Biomarkers and methods for determining sensitivity to epidermal growth factor receptor modulators

FIELD OF THE INVENTION

The present invention relates generally to the field of pharmacogenomics, and more specifically to methods and procedures to determine sensitivity in patients to allow the development of individualized genetic profiles which aid in treating diseases and disorders based on patient response at a molecular level.

BACKGROUND OF THE INVENTION

Cancer is a disease with extensive histoclinical heterogeneity. Although conventional histological and clinical features have been correlated to prognosis, the same apparent prognostic type of tumors varies widely in its responsiveness to therapy and consequent survival of the patient.

New prognostic and predictive markers, which would facilitate an individualization of therapy for each patient, are needed to accurately predict patient response to treatments, such as small molecule or biological molecule drugs, in the clinic. The problem may be solved by the identification of new parameters that could better predict the patient's sensitivity to treatment. The classification of patient samples is a crucial aspect of cancer diagnosis and treatment. The association of a patient's response to a treatment with molecular and genetic markers can open up new opportunities for treatment development in non-responding patients, or distinguish a treatment's indication among other treatment choices because of higher confidence in the efficacy. Further, the pre-selection of patients who are likely to respond well to a medicine, drug, or combination therapy may reduce the number of patients needed in a clinical study or accelerate the time needed to complete a clinical development program (M. Cockett et al., 2000, Current Opinion in Biotechnology, 11:602-609).

The ability to predict drug sensitivity in patients is particularly challenging because drug responses reflect not only properties intrinsic to the target cells, but also a host's metabolic properties. Efforts to use genetic information to predict drug sensitivity have primarily focused on individual genes that have broad effects, such as the multidrug resistance genes, mdr1 and mrp1 (P. Sonneveld, 2000, J. Intern. Med., 247:521-534).

The development of microarray technologies for large scale characterization of gene mRNA expression pattern has made it possible to systematically search for molecular markers and to categorize cancers into distinct subgroups not evident by traditional histopathological methods (J. Khan et al., 1998, Cancer Res., 58:5009-5013; A. A. Alizadeh et al., 2000, Nature, 403:503-511; M. Bittner et al., 2000, Nature, 406:536-540; J. Khan et al., 2001, Nature Medicine, 7(6):673-679; and T. R. Golub et al., 1999, Science, 286:531-537; U. Alon et al., 1999, Proc. Natl. Acad. Sci. USA, 96:6745-6750). Such technologies and molecular tools have made it possible to monitor the expression level of a large number of transcripts within a cell population at any given time (see, e.g., Schena et al., 1995, Science, 270:467-470; Lockhart et al., 1996, Nature Biotechnology, 14:1675-1680; Blanchard et al., 1996, Nature Biotechnology, 14:1649; U.S. Pat. No. 5,569,588 to Ashby et al.).

Recent studies demonstrate that gene expression information generated by microarray analysis of human tumors can predict clinical outcome (L. J. van't Veer et al., 2002, Nature, 415:530-536; M. West et al., 2001, Proc. Natl. Acad. Sci. USA, 98:11462-11467; T. Sorlie et al., 2001, Proc. Natl. Acad. Sci USA, 98:10869-10874; M. Shipp et al., 2002, Nature Medicine, 8(1):68-74). These findings bring hope that cancer treatment will be vastly improved by better predicting the response of individual tumors to therapy.

Needed are new and alternative methods and procedures to determine drug sensitivity in patients to allow the development of individualized genetic profiles which are necessary to treat diseases and disorders based on patient response at a molecular level.

SUMMARY OF THE INVENTION

The invention provides methods and procedures for determining patient sensitivity to one or more Epidermal Growth Factor Receptor (EGFR) modulators. The invention also provides methods of determining or predicting whether an individual requiring therapy for a disease state such as cancer will or will not respond to treatment, prior to administration of the treatment, wherein the treatment comprises one or more EGFR modulators. The one or more EGFR modulators are compounds that can be selected from, for example, one or more EGFR specific ligands, one or more small molecule EGFR inhibitors, or one or more EGFR binding monoclonal antibodies.

In one aspect, the invention provides a method for identifying a mammal that will respond therapeutically to a method of treating cancer comprising administering an EGFR modulator, wherein the method comprises: (a) measuring in the mammal the level of at least one biomarker selected from the biomarkers of Table 4; (b) exposing the mammal to the EGFR modulator; (c) following the exposing of step (b), measuring in the mammal the level of the at least one biomarker, wherein a difference in the level of the at least one biomarker measured in step (c) compared to the level of the at least one biomarker measured in step (a) indicates that the mammal will respond therapeutically to said method of treating cancer.

