]-7-[4-bromo-3-
7.81 (d, J = 4.0 Hz, 2H), 7.52-7.31 (m,

IE, 2*25 cm, 5 μm;



(trifluoromethyl)benzoyl]-2-[4-
4H), 7.10 (d, J = 4.0 Hz, 2H), 6.99-6.84

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
(m, 4H), 5.33 (s, 2H), 4.66-4.45 (m, 3H),

MTBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
3.84 (d, J = 6.0 Hz, 1H), 3.70 (d, J = 4.0

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
Hz, 1H), 3.58 (s, 1H), 1.40 (d, J = 4.0 Hz,

Phase B: EtOH--HPLC;




3H), 0.75-0.66 (m, 4H).

Flow rate: 20 mL/min;






Gradient: 80% B to 80%






B in 12 min; Wave






Length: 220/254 nm


 29b
rac-(6S)-N-[[2-(4-aminopyrimidin-2-
(400 MHz, CDCl3) δ 7.99-7.95 (m, 2H),
762
Column: CHIRALPAK



yl)phenyl]methyl]-7-[4-bromo-3-
7.81 (d, J = 4.0 Hz, 2H), 7.52-7.31 (m,

IE, 2*25 cm, 5 μm;



(trifluoromethyl)benzoyl]-2-[4-
4H), 7.10 (d, J = 4.0 Hz, 2H), 6.82 (s,

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
3H), 6.54 (s, 1H), 5.33 (s, 2H), 4.67-4.62

MTBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
(m, 1H), 4.46 (s, 2H), 3.84 (d, J = 6.0 Hz,

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
1H), 3.70 (d, J = 4.0 Hz, 2H), 1.40 (d, J =

Phase B: EtOH--HPLC;




4.0 Hz, 3H), 0.75-0.66 (m, 4H).

Flow rate: 20 mL/min;






Gradient: 80% B to 80%






B in 12 min; Wave






Length: 220/254 nm


 30a
rac-(6R)-N-[[2-(4-aminopyrimidin-2-
(400 MHz, CDCl3) δ 7.99-7.96 (m, 2H),
726
Column: CHIRALPAK



yl)phenyl]methyl]-7-(4-bromo-3-
7.72-7.69 (m, 1H), 7.57-7.52 (m, 1H),

ID, 2*25 cm, 5 n;



chloro-benzoyl)-2-[4-
7.41-7.36 (m, 3H), 7.19 (d, J = 2.0 Hz,

Mobile Phase A: Hex:



(cyclopropoxy)phenyl]-6-methyl-3-
1H), 7.07 (d, J = 4.0 Hz, 2H), 6.95 (s,

DCM = 3: 1(0.5% 2M



oxo-6,8-dihydro-5H-imidazo[1,5-
1H), 6.76 (d, J = 4.0 Hz, 2H), 6.39 (s,

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
1H), 5.38-5.18 (m, 3H), 4.63 (d, J = 6.0

Mobile Phase B: EtOH--




Hz, 1H), 4.52-4.47 (m, 2H), 3.83 (d, J =

HPLC; Flow rate: 16




6.0 Hz, 1H), 3.68 (d, J = 4.0 Hz, 1H),

mL/min; Gradient: 50%




3.53 (s, 1H), 1.38 (d, J = 4.0 Hz, 3H),

B to 50% B in 17 min;




0.77-0.60 (m, 4H).

Wave Length: 220/254






nm


 30b
rac-(6S)-N-[[2-(4-aminopyrimidin-2-
(400 MHz, CDCl3) δ 7.99-7.96 (m, 2H),
726
Column: CHIRALPAK



yl)phenyl]methyl]-7-(4-bromo-3-
7.72-7.69 (m, 1H), 7.57-7.52 (m, 1H),

ID, 2*25 cm, 5 μm;



chloro-benzoyl)-2-[4-
7.41-7.36 (m, 3H), 7.19 (d, J = 2.0 Hz,

Mobile Phase A: Hex:



(cyclopropoxy)phenyl]-6-methyl-3-
1H), 7.07 (d, J = 4.0 Hz, 2H), 6.95 (s,

DCM = 3: 1(0.5% 2M



oxo-6,8-dihydro-5H-imidazo[1,5-
1H), 6.76 (d, J = 4.0 Hz, 2H), 6.39 (s,

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
1H), 5.38-5.18 (m, 3H), 4.63 (d, J = 6.0

Mobile Phase B: EtOH--




Hz, 1H), 4.52-4.47 (m, 2H), 3.83 (d, J =

HPLC; Flow rate: 16




6.0 Hz, 1H), 3.68 (d, J = 4.0 Hz, 1H),

mL/min; Gradient: 50%




3.53 (s, 1H), 1.38 (d, J = 4.0 Hz, 3H),

B to 50% B in 17 min;




0.77-0.60 (m, 4H).

Wave Length: 220/254






nm


 31a
rac-(6R)-N-[[2-(4-aminopyrimidin-2-
(400 MHz, CDCl3) δ 8.07 (d, J = 4.0 Hz,
746
Column: CHIRALPAK



yl)-6-fluoro-phenyl]methyl]-7-(4-
1H), 7.74-7.69 (m, 2H), 7.58 (d, J = 2.0

ID, 2*25 cm, 5 μm;



bromo-3-chloro-benzoyl)-2-[4-
Hz, 1H), 7.36-7.33 (m, 1H), 7.26-7.19(m,

Mobile Phase A: Hex:



(cyclopropoxy)phenyl]-6-methyl-3-
1H), 7.15-7.06 (m, 3H), 6.69-6.62 (m,

DCM = 3: 1(0.5% 2M



oxo-6,8-dihydro-5H-imidazo[1,5-
3H), 6.33 (d, J = 2.0 Hz, 1H), 5.10-5.90

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
(m, 2H), 4.98 (s, 2H), 4.69(d, J = 2.0 Hz,

Mobile Phase B: EtOH--




2H), 4.47 (d, J = 6.0 Hz, 1H), 3.85 (d, J =

HPLC; Flow rate: 20




6.0 Hz, 1H), 3.69 (d, J = 4.0 Hz, 1H),

mL/min; Gradient: 20%




3.49-3.46 (m, 1H), 1.39 (d, J = 4.0 Hz,

B to 20% B in 20 min;




3H), 0.73-0.70 (m, 2H), 0.69-0.56 (m,

Wave Length: 220/254




2H).

nm


 31b
rac-(6S)-N-[[2-(4-aminopyrimidin-2-
(400 MHz, CDCl3) δ 8.07 (d, J = 2.0 Hz,
746
Column: CHIRALPAK



yl)-6-fluoro-phenyl]methyl]-7-(4-
1H), 7.75-7.70 (m, 2H), 7.57 (d, J = 2.0

ID, 2*25 cm, 5 μm;



bromo-3-chloro-benzoyl)-2-[4-
Hz, 1H), 7.37-7.32 (m, 1H), 7.22-7.19

Mobile Phase A: Hex:



(cyclopropoxy)phenyl]-6-methyl-3-
(m, 1H), 7.15-7.06 (m, 3H), 6.69-6.62

DCM = 3: 1(0.5% 2M



oxo-6,8-dihydro-5H-imidazo[1,5-
(m, 3H), 6.33 (d, J = 4.0 Hz, 1H), 5.93-

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
5.10 (m, 2H), 4.97 (s, 2H), 4.69 (d, J =

Mobile Phase B: EtOH--




4.0 Hz, 2H), 4.48 (d, J = 6.0 Hz, 1H),

HPLC; Flow rate: 20




3.86(d, J = 6.0 Hz, 1H), 3.69 (d, J = 4.0

mL/min; Gradient: 20%




Hz, 1H), 3.49-3.46 (m, 1H), 1.39 (d, J =

B to 20% B in 20 min;




4.0 Hz, 3H), 0.69-0.63 (m, 2H), 0.60-

Wave Length: 220/254




0.56 (m, 2H).

nm


 32a
rac-(6R)-N-[[2-(4-aminopyrimidin-2-
(400 MHz, CDCl3) δ 8.05 (d, J = 4.0 Hz,
780
Column: CHIRALPAK



yl)-6-fluoro-phenyl]methyl]-7-[4-
1H), 7.82 (d, J = 6.0 Hz, 2H), 7.74 (d, J =

IE, 2*25 cm, 5 μm;



bromo-3-(trifluoromethyl)benzoyl]-2-
4.0 Hz, 1H), 7.49-7.45 (m, 1H),

Mobile Phase A:



[4-(cyclopropoxy)phenyl]-6-methyl-3-
7.32(m, 1H), 7.25-6.90 (m, 3H), 6.74 (d,

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
J = 4.0 Hz, 3H), 6.33 (d, J = 4.0 Hz, 1H),

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
5.80-5.17 (m, 2H), 4.96 (s, 2H), 4.70-

Phase B: EtOH--HPLC;




4.67(m, 2H), 4.46 (d, J = 6.0 Hz, 1H),

Flow rate: 20 mL/min;




3.86 (d, J = 6.0 Hz, 1H), 3.70 (d, J = 4.0

Gradient: 20% B to 20%




Hz, 1H), 3.48-3.45 (m, 1H), 1.41 (d, J =

B in 13.5 min; Wave




4.0 Hz, 3H), 0.74-0.70 (m, 2H), 0.69-

Length: 220/254 nm




0.55 (m, 2H).




 32b
rac-(6S)-N-[[2-(4-aminopyrimidin-2-
(400 MHz, CDCl3) δ 8.05 (d, J = 4.0 Hz,
780
Column: CHIRALPAK



yl)-6-fluoro-phenyl]methyl]-7-[4-
1H), 7.82 (d, J = 6.0 Hz, 2H), 7.74 (d, J =

IE, 2*25 cm, 5 μm;



bromo-3-(trifluoromethyl)benzoyl]-2-
4.0 Hz, 1H), 7.52-7.45 (m, 1H), 7.37-

Mobile Phase A:



[4-(cyclopropoxy)phenyl]-6-methyl-3-
7.32(m, 1H), 7.15-7.05 (m, 3H), 6.68 (d,

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
J = 4.0 Hz, 3H), 6.33 (d, J = 4.0 Hz, 1H),

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
5.79-5.18 (m, 2H), 4.96 (s, 2H), 4.86-

Phase B: EtOH--HPLC;




4.67 (m, 2H), 4.46 (d, J = 6.0 Hz, 1H),

Flow rate: 20 mL/min;




3.86 (d, J = 6.0 Hz, 1H), 3.71 (d, J = 6.0

Gradient: 20% B to 20%




Hz, 1H), 3.48-3.45 (m, 1H), 1.41 (d, J =

B in 13.5 min; Wave




4.0 Hz, 3H), 0.73-0.69 (m, 2H), 0.67-

Length: 220/254 nm




0.55 (m, 2H).




 33a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 7.81 (d, J = 7.5 Hz
769
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
2H), 7.64 (d, J = 7.8 Hz 1H), 7.50-7.39

IF, 2*25 cm, 5 μm



(cyclopropoxy)phenyl]-N-[[2-fluoro-
(m, 2H), 7.25 (s, 1H), 7.02 (d, J = 9.0 Hz

Mobile Phase A: Hex:



6-(5-methyl-1,3,4-oxadiazol-2-
2H), 6.74 (t, J = 9.0 Hz 2H), 6.60 (d, J =

DCM = 3: 1(0.5% 2M



yl)phenyl]methyl]-6-methyl-3-oxo-
5.4 Hz 1H), 5.68-4.90 (m, 2H), 4.90-4.78

NH3-MeOH)--HPLC,



6,8-dihydro-5H-imidazo[1,5-
(m, 1H), 4.75-4.55 (m, 2H), 3.84 (d, J =

Mobile Phase B: EtOH--



a]pyrazine-1-carboxamide
12.9 Hz 1H), 3.72-3.50 (m, 2H), 2.63 (s,

HPLC; Flow rate: 20




3H), 1.38 (d, J = 7.2 Hz 3H), 0.80-0.70

mL/min; Gradient: 30%




(m, 4H).

B to 30% B in 16 min;






Wave Length: 220/254






nm


 33b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 7.81 (d, J = 7.5 Hz
769
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
2H), 7.64 (d, J = 7.8 Hz 1H), 7.50-7.32

IF, 2*25 cm, 5 μm



(cyclopropoxy)phenyl]-N-[[2-fluoro-
(m, 2H), 7.25 (s, 1H), 7.03 (d, J = 9.0 Hz

Mobile Phase A: Hex:



6-(5-methyl-1,3,4-oxadiazol-2-
2H), 6.80-6.52 (m, 3H), 5.82-4.90 (m,

DCM = 3: 1(0.5% 2M



yl)phenyl]methyl]-6-methyl-3-oxo-
2H), 4.90-4.75 (m, 1H), 4.72-4.52 (m,

NH3-MeOH)--HPLC,



6,8-dihydro-5H-imidazo[1,5-
2H), 3.90-3.52 (m, 3H), 2.63 (s, 3H),

Mobile Phase B: EtOH--



a]pyrazine-1-carboxamide
1.38 (d, J = 6.9 Hz 3H), 0.80-0.69 (m,

HPLC; Flow rate: 20




4H).

mL/min; Gradient: 30%






B to 30% B in 16 min;






Wave Length: 220/254






nm


 34a
rac-(6R)-7-[4-bromo-3-
(DMSO-d6, 600 MHz, 80° C.) δ 0.57-
746
NA



(trifluoromethyl)benzoyl]-2-[4-
0.63 (m, 2H), 0.74-0.79 (m, 2H), 1.28





(cyclopropoxy)phenyl]-6-methyl-3-
(d, J = 6.8 Hz, 3H), 3.64-3.72 (m, 2H),





oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
3.74-3.79 (m, 1H), 4.30 (d, J = 6.0 Hz,





6,8-dihydro-5H-imidazo[1,5-
2H), 4.47-4.69 (m, 2H), 5.19 (br. s., 1H),





a]pyrazine-1-carboxamide
6.95-7.00 (m, 2H), 7.12-7.19 (m, 3H),






7.21 (d, J = 7.2 Hz, 1H), 7.30-7.39 (m,






3H), 7.41 (dd, J = 7.8 Hz, 1.7 Hz, 1H),






7.50 (d, J = 7.9 Hz, 1H), 7.69 (dd, J = 8.2






Hz, 1.8 Hz, 1H), 7.86 (td, J = 7.7 Hz, 1.9






Hz, 1H), 7.91 (d, J = 1.6 Hz, 1H), 7.95 (d,






J = 8.0 Hz, 1H), 8.49 (d, J = 5.0 Hz, 1H).




 35a
rac-(6R)-N-[[2-(6-amino-2-pyridyl)-6-
(400 MHz, CDCl3) δ 7.72-7.70 (m, 1H),
745
Column: CHIRALPAK



fluoro-phenyl]methyl]-7-(4-bromo-3-
7.58 (d, J = 2.0 Hz, 1H), 7.49-7.45 (m,

IE, 2*25 cm, 5 μm;



chloro-benzoyl)-2-[4-
1H), 7.33-7.28 (m, 1H), 7.20-7.21 (m,

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
1H), 7.19-7.11 (m, 3H), 7.07-7.03 (m,

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
1H), 6.74-6.68 (m, 3H), 6.46 (d, J = 4.0

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
Hz, 1H), 6.14 (s, 1H), 5.80-4.85 (m, 2H),

Phase B: EtOH--HPLC;




4.68-4.26 (m, 5H), 3.86 (d, J = 6.0 Hz,

Flow rate: 20 mL/min;




1H), 3.70 (d, J = 4.0 Hz, 1H), 3.50 (d, J =

Gradient: 30% B to 30%




2.0 Hz, 1H), 1.40 (d, J = 4.0 Hz, 3H),

B in 11 min; Wave




0.72-0.62 (m, 2H), 0.59-0.53 (m, 2H).

Length: 220/254 nm


 35b
rac-(6S)-N-[[2-(6-amino-2-pyridyl)-6-
(400 MHz, CDCl3) δ 7.72-7.70 (m, 1H),
745
Column: CHIRALPAK



fluoro-phenyl]methyl]-7-(4-bromo-3-
7.57 (d, J = 2.0 Hz, 1H), 7.50-7.46 (m,

IE, 2*25 cm, 5 μm;



chloro-benzoyl)-2-[4-
1H), 7.34-7.28 (m, 1H), 7.21-7.19 (m,

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
1H), 7.17-7.11 (m, 3H), 7.08-7.03 (m,

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
1H), 6.75-6.69 (m, 3H), 6.46 (d, J = 4.0

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
Hz, 1H), 6.14 (s, 1H), 5.80-4.85 (m, 2H),

Phase B: EtOH--HPLC;




4.68-4.26 (m, 5H), 3.85 (d, J = 6.0 Hz,

Flow rate: 20 mL/min;




1H), 3.70 (d, J = 4.0 Hz, 1H), 3.49 (s,

Gradient: 30% B to 30%




1H), 1.40 (d, J = 4.0 Hz, 3H), 0.72-0.66

B in 11 min; Wave




(m, 2H), 0.65-0.53 (m, 2H).

Length: 220/254 nm


 36a
rac-(6R)-N-[[2-(6-amino-2-pyridyl)-6-
(400 MHz, CDCl3) δ 7.81 (d, J = 4.0 Hz,
779
Column: CHIRALPAK



fluoro-phenyl]methyl]-7-[4-bromo-3-
2H), 7.52-7.45 (m, 2H), 7.33-7.28 (m,

IE, 2*25 cm, 5 μm;



(trifluoromethyl)benzoyl]-2-[4-
1H), 7.16-7.11 (m, 3H), 7.07-7.03 (m,

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
1H), 6.74-6.69 (m, 3H), 6.45 (d, J = 4.0

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
Hz, 1H), 6.15 (s, 1H), 5.80-4.95 (m, 2H),

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
4.71-4.21 (m, 5H), 3.87 (d, J = 6.0 Hz,

Phase B: EtOH--HPLC;




1H), 3.72 (d, J = 4.0 Hz, 1H), 3.48 (s,

Flow rate: 20 mL/min;




1H), 1.42 (d, J = 4.0 Hz, 3H), 0.73-0.64

Gradient: 30% B to 30%




(m, 2H), 0.61-0.52 (m, 2H).

B in 10 min; Wave






Length: 220/254 nm


 36b
rac-(6S)-N-[[2-(6-amino-2-pyridyl)-6-
(400 MHz, CDCl3) δ 7.81 (d, J = 4.0 Hz,
779
Column: CHIRALPAK



fluoro-phenyl]methyl]-7-[4-bromo-3-
2H), 7.52-7.45 (m, 2H), 7.33-7.28 (m,

IE, 2*25 cm, 5 μm



(trifluoromethyl)benzoyl]-2-[4-
1H), 7.16-7.10 (m, 3H), 7.08-7.03 (m,

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
1H), 6.74-6.69 (m, 3H), 6.46 (d, J = 4.0

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
Hz, 1H), 6.15 (s, 1H), 5.68-4.87 (m, 2H),

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
4.71-4.25 (m, 5H), 3.87 (d, J = 6.0 Hz,

Phase B: EtOH--HPLC;




1H), 3.72 (d, J = 4.0 Hz, 1H), 3.49 (d, J

Flow rate: 20 mL/min;




= 1.0 Hz, 1H), 1.42 (d, J = 4.0 Hz, 3H),

Gradient: 30% B to 30%




0.73-0.64 (m, 2H), 0.62-0.52 (m, 2H).

B in 10 min; Wave






Length: 220/254 nm


 37a
rac-(6R)-7-(4-bromo-3-chloro-
(300 MHz, CDCl3) δ 8.54 (d, J = 5.1 Hz
743
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
1H), 7.67 (d, J = 8.1 Hz 1H), 7.60-7.50

ID, 2*25 cm, 5 μm;



N-[[2-(2-methoxypyrimidin-4-
(m, 2H), 7.50-7.30 (m, 3H), 7.20-7.00

Mobile Phase A: Hex:



yl)phenyl]methyl]-6-methyl-3-oxo-
(m, 4H), 6.79 (t, J = 5.9 Hz 1H), 6.70-

DCM = 3: 1(0.5% 2M



6,8-dihydro-5H-imidazo[1,5-
6.50 (m, 2H), 5.80-4.80 (m, 2H), 4.72-

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
4.45 (m, 2H), 4.42-4.22 (m, 1H), 3.99 (s,

Mobile Phase B: EtOH--




3H), 3.85 (d, J = 12.9 Hz 1H), 3.78-3.60

HPLC; Flow rate: 18




(m, 1H), 3.55-3.30 (m, 1H), 1.40 (s, 3H),

mL/min; Gradient: 50%




0.80-0.40 (m, 4H)

B to 50% B in 38 min;






Wave Length: 220/254






nm


 37b
rac-(6S)-7-(4-bromo-3-chloro-
(300 MHz, CDCl3) δ 8.54 (d, J = 5.1 Hz
743
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
1H), 7.67 (d, J = 8.4 Hz 1H), 7.60-7.45

ID, 2*25 cm, 5 μm;



N-[[2-(2-methoxypyrimidin-4-
(m, 2H), 7.45-7.30 (m, 3H), 7.20-7.10

Mobile Phase A: Hex:



yl)phenyl]methyl]-6-methyl-3-oxo-
(m, 2H), 7.04 (d, J = 8.7 Hz 2H), 6.78 (t,

DCM = 3: 1(0.5% 2M



6,8-dihydro-5H-imidazo[1,5-
J = 5.7 Hz 1H), 6.65 (d, J = 8.7 Hz 2H)

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
5.70-4.80 (m, 2H), 4.70-4.40 (m, 2H),

Mobile Phase B: EtOH--




4.40-4.20 (m, 1H), 3.99 (s, 3H), 3.85 (d, J

HPLC; Flow rate: 18




= 12.6 Hz 1H), 3.78-3.60 (m, 1H), 3.50-

mL/min; Gradient: 50%




3.30 (m, 1H), 1.40 (d, J = 6.9 Hz 3H),

B to 50% B in 38 min;




0.78-0.50 (m, 4H).

Wave Length: 220/254






nm


 38a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.53 (d, J = 5.1 Hz
777
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
1H), 7.90-7.72 (m, 2H), 7.52-7.35 (m,

IE, 2*25 cm, 5 μm;



(cyclopropoxy)phenyl]-N-[[2-(2-
5H), 7.22-6.95 (m, 3H), 6.82-6.60 (m,

Mobile Phase A:



methoxypyrimidin-4-
3H), 5.60-4.80 (m, 2H), 4.72-4.42 (m,

MtBE(0.5% 2M NH3-



yl)phenyl]methyl]-6-methyl-3-oxo-
2H), 4.40-4.20 (m, 1H), 3.99 (s, 3H),

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
3.90-3.70 (m, 2H), 3.55-3.25 (m, 1H),

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1.42 (d, J = 7.2 Hz 3H), 0.72-0.60 (m,

Flow rate: 17 mL/min;




2H), 0.60-0.50 (m, 2H).

Gradient: 30% B to 30%






B in 18.5 min; Wave






Length: 254/220 nm


 38b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.53 (d, J = 5.1 Hz
777
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
1H), 7.90-7.70 (m, 2H), 7.60-7.30 (m,

IE, 2*25 cm, 5 μm;



(cyclopropoxy)phenyl]-N-[[2-(2-
5H), 7.10-7.00 (m, 3H), 6.78 (t, J = 5.9

Mobile Phase A:



methoxypyrimidin-4-
Hz 1H), 6.64 (d, J = 9.0 Hz 2H), 5.60-

MtBE(0.5% 2M NH3-



yl)phenyl]methyl]-6-methyl-3-oxo-
4.85 (m, 2H), 4.75-4.40 (m, 2H), 4.40-

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
4.24 (m, 1H), 3.99 (s, 3H), 3.86 (d, J =

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
12.9 Hz 1H), 3.80-3.60 (m, 1H), 3.50-

Flow rate: 17 mL/min;




3.38 (m, 1H), 1.42 (d, J = 7.2 Hz 3H),

Gradient: 30% B to 30%




0.70-0.50 (m, 4H).

B in 18.5 min; Wave






Length: 254/220 nm


 39a
rac-(6R)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 8.15 (s, 1H), 7.69
742
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
(d, J = 4.0, 1H), 7.56 (s, 1H), 7.52-7.27

IA, 2*25 cm, 5 μm;



(methylamino)pyrimidin-4-
(m, 4H),7.25-7.09 (m, 4H), 6.83 (d, J =

Mobile Phase A:



6-methyl-N-[[246-
6.0 Hz, 2H), 6.41 (s, 1H), 5.38-5.08 (m,

MtBE(0.5% 2M NH3-



yl]phenyl]methyl]-3-oxo-6,8-dihydro-
2H), 4.61 (d, J = 10.0 Hz, 1H), 4.32-4.24

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
(m, 2H), 3.84 (d, J = 8.0 Hz, 1H), 3.69 (d,

Phase B: IPA--HPLC;



carboxamide
J = 6.0 Hz, 1H), 3.57 (d, J = 2.0 Hz, 1H),

Flow rate: 20 mL/min;




2.99 (d, J = 4.0 Hz, 3H), 1.38 (d, J = 4.0

Gradient: 30% B to 30%




Hz, 3H), 0.75-0.64 (m, 4H).