As used herein, respond therapeutically refers to the alleviation or abrogation of the cancer. This means that the life expectancy of an individual affected with the cancer will be increased or that one or more of the symptoms of the cancer will be reduced or ameliorated. The term encompasses a reduction in cancerous cell growth or tumor volume. Whether a mammal responds therapeutically can be measured by many methods well known in the art, such as PET imaging.

The at least one biomarker can also be selected from the biomarkers of Table 5. The mammal can be, for example, a human, rat, mouse, dog rabbit, pig sheep, cow, horse, cat, primate, or monkey.

The method of the invention can be, for example, an in vitro method and wherein the at least one biomarker is measured in at least one mammalian biological sample from the mammal. The biological sample can comprise, for example, at least one of whole fresh blood, peripheral blood mononuclear cells, frozen whole blood, fresh plasma, frozen plasma, urine, saliva, skin, hair follicle, or tumor tissue.

In another aspect, the invention provides a method for identifying a mammal that will respond therapeutically to a method of treating cancer comprising administering an EGFR modulator, wherein the method comprises: (a) exposing the mammal to the EGFR modulator; (b) following the exposing of step (a), measuring in the mammal the level of the at least one biomarker selected from the biomarkers of Table 4, wherein a difference in the level of the at least one biomarker measured in step (b), compared to the level of the biomarker in a mammal that has not been exposed to said EGFR modulator, indicates that the mammal will respond therapeutically to said method of treating cancer.

In yet another aspect, the invention provides a method for testing or predicting whether a mammal will respond therapeutically to a method of treating cancer comprising administering an EGFR modulator, wherein the method comprises: (a) measuring in the mammal the level of at least one biomarker selected from the biomarkers of Table 4; (b) exposing the mammal to the EGFR modulator; (c) following the exposing of step (b), measuring in the mammal the level of the at least one biomarker, wherein a difference in the level of the at least one biomarker measured in step (c) compared to the level of the at least one biomarker measured in step (a) indicates that the mammal will respond therapeutically to said method of treating cancer.

In another aspect, the invention provides a method for determining whether a compound inhibits EGFR activity in a mammal, comprising: (a) exposing the mammal to the compound; and (b) following the exposing of step (a), measuring in the mammal the level of at least one biomarker selected from the biomarkers of Table 4, wherein a difference in the level of said biomarker measured in step (b), compared to the level of the biomarker in a mammal that has not been exposed to said compound, indicates that the compound inhibits EGFR activity in the mammal.

In yet another aspect, the invention provides a method for determining whether a mammal has been exposed to a compound that inhibits EGFR activity, comprising (a) exposing the mammal to the compound; and (b) following the exposing of step (a), measuring in the mammal the level of at least one biomarker selected from the biomarkers of Table 4, wherein a difference in the level of said biomarker measured in step (b), compared to the level of the biomarker in a mammal that has not been exposed to said compound, indicates that the mammal has been exposed to a compound that inhibits EGFR activity.

In another aspect, the invention provides a method for determining whether a mammal is responding to a compound that inhibits EGFR activity, comprising (a) exposing the mammal to the compound; and (b) following the exposing of step (a), measuring in the mammal the level of at least one biomarker selected from the biomarkers of Table 4, wherein a difference in the level of said biomarker measured in step (b), compared to the level of the biomarker in a mammal that has not been exposed to said compound, indicates that the mammal is responding to the compound that inhibits EGFR activity.

As used herein, “responding” encompasses responding by way of a biological and cellular response, as well as a clinical response (such as improved symptoms, a therapeutic effect, or an adverse event), in a mammal The invention also provides an isolated biomarker selected from the biomarkers of Table 4. The biomarkers of the invention comprise sequences selected from the nucleotide and amino acid sequences provided in Table 4 and the Sequence Listing, as well as fragments and variants thereof.

The invention also provides a biomarker set comprising two or more biomarkers selected from the biomarkers of Table 4.

The invention also provides kits for determining or predicting whether a patient would be susceptible or resistant to a treatment that comprises one or more EGFR modulators. The patient may have a cancer or tumor such as, for example, a colon cancer or tumor.

In one aspect, the kit comprises a suitable container that comprises one or more specialized microarrays of the invention, one or more EGFR modulators for use in testing cells from patient tissue specimens or patient samples, and instructions for use. The kit may further comprise reagents or materials for monitoring the expression of a biomarker set at the level of mRNA or protein.