B in 12.5 min; Wave






Length: 220/254 nm


 39b
rac-(6S)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 8.15 (s, 1H), 7.69
742
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
(d, J = 4.0, 1H), 7.56 (s, 1H), 7.52-7.27

IA, 2*25 cm, 5 μm;



6-methyl-N-[[246-
(m, 4H),7.25-7.09 (m, 4H), 6.83 (d, J =

Mobile Phase A:



(methylamino)pyrimidin-4-
6.0 Hz, 2H), 6.41 (s, 1H), 5.38-5.08 (m,

MtBE(0.5% 2M NH3-



yl]phenyl]methyl]-3-oxo-6,8-dihydro-
2H), 4.61 (d, J = 10.0 Hz, 1H), 4.32-4.24

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
(m, 2H), 3.84 (d, J = 8.0 Hz, 1H), 3.69 (d,

Phase B: IPA--HPLC;



carboxamide
J = 6.0 Hz, 1H), 3.57 (d, J = 2.0 Hz, 1H),

Flow rate: 20 mL/min;




2.99 (d, J = 4.0 Hz, 3H), 1.38 (d, J = 4.0

Gradient: 30% B to 30%




Hz, 3H), 0.75-0.64 (m, 4H).

B in 12.5 min; Wave






Length: 220/254 nm


 40a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.15 (s, 1H), 7.79
776
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
(d, J = 4.0, 2H), 7.52-7.34 (m, 5H),7.25-

IF, 2*25 cm, 5 μm;



(cyclopropoxy)phenyl]-6-methyl-N-
7.12 (m, 3H), 6.83 (d, J = 6.0 Hz, 2H),

Mobile Phase A:



[[2-[6-(methylamino)pyrimidin-4-
6.41 (s, 1H), 5.35-5.07 (m, 2H), 4.61 (d, J

MtBE(0.5% 2M NH3-



yl]phenyl]methyl]-3-oxo-6,8-dihydro-
= 10.0 Hz, 1H), 4.32-4.24 (m, 2H), 3.84

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
(d, J = 8.0 Hz, 1H), 3.69 (d, J = 6.0 Hz,

Phase B: IPA--HPLC;



carboxamide
1H), 3.57 (d, J = 2.0 Hz, 1H), 2.98 (d, J =

Flow rate: 14 mL/min;




8.0 Hz, 3H), 1.40 (d, J = 4.0 Hz, 3H),

Gradient: 25% B to 25%




0.75-0.64 (m, 4H).

B in 29 min; Wave






Length: 220/254 nm


 40b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.15 (s, 1H), 7.79
776
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
(d, J = 4.0, 2H), 7.52-7.34 (m, 5H),7.25-

IF, 2*25 cm, 5 μm



(cyclopropoxy)phenyl]-6-methyl-N-
7.12 (m, 3H), 6.83 (d, J = 6.0 Hz, 2H),

Mobile Phase A:



[[2-[6-(methylamino)pyrimidin-4-
6.41 (s, 1H), 5.35-5.07 (m, 2H), 4.61 (d, J

MtBE(0.5% 2M NH3-



yl]phenyl]methyl]-3-oxo-6,8-dihydro-
= 10.0 Hz, 1H), 4.32-4.24 (m, 2H), 3.84

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
(d, J = 8.0 Hz, 1H), 3.69 (d, J = 6.0 Hz,

Phase B: IPA--HPLC;



carboxamide
1H), 3.57 (d, J = 2.0 Hz, 1H), 2.98 (d, J =

Flow rate: 14 mL/min;




8.0 Hz, 3H), 1.40 (d, J = 4.0 Hz, 3H),

Gradient: 25% B to 25%




0.75-0.64 (m, 4H).

B in 29 min; Wave






Length: 220/254 nm;






RT1(min): 18.62;






RT2(min): 26.85;






Sample Solvent: EtOH--






HPLC; Injection






Volume: 1.2 mL;






Number Of Runs: 4


 41a
rac-(6R)-7-[4-bromo-3-
(DMSO-d6, 600 MHz, 80° C.) δ 0.48-0.65
764
NA



(trifluoromethyl)benzoyl]-2-[4-
(m, 2H), 0.66-0.79 (m, 2H), 1.29 (d, J =





(cyclopropoxy)phenyl]-N-[[2-fluoro-
6.4 Hz, 3H), 3.58-3.81 (m, 3H), 4.21-





6-(2-pyridyl)phenyl]methyl]-6-methyl-
4.38 (m, 2H), 4.51 (d, J = 18.2 Hz, 1H),





3-oxo-6,8-dihydro-5H-imidazo[1,5-
4.61 (br. s, 1H), 5.19 (br. s, 1H), 6.88 (d,





a]pyrazine-1-carboxamide
J = 7.9 Hz, 2H), 7.14 (d, J = 8.3 Hz, 2H)'






7.18-7.25 (m, 1H), 7.27 (d, J = 7.5 Hz,






1H), 7.33-7.42 (m, 1H), 7.42-7.48 (m,






1H), 7.52 (d, J = 7.5 Hz, 2H), 7.70 (d, J =






7.7 Hz, 2H), 7.80-7.90 (m, 1H), 7.92 (s,






1H), 7.96 (d, J = 7.9 Hz, 1H), 8.52 (s, 1H).




126
2-(1,3-benzoxazol-5-yl)-N-benzyl-7-
(DMSO-d6, 600 MHz, 80° C.) δ 3.72 (t,
605
NA



(4-bromo-3-chloro-benzoyl)-3-oxo-
J = 5.6 Hz, 2H), 3.85 (s, 2H), 4.24 (d, J =





6,8-dihydro-5H-imidazo[1,5-
5.4 Hz, 2H), 4.88 (s, 2H), 7.01 (s, 2H),





a]pyrazine-1-carboxamide
7.14-7.20 (m, 3H), 7.32 (dd, J = 9.0 Hz,






2.0 Hz, 1H), 7.41 (dd, J = 8.6 Hz, 2.0 Hz,






1H), 7.53 (s, 1H), 7.7 (d, J = 2.0 Hz, 1H),






7.76 (dd, J = 5.9 Hz, 3.1 Hz, 2H), 7.86 (d,






J = 8.6 Hz, 1H), 8.73 (s, 1H).




 42a
rac-(6R)-N-[[2-(5-aminopyridazin-3-
(400 MHz, CDCl3) δ 8.53 (d, J = 2.8 Hz,
728
Column: CHIRALPAK



yl)phenyl]methyl]-7-(4-bromo-3-
1H), 7.72-7.48 (m, 2H), 7.41-7.29 (m,

IF, 2*25 cm, 5 μm;



chloro-benzoyl)-2-[4-
4H), 7.22-7.08 (m, 4H), 6.85-6.68 (m,

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
3H), 6.01-4.39 (m, 5H), 4.39-4.20 (m,

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
2H), 3.85 (d, J = 12.7 Hz, 1H), 3.79-3.59

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
(m, 1H), 3.59-3.48 (m, 1H), 1.38 (d, J =

Phase B: EtOH--HPLC;




6.9 Hz, 3H), 0.75-0.65 (m, 2H), 0.65-

Flow rate: 15 mL/min;




0.58 (m, 2H).

Gradient: 25% B to 25%






B in 27.5 min; Wave






Length: 220/254 nm


 42b
rac-(6S)-N-[[2-(5-aminopyridazin-3-
(400 MHz, CDCl3) δ 8.53 (d, J = 2.8 Hz,
728
Column: CHIRALPAK



yl)phenyl]methyl]-7-(4-bromo-3-
1H), 7.71-7.49 (m, 2H), 7.49-7.30 (m,

IF, 2*25 cm, 5 μm;



chloro-benzoyl)-2-[4-
4H), 7.22-7.04 (m, 4H), 6.85-6.60 (m,

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
3H), 5.95-4.38 (m, 5H), 4.38-4.20 (m,

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
2H), 3.85 (d, J = 12.8 Hz, 1H), 3.79-3.59

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
(m, 1H), 3.59-3.48 (m, 1H), 1.38 (d, J =

Phase B: EtOH--HPLC;




6.8 Hz, 3H), 0.78-0.53 (m, 4H).

Flow rate: 15 mL/min;






Gradient: 25% B to 25%






B in 27.5 min; Wave






Length: 220/254 nm


 43a
rac-(6R)-N-[[2-(5-aminopyridazin-3-
(400 MHz, CDCl3) δ 8.53 (d, J = 2.7 Hz,
762
Column: CHIRALPAK



yl)phenyl]methyl]-7-[4-bromo-3-
1H), 7.81 (d, J = 1.4 Hz, 1H), 7.80-7.65

IF, 2*25 cm, 5 μm;



(trifluoromethyl)benzoyl]-2-[4-
(m, 1H), 7.45-7.30 (m, 5H), 7.21-7.05

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
(m, 3H), 6.80-6.61 (m, 3H), 5.88-4.85

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
(m, 2H), 4.81-4.40 (m, 3H), 4.40-4.15

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
(m, 2H), 3.86 (d, J = 12.8 Hz, 1H), 3.79-

Phase B: EtOH--HPLC;




3.59 (m, 1H), 3.59-3.40 (m, 1H), 1.40 (d,

Flow rate: 15 mL/min;




J = 6.9 Hz, 3H), 0.79-0.50 (m, 4H).

Gradient: 25% B to 25%






B in 18 min; Wave






Length: 220/254 nm


 43b
rac-(6S)-N-[[2-(5-aminopyridazin-3-
(400 MHz, CDCl3) δ 8.52 (d, J = 2.6 Hz,
762
Column: CHIRALPAK



yl)phenyl]methyl]-7-[4-bromo-3-
1H), 7.81 (d, J = 1.4 Hz, 1H), 7.75-7.67

IF, 2*25 cm, 5 μm;



(trifluoromethyl)benzoyl]-2-[4-
(m, 1H), 7.50-7.29 (m, 5H), 7.20-7.02

Mobile Phase A:



(cyclopropoxy)phenyl]-6-methyl-3-
(m, 3H), 6.82-6.60 (m, 3H), 5.98-4.79

MtBE(0.5% 2M NH3-



oxo-6,8-dihydro-5H-imidazo[1,5-
(m, 2H), 4.79-4.40 (m, 3H), 4.35-4.19

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
(m, 2H), 3.86 (d, J = 12.7 Hz, 1H), 3.79-

Phase B: EtOH--HPLC;




3.60 (m, 1H), 3.60-3.30 (m, 1H), 1.40 (d,

Flow rate: 15 mL/min;




J = 6.9 Hz, 3H), 0.78-0.51 (m, 4H).

Gradient: 25% B to 25%






B in 18 min; Wave






Length: 220/254 nm


 44a
rac-(6R)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 7.70 (d, J = 8.1 Hz,
701
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
1H), 7.57 (d, J = 1.9 Hz, 2H), 7.45-7.38

ID, 2*25 cm, 5 μm;



N-[[2-(1H-imidazol-4-
(m, 1H), 7.34-7.29 (m, 1H), 7.28-7.09

Mobile Phase A: Hex:



yl)phenyl]methyl]-6-methyl-3-oxo-
(m, 6H), 7.06-6.98 (m, 2H), 5.83-4.25

DCM = 3: 1(0.5% 2M



6,8-dihydro-5H-imidazo[1,5-
(m, 5H), 3.86 (d, J = 12.7 Hz, 1H), 3.71

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
(d, J = 8.6 Hz, 2H), 1.44-1.32 (m, 3H),

Mobile Phase B: EtOH--




0.92-0.69 (m, 4H).

HPLC; Flow rate: 20






mL/min; Gradient: 50%






B to 50% B in 11 min;






Wave Length: 220/254






nm


 44b
rac-(6S)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 7.70 (d, J = 8.2 Hz,
701
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
1H), 7.57 (d, J = 1.9 Hz, 2H), 7.45-7.40

ID, 2*25 cm, 5 μm;



N-[[2-(1H-imidazol-4-
(m, 1H), 7.34-7.29 (m, 1H), 7.28-7.08

Mobile Phase A: Hex:



yl)phenyl]methyl]-6-methyl-3-oxo-
(m, 6H), 7.07-6.98 (m, 2H), 5.65-4.24

DCM = 3: 1(0.5% 2M



6,8-dihydro-5H-imidazo[1,5-
(m, 5H), 3.86 (d, J = 12.8 Hz, 1H), 3.70

NH3-MeOH)--HPLC,



a]pyrazine-1-carboxamide
(s, 2H), 1.39 (d, J = 6.9 Hz, 3H), 0.93-

Mobile Phase B: EtOH--




0.63 (m, 4H).

HPLC; Flow rate: 20






mL/min; Gradient: 50%






B to 50% B in 11 min;






Wave Length: 220/254 nm


 45a
rac-(6R)-7-(4-bromo-3-chloro-
(300 MHz, CDCl3) δ 7.74-7.62 (m, 2H),
735
Column: CHIRAL ART



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
7.56 (d, J = 1.8 Hz 1H), 7.50-7.40 (m,

Cellulose-SB, 2*25 cm,



N-[[2-fluoro-6-(5-methyl-1,3,4-
1H), 7.25-7.18 (m, 2H), 7.03 (d, J = 9.0

5 μm; Mobile Phase A:



oxadiazol-2-yl)phenyl]methyl]-6-
Hz, 2H), 6.74 (d, J = 9.0 Hz 2H), 6.60 (t,

MtBE(0.5% 2M NH3-



methyl-3-oxo-6,8-dihydro-5H-
J = 6.1 Hz 1H), 5.80-4.90 (m, 2H), 4.92-

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
4.80 (m, 1H), 4.75-4.50 (m, 2H), 3.82 (d,

Phase B: IPA--HPLC;



carboxamide
J = 12.6 Hz 1H), 3.70-3.50 (m, 2H), 2.63

Flow rate: 45 mL/min;




(s, 3H), 1.36 (d, J = 6.9 Hz 3H), 0.90-

Gradient: 50% B to 50%




0.68 (m, 4H).

B in 18 min; Wave






Length: 220/254 nm


 45b
rac-(6S)-7-(4-bromo-3-chloro-
(300 MHz, CDCl3) δ 7.76-7.62 (m, 2H),
735
Column: CHIRAL ART



benzoyl)-2[4-(cyclopropoxy)phenyl]-
7.56 (d, J = 1.8 Hz 1H), 7.50-7.36 (m,

Cellulose-SB, 2*25 cm,



N-[[2-fluoro-6-(5-methyl-1,3,4-
1H), 7.25 (s, 1H), 7.20-7.16 (m, 1H),

5 μm; Mobile Phase A:



oxadiazol-2-yl)phenyl]methyl]-6-
7.03 (d, J = 9.0 Hz 2H), 6.74 (d, J = 9.0

MtBE(0.5% 2M NH3-



methyl-3-oxo-6,8-dihydro-5H-
Hz, 2H), 6.60 (t, J = 6.0 Hz 1H), 5.78-

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
4.92 (m, 2H), 4.90-4.80 (m, 1H), 4.70-

Phase B: IPA--HPLC;



carboxamide
4.50 (m, 2H), 3.82 (d, J = 12.3 Hz 1H),

Flow rate: 45 mL/min;




3.78-3.56 (m, 2H), 2.63 (s, 3H), 1.36 (d,

Gradient: 50% B to 50%




J = 6.9 Hz 3H), 0.88-0.70 (m, 4H).

B in 18 min; Wave






Length: 220/254 nm


 46a
rac-(6R)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 8.70 (d, J = 4.0 Hz,
712
Column: CHIRALPAK



benzoyl)-6-methyl-2-(2-methyl-1,3-
1H), 8.56 (s, 1H), 7.72-7.70 (m, 1H),

IF, 2*25 cm, 5 μm;



benzoxazol-5-yl)-3-oxo-N-[(2-
7.59-7.58 (m, 2H), 7.52-7.38 (s, 5H),

Mobile Phase A:



pyrimidin-4-ylphenyl)methyl]-6,8-
7.22-7.19 (m, 1H), 7.13-7.05 (m, 2H),

MtBE(0.5% 2M NH3-



dihydro-5H-imidazo[1,5-a]pyrazine-1-
6.71 (s, 1H), 5.34 (s, 2H), 4.64 (d, J = 8.0

MeOH)--HPLC, Mobile



carboxamide
Hz, 1H), 4.38-4.23 (m, 2H), 3.87 (d, J =

Phase B: EtOH--HPLC;




6.0 Hz, 1H), 3.72 (d, J = 6.0 Hz, 1H),

Flow rate: 12 mL/min;




2.56 (s, 3H), 1.41 (d, J = 4.0 Hz, 3H).

Gradient: 40% B to 40%






B in 50 min; Wave






Length: 220/254 nm


 46b
rac-(6S)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 8.70 (d, J = 4.0 Hz,
712
Column: CHIRALPAK



benzoyl)-6-methyl-2-(2-methyl-1,3-
1H), 8.56 (s, 1H), 7.72-7.70 (m, 1H),

IF, 2*25 cm, 5 μm;



benzoxazol-5-yl)-3-oxo-N-[(2-
7.59-7.58 (m, 2H), 7.52-7.38 (s, 5H),

Mobile Phase A:



pyrimidin-4-ylphenyl)methyl]-6,8-
7.22-7.19 (m, 1H), 7.13-7.05 (m, 2H),

MtBE(0.5% 2M NH3-



dihydro-5H-imidazo[1,5-a]pyrazine-1-
6.71 (s, 1H), 5.34 (s, 2H), 4.64 (d, J = 8.0

MeOH)--HPLC, Mobile



carboxamide
Hz, 1H), 4.38-4.23 (m, 2H), 3.87 (d, J =

Phase B: EtOH--HPLC;




6.0 Hz, 1H), 3.72 (d, J = 6.0 Hz, 1H),

Flow rate: 12 mL/min;




2.56 (s, 3H), 1.41 (d, J = 4.0 Hz, 3H).

Gradient: 40% B to 40%






B in 50 min; Wave






Length: 220/254 nm


127
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.): 2.95 (d,
634
NA



benzoyl)-2-[2-(methylamino)-1,3-
J = 5.5 Hz, 3H), 3.7 (t, J = 5.9 Hz, 2H),





benzoxazol-5-yl]-3-oxo-6,8-dihydro-
3.84 (s, 2H), 4.23 (d, J = 4.6 Hz, 2H),





5H-imidazo[1,5-a]pyrazine-1-
4.88 (s, 2H), 6.87 (dd, J = 9.1 Hz, 2.8 Hz,





carboxamide
1H), 6.98 (s, 2H), 7.10 (s, 1H), 7.14-7.16






(m, 1H), 7.17-7.21 (m, 3H), 7.31 (d, J =






9.1 Hz, 1H), 7.40 (dd, J = 9.1 Hz, 1.8 Hz,






1H), 7.66 (s, 1H), 7.75 (d J = 1.7 Hz,






1H), 7.85 (d, J = 8.2 Hz) ppm.




 47a
rac-(6R)-7-[4-bromo-3-
(DMSO-d6, 600 MHz, 80° C.) δ 0.66-0.71
751
NA



(trifluoromethyl)benzoyl]-2-[4-
(m, 2H), 0.78-0.83 (m, 2H), 1.29 (s, 3H),





(cyclopropoxy)phenyl]-6-methyl-N-
2.57 (s, 3H), 3.63-3.73 (m, 2H), 3.82





[[2-(5-methyl-1,3,4-oxadiazol-2-
(hept, J = 3.1 Hz, 1H), 4.52 (d, J = 18.2





yl)phenyl]methyl]-3-oxo-6,8-dihydro-
Hz, 1H), 4.58 (br. s, 1H), 4.62 (d, J = 6.2





5H-imidazo[1,5-a]pyrazine-1-
Hz, 2H), 5.18 (br. s, 1H), 6.98 (d, J = 6.8





carboxamide
Hz, 2H), 7.14 (d, J = 8.8Hz, 3H), 7.28-






7.33 (m, 1H), 7.45-7.51 (m, 2H), 7.70






(dd, J = 8.1 Hz, 1.5 Hz, 1H), 7.81-7.87






(m, 1H), 7.91 (d, J = 1.5 Hz, 1H), 7.97 (d,






J = 8.1 Hz, 1H) ppm.




 48a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.70 (d, J = 2.0 Hz,
746
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
1H), 8.54 (s, 1H), 7.82 (d, J = 2.0 Hz,

IE, 2*25 cm, 5 μm



(2-methyl-1,3-benzoxazol-5-yl)-3-
2H), 7.59-7.37 (m, 7H), 7.13-7.05 (m,

Mobile Phase A:



oxo-N-[(2-pyrimidin-4-
2H), 6.71 (s, 1H), 5.37 (s, 2H), 4.66 (d,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
J = 8.0 Hz, 1H), 4.37-4.23 (m, 2H), 3.88

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
(d, J = 6.0 Hz, 1H), 3.73 (d, J = 4.0 Hz,

Phase B: EtOH--HPLC;



carboxamide
1H), 2.56 (s, 3H), 1.43 (d, J = 4.0 Hz,

Flow rate: 15 mL/min;




3H).

Gradient: 50% B to 50%






B in 28.5 min; Wave






Length: 220/254 nm


 48b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.70 (d, J = 2.0 Hz,
746
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
1H), 8.54 (s, 1H), 7.82 (d, J = 2.0 Hz,

IE, 2*25 cm, 5 μm



(2-methyl-1,3-benzoxazol-5-yl)-3-
2H), 7.59-7.37 (m, 7H), 7.13-7.05 (m,

Mobile Phase A:



oxo-N-[(2-pyrimidin-4-
2H), 6.71 (s, 1H), 5.37 (s, 2H), 4.66 (d,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
J = 8.0 Hz, 1H), 4.37-4.23 (m, 2H), 3.88

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
(d, J = 6.0 Hz, 1H), 3.73 (d, J = 4.0 Hz,

Phase B: EtOH--HPLC;



carboxamide
1H), 2.56 (s, 3H), 1.43 (d, J = 4.0 Hz,

Flow rate: 15 mL/min;




3H).

Gradient: 50% B to 50%






B in 28.5 min; Wave






Length: 220/254 nm


 49a
rac-(6R)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 9.17-9.15 (m, 1H),
731
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
7.69-7.56 (m, 4H), 7.45-7.39 (m, 1H),

IA, 2*25 cm, 20 um



N-[(2-fluoro-6-pyridazin-3-yl-
7.21-7.14 (m, 5H), 6.71 (d, J = 4.0 Hz,

Mobile Phase A:



phenyl)methyl]-6-methyl-3-oxo-6,8-
2H), 6.45-6.43 (m, 1H), 5.70-4.85 (m,

MtBE(0.5% 2M NH3-



dihydro-5H-imidazo[1,5-a]pyrazine-1-
2H), 4.63 (d, J = 10.0 Hz, 1H), 4.44-4.39

MeOH)--HPLC, Mobile



carboxamide
(m, 1H), 4.27-4.23 (m, 1H), 3.86 (d, J =

Phase B: IPA--HPLC;




8.0 Hz, 1H), 3.71-3.68 (m, 1H), 3.45-

Flow rate: 16 mL/min;




3.42 (m, 1H), 1.40 (d, J = 2.0 Hz, 3H),

Gradient: 50% B to 50%




0.67-0.63 (m, 2H), 0.57-0.49 (m, 2H).

B in 19 min; Wave






Length: 220/254 nm


 49b
rac-(6S)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 9.17-9.15 (m, 1H),
731
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
7.69-7.56 (m, 4H), 7.45-7.39 (m, 1H),

IA, 2*25 cm, 20 um



N-[(2-fluoro-6-pyridazin-3-yl-
7.21-7.14 (m, 5H), 6.71 (d, J = 4.0 Hz,

Mobile Phase A:



phenyl)methyl]-6-methyl-3-oxo-6,8-
2H), 6.45-6.43 (m, 1H), 5.75-4.85 (m,

MtBE(0.5% 2M NH3-



dihydro-5H-imidazo[1,5-a]pyrazine-1-
2H), 4.63 (d, J = 10.0 Hz, 1H), 4.44-4.39

MeOH)--HPLC, Mobile



carboxamide
(m, 1H), 4.27-4.23 (m, 1H), 3.87 (d, J =

Phase B: IPA--HPLC;




8.0 Hz, 1H), 3.71-3.68 (m, 1H), 3.45-

Flow rate: 16 mL/min;




3.42 (m, 1H), 1.40 (d, J = 2.0 Hz, 3H),

Gradient: 50% B to 50%




0.70-0.63 (m, 2H), 0.57-0.49 (m, 2H).