In another aspect, the invention provides a kit comprising two or more biomarkers selected from the biomarkers of Table 4.

In yet another aspect, the invention provides a kit comprising at least one of an antibody and a nucleic acid for detecting the presence of at least one of the biomarkers selected from the biomarkers of Table 4. In one aspect, the kit further comprises instructions for determining whether or not a mammal will respond therapeutically to a method of treating cancer comprising administering a compound that inhibits EGFR activity. In another aspect, the instructions comprise the steps of (a) measuring in the mammal the level of at least one biomarker selected from the biomarkers of Table 4, (b) exposing the mammal to the compound, (c) following the exposing of step (b), measuring in the mammal the level of the at least one biomarker, wherein a difference in the level of the at least one biomarker measured in step (c) compared to the level of the at least one biomarker measured in step (a) indicates that the mammal will respond therapeutically to said method of treating cancer.

The invention also provides screening assays for determining if a patient will be susceptible or resistant to treatment with one or more EGFR modulators.

The invention also provides a method of monitoring the treatment of a patient having a disease treatable by one or more EGFR modulators.

The invention also provides individualized genetic profiles which are necessary to treat diseases and disorders-based on patient response at a molecular level.

The invention also provides specialized microarrays, e.g., oligonucleotide microarrays or cDNA microarrays, comprising one or more biomarkers having expression profiles that correlate with either sensitivity or resistance to one or more EGFR modulators. The invention also provides antibodies, including polyclonal or monoclonal, directed against one or more biomarkers of the invention.

The invention will be better understood upon a reading of the detailed description of the invention when considered in connection with the accompanying figures.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 illustrates a EGFR biomarker identification and prioritization strategy.

FIG. 2A illustrates the RT-PCR results for EGFR in thirty one colon cancer cell lines to identify cell lines which do not have significant mRNA expression of EGFR.

FIG. 2B illustrates the IC₅₀profile for twenty two colon cancer cell lines with an EGFR inhibitor compound, and determination of sensitive and resistant cell lines.

DETAILED DESCRIPTION OF THE INVENTION

The invention provides biomarkers that respond to the modulation of a specific signal transduction pathway and also correlate with EGFR modulator sensitivity or resistance. These biomarkers can be employed for predicting response to one or more EGFR modulators. In one aspect, the biomarkers of the invention are those provided in Table 4 and the Sequence Listing, including both polynucleotide and polypeptide sequences.

The biomarkers were determined by an in vitro assay employing microarray technology to monitor simultaneously the expression pattern of thousands of discrete genes in untreated cells, whose response to the modulation of a signal transduction pathway, in particular the EGFR pathway, was tested on untreated cells whose sensitivity to EGFR modulators was tested. The biomarkers have expression levels in the cells that are dependent on the activity of the EFGR signal transduction pathway and that are also highly correlated with EGFR modulator sensitivity exhibited by the cells. Biomarkers serve as useful molecular tools for predicting a response to EGFR modulators, preferably biological molecules, small molecules, and the like that affect EGFR kinase activity via direct or indirect inhibition or antagonism of EGFR kinase function or activity.

EGFR Modulators

As used herein, the term “EGFR modulator” is intended to mean a compound or drug that is a biological molecule or a small molecule that directly or indirectly modulates EGFR activity or the EGFR signal transduction pathway. Thus, compounds or drugs as used herein is intended to include both small molecules and biological molecules. Direct or indirect modulation includes activation or inhibition of EGFR activity or the EGFR signal transduction pathway. In one aspect, inhibition refers to inhibition of the binding of EGFR to an EGFR ligand such as, for example, EGF. In another aspect, inhibition refers to inhibition of the kinase activity of EGFR.

EGFR modulators include, for example, EGFR specific ligands, small molecule EGFR inhibitors, and EGFR monoclonal antibodies. In one aspect, the EGFR modulator inhibits EGFR activity and/or inhibits the EGFR signal transduction pathway. In another aspect, the EGFR modulator is an EGFR antibody that inhibits EGFR activity and/or inhibits the EGFR signal transduction pathway.

EGFR modulators include biological molecules or small molecules. Biological molecules include all lipids and polymers of monosaccharides, amino acids, and nucleotides having a molecular weight greater than 450. Thus, biological molecules include, for example, oligosaccharides and polysaccharides; oligopeptides, polypeptides, peptides, and proteins; and oligonucleotides and polynucleotides. Oligonucleotides and polynucleotides include, for example, DNA and RNA.