B in 19 min; Wave






Length: 220/254 nm


 50a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 9.16-9.15 (m, 1H),
765
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
7.83-7.77 (m, 2H), 7.64-7.56 (m, 2H),

IF, 2*25 cm, 5 μm



(cyclopropoxy)phenyl]-N-[(2-fluoro-
7.47-7.39 (m, 2H), 7.21-7.14 (m, 4H),

Mobile Phase A:



6-pyridazin-3-yl-phenyl)methyl]-6-
6.70 (d, J = 4.0 Hz, 2H), 6.46-6.43 (m,

MtBE(0.5% 2M NH3-



methyl-3-oxo-6,8-dihydro-5H-
1H), 5.69-4.90 (m, 2H), 4.65 (d, J = 8.0

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
Hz, 1H), 4.44-4.39 (m, 1H), 4.25-4.22

Phase B: EtOH--HPLC;



carboxamide
(m, 1H), 3.87 (d, J = 6.0 Hz, 1H), 3.71 (d,

Flow rate: 12.5 mL/min;




J = 6.0 Hz, 1H), 3.44-3.41 (m Hz, 1H),

Gradient: 35% B to 35%




1.41 (d, J = 4.0 Hz, 3H), 0.69-0.62 (m,

B in 20 min; Wave




2H), 0.56-0.49 (m, 2H).

Length: 220/254 nm


 50b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 9.17-9.15 (m, 1H),
765
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
7.83-7.77 (m, 2H), 7.64-7.57 (m, 2H),

IF, 2*25 cm, 5 μm



(cyclopropoxy)phenyl]-N-[(2-fluoro-
7.47-7.39 (m, 2H), 7.21-7.14 (m, 4H),

Mobile Phase A:



6-pyridazin-3-yl-phenyl)methyl]-6-
6.71 (d, J = 4.0 Hz, 2H), 6.45-6.42 (m,

MtBE(0.5% 2M NH3-



methyl-3-oxo-6,8-dihydro-5H-
1H), 5.69-4.90 (m, 2H), 4.64 (d, J = 10.0

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
Hz, 1H), 4.44-4.39 (m, 1H), 4.24 (d, J =

Phase B: EtOH--HPLC;



carboxamide
4.0 Hz, 1H), 3.88 (d, J = 4.0 Hz, 1H),

Flow rate: 12.5 mL/min;




3.72 (d, J = 6.0 Hz, 1H), 3.45-3.42 (m

Gradient: 35% B to 35%




Hz, 1H), 1.41 (d, J = 4.0 Hz, 3H), 0.70-

B in 20 min; Wave




0.63 (m, 2H), 0.57-0.49 (m, 2H).

Length: 220/254 nm


 51a
rac-(6R)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 7.78 (d, J = 8.1 Hz,
701
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
1H), 7.73-7.42 (m, 5H), 7.42-7.29 (m,

IE, 2*25 cm, 5 μm;



6-methyl-3-oxo-N-[[2-(1H-pyrazol-3-
3H), 7.26-7.17 (m, 3H), 7.13-7.02 (m,

Mobile Phase A:



yl)phenyl]methyl]-6,8-dihydro-5H-
2H), 6.54 (s, 1H), 5.98 (s, 1H), 4.77-4.25

MtBE(0.5% 2M NH3-



imidazo[1,5-a]pyrazine-1-
(m, 4H), 3.92 (d, J = 12.8 Hz, 1H), 3.78-

MeOH)--HPLC Mobile



carboxamide
3.61 (m, 2H), 1.37 (d, J = 6.8 Hz, 3H),

Phase B: EtOH--HPLC;




0.81 (d, J = 7.2 Hz, 4H).

Flow rate: 20 mL/min;






Gradient: 20% B to 20%






B in 26 min; Wave






Length: 220/254 nm


 51b
rac-(6S)-7-(4-bromo-3-chloro-
(400 MHz, CDCl3) δ 7.78 (d, J = 8.2 Hz,
701
Column: CHIRALPAK



benzoyl)-2-[4-(cyclopropoxy)phenyl]-
1H), 7.72-7.42 (m, 5H), 7.42-7.29 (m,

IE, 2*25 cm, 5 μm;



6-methyl-3-oxo-N-[[2-(1H-pyrazol-3-
3H), 7.26-7.17 (m, 3H), 7.07 (m, J = 8.5

Mobile Phase A:



yl)phenyl]methyl]-6,8-dihydro-5H-
Hz, 2H), 6.54 (s, 1H), 5.99 (s, 1H), 4.50

MtBE(0.5% 2M NH3-



imidazo[1,5-a]pyrazine-1-
(m, J = 155.7, 16.0 Hz, 4H), 3.92 (d, J =

MeOH)--HPLC, Mobile



carboxamide
12.8 Hz, 1H), 3.77-3.62 (m, 2H), 1.37 (d,

Phase B: EtOH--HPLC;




J = 6.8 Hz, 3H), 0.81 (d, J = 6.9 Hz, 4H).

Flow rate: 20 mL/min;






Gradient: 20% B to 20%






B in 26 min; Wave






Length: 220/254 nm


 52a
rac-(6S)-7-[4-bromo-3-
(DMSO-d6, 600 MHz, 80° C.) δ 1.28 (d,
844
NA



(trifluoromethyl)benzoyl]-6-methyl-3-
J = 6.7 Hz, 3H), 2.67 (t, J = 11.1 Hz, 1H),





oxo-N-[(2-pyrimidin-4-
2.75 (td, J = 12.0 Hz, 3.1 Hz, 1H), 3.44





ylphenyl)methyl]-2-[4-[(2S)-2-
(d, J = 11.8 Hz, 1H), 3.59 (d, J = 11.8 Hz,





(trifluoromethyl)morpholin-4-
1H), 3.64-3.72 (m, 2H), 3.75 (td, J = 11.4





yl]phenyl]-6,8-dihydro-5H-
Hz, 2.7 Hz, 1H), 4.08 (d, J = 11.0 Hz,





imidazo[1,5-a]pyrazine-1-
1H), 4.20-4.29 (m, 1H), 4.37 (d, J = 6.0





carboxamide
Hz, 2H), 4.47-4.78 (m, 2H), 5.20 (br. s.'






1H), 6.87 (d, J = 8.9 Hz, 2H), 7.01 (br. s.,






1H), 7.11 (d, J = 8.6 Hz, 2H), 7.30 (br. s.,






1H), 7.40-7.46 (m, 2H), 7.50-7.55 (m,






1H), 7.66 (dd, J = 5.2 Hz, 0.8 Hz, 1H),






7.70 (dd, J = 8.1 Hz, 1.4 Hz, 1H), 7.91 (d,






J = 1.7 Hz, 1H), 7.97 (d, J = 8.0 Hz, 1H),






8.84 (d, J = 5.3 Hz, 1H), 9.05 (d, J = 0.7






Hz, 1H).




 52b
rac-(6R)-7-[4-bromo-3-
(DMSO-d6, 600 MHz, 80° C.) δ 1.28 (d,
844
NA



(trifluoromethyl)benzoyl]-6-methyl-3-
J = 6.8 Hz, 3H), 2.67 (t, J = 11.2 Hz, 1H),





oxo-N-[(2-pyrimidin-4-
2.72-2.80 (m, 1H), 3.44 (d, J = 12.1 Hz,





ylphenyl)methyl]-2-[4-[(2S)-2-
1H), 3.59 (d, J = 11.6 Hz, 1H), 3.64-3.71





(trifluoromethyl)morpholin-4-
(m, 2H), 3.72-3.79 (m, 1H), 4.00-4.13





yl]phenyl]-6,8-dihydro-5H-
(m, 1H), 4.21-4.30 (m, 1H), 4.37 (d, J =





imidazo[1,5-a]pyrazine-1-
5.7 Hz, 2H), 4.51 (d, J = 18.2 Hz, 1H),





carboxamide
4.59 (br. s, 1H), 5.20 (br. s, 1H), 6.87 (d,






J = 9.0 Hz, 2H), 7.01 (br. s, 1H), 7.11 (d,






J = 8.8 Hz, 2H), 7.23-7.32 (m, 1H), 7.37-






7.47 (m, 2H), 7.49-7.57 (m, 1H), 7.66






(dd, J = 0.9 Hz, 5.8 Hz, 1H), 7.70 (dd, J =






1.5 Hz, 8.3 Hz, 1H), 7.91 (d, J = 1.5 Hz,






1H), 7.97 (d, J = 8.1 Hz, 1H), 8.83 (d, J =






5.3 Hz, 1H), 9.05 (d, J = 0.7 Hz, 1H).




 53a
rac-(6R)-7-(4-bromo-3-chloro-
(300 MHz, CDCl3) δ 7.70 (t, J = 4.2 Hz
716
Column: CHIRAL ART



benzoyl)-6-methyl-2-(2-methyl-1,3-
2H), 7.68-7.52 (m, 2H), 7.50-7.40 (m,

Cellulose-SB, 2*25 cm,



benzoxazol-5-yl)-N-[[2-(5-methyl-
3H), 7.40-7.30 (m, 1H), 7.22-7.10 (m,

5 μm Mobile Phase A:



1,3,4-oxadiazol-2-yl)phenyl]methyl]-
2H), 6.81 (d, J = 5.7 Hz 1H), 5.90-4.78

MtBE(0.5% 2M NH3-



3-oxo-6,8-dihydro-5H-imidazo[1,5-
(m, 2H), 4.70-4.45 (m, 3H), 3.84 (d, J =

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
12.6 Hz, 1H), 3.75-3.50 (m, 1H), 2.70 (s,

Phase B: EtOH--HPLC;




3H), 2.55 (s, 3H), 1.38 (d, J = 6.9 Hz

Flow rate: 20 mL/min;




3H).

Gradient: 50% B to 50%






B in 35 min; Wave






Length: 220/254 nm


 53b
rac-(6S)-7-(4-bromo-3-chloro-
300 MHz, CDCl3) δ 7.80-7.60 (m, 2H),
716
Column: CHIRAL ART



benzoyl)-6-methyl-2-(2-methyl-1,3-
7.56 (t, J = 4.6 Hz 2H), 7.50-7.38 (m,

Cellulose-SB, 2*25 cm,



benzoxazol-5-yl)-N-[[2-(5-methyl-
3H), 7.38-7.30 (m, 1H), 7.20-7.10 (m,

5 μm Mobile Phase A:



1,3,4-oxadiazol-2-yl)phenyl]methyl]-
2H), 6.82 (s, 1H), 5.90-4.80 (m, 2H),

MtBE(0.5% 2M NH3-



3-oxo-6,8-dihydro-5H-imidazo[1,5-
4.65-4.32 (m, 3H), 3.90-3.59 (m, 2H),

MeOH)--HPLC, Mobile



a]pyrazine-1-carboxamide
2.70 (s, 3H), 2.55 (s, 3H), 1.38 (d, J = 6.9

Phase B: EtOH--HPLC;




Hz 3H).

Flow rate: 20 mL/min;






Gradient: 50% B to 50%






B in 35 min; Wave






Length: 220/254 nm


 54a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 7.80 (d, J = 8.4 Hz
750
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 7.75-7.65 (m, 1H), 7.64-7.38 (m,

IA, 2*25 cm, 5 μm



(2-methyl-1,3-benzoxazol-5-yl)-N-[[2-
5H), 7.36-7.28 (m, 1H), 7.24-7.02 (m,

Mobile Phase A:



(5-methyl-1,3,4-oxadiazol-2-
1H), 6.81 (t, J = 6.0 Hz 1H), 5.90-4.80

MtBE(0.5% 2M NH3-



yl)phenyl]methyl]-3-oxo-6,8-dihydro-
(m, 2H), 4.76-4.35 (m, 3H), 3.83 (t, J =

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
6.3 Hz 1H), 3.78-3.55 (m, 1H), 2.69 (s,

Phase B: EtOH--HPLC;



carboxamide
3H), 2.54 (s, 3H), 1.60 (s, 3H).

Flow rate: 20 mL/min;






Gradient: 30% B to 30%






B in 21 min; Wave






Length: 220/254 nm


 54b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 7.81 (d, J = 8.0 Hz
750
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 7.75-7.68 (m, 1H), 7.54 (t, J = 6.0

IA, 2*25 cm, 5 μm



(2-methyl-1,3-benzoxazol-5-yl)-N-[[2-
Hz 1H), 7.52-7.45 (m, 2H), 7.45-7.35 (m,

Mobile Phase A:



(5-methyl-1,3,4-oxadiazol-2-
2H), 7.35-7.28 (m, 1H), 7.20-7.10 (m,

MtBE(0.5% 2M NH3-



yl)phenyl]methyl]-3-oxo-6,8-dihydro-
1H), 6.82 (s, 1H), 5.80-4.80 (m, 2H),

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
4.80-4.40 (m, 3H), 3.85 (d, J = 12.4 Hz

Phase B: EtOH--HPLC;



carboxamide
1H), 3.70 (d, J = 9.2 Hz 1H), 2.69 (s,

Flow rate: 20 mL/min;




3H), 2.54 (s, 3H), 1.40 (d, J = 6.8 Hz

Gradient: 30% B to 30%




3H).

B in 21 min; Wave






Length: 220/254 nm


128
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 3.69-3.71
650
NA



benzoyl)-2-[1-(2-hydroxyethyl)indol-
(m, J = 6.1 Hz, 2H), 3.76-3.79 (m, 2H),





5-yl]-3-oxo-6,8-dihydro-5H-
3.85 (br s, 2H), 4.18 (d, J = 6.1 Hz, 2H),





imidazo[1,5-a]pyrazine-1-
4.24 (t, J = 6.1 Hz, 2H), 4.68 (t, J = 5.4





carboxamide
Hz, 1H), 4.89 (s, 2H), 6.46 (d, J = 3.3






Hz, 1H), 6.80 (br s, 1H), 6.86 (d, J = 7.5






Hz, 2H), 7.02 (dd, J = 8.9 Hz, 1.9 Hz,






1H), 7.10-7.15 (m, 3H), 7.41 (dd, J= 8.4






Hz, 2.3 Hz, 1H), 7.44 (d, J = 3.3 Hz,






1H), 7.48 (s, 1H), 7.49 (s, 1H), 7.75 (d, J =






1.9 Hz, 1H), 7.85 (d, J = 8.4 Hz, 1H)






ppm.




 56a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 9.12-9.11 (m, 1H),
765
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-2-[4-[(2R)-
7.82 (s, 1H), 7.77 (d, J = 4.0 Hz, 1H),

Amylose-SA, 2*25 cm,



2-hydroxypropoxy]phenyl]-6-methyl-
7.64-7.61 (m, 1H), 7.57-7.52 (m, 1H),

5 μm; Mobile Phase A:



3-oxo-N-[(2-pyridazin-3-
7.46-7.44 (m, 4H), 7.40-7.27 (m, 1H),

Hex: DCM = 3: 1(0.5%



ylphenyl)methyl]-6,8-dihydro-5H-
7.12 (d, J = 4.0 Hz, 2H), 6.84 (d, J = 4.0

2M NH3-MeOH)--



imidazo[1,5-a]pyrazine-1-
Hz, 1H), 6.56 (d, J = 4.0 Hz, 2H), 5.23 (s,

HPLC, Mobile Phase B:



carboxamide
2H), 4.67-4.63 (m, 1H), 4.35-4.25 (m,

IPA--HPLC; Flow rate:




2H), 4.08-4.05 (m, 1H), 3.87 (d, J = 6.0

20 mL/min; Gradient:




Hz, 1H), 3.72-3.67 (m, 2H), 3.52 (d, J =

20% B to 20% B in 12.5




4.0 Hz, 1H), 2.28 (s, 1H), 1.41 (d, J = 4.0

min; Wave Length:




Hz, 3H), 1.25-1.22 (m, 3H).

254/220 nm


 56b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 9.12-9.11 (m, 1H),
765
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-2-[4-[(2R)-
7.82 (s, 1H), 7.77 (d, J = 4.0 Hz, 1H),

Amylose-SA, 2*25 cm,



2-hydroxypropoxy]phenyl]-6-methyl-
7.64-7.61 (m, 1H), 7.57-7.52 (m, 1H),

5 μm; Mobile Phase A:



3-oxo-N-[(2-pyridazin-3-
7.46-7.44 (m, 4H), 7.40-7.27 (m, 1H),

Hex: DCM = 3: 1(0.5%



ylphenyl)methyl]-6,8-dihydro-5H-
7.12 (d, J = 4.0 Hz, 2H), 6.84 (d, J = 4.0

2M NH3-MeOH)--



imidazo[1,5-a]pyrazine-1-
Hz, 1H), 6.56 (d, J = 4.0 Hz, 2H), 5.23 (s,

HPLC, Mobile Phase B:



carboxamide
2H), 4.67-4.63 (m, 1H), 4.35-4.25 (m,

IPA--HPLC; Flow rate:




2H), 4.08-4.05 (m, 1H), 3.87 (d, J = 6.0

20 mL/min; Gradient:




Hz, 1H), 3.72-3.67 (m, 2H), 3.52 (d, J =

20% B to 20% B in 12.5




4.0 Hz, 1H), 2.28 (s, 1H), 1.41 (d, J = 4.0

min; Wave Length:




Hz, 3H), 1.25-1.22 (m, 3H).

254/220 nm


 57a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 9.12-9.10 (m, 1H),
765
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(2S)-
7.82-7.76 (m, 2H), 7.64 (d, J = 2.0 Hz,

IF, 2*25 cm, 5 μm;



2-hydroxypropoxy]phenyl]-6-methyl-
1H), 7.62-7.54 (m, 1H), 7.46-7.38 (m,

Mobile Phase A:



3-oxo-N-[(2-pyridazin-3-
5H), 7.12 (d, J = 4.0 Hz, 2H), 6.85-6.82

MtBE(0.1% DEA)-



ylphenyl)methyl]-6,8-dihydro-5H-
(m, 1H), 6.62-6.55 (m, 2H), 5.85-4.90 (s

HPLC, Mobile Phase B:



imidazo[1,5-a]pyrazine-1-
2H), 4.66 (d, J = 10.0 Hz, 1H), 4.36-4.25

EtOH--HPLC; Flow



carboxamide
(m, 2H), 4.09-4.03 (m, 1H), 3.87 (d, J =

rate: 20 mL/min;




6.0 Hz, 1H), 3.72-3.62 (m, 2H), 3.51-

Gradient: 30% B to 30%




3.47 (m, 1H), 2.50-2.10 (s, 1H), 1.41 (d,

B in 16 min; Wave




J = 4.0 Hz, 3H), 1.25-1.22 (m, 3H).

Length: 220/254 nm


 57b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 9.12-9.10 (m, 1H),
765
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(2S)-
7.82-7.76 (m, 2H), 7.64 (d, J = 2.0 Hz,

IF, 2*25 cm, 5 μm;



2-hydroxypropoxy]phenyl]-6-methyl-
1H), 7.62-7.54 (m, 1H), 7.46-7.40 (m,

Mobile Phase A:



3-oxo-N-[(2-pyridazin-3-
4H),7.39-7.38 (m, 1H), 7.12 (d, J = 4.0

MtBE(0.1% DEA)-



ylphenyl)methyl]-6,8-dihydro-5H-
Hz, 2H), 6.85-6.82 (m, 1H), 6.56 (d, J =

HPLC, Mobile Phase B:



imidazo[1,5-a]pyrazine-1-
4.0 Hz, 2H), 5.85-4.90 (s, 2H), 4.65 (d,

EtOH--HPLC; Flow



carboxamide
J = 10.0 Hz, 1H), 4.35-4.25 (m, 2H), 4.09-

rate: 20 mL/min;




4.05 (m, 1H), 3.87 (d, J = 6.0 Hz, 1H),

Gradient: 30% B to 30%




3.72-3.67 (m, 2H), 3.53-3.48 (m, 1H),

B in 16 min; Wave




2.28 (s, 1H), 1.41 (d, J = 4.0 Hz, 3H),

Length: 220/254 nm




1.25-1.22 (m, 3H).




129
N-benzyl-7-(4-bromo-3-chloro-
(DMSO-d6, 600 MHz, 80° C.) δ 2.32-2.34
652
NA



benzoyl)-2-[4-(3-
(m, 4H), 3.67-3.69 (m, 2H), 3.83 (br s





hydroxycyclobutoxy)phenyl]-3-oxo-
2H), 4.25 (d, J = 5.4 Hz, 2H), 4.38-4.43





6,8-dihydro-5H-imidazo[1,5-a]
(m, 1H), 4.79-4.93 (m, 4H), 6.82 (d, J =





pyrazine-1-carboxamide
8.8 Hz, 2H), 7.05 (d, J = 6.5 Hz, 2H),






7.14-7.27 (m, 6H), 7.39 (dd, J = 8.2 Hz,






1.8 Hz, 1H), 7.74 (d, J = 1.7 Hz, 1H),






7.85 (d, J = 8.1 Hz, 1H) ppm.




 58a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.77-8.74 (m, 2H),
765
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(2S)-
7.82 (d, J = 4.0 Hz, 2H), 7.54-7.41 (m,

IF, 2*25 cm, 5 μm;



2-hydroxypropoxy]phenyl]-6-methyl-
6H), 7.15 (d, J = 4.0 Hz, 2H), 6.84-6.81

Mobile Phase A:



3-oxo-N-[(2-pyrimidin-4-
(m, 1H), 6.64 (d, J = 4.0 Hz, 2H), 5.23 (s,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
2H), 4.65(d, J = 8.0 Hz, 1H), 4.45-4.32

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
(m, 2H), 4.09-3.84 (m, 1H), 3.74-3.69

Phase B: EtOH--HPLC;



carboxamide
(m, 1H), 3.58-3.54 (m, 2H), 2.54 (s, 1H),

Flow rate: 14 mL/min;




1.41 (d, J = 4.0 Hz, 3H), 1.26 (d, J = 2.0

Gradient: 20% B to 20%




Hz, 3H).

B in 30 min; Wave






Length: 220/254 nm


 58b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.77-8.74 (m, 2H),
765
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(2S)-
7.82 (d, J = 4.0 Hz, 2H), 7.54-7.41 (m,

IF, 2*25 cm, 5 μm;



2-hydroxypropoxy]phenyl]-6-methyl-
6H), 7.15 (d, J = 4.0 Hz, 2H), 6.84-6.81

Mobile Phase A:



3-oxo-N-[(2-pyrimidin-4-
(m, 1H), 6.64 (d, J = 4.0 Hz, 2H), 5.23 (s,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
2H), 4.65 (d, J = 8.0 Hz, 1H), 4.45-4.32

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
(m, 2H), 4.09-3.84 (m, 1H), 3.74-3.69

Phase B: EtOH--HPLC;



carboxamide
(m, 1H), 3.58-3.54 (m, 2H), 2.54 (s, 1H),

Flow rate: 14 mL/min;




1.41 (d, J = 4.0 Hz, 3H), 1.26 (d, J = 2.0

Gradient: 20% B to 20%




Hz, 3H).

B in 30 min; Wave






Length: 220/254 nm


 59a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.61 (d, J = 4.9 Hz,
747
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
2H), 8.13 (dd, J = 5.7, 3.6 Hz, 1H), 7.84

IA, 2*25 cm, 20 um;



(cyclopropoxy)phenyl]-6-methyl-3-
(d, J = 7.7 Hz, 2H), 7.47 (ddd, J = 9.3,

Mobile Phase A:



oxo-N-[(2-pyrimidin-2-
6.9, 2.8 Hz, 4H), 7.19 (t, J = 4.9 Hz, 1H),

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
7.13-6.94 (m, 3H), 6.73 (d, J = 8.7 Hz,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
2H), 5.70-4.38 (m, 5H), 3.87 (d, J = 12.8

Phase B: EtOH--HPLC;



carboxamide
Hz, 1H), 3.73 (d, J = 13.5 Hz, 1H), 3.45

Flow rate: 16 mL/min;




(dt, J = 6.0, 3.0 Hz, 1H), 1.43 (d, J = 7.0

Gradient: 30% B to 30%




Hz, 3H), 0.71 (t, J = 6.1 Hz, 2H), 0.60 (t,

B in 14 min; Wave




J = 3.8 Hz, 2H).

Length: 220/254 nm


 59b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.61 (d, J = 4.9 Hz,
747
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-
2H), 8.13 (dd, J = 5.5, 3.6 Hz, 1H), 7.88-

IA, 2*25 cm, 20 um;



(cyclopropoxy)phenyl]-6-methyl-3-
7.80 (m, 2H), 7.47 (ddd, J = 9.3, 6.9, 2.8

Mobile Phase A:



oxo-N-[(2-pyrimidin-2-
Hz, 4H), 7.19 (t, J = 4.9 Hz, 1H), 7.14-

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
6.95 (m, 3H), 6.73 (d, J = 8.8 Hz, 2H),

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
5.53-4.39 (m, 5H), 3.87 (d, J = 12.5 Hz,

Phase B: EtOH--HPLC;



carboxamide
1H), 3.73 (d, J = 10.8 Hz, 1H), 3.45 (dt,

Flow rate: 16 mL/min;




J = 6.0, 3.1 Hz, 1H), 1.43 (d, J = 7.0 Hz,

Gradient: 30% B to 30%




3H), 0.78-0.66 (m, 2H), 0.59 (d, J = 2.9

B in 14 min; Wave




Hz, 2H).

Length: 220/254 nm


 60a
(6RS)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.24 (d, J = 4.6 Hz,
764
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(2R)-
1H), 7.88-7.67 (m, 3H), 7.51-7.35 (m,

IE, 2*25 cm, 5 μm;



2-hydroxypropoxy]phenyl]-6-methyl-
6H), 7.25-7.08 (m, 4H), 6.64-6.56 (m,

Mobile Phase A:



3-oxo-N-[[2-(2-
2H), 5.70-4.82 (m, 2H), 4.68 (d, J = 18.8

MtBE(0.5% 2M NH3-



pyridyl)phenyl]methyl]-6,8-dihydro-
Hz, 1H), 4.47-4.15 (m, 2H), 4.06 (s, 1H),

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
3.92-3.80 (m, 1H), 3.78-3.57 (m, 2H),

Phase B: EtOH--HPLC;



carboxamide
3.55-3.43 (m, 1H), 2.19 (s, 1H), 1.43 (d,

Flow rate: 20 mL/min;




J = 7.0 Hz, 3H), 1.24 (d, J = 6.4 Hz, 3H)

Gradient: 20% B to 20%






B in 16 min; Wave






Length: 220/254 nm


 60b
(6SR)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.24 (d, J = 4.9 Hz,
764
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(2R)-
1H), 7.87-7.71 (m, 3H), 7.52-7.35 (m,

IE, 2*25 cm, 5 μm;



2-hydroxypropoxy]phenyl]-6-methyl-
6H), 7.23-7.09 (m, 4H), 6.64-6.57 (m,

Mobile Phase A:



3-oxo-N-[[2-(2-
2H), 6.00-4.80 (m, 2H), 4.68 (d, J = 18.8

MtBE(0.5% 2M NH3-



pyridyl)phenyl]methyl]-6,8-dihydro-
Hz, 1H), 4.44-4.17 (m, 2H), 4.07 (s, 1H),

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
3.98-3.80 (m, 1H), 3.80-3.58 (m, 2H),

Phase B: EtOH--HPLC;



carboxamide
3.55-3.42 (m, 1H), 2.19 (s, 1H), 1.43 (d,

Flow rate: 20 mL/min;




J = 7.0 Hz, 3H), 1.24 (d, J = 6.4 Hz, 3H).

Gradient: 20% B to 20%






B in 16 min; Wave






Length: 220/254 nm


 61a
(6RS)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.25 (s, 1H), 7.87-
764
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(2S)-
7.71 (m, 3H), 7.52-7.35 (m, 6H), 7.25-

IF, 2*25 cm, 5 μm;



2-hydroxypropoxy]phenyl]-6-methyl-
7.08 (m, 4H), 6.61 (d, J = 8.7 Hz, 2H),

Mobile Phase A:



3-oxo-N-[[2-(2-
6.00-4.80 (m, 2H), 4.68 (d, J = 18.7 Hz,

MtBE(0.5% 2M NH3-



pyridyl)phenyl]methyl]-6,8-dihydro-
1H), 4.44-4.19 (m, 2H), 4.14-4.00 (m,

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
1H), 3.94-3.82 (m, 1H), 3.79-3.59 (m,

Phase B: EtOH--HPLC;



carboxamide
2H), 3.56-3.42 (m, 1H), 2.18 (s, 1H),

Flow rate: 20 mL/min;




1.43 (d, J = 7.0 Hz, 3H), 1.24 (d, J = 6.4

Gradient: 20% B to 20%




Hz, 3H).

B in 16 min; Wave






Length: 220/254 nm


 61b
(6SR)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.26 (s, 1H), 7.89-
764
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(2S)-
7.68 (m, 3H), 7.53-7.34 (m, 6H), 7.25-

IF, 2*25 cm, 5 μm;



2-hydroxypropoxy]phenyl]-6-methyl-
7.07 (m, 4H), 6.61 (d, J = 8.5 Hz, 2H),

Mobile Phase A:



3-oxo-N-[[2-(2-
5.90-4.82 (s, 2H), 4.68 (d, J = 18.8 Hz,

MtBE(0.5% 2M NH3-



pyridyl)phenyl]methyl]-6,8-dihydro-
1H), 4.47-4.17 (m, 2H), 4.14-3.95 (m,

MeOH)--HPLC, Mobile



5H-imidazo[1,5-a]pyrazine-1-
1H), 3.88 (d, J = 12.8 Hz, 1H), 3.82-3.58

Phase B: EtOH--HPLC;



carboxamide
(m, 2H), 3.52 (t, J = 8.4 Hz, 1H), 1.43 (d,

Flow rate: 20 mL/min;




J = 7.0 Hz, 3H), 1.24 (d, J = 6.4 Hz, 3H).

Gradient: 20% B to 20%






B in 16 min; Wave






Length: 220/254 nm


 62a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.73 (d, J = 4.0 Hz,
819
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 8.66 (s, 1H), 7.83 (d, J = 4.0 Hz,

Cellulose-SB, 2*25 cm,



oxo-N-[(2-pyrimidin-4-
2H), 7.59-7.41 (m, 6H), 7.18 (d, J = 6.0

5 μm; Mobile Phase A:



ylphenyl)methyl]-2-[4-[(2R)-3,3,3-
Hz, 2H), 6.76-6.70 (m, 3H), 5.35 (s, 2H),

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
4.66-4.55(m, 2H), 4.47-4.42 (m, 2H),

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
4.38-4.31 (m, 1H), 4.12 (d, J = 2.0 Hz,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1H), 3.98-3.93 (m, 1H), 3.85(d, J = 6.0

Flow rate: 20 mL/min;




Hz, 1H), 3.71-3.67 (m, 1H), 1.40 (d, J =

Gradient: 25% B to 25%




4.0 Hz, 3H).

B in 13 min; Wave






Length: 220/254 nm


 62b
((6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.73 (d, J = 4.0 Hz,
819
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 8.66 (s, 1H), 7.83 (d, J = 4.0 Hz,

Cellulose-SB, 2*25 cm,



oxo-N-[(2-pyrimidin-4-
2H), 7.59-7.41 (m, 6H), 7.18 (d, J = 6.0

5 μm; Mobile Phase A:



ylphenyl)methyl]-2-[4-[(2R)-3,3,3-
Hz, 2H), 6.76-6.70 (m, 3H), 5.35 (s, 2H),

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
4.66-4.55 (m, 2H), 4.47-4.42 (m, 2H),

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
4.38-4.31 (m, 1H), 4.12 (d, J = 2.0 Hz,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1H), 3.98-3.93 (m, 1H), 3.85 (d, J = 6.0

Flow rate: 20 mL/min;




Hz, 1H), 3.71-3.67 (m, 1H), 1.40 (d, J =

Gradient: 25% B to 25%




4.0 Hz, 3H).

B in 13 min; Wave






Length: 220/254 nm


 63a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.73 (d, J = 4.0 Hz,
819
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 8.66 (s, 1H), 7.83 (d, J = 4.0 Hz,

Cellulose-SB, 2*25 cm,



oxo-N-[(2-pyrimidin-4-
2H), 7.59-7.41 (m, 6H), 7.18 (d, J = 6.0

5 μm; Mobile Phase A:



ylphenyl)methyl]-2-[4-[(25)-3,3,3-
Hz, 2H), 6.76-6.70 (m, 3H), 5.35 (s, 2H),

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
4.66-4.55 (m, 2H), 4.47-4.42 (m, 2H),

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
4.38-4.31 (m, 1H), 4.12 (d, J = 2.0 Hz,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1H), 3.98-3.93 (m, 1H), 3.85(d, J = 6.0

Flow rate: 20 mL/min;




Hz, 1H), 3.71-3.67 (m, 1H), 1.40 (d, J =

Gradient: 25% B to 25%




4.0 Hz, 3H).

B in 14 min; Wave






Length: 220/254 nm


 63b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.73 (d, J = 4.0 Hz,
819
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 8.66 (s, 1H), 7.83 (d, J = 4.0 Hz,

Cellulose-SB, 2*25 cm,



oxo-N-[(2-pyrimidin-4-
2H), 7.59-7.41 (m, 6H), 7.18 (d, J = 6.0

5 μm; Mobile Phase A:



ylphenyl)methyl]-2-[4-[(25)-3,3,3-
Hz, 2H), 6.76-6.70 (m, 3H), 5.35 (s, 2H),

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
4.66-4.55(m, 2H), 4.47-4.42 (m, 2H),

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
4.38-4.31 (m, 1H), 4.12 (d, J = 2.0 Hz,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1H), 3.98-3.93 (m, 1H), 3.85(d, J = 6.0

Flow rate: 20 mL/min;




Hz, 1H), 3.71-3.67 (m, 1H), 1.40 (d, J =

Gradient: 25% B to 25%




4.0 Hz, 3H).

B in 14 min; Wave






Length: 220/254 nm


 64a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.62 (d, J = 5.0 Hz,
765
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-2-[4-[(2R)-
2H), 8.23-8.12 (m, 1H), 7.85 (d, J = 7.7

Cellulose-SB, 2*25 cm,



2-hydroxypropoxy]phenyl]-6-methyl-
Hz, 2H), 7.48 (q, J = 6.3, 4.3 Hz, 4H),

5 μm; Mobile Phase A:



3-oxo-N-[(2-pyrimidin-2-
7.20 (t, J = 4.9 Hz, 1H), 7.08 (d, J = 8.5

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
Hz, 2H), 6.96 (s, 1H), 6.54 (d, J = 8.7 Hz,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
2H), 5.32 (s, 1H), 4.73-4.54 (m, 2H),

Phase B: EtOH--HPLC;



carboxamide
4.46 (d, J = 13.4 Hz, 1H), 4.12 (td, J =

Flow rate: 20 mL/min;




7.0, 3.0 Hz, 1H), 3.87 (d, J = 12.7 Hz,

Gradient: 25% B to 25%




1H), 3.79-3.63 (m, 2H), 3.52 (t, J = 8.4

B in 18.5 min; Wave




Hz, 1H), 2.09 (s, 1H), 1.43 (d, J = 7.0 Hz,

Length: 220/254 nm




3H), 1.29 (d, J = 6.4 Hz, 3H).




 64b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.61 (d, J = 4.9 Hz,
765
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-2-[4-[(2R)-
2H), 8.23-8.12 (m, 1H), 7.85 (d, J = 6.5

Cellulose-SB, 2*25 cm,



2-hydroxypropoxy]phenyl]-6-methyl-
Hz, 2H), 7.59-7.38 (m, 4H), 7.19 (t, J =

5 μm; Mobile Phase A:



3-oxo-N-[(2-pyrimidin-2-
4.9 Hz, 1H), 7.08 (d, J = 8.3 Hz, 2H),

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
6.97 (s, 1H), 6.54 (d, J = 8.3 Hz, 2H),

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
5.32 (s, 1H), 4.63 (dd, J = 41.9, 15.6 Hz,

Phase B: EtOH--HPLC;



carboxamide
2H), 4.50-4.41 (m, 1H), 4.17-4.06 (m,

Flow rate: 20 mL/min;




1H), 3.87 (d, J = 12.9 Hz, 1H), 3.80-3.59

Gradient: 25% B to 25%




(m, 2H), 3.52 (t, J = 8.5 Hz, 1H), 2.09 (s,

B in 18.5 min; Wave




1H), 1.43 (d, J = 6.9 Hz, 3H), 1.29 (d, J =

Length: 220/254 nm




6.4 Hz, 3H).




 65a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.61 (d, J = 4.9 Hz,
765
Column:CHIRAL ART 65



(trifluoromethyl)benzoyl]-2-[4-[(2S)-
2H), 8.18 (dd, J = 6.0, 3.2 Hz, 1H), 7.91-

Cellulose-SB, 2*25 cm,



2-hydroxypropoxy]phenyl]-6-methyl-
7.78 (m, 2H), 7.49 (dq, J = 12.7, 4.7 Hz,

5 μm; Mobile Phase A:



3-oxo-N-[(2-pyrimidin-2-
4H), 7.18 (t, J = 4.9 Hz, 1H), 7.08 (d, J =

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
8.7 Hz, 2H), 6.97 (s, 1H), 6.58-6.49 (m,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
2H), 5.32-4.11 (m, 5H), 3.87 (d, J = 12.8

Phase B: EtOH--HPLC;



carboxamide
Hz, 1H), 3.77-3.60 (m, 2H), 3.52 (t, J =

Flow rate: 20 mL/min;




8.3 Hz, 1H), 2.09 (s, 1H), 1.43 (d, J = 6.9

Gradient: 25% B to 25%




Hz, 3H), 1.29 (d, J = 6.4 Hz, 3H).

B in 19 min; Wave






Length: 220/254 nm


 65b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.62 (d, J = 4.9 Hz,
765
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-2-[4-[(25)-
2H), 8.19 (dd, J = 5.9, 3.4 Hz, 1H), 7.85

Cellulose-SB, 2*25 cm,



2-hydroxypropoxy]phenyl]-6-methyl-
(d, J = 7.2 Hz, 2H), 7.59-7.37 (m, 4H),

5 μm; Mobile Phase A:



3-oxo-N-[(2-pyrimidin-2-
7.20 (t, J = 4.9 Hz, 1H), 7.08 (d, J = 8.5

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
Hz, 2H), 6.96 (s, 1H), 6.54 (d, J = 8.5 Hz,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
2H), 5.30-4.12 (m, 5H), 3.87 (d, J = 12.7

Phase B: EtOH--HPLC;



carboxamide
Hz, 1H), 3.79-3.61 (m, 2H), 3.55-3.47

Flow rate: 20 mL/min;




(m, 1H), 2.09 (s, 1H), 1.43 (d, J = 7.0 Hz,

Gradient: 25% B to 25%




3H), 1.29 (d, J = 6.4 Hz, 3H).

B in 19 min; Wave






Length: 220/254 nm


 66a
(6RS)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 9.08 (d, J = 4.0 Hz,
819
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 7.82-7.76 (m, 2H), 7.63-7.31 (m,

IE, 2*25 cm, 5 μm



oxo-N-[(2-pyridazin-3-
7H), 7.12-7.05 (m, 2H), 6.77 (d, J = 10.0

Mobile Phase A:



ylphenyl)methyl]-2-[4-[(2R)-3,3,3-
Hz, 1H), 6.53 (d, J = 6.0 Hz, 2H), 5.46-

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
4.88 (m, 2H), 4.65 (d, J = 12.0 Hz, 1H),

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
4.47-4.01 (m, 4H), 3.95-3.68 (m, 4H),

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1.41 (d, J = 4.0 Hz, 3H).

Flow rate: 20 mL/min;






Gradient: 30% B to 30%






B in 21 min; Wave






Length: 220/254 nm


 66b
(6SR)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 9.09-9.07 (m, 1H),
819
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
7.82-7.77 (m, 2H), 7.64-7.35 (m, 7H),

IE, 2*25 cm, 5 μm;



oxo-N-[(2-pyridazin-3-
7.10 (d, J = 4.0 Hz, 2H), 6.76-6.72 (m,

Mobile Phase A:



ylphenyl)methyl]-2-[4-[(2R)-3,3,3-
1H), 6.55 (d, J = 6.0 Hz, 2H), 5.46-5.06

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
(m, 2H), 4.68-4.58 (m, 1H), 4.36-3.69

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
(m, 8H), 1.41 (d, J = 4.0 Hz, 3H).

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide


Flow rate: 20 mL/min;






Gradient: 30% B to 30%






B in 21 min; Wave






Length: 220/254 nm


 67a
(6RS)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 9.09 (d, J = 4.0 Hz,
819
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 7.83-7.74 (m, 2H), 7.65-7.55 (m,

IE, 2*25 cm, 5 μm;



oxo-N-[(2-pyridazin-3-
2H), 7.49-7.29 (m, 5H), 7.11 (d, J = 6.0

Mobile Phase A:



ylphenyl)methyl]-2-[4-[(2S)-3,3,3-
Hz, 2H), 6.72 (s, 1H), 6.55 (d, J = 6.0 Hz,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
2H), 5.10-4.94 (s, 1H), 4.65 (d, J = 12.0

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
Hz, 1H), 4.36-3.65 (m, 8H), 1.41 (d, J =

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
4.0 Hz, 3H).

Flow rate: 20 mL/min;






Gradient: 50% B to 50%






B in 11 min; Wave






Length: 220/254 nm


 67b
(6SR)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 9.10 (d, J = 4.0 Hz,
819
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 7.83-7.77 (m, 2H), 7.67-7.59 (m,

IE, 2*25 cm, 5 μm;



oxo-N-[(2-pyridazin-3-
2H), 7.49-7.35 (m, 5H), 7.24-7.10 (m,

Mobile Phase A:



ylphenyl)methyl]-2-[4-[(2S)-3,3,3-
2H), 6.70 (d, J = 2.0 Hz, 1H), 6.55 (d, J =

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
6.0 Hz, 2H), 5.47-5.02 (s, 1H), 4.65 (d,

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
J = 12.0 Hz, 1H), 4.37-3.68 (m, 8H), 1.41

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
(m, 3H).

Flow rate: 20 mL/min;






Gradient: 50% B to 50%






B in 11 min; Wave






Length: 220/254 nm


 68a
(6RS)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.26 (s, 1H), 7.88-
818
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
7.70 (m, 3H), 7.53-7.34 (m, 6H), 7.23 (s,

Cellulose-SB, 2*25 cm,



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
1H), 7.17-6.99 (m, 3H), 6.56 (d, J = 8.5

5 μm; Mobile Phase A:



2-[4-[(2R)-3,3,3-trifluoro-2-hydroxy-
Hz, 2H), 5.34 (s, 2H), 4.68 (d, J = 18.8

MtBE(0.5% 2M NH3-



propoxy]phenyl]-6,8-dihydro-5H-
Hz, 1H), 4.46-4.30 (m, 1H), 4.28-4.18

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
(m, 1H), 4.10 (s, 1H), 3.94-3.58 (m, 5H),

Phase B: EtOH--HPLC;



carboxamide
1.43 (d, J = 7.0 Hz, 3H).

Flow rate: 20 mL/min;






Gradient: 25% B to 25%






B in 11 min; Wave






Length: 220/254 nm;






RT1(min)


 68b
(6SR)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.26 (s, 1H), 7.89-
818
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
7.70 (m, 3H), 7.54-7.34 (m, 6H), 7.26-

Cellulose-SB, 2*25 cm,



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
6.98 (m, 4H), 6.56 (d, J = 8.5 Hz, 2H),

5 μm; Mobile Phase A:



2-[4-[(2R)-3,3,3-trifluoro-2-hydroxy-
6.20-4.80 (m, 1H), 4.68 (d, J = 18.6 Hz,

MtBE(0.5% 2M NH3-



propoxy]phenyl]-6,8-dihydro-5H-
1H), 4.40-4.30 (m, 1H), 4.29-4.07 (m,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
2H), 4.03-3.63 (m, 5H), 1.44 (d, J = 6.9

Phase B: EtOH--HPLC;



carboxamide
Hz, 3H).

Flow rate: 20 mL/min;






Gradient: 25% B to 25%






B in 11 min; Wave






Length: 220/254 nm;






RT1(min)


 69a
(6RS)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.26 (s, 1H), 7.88-
818
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
7.71 (m, 3H), 7.54-7.34 (m, 6H), 7.23 (s,

Cellulose-SB, 2*25 cm,



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
1H) 7.18-7 09 (m, 2H) 7.04 (d J = 6.3

5 μm; Mobile Phase A:



2-[4-[(2S)-3,3,3-trifluoro-2-hydroxy-
Hz, 1H) δ.56. (d j = 8.4, Hz 2H) δ.00-

MtBE(0.5% 2M NH3-



propoxy]phenyl]-6,8-dihydro-5H-
4.80 (m, 2H), 4.68 (d, J = 18.8 Hz, 1H),

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
4.42-4.30 (m, 1H), 4.27-4.03 (m, 2H),

Phase B: EtOH--HPLC;



carboxamide
3.96-3.66 (m, 4H), 3.61 (s, 1H), 1.44 (d,

Flow rate: 20 mL/min;




J = 7.0 Hz, 3H).

Gradient: 25% B to 25%






B in 12.5 min; Wave






Length: 220/254 nm


 69b
(6SR)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.23 (s, 1H), 7.89-
818
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
7.69 (m, 3H), 7.53-7.33 (m, 6H), 7.23 (t,

Cellulose-SB, 2*25 cm,



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
J = 6.4 Hz, 1H), 7.18-7.08 (m, 2H), 7.09-

5 μm; Mobile Phase A:



2-[4-[(2S)-3,3,3-trifluoro-2-hydroxy-
6.99 (m, 1H), 6.56 (d, J = 8.5 Hz, 2H),

MtBE(0.5% 2M NH3-



propoxy]phenyl]-6,8-dihydro-5H-
6.10-4.90 (m, 2H), 4.68 (d, J = 18.8 Hz,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
1H), 4.40-4.30 (m, 1H), 4.29-4.04 (m,

Phase B: EtOH--HPLC;



carboxamide
2H), 3.96-3.68 (m, 4H), 3.60 (s, 1H),

Flow rate: 20 mL/min;




1.43 (d, J = 7.0 Hz, 3H).

Gradient: 25% B to 25%






B in 12.5 min; Wave






Length: 220/254 nm


 70a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.62-8.57 (m, 2H),
777
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
8.13-8.10 (m, 1H), 7.83-7.81 (m, 2H),

IE, 2*25 cm, 5 μm;



oxo-2-[4-(2-oxobutoxy)phenyl]-N-[(2-
7.61-7.36 (m, 4H), 7.22-7.19 (m, 1H),

Mobile Phase A:



pyrimidin-2-ylphenyl)methyl]-6,8-
7.10 (d, J = 6.0 Hz, 2H), 6.99 (s, 1H),

MtBE(0.5% 2M NH3-



dihydro-5H-imidazo[1,5-a]pyrazine-1-
6.53 (d, J = 6.0 Hz, 2H), 5.41-5.02 (m,

MeOH)--HPLC, Mobile



carboxamide
2H), 4.68-4.39 (m, 3H), 4.32 (d, J = 6.0

Phase B: EtOH--HPLC;




Hz, 2H), 3.86-3.67 (m,2H), 2.59-2.50

Flow rate: 20 mL/min;




(m, 2H), 1.40 (d, J = 4.0 Hz, 3H), 1.26-

Gradient: 30% B to 30%




1.14 (m, 3H).

B in 14 min; Wave






Length: 220/254 nm


 70b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.64-8.59 (m, 2H),
777
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
8.13-8.11 (m, 1H), 7.83-7.77 (m, 2H),

IE, 2*25 cm, 5 μm;



oxo-2-[4-(2-oxobutoxy)phenyl]-N-[(2-
7.52-7.29 (m, 4H), 7.25-7.22 (m, 1H),

Mobile Phase A:



pyrimidin-2-ylphenyl)methyl]-6,8-
7.10 (d, J = 6.0 Hz, 2H), 6.99 (d, J = 4.0

MtBE(0.5% 2M NH3-



dihydro-5H-imidazo[1,5-a]pyrazine-1-
Hz, 1H), 6.53 (d, J = 4.0 Hz, 2H), 5.39-

MeOH)--HPLC, Mobile



carboxamide
5.10 (m, 2H), 4.65 (d, J = 10.0 Hz, 1H),

Phase B: EtOH--HPLC;




4.54-4.48 (m, 1H), 4.42 (d, J = 6.0 Hz,

Flow rate: 20 mL/min;




1H), 4.32 (s, 2H), 3.84 (d, J = 6.0 Hz,

Gradient: 30% B to 30%




1H), 3.70 (d, J = 4.0 Hz, 1H), 2.61-2.51

B in 14 min; Wave




(m, 2H), 1.41-1.36 (m, 3H), 1.19-1.10

Length: 220/254 nm




(m, 3H).




 72a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.66 (d, J = 5.3 Hz,
813
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 8.56 (s, 1H), 7.86-7.82 (m, 2H),

Celluloes-3, 2.12*25



oxo-N-[(2-pyrimidin-4-
7.63 (s, 1H), 7.57-7.38 (m, 6H), 7.33 (d,

cm, 5 μm; Mobile Phase



ylphenyl)methyl]-2-[1-(2,2,2-
J = 5.4 Hz, 1H), 7.25-7.23 (m, 2H), 7.06

A: CO2, Mobile Phase



trifluoroethyl)indazol-5-yl]-6,8-
(s, 1H), 5.36 (s, 2H), 4.75-4.73 (m, 3H),

B: IPA: ACN = 2:1;



dihydro-SH-imidazo[1,5-a]pyrazine-1-
4.38 (s, 1H), 4.27-4.17 (m, 1H), 3.91 (d,

Flow rate: 100 mL/min;



carboxamide
J = 12.8 Hz, 1H), 3.78 (d, J = 12.7 Hz,

Gradient: isocratic 40%




1H), 1.47 (d, J = 6.9 Hz, 3H).