Biological molecules further include derivatives of any of the molecules described above. For example, derivatives of biological molecules include lipid and glycosylation derivatives of oligopeptides, polypeptides, peptides, and proteins.

Derivatives of biological molecules further include lipid derivatives of oligosaccharides and polysaccharides, e.g., lipopolysaccharides. Most typically, biological molecules are antibodies, or functional equivalents of antibodies. Functional equivalents of antibodies have binding characteristics comparable to those of antibodies, and inhibit the growth of cells that express EGFR. Such functional equivalents include, for example, chimerized, humanized, and single chain antibodies as well as fragments thereof.

Functional equivalents of antibodies also include polypeptides with amino acid sequences substantially the same as the amino acid sequence of the variable or hypervariable regions of the antibodies. An amino acid sequence that is substantially the same as another sequence, but that differs from the other sequence by means of one or more substitutions, additions, and/or deletions, is considered to be an equivalent sequence. Preferably, less than 50%, more preferably less than 25%, and still more preferably less than 10%, of the number of amino acid residues in a sequence are substituted for, added to, or deleted from the protein.

The functional equivalent of an antibody is preferably a chimerized or humanized antibody. A chimerized antibody comprises the variable region of a non-human antibody and the constant region of a human antibody. A humanized antibody comprises the hypervariable region (CDRs) of a non-human antibody. The variable region other than the hypervariable region, e.g., the framework variable region, and the constant region of a humanized antibody are those of a human antibody.

Suitable variable and hypervariable regions of non-human antibodies may be derived from antibodies produced by any non-human mammal in which monoclonal antibodies are made. Suitable examples of mammals other than humans include, for example, rabbits, rats, mice, horses, goats, or primates.

Functional equivalents further include fragments of antibodies that have binding characteristics that are the same as, or are comparable to, those of the whole antibody. Suitable fragments of the antibody include any fragment that comprises a sufficient portion of the hypervariable (i.e., complementarity determining) region to bind specifically, and with sufficient affinity, to EGFR tyrosine kinase to inhibit growth of cells that express such receptors.

Such fragments may, for example, contain one or both Fab fragments or the F(ab′)₂fragment. Preferably, the antibody fragments contain all six complementarity determining regions of the whole antibody, although functional fragments containing fewer than all of such regions, such as three, four, or five CDRs, are also included.

In one aspect, the fragments are single chain antibodies, or Fv fragments. Single chain antibodies are polypeptides that comprise at least the variable region of the heavy chain of the antibody linked to the variable region of the light chain, with or without an interconnecting linker. Thus, Fv fragment comprises the entire antibody combining site. These chains may be produced in bacteria or in eukaryotic cells.

The antibodies and functional equivalents may be members of any class of immunoglobulins, such as IgG, IgM, IgA, IgD, or IgE, and the subclasses thereof. In one aspect, the antibodies are members of the IgG1 subclass. The functional equivalents may also be equivalents of combinations of any of the above classes and subclasses.

In one aspect, EGFR antibodies can be selected from chimerized, humanized, fully human, and single chain antibodies derived from the murine antibody 225 described in U.S. Pat. No. 4,943,533 to Mendelsohn et al. In one aspect, the 225 derived antibodies have the following hypervariable (CDR) regions of the light and heavy chain, wherein the amino acid sequences are indicated below the nucleotide sequences:

Heavy Chain Hypervarlible Regions (VH):

CDR1AACTATGGTGTACAC(SEQ ID NO: 179)N Y G V H(SEQ ID NO: 180)CDR2GTGATATGGAGTGGTGGAAACACAGACTATAATACACCTTTCACATCC(SEQ ID NO: 181)V I W S G G N T D Y N T P F T S(SEQ ID NO: 182)CDR3GCCCTCACCTACTATGATTACGAGTTTGCTTAC(SEQ ID NO: 183)A L T Y Y D Y E F A Y(SEQ ID NO: 184)LIGHT CHAIN HYPERVARIABLE REGIONS (VL):CDR1AGGGCCAGTCAGAGTATTGGCACAAACATACAC(SEQ ID NO: 185)R A S Q S I G T N I H(SEQ ID NO: 186)CDR2GCTTCTGAGTCTATCTCT(SEQ ID NO: 187)A S E S I S(SEQ ID NO: 188)CDR3CAACAAAATAATAACTGGCCAACCACG(SEQ ID NO: 189)Q Q N N N W P T T(SEQ ID NO: 190)

In another aspect, the EGFR antibody can be selected from the antibodies described in U.S. Pat. No. 6,235,883 to Jakobovits et al., U.S. Pat. No. 5,558,864 to Bendi et al., and U.S. Pat. No. 5,891,996 to Mateo de Acosta del Rio et al.