B; Column






Temperature(° C.): 35;






Back Pressure(bar): 100;






Wave Length: 220 nm


 72b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.65 (d, J = 5.3 Hz,
813
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 8.55 (s, 1H), 7.96-7.82 (m, 2H),

Celluloes-3, 2.12*25



oxo-N-[(2-pyrimidin-4-
7.63 (s, 1H), 7.59-7.38 (m, 6H), 7.32 (dd,

cm, 5 μm; Mobile Phase



ylphenyl)methyl]-2-[1-(2,2,2-
J = 5.3, 1.4 Hz, 1H), 7.25-7.23 (m, 2H),

A: CO2, Mobile Phase



trifluoroethyl)indazol-5-yl]-6,8-
7.07 (s, 1H), 5.39 (s, 2H), 4.75-4.73 (m,

B: IPA: ACN=2: 1;



dihydro-SH-imidazo[1,5-a]pyrazine-1-
3H), 4.36 (d, J = 8.7 Hz, 1H), 4.27-4.17

Flow rate: 100 mL/min;



carboxamide
(m, 1H), 3.91 (d, J = 12.8 Hz, 1H), 3.77

Gradient: isocratic 40%




(d, J = 12.8 Hz, 1H), 1.46 (d, J = 7.0 Hz,

B; Column




3H).

Temperature(° C.): 35;






Back Pressure(bar): 100;






Wave Length: 220 nm


 74a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.77-8.73 (m, 2H),
777
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(1-
7.82 (d, J = 4.0 Hz, 2H), 7.57-7.41 (m,

IF, 2*25 cm, 5 μm;



hydroxycyclopropyl)methoxy]phenyl]-
6H), 7.13 (d, J = 4.0 Hz, 2H), 6.81-6.78

Mobile Phase A:



6-methyl-3-oxo-N-[(2-pyrimidin-4-
(m, 1H), 6.69 (d, J = 6.0 Hz, 2H), 5.80-

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-SH-
4.96 (m, 2H), 4.65 (d, J = 10.0 Hz, 1H),

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
4.47-4.35 (m, 2H), 3.87-3.81 (m, 3H),

Phase B: EtOH--HPLC;



carboxamide
3.70 (d, J = 4.0 Hz, 1H), 3.30 (s, 1H),

Flow rate: 13 mL/min;




1.40 (d, J =2.0 Hz, 3H), 0.98-0.90 (m,

Gradient: 30% B to 30%




2H), 0.74-0.66 (m, 2H).

B in 30 min; Wave






Length: 220/254 nm


 74b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.76-8.73 (m, 2H),
777
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(1-
7.82 (d, J = 4.0 Hz, 2H), 7.57-7.41 (m,

IF, 2*25 cm, 5 μm;



hydroxycyclopropyl)methoxy]phenyl]-
6H), 7.13 (d, J = 4.0 Hz, 2H), 6.81-6.78

Mobile Phase A:



6-methyl-3-oxo-N-[(2-pyrimidin-4-
(m, 1H), 6.69 (d, J = 6.0 Hz, 2H), 5.80-

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
4.87 (m, 2H), 4.65 (d, J = 10.0 Hz, 1H),

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
4.47-4.34 (m, 2H), 3.87-3.81 (m, 3H),

Phase B: EtOH--HPLC;



carboxamide
3.70 (d, J = 6.0 Hz, 1H), 3.32 (s, 1H),

Flow rate: 13 mL/min;




1.40 (d, J =2.0 Hz, 3H), 0.97-0.90 (m,

Gradient: 30% B to 30%




2H), 0.73-0.66 (m, 2H).

B in 30 min; Wave






Length: 220/254 nm


 75a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.59 (d, J = 4.0 Hz,
819
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 8.16-8.12 (m, 1H), 7.84-7.82 (m,

Amylose-SA, 2*25 cm,



oxo-N-[(2-pyrimidin-2-
2H), 7.52-7.43 (m, 4H), 7.18-7.16 (m,

5 μm; Mobile Phase A:



ylphenyl)methyl]-2-[4-[(2S)-3,3,3-
1H), 7.05 (d, J = 4.0 Hz, 2H), 6.84 (s,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
1H), 6.47 (d, J = 4.0 Hz, 2H), 5.22 (s,

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
2H) 4.68-4.55 (m, 2H), 4.48-4.43 (m,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1H; 4.22 (s, 1H), 3.93-3.79 (m, 1H),

Flow rate: 20 mL/min;




3.85-3.81 (m, 2H), 3.71 (d, J = 6.0 Hz,

Gradient: 20% B to 20%




1H), 3.53 (s, 1H), 1.41 (d, J = 2.0 Hz,

B in 10 min; Wave




3H).

Length: 220/254 nm


 75b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.59 (d, J = 4.0 Hz,
819
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 8.16-8.12 (m, 1H), 7.84-7.82 (m,

Amylose-SA, 2*25 cm,



oxo-N-[(2-pyrimidin-2-
2H), 7.52-7.43 (m, 4H), 7.18-7.16 (m,

5 μm; Mobile Phase A:



ylphenyl)methyl]-2-[4-[(2S)-3,3,3-
1H), 7.05 (d, J = 4.0 Hz, 2H), 6.84 (s,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propoxy]phenyl]-
1H), 6.47 (d, J = 4.0 Hz, 2H), 5.22 (s,

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
2H), 4.68-4.55 (m, 2H), 4.48-4.43 (m,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1H), 4.22 (s, 1H), 3.93-3.79 (m, 1H),

Flow rate: 20 mL/min;




3.85-3.81 (m, 2H), 3.71 (d, J = 6.0 Hz,

Gradient: 20% B to 20%




1H), 3.53 (s, 1H), 1.41 (d, J = 2.0 Hz,

B in 10 min; Wave




3H).

Length: 220/254 nm


 76a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 9.14 (dd, J = 4.8,
801
Column: (R, R)-



(trifluoromethyl)benzoyl]-6-methyl-2-
1.8 Hz, 1H), 7.82 (s, 1H) , 7.78 (d, J = 8.2

WHELK-01-Kromasil,



[4-(6-methyl-2,6-
Hz, 1H),7.75-7.50 (m, 2H) 7.49-7.35 (m,

5*25 cm, 5 μm; Mobile



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
5H), 7.09-7.03 (m, 2H), 6.52 (t, J = 6.0

Phase A: Hex: DCM=1:



oxo-N-[(2-pyridazin-3-
Hz, 1H), 6.15 (d, J = 8.6 Hz, 2H), 5.24 (s,

1(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
1H), 4.65 (d, J = 18.7 Hz, 1H), 4.34 (qd,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
J = 14.2, 5.8 Hz, 2H), 3.89 (d, J = 12.8

Phase B: EtOH--HPLC;



carboxamide
Hz, 1H), 3.76 (s, 5H), 3.43 (s, 4H), 2.39

Flow rate: 20 mL/min;




(s, 3H), 1.42 (d, J = 6.9 Hz, 3H).

Gradient: 15% B to 15%






B in 16 min; Wave






Length: 220/254 nm


 76b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 9.14 (dd, J = 4.8,
801
Column: (R,R)-



(trifluoromethyl)benzoyl]-6-methyl-2-
1.8 Hz, 1H), 7.87-7.74 (m, 2H), 7.65-

WHELK-01-Kromasil,



[4-(6-methyl-2,6-
7.53 (m, 2H), 7.49-7.35 (m, 5H), 7.09-

5*25 cm, 5 μm; Mobile



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
7.03 (m, 2H), 6.52 (t, J = 6.0 Hz, 1H),

Phase A: Hex: DCM = 1:



oxo-N-[(2-pyridazin-3-
6.15 (d, J = 8.6 Hz, 2H), 5.24 (s, 1H),

1(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
4.65 (d, J = 18.7 Hz, 1H), 4.34 (qd, J =

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
14.2, 5.8 Hz, 2H), 3.89 (d, J = 12.8 Hz,

Phase B: EtOH--HPLC;



carboxamide
1H), 3.76 (s, 5H), 3.43 (s, 4H), 2.39 (s,

Flow rate: 20 mL/min;




3H), 1.42 (d, J = 6.9 Hz, 3H).

Gradient: 15% B to 15%






B in 16 min; Wave






Length: 220/254 nm


 77a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.29 (d, J = 4.8 Hz,
800
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
1H), 7.87-7.79 (m, 2H), 7.74 (td, J = 7.7,

Cellulose-SB, 2*25 cm,



[4-(6-methyl-2,6-
1.8 Hz, 1H), 7.50-7.34 (m, 6H), 7.21-

5 μm; Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
7.16 (m, 1H), 7.07-7.00 (m, 2H), 6.92 (t,

MtBE(0.5% 2M NH3-



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
J = 6.0 Hz, 1H), 6.14 (d, J = 8.7 Hz, 2H)

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
5.28 (s, 1H), 4.68 (d, J = 19.0 Hz, 1H),

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
4.45-4.31 (m, 1H), 4.24 (dd, J = 13.7, 5.7

Flow rate: 20 mL/min;




Hz, 1H), 3.88 (d, J = 12.7 Hz, 1H), 3.69

Gradient: 50% B to 50%




(s, 5H), 3.47 (s, 4H), 2.43 (s, 3H), 1.42

B in 15.5 min; Wave




(d, J = 6.9 Hz, 3H).

Length: 254/220 nm


 77b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.29 (d, J = 4.8 Hz,
800
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
1H), 7.87-7.79 (m, 2H), 7.74 (td, J = 7.7,

Cellulose-SB, 2*25 cm,



[4-(6-methyl-2,6-
1.8 Hz, 1H), 7.50-7.34 (m, 6H), 7.21-

5 μm; Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
7.16 (m, 1H), 7.07-7.00 (m, 2H), 6.92 (t,

MtBE(0.5% 2M NH3-



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
J = 6.0 Hz, 1H), 6.14 (d, J = 8.7 Hz, 2H)

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
5.28 (s, 1H), 4.68 (d, J = 19.0 Hz, 1H),

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
4.45-4.31 (m, 1H), 4.24 (dd, J = 13.7, 5.7

Flow rate: 20 mL/min;




Hz, 1H), 3.88 (d, J = 12.7 Hz, 1H), 3.69

Gradient: 50% B to 50%




(s, 5H), 3.47 (s, 4H), 2.43 (s, 3H), 1.42

B in 15.5 min; Wave




(d, J = 6.9 Hz, 3H).

Length: 254/220 nm


 78a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.58 (d, J = 4.9 Hz,
801
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 8.14-8.03 (m, 1H), 7.87-7.75 (m,

Celluloes-3, 3*25 cm, 5



[4-(6-methyl-2,6-
2H), 7.44 (ddt, J = 9.3, 6.0, 2.9 Hz, 4H),

μm; Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
7.14 (t, J = 4.9 Hz, 1H), 6.93 (dd, J = 7.2,

CO2, Mobile Phase B:



oxo-N-[(2-pyrimidin-2-
5.0 Hz, 3H), 5.98 (d, J = 8.6 Hz, 2H),

MeOH(0.2% DEA);



ylphenyl)methyl]-6,8-dihydro-5H-
5.27 (s, 1H), 4.76-4.33 (m, 3H), 3.84 (d,

Flow rate: 70 mL/min;



imidazo[1,5-a]pyrazine-1-
J = 12.8 Hz, 1H), 3.66 (s, 5H), 3.43 (s,

Gradient: isocratic 40%



carboxamide
4H), 2.38 (s, 3H), 1.39 (d, J = 7.0 Hz,

B; Column




3H).

Temperature(° C.): 35;






Back Pressure(bar): 100;






Wave Length: 220 nm


 78b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.61 (d, J = 4.8 Hz,
801
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 8.15-8.10 (m, 1H), 7.90-7.81 (m,

Celluloes-3, 3*25 cm, 5



[4-(6-methyl-2,6-
2H), 7.52-7.42 (m, 4H), 7.17 (t, J = 4.9

μm; Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
Hz, 1H), 6.99-6.85 (m, 3H), 6.01 (d, J =

CO2, Mobile Phase B:



oxo-N-[(2-pyrimidin-2-
8.5 Hz, 2H), 5.32 (s, 1H), 4.74-4.51 (m,

MeOH(0.2% DEA);



ylphenyl)methyl]-6,8-dihydro-SH-
2H), 4.46-4.37 (m, 1H), 3.91-3.83 (m,

Flow rate: 70 mL/min;



imidazo[1,5-a]pyrazine-1-
1H), 3.77-3.64 (m, 5H), 3.49 (s, 4H),

Gradient: isocratic 40%



carboxamide
2.42 (s, 3H), 1.42 (d, J = 7.0 Hz, 3H).

B; Column






Temperature(° C.): 35;






Back Pressure(bar): 100;






Wave Length: 220 nm


 79a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.58 (d, J = 2.8 Hz,
813
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 8.47 (s, 1H), 7.90-7.80 (m, 3H), 7.70

IA, 3*25 cm, 5 μm



oxo-N-[(2-pyrimidin-4-
(s, 1H), 7.60-7.40 (m, 4H), 7.40-7.28 (m,

Mobile Phase A: CO2,



ylphenyl)methyl]-2-[2-(2,2,2-
2H), 7.22-7.10 (m, 1H), 6.95-6.70 (m,

Mobile Phase B:



trifluoroethyl)indazol-5-yl]-6,8-
1H), 5.80-5.00 (m, 2H), 5.00-4.80 (m,

MeOH(0.2% DEA);



dihydro-5H-imidazo[1,5-a]pyrazine-1-
2H), 4.69 (d, J = 9.8 Hz 1H), 4.38 (d, J =

Flow rate: 70 mL/min;



carboxamide
2.6 Hz 1H), 4.30-4.10 (m, 1H), 3.88 (d,

Gradient: isocratic 40%




J = 6.4 Hz, 1H), 3.75 (d, J = 3.5 Hz, 1H),

B; Column




1.44 (d, J = 3.4 Hz, 3H).

Temperature(° C.): 35;






Back Pressure(bar): 100;






Wave Length: 220 nm


 79b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.58 (d, J = 2.8 Hz,
813
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
1H), 8.47 (s, 1H), 7.90-7.80 (m, 3H), 7.70

IA, 3*25 cm, 5 μm



oxo-N-[(2-pyrimidin-4-
(s, 1H), 7.60-7.40 (m, 4H), 7.40-7.28 (m,

Mobile Phase A: CO2,



ylphenyl)methyl]-2-[2-(2,2,2-
2H), 7.22-7.10 (m, 1H), 6.95-6.70 (m,

Mobile Phase B:



trifluoroethyl)indazol-5-yl]-6,8-
1H), 5.80-5.00 (m, 2H), 5.00-4.80 (m,

MeOH(0.2% DEA);



dihydro-5H-imidazo[1,5-a]pyrazine-1-
2H), 4.69 (d, J = 9.8 Hz 1H), 4.38 (d, J =

Flow rate: 70 mL/min;



carboxamide
2.6 Hz 1H), 4.30-4.10 (m, 1H), 3.88 (d,

Gradient: isocratic 40%




J = 6.4 Hz, 1H), 3.75 (d, J = 3.5 Hz, 1H),

B; Column




1.44 (d, J = 3.4 Hz, 3H).

Temperature(° C.): 35;






Back Pressure(bar): 100;






Wave Length: 220 nm


 80a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.79-8.72 (m, 2H),
829
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
7.82 (d, J = 6.0 Hz, 2H), 7.51-7.39 (m,

IE, 2*25 cm, 5 μm



[4-(2-methyl-2,7-
6H), 7.06 (d, J = 6.0 Hz, 2H), 6.86-6.82

Mobile Phase A:



diazaspiro[3.5]nonan-7-yl)phenyl]-3-
(m, 1H), 6.61 (d, J = 6.0 Hz, 2H), 5.69-

MtBE(0.5% 2M NH3-



oxo-N-[(2-pyrimidin-4-
4.85 (s, 1H), 4.65 (d, J = 12.0 Hz, 1H),

MeOH)--HPLC, Mobile



ylphenyl)methyl]-6,8-dihydro-5H-
4.44-4.28 (m, 2H), 3.86 (d, J = 10.0 Hz,

Phase B: MeOH--HPLC;



imidazo[1,5-a]pyrazine-1-
1H), 3.73-3.65 (m, 1H), 3.21 (s, 4H),

Flow rate: 20 mL/min;



carboxamide
2.89-2.80 (m, 4H), 2.48 (s, 3H), 1.82-

Gradient: 50% B to 50%




1.79 (m, 4H), 1.42-1.31 (m, 3H).

B in 25 min; Wave






Length: 220/254 nm


 80b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.80 (s, 1H), 8.73
829
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
(d, J = 4.0 Hz, 1H), 7.82 (d, J = 6.0 Hz,

IE, 2*25 cm, 5 μm;



[4-(2-methyl-2,7-
2H), 7.50-7.39 (m, 6H), 7.05 (d, J = 6.0

Mobile Phase A:



diazaspiro[3.5]nonan-7-yl)phenyl]-3-
Hz, 2H), 6.86-6.82 (m, 1H), 6.60 (d, J =

MtBE(0.5% 2M NH3-



oxo-N-[(2-pyrimidin-4-
6.0 Hz, 2H), 5.85-4.85 (s, 1H), 4.65 (d,

MeOH)--HPLC, Mobile



ylphenyl)methyl]-6,8-dihydro-5H-
J = 12.0 Hz, 1H), 4.44-4.28 (m, 2H), 3.85

Phase B: MeOH--HPLC;



imidazo[1,5-a]pyrazine-1-
(d, J = 10.0 Hz, 1H),3.70 (d, J = 12.0 Hz,

Flow rate: 20 mL/min;



carboxamide
1H), 3.10 (s, 4H), 2.88-2.85 (m, 4H),

Gradient: 50% B to 50%




2.47 (s, 3H), 1.87-1.71 (m, 4H), 1.42-

B in 25 min; Wave




1.33 (m, 3H).

Length: 220/254 nm


 81a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.66-8.58 (m, 2H),
777
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(1-
8.18-8.14 (m, 1H), 7.87-7.77 (m, 2H),

IE, 2*25 cm, 5 μm;



hydroxycyclopropyl)methoxy]phenyl]-
7.49-7.33 (m, 4H), 7.23-7.15 (m 1H),

Mobile Phase A:



6-methyl-3-oxo-N-[(2-pyrimidin-2-
7.06-7.00 (m, 2H), 6.92 (d, J = 4.0 Hz,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
1H), 6.53 (d, J = 6.0 Hz, 2H), 5.79-4.85

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
(s, 1H), 4.69-4.42 (m, 3H), 3.84 (d, J =

Phase B: EtOH--HPLC;



carboxamide
8.0 Hz, 1H), 3.66 (m, d, J = 12.0 Hz,

Flow rate: 20 mL/min;




3H), 3.08-1.82 (m, 1H), 1.40 (d, J = 4.0

Gradient: 20% B to 20%




Hz, 3H), 0.99-0.89 (m, 2H), 0.69-0.60

B in 22 min; Wave




(m, 2H).

Length: 220/254 nm


 81b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.62-8.58 (m, 2H),
777
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[(1-
8.16-8.13 (m, 1H), 7.82 (d, J = 6.0 Hz,

IE, 2*25 cm, 5 μm;



hydroxycyclopropyl)methoxy]phenyl]-
2H), 7.49-7.42 (m, 4H), 7.18-7.15 (m

Mobile Phase A:



6-methyl-3-oxo-N-[(2-pyrimidin-2-
1H), 7.05 (d, J = 6.0 Hz, 2H), 6.96-6.91

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
(m, 1H), 6.53 (d, J = 6.0 Hz, 2H), 5.40-

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
4.42 (m, 5H), 3.84 (d, J = 8.0 Hz, 1H),

Phase B: EtOH--HPLC;



carboxamide
3.70 (s, 3H), 3.04-2.34 (m, 1H), 1.40 (d,

Flow rate: 20 mL/min;




J = 4.0 Hz, 3H), 0.99-0.94 (m, 2H), 0.69-

Gradient: 20% B to 20%




0.64 (m, 2H).

B in 22 min; Wave






Length: 220/254 nm


 82a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.74 (d, J = 2.0 Hz,
833
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.83-7.81 (m, 2H), 7.57-7.42 (m,

Cellulose-2, 2.12*25



oxo-N-[(2-pyrimidin-4-
6H), 7.14 (d, J = 4.0 Hz, 2H), 6.83-6.80

cm, 5 μm; Mobile Phase



ylphenyl)methyl]-2-[4-[rac-(2R)-3,3,3-
(m, 1H), 6.63 (d, J = 4.0 Hz, 2H), 5.35 (s,

A: Hex(0.5% 2M NH3-



trifluoro-2-hydroxy-2-methyl-
2H), 4.65 (d, J = 8.0 Hz, 1H), 4.45-4.33

MeOH)--HPLC, Mobile



propoxy]phenyl]-6,8-dihydro-5H-
(m, 2H), 3.88-3.69 (m, 5H), 1.58-1.40

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
(m, 6H).

Flow rate: 20 mL/min;



carboxamide


Gradient: 50% B to 50%






B in 52 min; Wave






Length: 254/220 nm


 82b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.74 (d, J = 2.0 Hz,
833
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.83-7.81 (m, 2H), 7.57-7.42 (m,

Cellulose-2, 2.12*25



oxo-N-[(2-pyrimidin-4-
6H), 7.14 (d, J = 4.0 Hz, 2H), 6.83-6.80

cm, 5 μm; Mobile Phase



ylphenyl)methyl]-2-[4-[rac-(2R)-3,3,3-
(m, 1H), 6.63 (d, J = 4.0 Hz, 2H), 5.35 (s,

A: Hex(0.5% 2M NH3-



trifluoro-2-hydroxy-2-methyl-
2H), 4.65 (d, J = 8.0 Hz, 1H), 4.45-4.33

MeOH)--HPLC, Mobile



propoxy]phenyl]-6,8-dihydro-SH-
(m, 2H), 3.88-3.69 (m, 5H), 1.58-1.40

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
(m, 6H).

Flow rate: 20 mL/min;



carboxamide


Gradient: 50% B to 50%






B in 52 min; Wave






Length: 254/220 nm


 83a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.74 (d, J = 2.0 Hz,
833
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.83-7.81 (m, 2H), 7.57-7.42 (m,

Cellulose-2, 2.12*25



oxo-N-[(2-pyrimidin-4-
6H), 7.14 (d, J = 4.0 Hz, 2H), 6.83-6.80

cm, 5 μm; Mobile Phase



ylphenyl)methyl]-2-[4-[rac-(2S)-3,3,3-
(m, 1H), 6.63 (d, J = 4.0 Hz, 2H), 5.35 (s,

A: Hex(0.5% 2M NH3-



trifluoro-2-hydroxy-2-methyl-
2H), 4.65 (d, J = 8.0 Hz, 1H), 4.45-4.33

MeOH)--HPLC, Mobile



propoxy]phenyl]-6,8-dihydro-SH-
(m, 2H), 3.88-3.69 (m, 5H), 1.58-1.40

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
(m, 6H).

Flow rate: 20 mL/min;



carboxamide


Gradient: 50% B to 50%






B in 47 min; Wave






Length: 254/220 nm


 84a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.83 (s, 1H), 8.76
801
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
(d, J = 5.3 Hz, 1H), 7.83 (d, J = 8.2 Hz,

IE, 3*25 cm, 5 μm



[4-(1-methyl-1,6-
2H), 7.57-7.41 (m, 6H), 7.06 (d, J = 8.6

Mobile Phase A:



diazaspiro[3.3]heptan-6-yl)phenyl]-3-
Hz, 2H), 6.79 (t, J = 6.2 Hz, 1H), 6.31-

MtBE(0.5% 2M NH3-



oxo-N-[(2-pyrimidin-4-
6.14 (m, 2H), 5.28 (s, 2H), 4.67 (d, J =

MeOH)--HPLC, Mobile



ylphenyl)methyl]-6,8-dihydro-5H-
18.9 Hz, 1H), 4.39 (qd, J = 13.7, 6.1 Hz,

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
2H), 3.90 (dd, J = 20.0, 10.4 Hz, 3H),

Flow rate: 27 mL/min;



carboxamide
3.71 (dd, J = 8.5, 2.6 Hz, 3H), 3.25 (s,

Gradient: 50% B to 50%




2H), 2.40 (s, 5H), 1.42 (d, J = 7.0 Hz,

B in 50 min; Wave




3H).

Length: 220/254 nm


 84b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.83 (s, 1H), 8.76
801
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
(d, J = 5.3 Hz, 1H), 7.83 (d, J = 8.2 Hz,

IE, 3*25 cm, 5 μm



[4-(1-methyl-1,6-
2H), 7.57-7.41 (m, 6H), 7.06 (d, J = 8.6

Mobile Phase A:



diazaspiro[3.3]heptan-6-yl)phenyl]-3-
Hz, 2H), 6.79 (t, J = 6.2 Hz, 1H), 6.31-

MtBE(0.5% 2M NH3-



oxo-N-[(2-pyrimidin-4-
6.14 (m, 2H), 5.28 (s, 1H), 4.67 (d, J =

MeOH)--HPLC, Mobile



ylphenyl)methyl]-6,8-dihydro-5H-
18.9 Hz, 1H), 4.39 (qd, J = 13.7, 6.1 Hz,

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
2H), 3.90 (dd, J = 20.0, 10.4 Hz, 3H),

Flow rate: 27 mL/min;



carboxamide
3.71 (dd, J = 8.5, 2.6 Hz, 3H), 3.25 (s,

Gradient: 50% B to 50%




2H), 2.40 (s, 5H), 1.42 (d, J = 7.0 Hz,

B in 50 min; Wave




3H).

Length: 220/254 nm


 83b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.74 (d, J = 2.0 Hz,
833
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.83-7.81 (m, 2H), 7.57-7.42 (m,

Cellulose-2, 2.12*25



oxo-N-[(2-pyrimidin-4-
6H), 7.14 (d, J = 4.0 Hz, 2H), 6.83-6.80

cm, 5 μm Mobile Phase



ylphenyl)methyl]-2-[4-[rac-(2S)-3,3,3-
(m, 1H), 6.63 (d, J = 4.0 Hz, 2H), 5.35 (s,

A: Hex(0.5% 2M NH3-



trifluoro-2-hydroxy-2-methyl-
2H), 4.65 (d, J = 8.0 Hz, 1H), 4.45-4.33

MeOH)--HPLC, Mobile



propoxy]phenyl]-6,8-dihydro-5H-
(m, 2H), 3.88-3.69 (m, 5H), 1.58-1.40

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
(m, 6H).

Flow rate: 20 mL/min;



carboxamide


Gradient: 50% B to 50%






B in 47 min; Wave






Length: 254/220 nm


 87a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.85-8.69 (m, 2H),
857
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
7.87-7.76 (m, 2H), 7.60-7.35 (m, 6H),

IF, 2*25 cm, 5 μm;



[4-[(3S)-4-methyl-3-
7.08 (d, J = 8.6 Hz, 2H), 6.99 (t, J = 6.3

Mobile Phase A:



(trifluoromethyl)piperazin-1-
Hz, 1H), 6.53 (d, J = 8.6 Hz, 2H), 5.30 (s,

MtBE(0.5% 2M NH3-



yl]phenyl]-3-oxo-N-[(2-pyrimidin-4-
2H), 4.66 (d, J = 18.5 Hz, 1H), 4.44-4.24

MeOH)--HPLC, Mobile



ylphenyl)methyl]-6,8-dihydro-5H-
(m, 2H), 3.86 (d, J = 12.8 Hz, 1H), 3.71

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
(d, J = 12.7 Hz, 1H), 3.23 (d, J = 12.4 Hz,

Flow rate: 20 mL/min;



carboxamide
1H), 3.15-2.93 (m, 3H), 2.92-2.72 (m,

Gradient: 20% B to 20%




2H), 2.57 (s, 4H), 1.41 (d, J = 7.0 Hz,

B in 16 min; Wave




3H).

Length: 220/254 nm


 87b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.86-8.63 (m, 2H),
857
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
7.92-7.76 (m, 2H), 7.63-7.34 (m, 6H),

IF, 2*25 cm, 5 μm;



[4-[(3S)-4-methyl-3-
7.08 (d, J = 8.7 Hz, 2H), 6.99 (t, J = 6.3

Mobile Phase A:



(trifluoromethyl)piperazin-1-
Hz, 1H), 6.53 (d, J = 8.5 Hz, 2H), 5.50 (s,

MtBE(0.5% 2M NH3-



yl]phenyl]-3-oxo-N-[(2-pyrimidin-4-
2H), 4.66 (d, J = 18.8 Hz, 1H), 4.44-4.23

MeOH)--HPLC, Mobile



ylphenyl)methyl]-6,8-dihydro-5H-
(m, 2H), 3.86 (d, J = 12.8 Hz, 1H), 3.76-

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
3.63 (m, 1H), 3.23 (d, J = 12.3 Hz, 1H),

Flow rate: 20 mL/min;



carboxamide
3.15-2.91 (m, 3H), 2.91-2.70 (m, 2H),

Gradient: 20% B to 20%




2.57 (s, 4H), 1.41 (d, J = 6.9 Hz, 3H).

B in 16 min; Wave






Length: 220/254 nm


 88a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.82 (d, J = 1.3 Hz,
815
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
1H), 8.73 (d, J = 5.3 Hz, 1H), 7.90-7.81

Cellulose-SB, 2*25 cm,



[4-(2-methyl-2,6-diazaspiro[3.4]octan-
(m, 2H), 7.58-7.40 (m, 6H), 7.09-7.02

5 μm; Mobile Phase A:



6-yl)phenyl]-3-oxo-N-[(2-pyrimidin-4-
(m, 2H), 6.77 (t, J = 6.2 Hz, 1H), 6.31 (d,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
J = 8.7 Hz, 2H), 5.32 (s, 1H), 4.67 (d, J =

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
19.0 Hz, 1H), 4.52-4.32 (m, 2H), 3.88 (d,

Phase B: EtOH--HPLC;



carboxamide
J = 12.8 Hz, 1H), 3.72 (d, J = 12.5 Hz,

Flow rate: 20 mL/min;




1H), 3.33 (d, J = 30.9 Hz, 6H), 3.16 (t,

Gradient: 50% B to 50%




J = 6.9 Hz, 2H), 2.47 (s, 3H), 2.19 (t, J =

B in 18 min; Wave




6.8 Hz, 2H), 1.42 (d, J = 6.9 Hz, 3H).

Length: 220/254 nm


 88b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.82 (d, J = 1.3 Hz,
815
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
1H), 8.73 (d, J = 5.3 Hz, 1H), 7.90-7.81

Cellulose-SB, 2*25 cm,



[4-(2-methyl-2,6-diazaspiro[3.4]octan-
(m, 2H), 7.58-7.40 (m, 6H), 7.09-7.02

5 μm; Mobile Phase A:



6-yl)phenyl]-3-oxo-N-[(2-pyrimidin-4-
(m, 2H), 6.77 (t, J = 6.2 Hz, 1H), 6.31 (d,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
J = 8.7 Hz, 2H), 5.32 (s, 1H), 4.67 (d, J =

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
19.0 Hz, 1H), 4.52-4.32 (m, 2H), 3.88 (d,

Phase B: EtOH--HPLC;



carboxamide
J = 12.8 Hz, 1H), 3.72 (d, J = 12.5 Hz,

Flow rate: 20 mL/min;




1H), 3.33 (d, J = 30.9 Hz, 6H), 3.16 (t,

Gradient: 50% B to 50%




J = 6.9 Hz, 2H), 2.47 (s, 3H), 2.19 (t, J =

B in 18 min; Wave




6.8 Hz, 2H), 1.42 (d, J = 6.9 Hz, 3H).

Length: 220/254 nm


 89a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.21 (s, 1H), 7.90-
832
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
7.70 (m, 3H), 7.55-7.35 (m, 6H), 7.22-

Cellulose-2, 2.12*25



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
7.00 (m, 4H), 6.54 (d, J = 8.7 Hz 2H),

cm, 5 μm Mobile Phase



2-[4-[rac-(2R)-3,3,3-trifluoro-2-
5.90-4.80 (m, 2H), 4.66 (d, J = 19.2 Hz

A: Hex(0.5% 2M NH3-



hydroxy-2-methyl-propoxy]phenyl]-
1H), 4.40-4.20 (m, 2H), 3.92-3.50 (m,

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
4H), 3.10 (s, 1H), 1.41 (d, J =7.2 Hz,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
6H).

Flow rate: 20 mL/min;






Gradient: 50% B to 50%






B in 43 min; Wave






Length: 220/254 nm


 89b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.21 (s, 1H), 7.90-
832
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
7.70 (m, 3H), 7.55-7.35 (m, 6H), 7.22-

Cellulose-2, 2.12*25



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
7.00 (m, 4H), 6.54 (d, J = 8.7 Hz 2H),

cm, 5 μm Mobile Phase



2-[4-[rac-(2R)-3,3,3-trifluoro-2-
5.90-4.80 (m, 2H), 4.66 (d, J = 19.2 Hz

A: Hex(0.5% 2M NH3-



hydroxy-2-methyl-propoxy]phenyl]-
1H), 4.45-4.30 (m, 1H), 4.30-4.10 (m,

MeOH)--HPLC, Mobile



6,8-dihydro-SH-imidazo[1,5-
1H), 3.92-3.50 (m, 4H), 3.10 (s, 1H),

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1.41 (d, J =9.0 Hz, 6H).

Flow rate: 20 mL/min;






Gradient: 50% B to 50%






B in 43 min; Wave






Length: 220/254 nm


 90a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.21 (s, 1H), 7.90-
832
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
7.70 (m, 3H), 7.55-7.35 (m, 6H), 7.22-

Cellulose-2, 2.12*25



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
7.00 (m, 4H), 6.54 (d, J = 8.7 Hz 2H),

cm, 5 μm Mobile Phase



2-[4-[rac-(2S)-3,3,3-trifluoro-2-
5.90-4.80 (m, 2H), 4.66 (d, J = 19.2 Hz

A: Hex(0.5% 2M NH3-



hydroxy-2-methyl-propoxy]phenyl]-
1H), 4.45-4.30 (m, 1H), 4.30-4.10 (m,

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
1H), 3.92-3.50 (m, 4H), 3.10 (s, 1H),

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
1.41 (d, J =8.1 Hz, 6H).

Flow rate: 20 mL/min;






Gradient: 50% B to 50%






B in 43 min; Wave






Length: 220/254 nm


 90b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.21 (s, 1H), 7.90-
832
Column: Lux Sum



(trifluoromethyl)benzoyl]-6-methyl-3-
7.70 (m, 3H), 7.55-7.35 (m, 6H), 7.22-

Cellulose-2, 2.12*25



oxo-N-[[2-(2-pyridyl)phenyl]methyl]-
7.00 (m, 4H), 6.54 (d, J = 8.7 Hz 2H),

cm, 5 μm Mobile Phase



2-[4-[rac-(2S)-3,3,3-trifluoro-2-
5.90-4.80 (m, 2H), 4.66 (d, J = 19.2 Hz

A: Hex(0.5% 2M NH3-



hydroxy-2-methyl-propoxy]phenyl]-
1H), 4.40-4.20 (m, 2H), 3.92-3.50 (m,

MeOH)--HPLC, Mobile



6,8-dihydro-5H-imidazo[1,5-
4H), 3.10 (s, 1H), 1.41 (d, J =7.5 Hz,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
6H).

Flow rate: 20 mL/min;






Gradient: 50% B to 50%






B in 43 min; Wave






Length: 220/254 nm


 92a
rac-(6R)-2-(2-amino-1,3-benzoxazol-
(300 MHz, CDCl3) δ 8.77-8.62 (m, 2H),
713
Column: CHIRAL ART



5-yl)-7-(4-bromo-3-chloro-benzoyl)-6-
7.82 (d, J = 8.0 Hz, 2H), 7.55-7.34 (m,

Amylose-SA, 2*25 cm,



methyl-3-oxo-N-[(2-pyrimidin-4-
6H), 7.22 (d, J = 1.7 Hz, 1H), 6.88 (q, J =

5 μm Mobile Phase A:



ylphenyl)methyl]-6,8-dihydro-5H-
8.5 Hz, 2H), 6.71 (s, 1H), 5.71 (s, 2H),

MtBE(0.5% 2M NH3-



imidazo[1,5-a]pyrazine-1-
5.34 (s, 1H), 4.66 (d, J = 19.1 Hz, 1H),

MeOH)--HPLC, Mobile



carboxamide
4.14-4.22 (m, 2H), 3.87 (d, J = 12.8 Hz,

Phase B: EtOH--HPLC;




1H), 3.73 (d, J = 12.9 Hz, 1H), 1.43 (d,

Flow rate: 20 mL/min;




J = 6.9 Hz, 3H).

Gradient: 50% B to 50%






B in 17 min; Wave






Length: 220/254 nm


 92b
rac-(6S)-2-(2-amino-1,3-benzoxazol-
(300 MHz, CDCl3) δ 8.75-8.57 (m, 2H),
713
Column: CHIRAL ART



5-yl)-7-(4-bromo-3-chloro-benzoyl)-6-
7.71 (d, J = 8.2 Hz, 1H), 7.58 (d, J = 2.0

Amylose-SA, 2*25 cm,



methyl-3-oxo-N-[(2-pyrimidin-4-
Hz, 1H), 7.53-7.29 (m, 6H), 7.24-7.15

5 μm; Mobile Phase A:



ylphenyl)methyl]-6,8-dihydro-5H-
(m, 2H), 6.92-6.77 (m, 2H), 6.75-6.64

MtBE(0.5% 2M NH3-



imidazo[1,5-a]pyrazine-1-
(m, 1H), 5.80 (s, 2H), 5.35 (s, 1H), 4.63

MeOH)--HPLC, Mobile



carboxamide
(d, J = 19.1 Hz, 1H), 4.32 (qd, J = 13.7,

Phase B: EtOH--HPLC;




6.1 Hz, 2H), 3.86 (d, J = 12.7 Hz, 1H),

Flow rate: 20 mL/min;




3.71 (d, J = 8.7 Hz, 1H), 1.40 (d, J = 7.0

Gradient: 50% B to 50%




Hz, 3H).

B in 17 min; Wave






Length: 220/254 nm


 94a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.29 (d, J = 8.0 Hz,
789
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[1-[(2S)-
2H), 8.03-8.01 (m, 1H), 7.90-7.83 (m,

IF, 2*25 cm, 5 μm;



2-hydroxypropyl]indazol-5-yl]-6-
2H), 7.75 (s, 1H), 7.65 (d, J = 8.0 Hz,

Mobile Phase A:



methyl-3-oxo-N-[(2-pyrimidin-2-
1H), 7.50-7.43 (m, 4H), 6.99-6.92 (m,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
4H), 5.22 (s, 1H), 4.70 (d, J = 8.0 Hz,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
1H), 4.53 (s, 1H), 4.36 (d, J = 6.0 Hz,

Phase B: IPA--HPLC;



carboxamide
1H), 4.22-4.12 (m, 2H), 4.03-3.97 (m,

Flow rate: 12 mL/min;




1H), 3.87 (d, J = 6.0 Hz, 1H), 3.74 (d, J =

Gradient: 50% B to 50%




4.0 Hz, 1H), 2.33 (s, 1H), 1.43 (d, J = 4.0

B in 41 min; Wave




Hz, 3H), 1.28-1.24 (m, 3H).

Length: 220/254 nm;


 94b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.29 (d, J = 8.0 Hz,
789
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[1-[(2S)-
2H), 8.03-8.01 (m, 1H), 7.90-7.83 (m,

IF, 2*25 cm, 5 μm;



2-hydroxypropyl]indazol-5-yl]-6-
2H), 7.75 (s, 1H), 7.65 (d, J = 8.0 Hz,

Mobile Phase A:



methyl-3-oxo-N-[(2-pyrimidin-2-
1H), 7.50-7.43 (m, 4H), 6.99-6.92 (m,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
4H), 5.22 (s, 2H), 4.70 (d, J = 8.0 Hz,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
1H), 4.53 (s, 1H), 4.36 (d, J = 6.0 Hz,

Phase B: IPA--HPLC;



carboxamide
1H), 4.22-4.12 (m, 2H), 4.03-3.97 (m,

Flow rate: 12 mL/min;




1H), 3.87 (d, J = 6.0 Hz, 1H), 3.74 (d, J =

Gradient: 50% B to 50%




4.0 Hz, 1H), 3.07 (s, 1H), 1.43 (d, J = 4.0

B in 41 min; Wave




Hz, 3H), 1.28-1.24 (m, 3H).

Length: 220/254 nm;


 95a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.58 (d, J =4.8 Hz,
778
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 8.20-8.00 (m, 1H), 7.90-7.70 (m,

IF, 2*25 cm, 5 μm;



[4-[2-(methylamino)propoxy]phenyl]-
2H), 7.52-7.40 (m, 4H), 7.23-7.10 (m,

Mobile Phase A:



3-oxo-N-[(2-pyrimidin-2-
1H), 7.10-6.95 (m, 3H), 6.70-6.45 (m,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
2H), 5.30 (s, 2H), 4.70-4.30 (m, 3H),

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
3.90-3.68 (m, 4H), 3.30-3.10 (m, 2H),

Phase B: EtOH--HPLC;



carboxamide
2.54 (d, J = 9.3 Hz, 3H), 1.42-1.46 (m,

Flow rate: 11 mL/min;




6H).

Gradient: 50% B to 50%






B in 32 min; Wave






Length: 220/254 nm


 95b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.58 (d, J = 4.8 Hz,
778
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 8.20-8.00 (m, 1H), 7.90-7.70 (m,

IF, 2*25 cm, 5 μm;



[4-[2-(methylamino)propoxy]phenyl]-
2H), 7.52-7.40 (m, 4H), 7.23-7.10 (m,

Mobile Phase A:



3-oxo-N-[(2-pyrimidin-2-
1H), 7.10-6.95 (m, 3H), 6.70-6.45 (m,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
2H), 5.30 (s, 2H), 4.70-4.30 (m, 3H),

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
3.90-3.68 (m, 4H), 3.30-3.10 (m, 2H),

Phase B: EtOH--HPLC;



carboxamide
2.54 (d, J =9.3 Hz, 3H), 1.40 (d, J =7.2

Flow rate: 11 mL/min;




Hz, 3H), 1.23 (d, J =6.6 Hz, 3H).

Gradient: 50% B to 50%






B in 32 min; Wave






Length: 220/254 nm


 96a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.59 (d, J = 4.8 Hz,
834
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 8.24-8.00 (m, 1H), 8.00-7.65 (m,

IF, 2*25 cm, 5 μm;



[4-(2-morpholinopropoxy)phenyl]-3-
2H), 7.50-7.38 (m, 4H), 7.24-6.80 (m,

Mobile Phase A:



oxo-N-[(2-pyrimidin-2-
4H), 6.70-6.30 (m, 2H), 5.30 (s, 1H),

MeOH(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
4.80-4.26 (m, 3H), 4.10-3.10 (m, 8H),

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
3.10-2.20 (m, 5H), 1.40 (d, J = 6.9 Hz,

Phase B: EtOH--HPLC;



carboxamide
3H), 1.20 (s, 3H).

Flow rate: 14 mL/min;






Gradient: 30% B to 30%






B in 17.5 min; Wave






Length: 220/254 nm


 96b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.59 (d, J = 2.4 Hz,
834
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 8.20-8.00 (m, 1H), 7.80 (d, J =3.8

IF, 2*25 cm, 5 μm;



[4-(2-morpholinopropoxy)phenyl]-3-
2H), 7.56-7.30 (m, 4H), 7.16 (s, 1H),

Mobile Phase A:



oxo-N-[(2-pyrimidin-2-
7.10-6.90 (m, 3H), 6.60-6.40 (m, 2H),

MeOH(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
5.40 (s, 2H), 4.80-4.60 (m, 1H), 4.60-

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
4.50 (m, 1H), 4.48-4.40 (m, 1H), 4.40-

Phase B: EtOH--HPLC;



carboxamide
3.40 (m, 8H), 2.80 (s, 1H), 2.62 (s, 4H),

Flow rate: 14 mL/min;




1.40-1.35 (m, 3H), 1.20 (s, 3H).

Gradient: 30% B to 30%






B in 17.5 min; Wave






Length: 220/254 nm


 97a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.58 (d, J = 4.8 Hz,
792
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[2-
2H), 8.20-7.90 (m, 1H), 7.90-7.70 (m,

IF, 2*25 cm, 5 μm;



(dimethylamino)propoxy]phenyl]-6-
2H), 7.60-7.30 (m, 4H), 7.20-7.10 (m,

Mobile Phase A:



methyl-3-oxo-N-[(2-pyrimidin-2-
1H), 7.10-6.88 (m, 3H), 6.70-6.20 (m,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
2H), 5.70-4.90 (m, 1H),4.80-4.20 (m,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
3H), 4.00-3.40 (m, 4H), 2.88 (d, J = 5.4

Phase B: EtOH--HPLC;



carboxamide
Hz, 1H), 2.36 (s, 6H) , 1.40 (d, J = 6.9 Hz,

Flow rate: 14.5 mL/min;




3H), 1.12 (d, J = 6.6 Hz, 3H).

Gradient: 30% B to 30%






B in 17 min; Wave






Length: 220/254 nm


 97b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.58 (d, J = 4.8 Hz,
792
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-2-[4-[2-
2H), 8.20-7.90 (m, 1H), 7.90-7.70 (m,

IF, 2*25 cm, 5 μm;



(dimethylamino)propoxy]phenyl]-6-
2H), 7.60-7.30 (m, 4H), 7.20-7.10 (m,

Mobile Phase A:



methyl-3-oxo-N-[(2-pyrimidin-2-
1H), 7.10-6.88 (m, 3H), 6.70-6.20 (m,

MtBE(0.5% 2M NH3-



ylphenyl)methyl]-6,8-dihydro-5H-
2H), 5.70-4.90 (m, 1H), 4.80-4.20 (m,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
3H), 4.00-3.40 (m, 4H), 2.88 (d, J = 5.4

Phase B: EtOH--HPLC;



carboxamide
Hz, 1H), 2.36 (s, 6H) , 1.40 (d, J = 6.9 Hz,

Flow rate: 14.5 mL/min;




3H), 1.13 (d, J = 6.6 Hz, 3H).

Gradient: 30% B to 30%






B in 17 min; Wave






Length: 220/254 nm


 98a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.75 (d, J = 5.0 Hz,
867
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
1H), 8.32 (dd, J = 7.3, 2.8 Hz, 1H),

Amylose-SA, 2*25 cm,



[4-(6-methyl-2,6-
7.90-7.74 (m, 2H) ,7.46 (dt, J = 7.2, 4.2

5 μm Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
Hz, 5H), 6.86 (d, J = 8.6 Hz, 2H), 6.62 (t,

MtBE(0.5% 2M NH3-



oxo-N-[[2-[4-
J = 6.2 Hz, 1H), 5.96-5.75 (m, 2H), 5.33

MeOH)--HPLC, Mobile



(trifluoromethyl)pyrimidin-2-
(s, 1H), 4.75-4.57 (m, 2H), 4.51 (dd, J =

Phase B: EtOH--HPLC;



yl]phenyl]methyl]-6,8-dihydro-5H-
13.8, 5.8 Hz, 1H), 3.83 (d, J = 12.9 Hz,

Flow rate: 20 mL/min;



imidazo[1,5-a]pyrazine-1-
1H), 3.75-3.60 (m, 5H), 3.41 (s, 4H),

Gradient: 30% B to 30%



carboxamide
2.37 (s, 3H), 1.39 (d, J = 6.9 Hz, 3H).

B in 13 min; Wave






Length: 220/254 nm


 98b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.75 (d, J = 5.0 Hz,
867
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
1H), 8.40-8.24 (m, 1H), 7.89-7.72 (m,

Amylose-SA, 2*25 cm,



[4-(6-methyl-2,6-
2H), 7.56-7.36 (m, 5H), 7.05-6.80 (m,

5 μm Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
2H), 6.62 (t, J = 6.3 Hz, 1H), 5.96-5.75

MtBE(0.5% 2M NH3-



oxo-N-[[2-[4-
(m, 2H), 5.31 (s, 1H), 4.70-4.20 (m, 3H),

MeOH)--HPLC, Mobile



(trifluoromethyl)pyrimidin-2-
3.83 (d, J = 12.8 Hz, 1H), 3.57-3.75 (m,

Phase B: EtOH--HPLC;



yl]phenyl]methyl]-6,8-dihydro-5H-
5H), 3.35 (s, 4H), 2.33 (s, 3H), 1.39 (d,

Flow rate: 20 mL/min;



imidazo[1,5-a]pyrazine-1-
J = 6.9 Hz, 3H).

Gradient: 30% B to 30%



carboxamide


B in 13 min; Wave






Length: 220/254 nm


 99a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 7.80 (d, J = 6.0 Hz,
871
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 7.61-7.43 (m, 3H), 7.39-7.29 (m,

Amylose-SA, 2*25 cm,



[4-(6-methyl-2,6-
3H), 6.99 (d, J = 6.0 Hz, 2H), 6.45 (d, J =

5 μm Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
2.0 Hz, 1H), 6.24 (s, 1H), 6.12 (d, J = 6.0

MtBE(0.5% 2M NH3-



oxo-N-[[2-[1-(2,2,2-
Hz, 2H), 5.44-5.16 (m, 1H), 4.66-4.37

MeOH)--HPLC, Mobile



trifluoroethyl)pyrazol-3-
(m, 5H), 3.91-3.67 (m, 7H), 3.58 (s, 4H),

Phase B: EtOH--HPLC;



yl]phenyl]methyl]-6,8-dihydro-5H-
2.43 (d, J = 12.0 Hz, 3H), 1.39 (d, J = 6.0

Flow rate: 20 mL/min;



imidazo[1,5-a]pyrazine-1-
Hz, 3H).

Gradient: 20% B to 20%



carboxamide


B in 25 min; Wave






Length: 220/254 nm


 99b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 7.80 (d, J = 4.0 Hz,
871
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
2H), 7.52-7.44 (m, 3H), 7.34-7.28 (m,

Amylose-SA, 2*25 cm,



[4-(6-methyl-2,6-
3H), 6.99 (d, J = 4.0 Hz, 2H), 6.45 (d, J =

5 μm Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
2.0 Hz, 1H), 6.24 (s, 1H), 6.11 (d, J = 4.0

MtBE(0.5% 2M NH3-



oxo-N-[[2-[1-(2,2,2-
Hz, 2H), 5.35-5.20 (m, 1H), 4.61-4.39

MeOH)--HPLC, Mobile



trifluoroethyl)pyrazol-3-
(m, 6H), 3.86-3.76 (m, 5H), 3.71-3.60

Phase B: EtOH--HPLC;



yl]phenyl]methyl]-6,8-dihydro-5H-
(m, 1H), 3.52 (s, 4H), 2.42 (s, 3H), 1.39

Flow rate: 20 mL/min;



imidazo[1,5-a]pyrazine-1-
(d, J = 4.0 Hz, 3H).

Gradient: 20% B to 20%



carboxamide


B in 25 min; Wave






Length: 220/254 nm


100a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.27 (d, J = 4.9 Hz,
813
Column: (R,R)-



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.95-7.86 (m, 1H), 7.87-7.80 (m,

WHELK-01-Kromasil,



oxo-N-[(2-pyrimidin-2-
2H), 7.77 (s, 1H), 7.60 (d, J = 1.9 Hz,

5*25 cm, 5 μm Mobile



ylphenyl)methyl]-2-[1-(2,2,2-
1H), 7.54-7.38 (m, 4H), 7.24-7.19 (m,

Phase A: MtBE(0.5%



trifluoroethyl)indazol-5-yl]-6,8-
1H), 7.16-7.01 (m, 2H), 6.94 (t, J = 4.9

2M NH3-MeOH)--



dihydro-5H-imidazo[1,5-a]pyrazine-1-
Hz, 1H), 5.49-5.26 (m, 1H), 4.84-4.63

HPLC, Mobile Phase B:



carboxamide
(m, 3H), 4.55-4.39 (m, 1H), 4.38-4.25

EtOH--HPLC; Flow




(m, 1H), 3.95-3.82 (m, 1H), 3.82-3.65

rate: 20 mL/min;




(m, 1H), 1.43 (d, J = 7.0 Hz, 3H).

Gradient: 25% B to 25%






B in 17 min; Wave






Length: 220/254 nm


100b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.27 (d, J = 4.9 Hz,
813
Column: (R,R)-



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.95-7.86 (m, 1H), 7.87-7.80 (m,

WHELK-01-Kromasil,



oxo-N-[(2-pyrimidin-2-
2H), 7.77 (s, 1H), 7.60 (d, J = 1.9 Hz,

5*25 cm, 5 μm Mobile



ylphenyl)methyl]-2-[1-(2,2,2-
1H), 7.54-7.38 (m, 4H), 7.24-7.19 (m,

Phase A: MtBE(0.5%



trifluoroethyl)indazol-5-yl]-6,8-
1H), 7.16-7.01 (m, 2H), 6.94 (t, J = 4.9

2M NH3-MeOH)--



dihydro-5H-imidazo[1,5-a]pyrazine-1-
Hz, 1H), 5.49-5.26 (m, 1H), 4.84-4.63

HPLC, Mobile Phase B:



carboxamide
(m, 3H), 4.55-4.39 (m, 1H), 4.38-4.25

EtOH--HPLC; Flow




(m, 1H), 3.95-3.82 (m, 1H), 3.82-3.65

rate: 20 mL/min;




(m, 1H), 1.43 (d, J = 7.0 Hz, 3H).

Gradient: 25% B to 25%






B in 17 min; Wave






Length: 220/254 nm


101a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.34 (d, J = 2.0 Hz,
843
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.94-7.92 (m, 1H), 7.87-7.83 (m,

IF, 2*25 cm, 5 μm



oxo-N-[(2-pyrimidin-2-
2H), 7.60 (s, 1H), 7.50 (d, J = 2.0 Hz,

Mobile Phase A:



ylphenyl)methyl]-2-[1-[(2R)-3,3,3-
1H), 7.50-7.41 (m, 4H), 7.03-6.95 (m,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propyl]indazol-5-
3H), 6.70 (s, 1H), 5.22 (s, 1H), 4.70 (d,

MeOH)--HPLC, Mobile



yl]-6,8-dihydro-5H-imidazo[1,5-
J = 8.0 Hz, 1H), 4.53 (s, 1H), 4.45-4.29 (m,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
4H), 3.86 (d, J = 8.0 Hz, 1H), 3.73 (d, J =

Flow rate: 20 mL/min;




12.0 Hz, 1H), 1.43 (d, J = 4.0 Hz, 3H).

Gradient: 20% B to 20%






B in 13 min; Wave






Length: 220/254 nm


101b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.34 (d, J = 2.0 Hz,
843
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.94-7.92 (m, 1H), 7.87-7.83 (m,

IF, 2*25 cm, 5 μm



oxo-N-[(2-pyrimidin-2-
2H), 7.60 (s, 1H), 7.50 (d, J = 2.0 Hz,

Mobile Phase A:



ylphenyl)methyl]-2-[1-[(2R)-3,3,3-
1H), 7.50-7.41 (m, 4H), 7.03-6.95 (m,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propyl]indazol-5-
3H) δ.70 (s, 1H), 5.22 (s, 1H), 4.70 (d,

MeOH)--HPLC, Mobile



yl]-6,8-dihydro-5H-imidazo[1,5-
J = 8.0 Hz, 1H), 4.53 (s, 1H), 4.45-4.29 (m,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
4H), 3.86 (d, J = 8.0 Hz, 1H), 3.73 (d, J =

Flow rate: 20 mL/min;




12.0 Hz, 1H), 1.43 (d, J = 4.0 Hz, 3H).

Gradient: 20% B to 20%






B in 13 min; Wave






Length: 220/254 nm


102a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.34 (d, J = 2.0 Hz,
843
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.94-7.92 (m, 1H), 7.87-7.83 (m,

IF, 2*25 cm, 5 μm



oxo-N-[(2-pyrimidin-2-
2H), 7.60 (s, 1H), 7.50 (d, J = 2.0 Hz,

Mobile Phase A:



ylphenyl)methyl]-2-[1-[(2S)-3,3,3-
1H), 7.50-7.41 (m, 4H), 7.03-6.95 (m,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propyl]indazol-5-
3H), 6.70 (s, 1H), 5.22 (s, 1H), 4.70 (d,

MeOH)--HPLC, Mobile



yl]-6,8-dihydro-5H-imidazo[1,5-
J = 8.0 Hz, 1H), 4.53 (s, 1H), 4.45-4.29 (m,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
4H), 3.86 (d, J = 8.0 Hz, 1H), 3.73 (d, J =

Flow rate: 20 mL/min;




12.0 Hz, 1H), 1.43 (d, J = 4.0 Hz, 3H).

Gradient: 12% B to 12%






B in 23 min; Wave






Length: 220/254 nm


102b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.34 (d, J = 2.0 Hz,
843
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.94-7.92 (m, 1H), 7.87-7.83 (m,

IF, 2*25 cm, 5 μm



oxo-N-[(2-pyrimidin-2-
2H), 7.60 (s, 1H), 7.50 (d, J = 2.0 Hz,

Mobile Phase A:



ylphenyl)methyl]-2-[1-[(2S)-3,3,3-
1H), 7.50-7.41 (m, 4H), 7.03-6.95 (m,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propyl]indazol-5-
3H), 6.70 (s, 1H), 5.22 (s, 1H), 4.70 (d,

MeOH)--HPLC, Mobile



yl]-6,8-dihydro-5H-imidazo[1,5-
J = 8.0 Hz, 1H), 4.53 (s, 1H), 4.45-4.29 (m,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
4H), 3.86 (d, J = 8.0 Hz, 1H), 3.73 (d, J =

Flow rate: 20 mL/min;




12.0 Hz, 1H), 1.43 (d, J = 4.0 Hz, 3H).

Gradient: 12% B to 12%






B in 23 min; Wave






Length: 220/254 nm


103a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.42 (s, 2H), 8.12
814
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
(d, J = 1.7 Hz, 1H), 7.96-7.87 (m, 1H),

IF, 2*25 cm, 5 μm



oxo-N-[(2-pyrimidin-2-
7.87-7.76 (m, 2H), 7.49 (d, J = 8.2 Hz,

Mobile Phase A:



ylphenyl)methyl]-2-[1-(2,2,2-
3H), 7.22 (s, 1H), 7.11 (s, 2H), 5.36-5.05

MtBE(0.5% 2M NH3-



trifluoroethyl)benzotriazol-5-yl]-6,8-
(m, 3H), 4.70 (d, J = 18.7 Hz, 1H), 4.54-

MeOH)--HPLC, Mobile



dihydro-5H-imidazo[1,5-a]pyrazine-1-
4.23 (m, 2H), 3.88 (d, J = 12.8 Hz, 1H),

Phase B: EtOH--HPLC;



carboxamide
3.74 (d, J = 13.5 Hz, 1H), 2.53 (s, 2H),

Flow rate: 15 mL/min;




1.44 (d, J = 6.9 Hz, 3H).

Gradient: 20% B to 20%






B in 19 min; Wave






Length: 254/220 nm


103b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.42 (s, 2H), 8.12
814
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
(d, J = 1.7 Hz, 1H), 7.96-7.87 (m, 1H),

IF, 2*25 cm, 5 μm



oxo-N-[(2-pyrimidin-2-
7.87-7.76 (m, 2H), 7.49 (d, J = 8.2 Hz,

Mobile Phase A:



ylphenyl)methyl]-2-[1-(2,2,2-
3H), 7.22 (s, 1H), 7.11 (s, 2H), 5.36-5.05

MtBE(0.5% 2M NH3-



trifluoroethyl)benzotriazol-5-yl]-6,8-
(m, 3H), 4.70 (d, J = 18.7 Hz, 1H), 4.54-

MeOH)--HPLC, Mobile



dihydro-5H-imidazo[1,5-a]pyrazine-1-
4.23 (m, 2H), 3.88 (d, J = 12.8 Hz, 1H),

Phase B: EtOH--HPLC;



carboxamide
3.74 (d, J = 13.5 Hz, 1H), 2.53 (s, 2H),

Flow rate: 15 mL/min;




1.44 (d, J = 6.9 Hz, 3H).

Gradient: 20% B to 20%






B in 19 min; Wave






Length: 254/220 nm


104a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.02-7.97 (m, 1H),
787
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-N-[(2-
7.86-7.80 (m, 2H), 7.69-7.64 (m, 1H),

Amylose-SA, 2*25 cm,



chloro-6-fluoro-phenyl)methyl]-6-
7.52-7.45 (m, 2H), 7.42-7.37 (m, 1H),

5 μm Mobile Phase A:



methyl-3-oxo-2-[1-(2,2,2-
7.12-7.04 (m, 1H), 6.90 (d, J = 8.1 Hz,

MtBE(0.5% 2M NH3-



trifluoroethyl)indazol-5-yl]-6,8-
1H), 6.76 (t, J = 8.7 Hz, 1H), 5.45-4.90

MeOH)--HPLC, Mobile



dihydro-5H-imidazo[1,5-a]pyrazine-1-
(m, 5H), 4.76-4.59 (m, 1H), 4.55-4.55

Phase B: EtOH--HPLC;



carboxamide
(m, 5.9 Hz, 1H), 4.37-4.27 (m, 1H), 3.91-

Flow rate: 20 mL/min;




3.84 (m, 1H), 3.79-3.69 (m, 1H), 1.42 (d,

Gradient: 20% B to 20%




J = 7.0 Hz, 3H).

B in 20 min; Wave






Length: 220/254 nm


104b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.02-7.97 (m, 1H),
787
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-N-[(2-
7.86-7.80 (m, 2H), 7.69-7.64 (m, 1H),

Amylose-SA, 2*25 cm,



chloro-6-fluoro-phenyl)methyl]-6-
7.52-7.45 (m, 2H), 7.42-7.37 (m, 1H),

5 μm Mobile Phase A:



methyl-3-oxo-2-[1-(2,2,2-
7.12-7.04 (m, 1H), 6.90 (d, J = 8.1 Hz,

MtBE(0.5% 2M NH3-



trifluoroethyl)indazol-5-yl]-6,8-
1H), 6.76 (t, J = 8.7 Hz, 1H), 5.45-4.90

MeOH)--HPLC, Mobile



dihydro-5H-imidazo[1,5-a]pyrazine-1-
(m, 5H), 4.76-4.59 (m, 1H), 4.55-4.45

Phase B: EtOH--HPLC;



carboxamide
(m, 1H), 4.37-4.27 (m, 1H), 3.91-3.84

Flow rate: 20 mL/min;




(m, 1H), 3.79-3.69 (m, 1H), 1.42 (d, J =

Gradient: 20% B to 20%




7.0 Hz, 3H).

B in 20 min; Wave






Length: 220/254 nm


105a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.34 (d, J = 2.0 Hz,
843
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.94-7.92 (m, 1H), 7.87-7.83 (m,

Amylose-SA, 2*25 cm,



oxo-N-[(2-pyrimidin-2-
2H), 7.60 (s, 1H), 7.50 (d, J = 2.0 Hz,

5 μm; Mobile Phase A:



ylphenyl)methyl]-2-[2-[(2R)-3,3,3-
1H), 7.50-7.41 (m, 4H), 7.03-6.95 (m,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propyl]indazol-5-
3H), 6.70 (s, 1H), 5.22 (s, 1H), 4.70 (d,

MeOH)--HPLC, Mobile



yl]-6,8-dihydro-5H-imidazo[1,5-
J = 8.0 Hz, 1H), 4.53 (s, 1H), 4.45-4.29

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
(m, 4H), 3.86 (d, J = 8.0 Hz, 1H), 3.73 (d,

Flow rate: 20 mL/min;




J =12.0 Hz, 1H), 1.43 (d, J = 4.0

Gradient: 20% B to 20%




Hz, 3H).

B in 10 min; Wave






Length: 220/254 nm


105b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.34 (d, J = 2.0 Hz,
843
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.94-7.92 (m, 1H), 7.87-7.83 (m,

Amylose-SA, 2*25 cm,



oxo-N-[(2-pyrimidin-2-
2H), 7.60 (s, 1H), 7.50 (d, J = 2.0 Hz,

5 μm; Mobile Phase A:



ylphenyl)methyl]-2-[2-[(2R)-3,3,3-
1H), 7.50-7.41 (m, 4H), 7.03-6.95 (m,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propyl]indazol-5-
3H), 6.70 (s, 1H), 5.22 (s, 1H), 4.70 (d,

MeOH)--HPLC, Mobile



yl]-6,8-dihydro-5H-imidazo[1,5-
J = 8.0 Hz, 1H), 4.53 (s, 1H), 4.45-4.29

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
(m, 4H), 3.86 (d, J = 8.0 Hz, 1H), 3.73 (d,

Flow rate: 20 mL/min;




J = 12.0 Hz, 1H), 1.43 (d, J = 4.0

Gradient: 20% B to 20%




Hz, 3H).

B in 10 min; Wave






Length: 220/254 nm


106a
rac-(6R)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 7.85-7.78 (m, 2H),
775
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-N-[(2-
7.48-7.43 (m, 1H), 7.21-7.13 (m, 1H),

Cellulose-SB, 2*25 cm,



chloro-6-fluoro-phenyl)methyl]-6-
7.11-7.04 (m, 3H), 6.96-6.89 (m, 1H),

5 μm; Mobile Phase A:



methyl-2-[4-(6-methyl-2,6-
6.37-6.31 (m, 2H), 5.69-4.92 (m, 2H),

MtBE(0.5% 2M NH3-



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
4.72-4.58 (m, 1H), 4.57-4.46 (m, 1H),

MeOH)--HPLC, Mobile



oxo-6,8-dihydro-5H-imidazo[1,5-
4.42-4.29 (m, 1H), 3.94 (s, 4H), 3.88-

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
3.81 (m, 1H), 3.77-3.64 (m, 1H), 3.53 (s,

Flow rate: 20 mL/min;




4H), 2.42 (s, 3H), 1.44-1.33 (m, 3H).

Gradient: 50% B to 50%






B in 21 min; Wave






Length: 220/254 nm


106b
rac-(6S)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 7.85-7.78 (m, 2H),
775
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-N-[(2-
7.48-7.43 (m, 1H), 7.21-7.13 (m, 1H),

Cellulose-SB, 2*25 cm,



chloro-6-fluoro-phenyl)methyl]-6-
7.11-7.04 (m, 3H), 6.96-6.89 (m, 1H),

5 μm; Mobile Phase A:



methyl-2-[4-(6-methyl-2,6-
6.37-6.31 (m, 2H), 5.69-4.92 (m, 2H),

MtBE(0.5% 2M NH3-



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
4.72-4.58 (m, 1H), 4.57-4.46 (m, 1H),

MeOH)--HPLC, Mobile



oxo-6,8-dihydro-5H-imidazo[1,5-
4.42-4.29 (m, 1H), 3.94 (s, 4H), 3.88-

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
3.81 (m, 1H), 3.77-3.64 (m, 1H), 3.53 (s,

Flow rate: 20 mL/min;




4H), 2.42 (s, 3H), 1.44-1.33 (m, 3H).

Gradient: 50% B to 50%






B in 21 min; Wave






Length: 220/254 nm


107a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.34 (d, J = 2.0 Hz,
843
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.94-7.92 (m, 1H), 7.87-7.83 (m,

IF, 2*25 cm, 5 μm



oxo-N-[(2-pyrimidin-2-
2H), 7.60 (s, 1H), 7.50 (d, J = 2.0 Hz,

Mobile Phase A:



ylphenyl)methyl]-2-[2-[(2S)-3,3,3-
1H), 7.50-7.41 (m, 4H), 7.03-6.95 (m,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propyl]indazol-5-
3H), 6.70 (s, 1H), 5.22 (s, 1H), 4.70 (d,

MeOH)--HPLC, Mobile



yl]-6,8-dihydro-5H-imidazo[1,5-
J = 8.0 Hz, 1H), 4.53 (s, 1H), 4.45-4.29 (m,

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
4H), 3.86 (d, J = 8.0 Hz, 1H), 3.73 (d, J =

Flow rate: 20 mL/min;




12.0 Hz, 1H), 1.43 (d, J = 4.0 Hz, 3H).

Gradient: 15% B to 15%






B in 14.5 min; Wave






Length: 220/254 nm


107b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 8.34 (d, J = 2.0 Hz,
843
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.94-7.92 (m, 1H), 7.87-7.83 (m,

IF, 2*25 cm, 5 μm



oxo-N-[(2-pyrimidin-2-
2H), 7.60 (s, 1H), 7.50 (d, J = 2.0 Hz,

Mobile Phase A:



ylphenyl)methyl]-2-[2-[(2S)-3,3,3-
1H), 7.50-7.41 (m, 4H), 7.03-6.95 (m,

MtBE(0.5% 2M NH3-



trifluoro-2-hydroxy-propyl]indazol-5-
3H), 6.70 (s, 1H), 5.22 (s, 1H), 4.70 (d,

MeOH)--HPLC, Mobile



yl]-6,8-dihydro-5H-imidazo[1,5-
J = 8.0 Hz, 1H), 4.53 (s, 1H), 4.45-4.29

Phase B: EtOH--HPLC;



a]pyrazine-1-carboxamide
(m, 4H), 3.86 (d, J = 8.0 Hz, 1H), 3.73

Flow rate: 20 mL/min;




(d, J = 12.0 Hz, 1H), 1.43 (d, J = 4.0

Gradient: 15% B to 15%




Hz, 3H).

B in 14.5 min; Wave






Length: 220/254 nm


108a
rac-(6R)-2-(1,2-benzoxazol-5-yl)-7-[4-
(300 MHz, DMSO-d6) δ 11.24 (s, 1H),
732
Column: CHIRALPAK



bromo-3-(trifluoromethyl)benzoyl]-6-
8.86 (s, 2H), 7.95 (s, 3H), 7.80-7.10 (m,

IE, 2*25 cm, 5 μm



methyl-3-oxo-N-[(2-pyrimidin-2-
8H), 6.82 (m, J =8.7 Hz 1H), 5.50 (s,

Mobile Phase A: Hex:



ylphenyl)methyl]-6,8-dihydro-5H-
1H), 4.52 (s, 4H), 3.66 (s, 2H), 1.25 (s,

DCM = 3: 1(0.1% FA)--



imidazo[1,5-a]pyrazine-1-
3H).

HPLC, Mobile Phase B:



carboxamide


IPA--HPLC; Flow rate:






20 mL/min; Gradient:






20% B to 20% B in 25






min; Wave Length:






220/254 nm


108b
rac-(6S)-2-(1,2-benzoxazol-5-yl)-7-[4-
(300 MHz, DMSO-d6) δ 11.24 (s, 1H),
732
Column: CHIRALPAK



bromo-3-(trifluoromethyl)benzoyl]-6-
8.86 (s, 2H), 7.95 (s, 3H), 7.80-7.10 (m,

IE, 2*25 cm, 5 μm;



methyl-3-oxo-N-[(2-pyrimidin-2-
8H), 6.82 (m, J =8.7 Hz 1H), 5.50 (s,

Mobile Phase A: Hex:



ylphenyl)methyl]-6,8-dihydro-5H-
1H), 4.52 (s, 4H), 3.66 (s, 2H), 1.25 (s,

DCM = 3: 1(0.1% FA)--



imidazo[1,5-a]pyrazine-1-
3H).

HPLC, Mobile Phase B:



carboxamide


IPA--HPLC; Flow rate:






20 mL/min; Gradient:






20% B to 20% B in 25






min; Wave Length:






220/254 nm


109a
rac-(6R)-2-[1-(azetidin-3-yl)indazol-5-
(300 MHz, CDCl3) δ 8.29 (d, J = 2.0 Hz,
786
Column: CHIRAL ART



yl]-7-[4-bromo-3-
2H), 8.00-7.97 (m, 1H), 7.85-7.82 (m,

Cellulose-SC, 2*25 cm,



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.76 (s, 1H), 7.61 (d, J = 2.0 Hz,

5 μm; Mobile Phase A:



oxo-N-[(2-pyrimidin-2-
1H), 7.51-7.43 (m, 4H), 7.07-6.87 (m,

Hex: DCM = 1: 1(0.5%



ylphenyl)methyl]-6,8-dihydro-5H-
4H), 5.51-5.06 (m, 3H), 4.70 (d, J = 14.0

2M NH3-MeOH)--



imidazo[1,5-a]pyrazine-1-
Hz, 1H), 4.54-4.47 (m, 1H), 4.36-4.23

HPLC, Mobile Phase B:



carboxamide
(m, 3H), 4.00-3.71 (m, 4H), 1.43 (d, J =

EtOH--HPLC; Flow




4.0 Hz, 3H).

rate: 20 mL/min;






Gradient: 50% B to 50%






B in 21 min; Wave






Length: 220/254 nm


109b
rac-(6S)-2-[1-(azetidin-3-yl)indazol-5-
(300 MHz, CDCl3) δ 8.30 (d, J = 2.0 Hz,
786
Column: CHIRAL ART



yl]-7-[4-bromo-3-
2H), 8.00-7.97 (m, 1H), 7.85-7.82 (m,

Cellulose-SC, 2*25 cm,



(trifluoromethyl)benzoyl]-6-methyl-3-
2H), 7.77 (s, 1H), 7.61 (d, J = 2.0 Hz,

5 μm; Mobile Phase A:



oxo-N-[(2-pyrimidin-2-
1H), 7.54-7.43 (m, 4H), 7.01-6.87 (m,

Hex: DCM = 1: 1(0.5%



ylphenyl)methyl]-6,8-dihydro-5H-
4H), 5.53-5.07 (m, 3H), 4.70 (d, J = 14.0

2M NH3-MeOH)--



imidazo[1,5-a]pyrazine-1-
Hz, 1H), 4.54-4.45 (m, 1H), 4.36-4.27

HPLC, Mobile Phase B:



carboxamide
(m, 3H), 4.05-372 (m, 4H), 1.43 (d, J =

EtOH--HPLC; Flow




4.0 Hz, 3H).

rate: 20 mL/min;






Gradient: 50% B to 50%






B in 21 min; Wave






Length: 220/254 nm


110a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 7.87-7.70 (m, 2H),
857
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
7.63 (d, J = 2.0 Hz, 1H), 7.47-7.34 (m,

Amylose-SA, 2*25 cm,



[4-(6-methyl-2,6-
3H), 7.31 (s, 1H), 7.25-7.19 (m, 1H),

5 μm; Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
7.08-6.94 (m, 2H), 6.66 (d, J = 2.6 Hz,

MtBE(0.5% 2M NH3-



oxo-N-[[2-[3-(trifluoromethyl)pyrazol-
1H), 6.19 (d, J = 8.7 Hz, 2H), 5.84 (t, J =

MeOH)--HPLC, Mobile



1-yl]phenyl]methyl]-6,8-dihydro-5H-
6.0 Hz, 1H), 5.23 (s, 1H), 4.60 (d, J =

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
18.9 Hz, 1H), 4.33-4.20 (m, 1H), 4.19-

Flow rate: 20 mL/min;



carboxamide
4.01 (m, 1H), 3.81 (s, 6H), 3.41 (s, 4H),

Gradient: 20% B to 20%




2.35 (s, 3H), 1.40 (d, J = 7.0 Hz, 3H).

B in 32 min; Wave






Length: 220/254 nm


110b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 7.87-7.70 (m, 2H),
857
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
7.63 (d, J = 2.0 Hz, 1H), 7.47-7.34 (m,

Amylose-SA, 2*25 cm,



[4-(6-methyl-2,6-
3H), 7.31 (s, 1H), 7.25-7.19 (m, 1H),

5 μm; Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-3-
7.08-6.94 (m, 2H), 6.66 (d, J = 2.6 Hz,

MtBE(0.5% 2M NH3-



oxo-N-[[2-[3-(trifluoromethyl)pyrazol-
1H), 6.19 (d, J = 8.7 Hz, 2H), 5.84 (t, J =

MeOH)--HPLC, Mobile



1-yl]phenyl]methyl]-6,8-dihydro-5H-
6.0 Hz, 1H), 5.23 (s, 1H), 4.60 (d, J =

Phase B: EtOH--HPLC;



imidazo[1,5-a]pyrazine-1-
18.9 Hz, 1H), 4.33-4.20 (m, 1H), 4.19-

Flow rate: 20 mL/min;



carboxamide
4.01 (m, 1H), 3.81 (s, 6H), 3.41 (s, 4H),

Gradient: 20% B to 20%




2.35 (s, 3H), 1.40 (d, J = 7.0 Hz, 3H).

B in 32 min; Wave






Length: 220/254 nm


111a
(6RS)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 7.88-7.70 (m, 3H),
859
Column: (R,R)-



(trifluoromethyl)benzoyl]-2-[1-[(2R)-
7.56 (s, 1H), 7.50-7.43 (m, 1H), 7.40-

WHELK-01-Kromasil,



2-hydroxypropyl]indazol-5-yl]-6-
7.27 (m, 4H), 7.06-6.95 (m, 2H), 6.53 (s,

2.11*25 cm, 5 μm;



methyl-3-oxo-N-[[2-[1-(2,2,2-
1H), 6.35-6.26 (m, 1H), 5.55-5.05 (m,

Mobile Phase A:



trifluoroethyl)pyrazol-3-
1H), 4.75-4.45 (m, 1H), 4.50-4.26 (m,

MtBE(0.5% 2M NH3-



yl]phenyl]methyl]-6,8-dihydro-5H-
4H), 4.25-4.13 (m, 2H), 4.10-4.01 (m,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
1H), 3.91-3.81 (m, 1H), 3.78-3.63 (m,

Phase B: EtOH--HPLC;



carboxamide
1H), 1.41 (d, J = 6.9 Hz, 3H), 1.30-1.17

Flow rate: 20 mL/min;




(m, 3H).

Gradient: 40% B to 40%






B in 27 min; Wave






Length: 220/254 nm


111b
(6SR)-7-[4-bromo-3-
(400 MHz, CDCl3) δ 7.86-7.69 (m, 3H),
859
Column: (R, R)-



(trifluoromethyl)benzoyl]-2-[1-[(2R)-
7.56 (s, 1H), 7.50-7.43 (m, 1H), 7.40-

WHELK-01-Kromasil,



2-hydroxypropyl]indazol-5-yl]-6-
7.26 (m, 4H), 7.05-6.95 (m, 2H), 6.53 (s,

2.11*25 cm, 5 μm;



methyl-3-oxo-N-[[2-[1-(2,2,2-
1H), 6.35-6.26 (m, 1H), 5.55-5.05 (m,

Mobile Phase A:



trifluoroethyl)pyrazol-3-
1H), 4.75-4.45 (m, 1H), 4.50-4.26 (m,

MtBE(0.5% 2M NH3-



yl]phenyl]methyl]-6,8-dihydro-5H-
4H), 4.24-4.11 (m, 2H), 4.10-4.01 (m,

MeOH)--HPLC, Mobile



imidazo[1,5-a]pyrazine-1-
1H), 3.91-3.81 (m, 1H), 3.78-3.61 (m,

Phase B: EtOH--HPLC;



carboxamide
1H), 2.10-1.93 (m, 1H), 1.41 (d, J = 6.9

Flow rate: 20 mL/min;




Hz, 3H), 1.30-1.17 (m, 3H).

Gradient: 40% B to 40%






B in 27 min; Wave






Length: 220/254 nm


112a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.37 (s, 1H), 7.88
791
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
(m, 1H), 7.85-7.75 (m, 2H), 7.57-7.38

IF, 2*25 cm, 5 μm;



[4-(6-methyl-2,6-
(m, 4H), 6.99-6.89 (m, 2H), 6.56 (s, 1H),

Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-N-
6.25-6.15 (m, 2H), 5.27 (s, 2H), 4.82-

MtBE(0.5% 2M NH3-



[[2-(1,3,4-oxadiazol-2-
4.53 (m, 3H), 3.94 (s, 4H), 3.83 (d, J =

MeOH)--HPLC, Mobile



yl)phenyl]methyl]-3-oxo-6,8-dihydro-
12.8 Hz, 1H), 3.72-3.62 (m, 1H), 3.55 (s,

Phase B: EtOH--HPLC;



5H-imidazo[1,5-a]pyrazine-1-
4H), 2.42 (s, 3H), 1.37 (d, J = 6.9 Hz,

Flow rate: 20 mL/min;



carboxamide
3H).

Gradient: 15% B to 15%






B in 14.5 min; Wave






Length: 220/254 nm


112b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 8.37 (s, 1H), 7.88
791
Column: CHIRALPAK



(trifluoromethyl)benzoyl]-6-methyl-2-
(m, 1H), 7.85-7.75 (m, 2H), 7.57-7.38

IF, 2*25 cm, 5 μm;



[4-(6-methyl-2,6-
(m, 4H), 6.99-6.89 (m, 2H), 6.56 (s, 1H),

Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-N-
6.25-6.15 (m, 2H), 5.27 (s, 2H), 4.82-

MtBE(0.5% 2M NH3-



[[2-(1,3,4-oxadiazol-2-
4.53 (m, 3H), 3.94 (s, 4H), 3.83 (d, J =

MeOH)--HPLC, Mobile



yl)phenyl]methyl]-3-oxo-6,8-dihydro-
12.8 Hz, 1H), 3.72-3.62 (m, 1H), 3.55 (s,

Phase B: EtOH--HPLC;



5H-imidazo[1,5-a]pyrazine-1-
4H), 2.42 (s, 3H), 1.37 (d, J = 6.9 Hz,

Flow rate: 20 mL/min;



carboxamide
3H).

Gradient: 15% B to 15%






B in 14.5 min; Wave






Length: 220/254 nm


113a
rac-(6R)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 7.87-7.81 (m, 2H),
820
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
7.64-7.56 (m, 1H), 7.50-7.33 (m, 3H),

Amylose-SA, 2*25 cm,



[4-(6-methyl-2,6-
7.30-7.27 (m, 1H), 7.22-7.11 (m, 2H),

5 μm; Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-N-
6.62-6.54 (m, 2H), 6.11 (s, 1H), 5.41 (s,

MtBE(0.5% IPAmine)--



[[2-(4-methyl-5-oxo-1H-1,2,4-triazol-
1H), 4.66-4.56 (m, 1H), 4.23 (d, J = 6.2

HPLC, Mobile Phase B:



3-yl)phenyl]methyl]-3-oxo-6,8-
Hz, 2H), 4.09 (s, 4H), 3.91-3.83 (m, 1H),

EtOH--HPLC; Flow



dihydro-5H-imidazo[1,5-a]pyrazine-1-
3.69 (s, 5H), 3.18 (s, 3H), 2.48 (s, 3H),

rate: 20 mL/min;



carboxamide
1.37 (d, J = 6.9 Hz, 3H).

Gradient: 40% B to 40%






B in 24 min; Wave






Length: 220/254 nm


113b
rac-(6S)-7-[4-bromo-3-
(300 MHz, CDCl3) δ 7.87-7.81 (m, 2H),
820
Column: CHIRAL ART



(trifluoromethyl)benzoyl]-6-methyl-2-
7.64-7.56 (m, 1H), 7.50-7.33 (m, 3H),

Amylose-SA, 2*25 cm,



[4-(6-methyl-2,6-
7.30-7.27 (m, 1H), 7.22-7.11 (m, 2H),

5 μm; Mobile Phase A:



diazaspiro[3.3]heptan-2-yl)phenyl]-N-
6.62-6.54 (m, 2H), 6.11 (s, 1H), 5.41 (s,

MtBE(0.5% IPAmine)--



[[2-(4-methyl-5-oxo-1H-1,2,4-triazol-
1H), 4.66-4.56 (m, 1H), 4.23 (d, J = 6.2

HPLC, Mobile Phase B:



3-yl)phenyl]methyl]-3-oxo-6,8-
Hz, 2H), 4.09 (s, 4H), 3.91-3.83 (m, 1H),

EtOH--HPLC; Flow



dihydro-5H-imidazo[1,5-a]pyrazine-1-
3.69 (s, 5H), 3.18 (s, 3H), 2.48 (s, 3H),

rate: 20 mL/min;



carboxamide
1.37 (d, J = 6.9 Hz, 3H).

Gradient: 40% B to 40%






B in 24 min; Wave






Length: 220/254 nm

















TABLE D





Structure
Cmpd









embedded image


114







embedded image


115a







embedded image


115b







embedded image


 19a







embedded image


 19b







embedded image


116







embedded image


117







embedded image


118







embedded image


 20a







embedded image


 20b







embedded image


119







embedded image


120







embedded image


 21a







embedded image


 21b







embedded image


121







embedded image


 22a







embedded image


 22b







embedded image


 23a







embedded image


 23b







embedded image


 24a







embedded image


 24b







embedded image


 25a







embedded image


 25b







embedded image


 26a







embedded image


 26b







embedded image


122







embedded image


123







embedded image


124







embedded image


125a







embedded image


125b







embedded image


 27a







embedded image


 27b







embedded image


 28a







embedded image


 28b







embedded image


 29a







embedded image


 29b







embedded image


 30a







embedded image


 30b







embedded image


 31a







embedded image


 31b







embedded image


 32a







embedded image


 32b







embedded image


 33a







embedded image


 33b







embedded image


 34a







embedded image


 35a







embedded image


 35b







embedded image


 36a







embedded image


 36b







embedded image


 37a







embedded image


 37b







embedded image


 38a







embedded image


 38b







embedded image


 39a







embedded image


 39b







embedded image


 40a







embedded image


 40b







embedded image


 41a







embedded image


126







embedded image


 42a







embedded image


 42b







embedded image


 43a







embedded image


 43b







embedded image


 44a







embedded image


 44b







embedded image


 45a







embedded image


 45b







embedded image


 46a







embedded image


 46b







embedded image


127







embedded image


 47a







embedded image


 48a







embedded image


 48b







embedded image


 49a







embedded image


 49b







embedded image


 50a







embedded image


 50b







embedded image


 51a







embedded image


 51b







embedded image


 52a







embedded image


 52b







embedded image


 53a







embedded image


 53b







embedded image


 54a







embedded image


 54b







embedded image


128







embedded image


 56a







embedded image


 56b







embedded image


 57a







embedded image


 57b







embedded image


129







embedded image


 58a







embedded image


 58b







embedded image


 59a







embedded image


 59b







embedded image


 60a







embedded image


 60b







embedded image


 61a







embedded image


 61b







embedded image


 62a







embedded image


 62b







embedded image


 63a







embedded image


 63b







embedded image


 64a







embedded image


 64b







embedded image


 65a







embedded image


 65b







embedded image


 66a







embedded image


 66b







embedded image


 67a







embedded image


 67b







embedded image


 68a







embedded image


 68b







embedded image


 69a







embedded image


 69b







embedded image


 70a







embedded image


 70b







embedded image


 72a







embedded image


 72b







embedded image


 74a







embedded image


 74b







embedded image


 75a







embedded image


 75b







embedded image


 76a







embedded image


 76b







embedded image


 77a







embedded image


 77b







embedded image


 78a







embedded image


 78b







embedded image


 79a







embedded image


 79b







embedded image


 80a







embedded image


 80b







embedded image


 81a







embedded image


 81b







embedded image


 82a







embedded image


 82b







embedded image


 83a







embedded image


 84a







embedded image


 84b







embedded image


 83b







embedded image


 87a







embedded image


 87b







embedded image


 88a







embedded image


 88b







embedded image


 89a







embedded image


 89b







embedded image


 90a







embedded image


 90b







embedded image


 92a







embedded image


 92b







embedded image


 94a







embedded image


 94b







embedded image


 95a







embedded image


 95b







embedded image


 96a







embedded image


 96b







embedded image


 97a







embedded image


 97b







embedded image


 98a







embedded image


 98b







embedded image


 99a







embedded image


 99b







embedded image


100a







embedded image


100b







embedded image


101a







embedded image


101b







embedded image


102a







embedded image


102b







embedded image


103a







embedded image


103b







embedded image


104a







embedded image


104b







embedded image


105a







embedded image


105b







embedded image


106a







embedded image


106b







embedded image


107a







embedded image


107b







embedded image


108a







embedded image


108b







embedded image


109a







embedded image


109b







embedded image


130







embedded image


110a







embedded image


110b







embedded image


131







embedded image


111a







embedded image


111b







embedded image


132a







embedded image


132b







embedded image


112a







embedded image


112b







embedded image


113a







embedded image


113b







embedded image


133









Example A
HBV-DNA Antiviral Assay Using HepG2.117 Cells

The following assay procedure describes the HBV antiviral assay, using HepG2.117 cells, which carry a stably integrated genotype D HBV genome under the control of a Tet-off promoter, and intracellular HBV DNA quantification as endpoint. Cell viability is assessed in parallel by measuring the intracellular ATP content using ATPlite (Perkin Elmer).


On day 0, HepG2.117 cells (which are maintained in routine cell culture with doxycycline present in the medium at a final concentration of 1 μg/mL) were seeded in 96-well plates (white with clear bottom) at a density of 2.0×104 cells/well (0.1 mL/well) in medium without doxycycline to induce pgRNA transcription and subsequent formation of HBV particles. The cells were incubated at 37° C. and 5% CO2.


On day 1, medium was removed from each well, the test articles were diluted in culture medium without doxcycyline and 100 μL was added to cell culture wells (9 concentrations, 4-fold dilution). For each plate, 6 untreated (merely DMSO) wells were included. The final concentration of DMSO in the culture medium was 2%. Each plate was prepared in duplicate (one for HBV DNA extraction, one for ATPlite measurement). The cells were incubated at 37° C. and 5% CO2 for 3 days. The plate map of compound treatment is shown in FIG. 1.


On day 4, cell viability was assessed using ATPlite and cell lysates were prepared for HBV DNA extraction and subsequent quantification by qPCR.


HBV DNA Quantification by qPCR


Medium was removed from each well and 100 μL of 0.33% NP-40 in H2O was added to each well. Plates were sealed, incubated at 4° C. for 5 mins, vortexed extensively and centrifuged briefly. Next, 35 μL of lysate was added to 65 μL QuickExtract DNA Extraction Solution (Epicentre) in a PCR plate for each well. PCR plate was incubated at 65° C. for 6 mins, 98° C. for 2 mins and finally cooled to 4° C. HBV DNA was then quantified by qPCR with HBV-specific primers and probes as specified in Table 1 using the Bio-Rad SSOAdvanced Universal Probes Supermix on a CFX96 machine (Bio-Rad). The PCR cycle program consisted of 95° C. for 3 mins, followed by 40 cycles at 95° C. for 10 sec and 60° C. for 30 sec.









TABLE 1







HBV DNA Primers and Probe for HepG2.117 assay









Items
Name
Sequence (5′→3′)





HBV
HBV-
GTGTCTGCGGCGTTTTATCA (SEQ ID NO: 1)


Primer
forward




HBV-
GACAAACGGGCAACATACCTT (SEQ ID NO: 2)



reverse






HBV
HBV
FAM/CCTCTKCAT/ZEN/


Probe
probe
CCTGCTGCTATGCCTCATC/3IABkFQ/ 




(SEQ ID NO: 3)









A DNA standard was prepared by dilution of an IDT gBlock corresponding to the amplicon with concentrations ranging from 10{circumflex over ( )}2 to 10{circumflex over ( )}8 copies/input (i.e. per 4 μL) and used to generate a standard curve by plotting Cq values vs. HBV DNA standard concentration. The quantity of HBV DNA in each sample was determined by interpolating from the standard curve.


Cell Viability

Using the other plates, the cell viability was quantified by ATPlite according to the manufacturer's manual. In brief, 50 μL of cell lysis solution was added to the culture plates and shaken for 5′, followed by addition of 50 μL substrate into each well and further shaking. The plates were incubated at room temperature for 10 mins and luminescence signal was subsequently measured on a VarioSkan Lux (ThermoFisher) plate reader.


Data Analysis

Cell viability was calculated as follows: % Cell viability=(luminescence value of test sample)/(average luminescence value of 2% DMSO control)×100%. HBV DNA inhibition was calculated as follows: 100−(HBV DNA copy number of test sample)/(average HBV DNA copy number of 2% DMSO control)×100%. No normalization to entecavir was required due to the excellent dynamic window of this assay. The CC50, EC50 and EC90 values were determined by dose-response curves fitted using non-linear regression.


As shown in Table 2, compounds of Formula (I) are active against HBV, where ‘A’ indicates an EC50≤50 nM, ‘B’ indicates an EC50>50 nM and ≤500 nM, ‘C’ indicates an EC50>500 nM and ≤5000 nM, and ‘D’ indicates an EC50>5000 nM. Cell viability assessments indicated a large window between effective antiviral concentrations and cytotoxic compound concentrations.












TABLE 2







Compound
EC50









  1a
B



  1b
A



  2a
B



  2b
A



  3a
A



  3b
B



  4a
B



  4h
A



  5a
C



  6a
B



  6b
A



  7a
B



  7b
A



  8a
B



  8b
A



  9a
B



  9b
A



 10a
C



 10b
B



 11a
A



 11b
B



 12a
B



 12b
A



 13a
B



 13b
A



 14a
B



 14b
A



 15a
B



 15b
A



 16a
B



 16b
A



 17a
B



 17b
A



 18a
B



 18b
A



 19a
C



 19b
B



 20a
C



 20b
B



 21a
A



 21b
B



 22a
B



 22b
A



 23a
B



 23b
A



 24a
B



 24b
A



 25a
B



 25b
A



 26a
A



 26b
A



 27a
A



 27b
A



 28a
A



 28b
A



 29a
A



 29b
A



 30a
B



 30b
A



 31a
B



 31b
A



 32a
A



 32b
A



 33a
B



 33b
A



 34a
A



 35a
B



 35b
A



 36a
A



 36b
A



 37a
B



 37b
A



 38a
A



 38b
A



 39a
B



 39b
A



 40a
A



 40b
A



 41a
A



 42a
C



 42b
B



 43a
C



 43b
B



 44a
B



 44b
A



 45a
B



 45b
B



 46a
B



 46b
A



 47a
A



 48a
B



 48b
A



 49a
B



 49b
B



 50a
B



 50b
A



 51a
B



 51b
A



 52a
B



 52b
A



 53a
B



 53b
B



 54a
A



 54b
B



 55a
B



 55b
A



 56a
C



 56b
B



 57a
B



 57b
B



 58a
B



 58b
A



 59a
A



 59b
A



 60a
B



 60b
A



 61a
A



 61b
A



 62a
A



 62b
B



 63a
A



 63b
B



 64a
A



 64b
B



 65a
A



 65b
B



 66a
B



 66b
B



 67a
B



 67b
A



 68a
A



 68b
A



 69a
A



 69b
B



 70a
B



 70b
A



 71a
A



 71b
B



 72a
A



 72b
B



 73a
C



 73b
B



 74a
B



 74b
A



 75a
A



 75b
B



 76a
C



 76b
C



 77a
A



 77b
B



 78a
A



 78b
B



 79a
B



 79b
A



 80a
B



 80b
B



 81a
B



 81b
A



 82a
B



 82b
A



 83a
B



 83b
B



 84a
B



 84b
A



 85a
B



 85b
B



 85c
B



 85d
B



 87a
B



 87b
A



 88a
A



 88b
B



 89a
A



 89b
A



 90a
B



 90b
B



 91a
B



 91b
B



 92a
C



 92b
C



 93a
C



 93b
B



 94a
B



 94b
B



 95a
B



 95b
B



 96a
A



 96b
A



 97a
B



 97b
A



 98a
B



 98b
C



 99a
B



 99b
B



 100a
A



 100b
A



 101a
B



 101b
A



 102a
B



 102b
A



 103a
B



 103b
A



 104a
A



 104b
B



 105a
A



 105b
B



 106a
B



 106b
B



 107a
B



 107b
B



 108a
C



 108b
C



 109a
C



 109b
C



 110a
B



 110b
B



 111a
B



 111b
B



 112a
C



 112b
C



 113a
nd



 113b
nd



114
B



 115a
B



 115b
B



116
B



117
B



118
B



119
B



120
B



121
B



122
B



123
C



124
C



125a
B



125b
B



126
C



127
C



128
B



129
B



130
C



131
C



 132a
C



 132b
C







nd = no data






Although the foregoing has been described in some detail by way of illustrations and examples for purposes of clarity and understanding, it will be understood by those of skill in the art that numerous and various modifications can be made without departing from the spirit of the present disclosure. Therefore, it should be clearly understood that the forms disclosed herein are illustrative only and are not intended to limit the scope of the present disclosure, but rather to also cover all modification and alternatives coming with the true scope and spirit of the present disclosure.

Claims
  • 1. A compound of Formula (I), or a pharmaceutically acceptable salt thereof, having the structure:
  • 2. The compound of claim 1, wherein R6 is selected from the group consisting of an unsubstituted or a substituted pyrazole, an unsubstituted or a substituted imidazole, an unsubstituted or a substituted oxazole, an unsubstituted or a substituted 1,3,4-oxadiazole, an unsubstituted or a substituted pyridine, an unsubstituted or a substituted pyrimidine, an unsubstituted or a substituted pyrazine, an unsubstituted or a substituted pyridazine and an unsubstituted or a substituted 1,2,4-triazine.
  • 3. The compound of claim 1, wherein R5 is
  • 4. The compound of claim 1, wherein R5 is
  • 5. The compound of claim 1, wherein R5 is selected from the group consisting of:
  • 6.-10. (canceled)
  • 11. The compound of claim 1, wherein R1 is 3,4-disubstituted phenyl, wherein each substitution group on the phenyl is independently selected from the group consisting of fluoro, chloro, bromo, —CHF2, —CF3, —CH3, —CN and —C≡CH.
  • 12. The compound of claim 11, wherein R1 is selected from the group consisting of:
  • 13. (canceled)
  • 14. The compound of claim 1, wherein R1 is trisubstituted phenyl, wherein each substitution group on the phenyl is independently selected from the group consisting of fluoro, chloro, bromo, —CHF2, —CF3, —CH3, —CN and —C≡CH.
  • 15.-18. (canceled)
  • 19. The compound of claim 1, wherein R4 is —CH3.
  • 20.-24. (canceled)
  • 25. The compound of claim 1, wherein R3 is a substituted phenyl.
  • 26. (canceled)
  • 27. The compound of claim 1, wherein R3 is a substituted bicyclic heteroaryl.
  • 28. The compound of claim 1, wherein R3 is selected from the group consisting of:
  • 29. The compound of claim 1, wherein R3 is selected from the group consisting of:
  • 30. The compound of claim 1, wherein R6 is halogen; n is 1; and R7 is halogen.
  • 31. The compound of claim 1 selected from the group consisting of:
  • 32. The compound of claim 1 selected from the group consisting of:
  • 33. (canceled)
  • 34. (canceled)
  • 35. A compound selected from the group consisting of:
  • 36. A pharmaceutical composition comprising an effective amount of a compound of claim 1, or a pharmaceutically acceptable salt thereof, and excipient.
  • 37.-46. (canceled)
  • 47. A method for treating hepatitis B in a subject comprising administering to the subject in need thereof an effective amount of a compound of claim 1, or a pharmaceutically acceptable salt thereof, suffering from hepatitis B.
  • 48. A method for treating hepatitis D in a subject comprising administering to the subject in need thereof an effective amount of a compound of claim 1, or a pharmaceutically acceptable salt thereof, suffering from hepatitis D.
  • 49. The method of claim 47, further comprising administering an additional agent selected from the group consisting of an interferon, a nucleoside analog, a nucleotide analog, a sequence specific oligonucleotide, a nucleic acid polymer, an entry inhibitor and a small molecule immunomodulator.
  • 50.-51. (canceled)
INCORPORATION BY REFERENCE TO ANY PRIORITY APPLICATIONS

Any and all applications for which a foreign or domestic priority claim is identified, for example, in the Application Data Sheet or Request as filed with the present application, are hereby incorporated by reference under 37 CFR 1.57, and Rules 4.18 and 20.6, including U.S. Provisional Application No. 63/092,309, filed Oct. 15, 2020.

Provisional Applications (1)
Number Date Country
63092309 Oct 2020 US