In addition to the biological molecules discussed above, the EGFR modulators useful in the invention may also be small molecules. Any molecule that is not a biological molecule is considered herein to be a small molecule. Some examples of small molecules include organic compounds, organometallic compounds, salts of organic and organometallic compounds, saccharides, amino acids, and nucleotides. Small molecules further include molecules that would otherwise be considered biological molecules, except their molecular weight is not greater than 450. Thus, small molecules may be lipids, oligosaccharides, oligopeptides, and oligonucleotides and their derivatives, having a molecular weight of 450 or less.

It is emphasized that small molecules can have any molecular weight. They are merely called small molecules because they typically have molecular weights less than 450. Small molecules include compounds that are found in nature as well as synthetic compounds. In one embodiment, the EGFR modulator is a small molecule that inhibits the growth of tumor cells that express EGFR. In another embodiment, the EGFR modulator is a small molecule that inhibits the growth of refractory tumor cells that express EGFR.

Numerous small molecules have been described as being useful to inhibit EGFR. For example, U.S. Pat. No. 5,656,655 to Spada et al. discloses styryl substituted heteroaryl compounds that inhibit EGFR. The heteroaryl group is a monocyclic ring with one or two heteroatoms, or a bicyclic ring with 1 to about 4 heteroatoms, the compound being optionally substituted or polysubstituted.

U.S. Pat. No. 5,646,153 to Spada et al. discloses bis mono and/or bicyclic aryl heteroaryl, carbocyclic, and heterocarbocyclic compounds that inhibit EGFR.

U.S. Pat. No. 5,679,683 to Bridges et al. discloses tricyclic pyrimidine compounds that inhibit the EGFR. The compounds are fused heterocyclic pyrimidine derivatives described at column 3, line 35 to column 5, line 6.

U.S. Pat. No. 5,616,582 to Barker discloses quinazoline derivatives that have receptor tyrosine kinase inhibitory activity.

Fry et al., Science 265, 1093-1095 (1994) in FIG. 1 discloses a compound having a structure that inhibits EGFR.

Osherov et al. disclose tyrphostins that inhibit EGFR/HER1 and HER 2, particularly those in Tables I, II, III, and IV.

U.S. Pat. No. 5,196,446 to Levitzki et al. discloses heteroarylethenediyl or heteroarylethendeiylaryl compounds that inhibit EGFR, particularly from column 2, line 42 to column 3, line 40.

Panek et al., Journal of Pharmacology and Experimental Therapeutics 283, 1433-1444 (1997) discloses a compound identified as PD166285 that inhibits the EGFR, PDGFR, and FGFR families of receptors. PD166285 is identified as 6-(2,6-dichlorophenyl)-2-(4-(2-diethylaminoethyoxy)phenylamino)-8-methyl-8H-pyrido(2,3-d)pyrimidin-7-one having the structure shown in FIG. 1 on page 1436.

Biomarkers and Biomarker Sets

The invention includes individual biomarkers and biomarker sets having both diagnostic and prognostic value in disease areas in which signaling through EGFR or the EGFR pathway is of importance, e.g., in cancers or tumors, in immunological disorders, conditions or dysfunction, or in disease states in which cell signaling and/or cellular proliferation controls are abnormal or aberrant. The biomarker sets comprise a plurality of biomarkers such as, for example, a plurality of the biomarkers provided in Table 4 below, that highly correlate with resistance or sensitivity to one or more EGFR modulators.

The biomarker sets of the invention enable one to predict or reasonably foretell the likely effect of one or more EGFR modulators in different biological systems or for cellular responses. The biomarker sets can be used in in vitro assays of EGFR modulator response by test cells to predict in vivo outcome. In accordance with the invention, the various biomarker sets described herein, or the combination of these biomarker sets with other biomarkers or markers, can be used, for example, to predict how patients with cancer might respond to therapeutic intervention with one or more EGFR modulators.

A biomarker set of cellular gene expression patterns correlating with sensitivity or resistance of cells following exposure of the cells to one or more EGFR modulators provides a useful tool for screening one or tumor samples before treatment with the EGFR modulator. The screening allows a prediction of cells of a tumor sample exposed to one or more EGFR modulators, based on the expression results of the biomarker set, as to whether or not the tumor, and hence a patient harboring the tumor, will or will not respond to treatment with the EGFR modulator.

The biomarker or biomarker set can also be used as described herein for monitoring the progress of disease treatment or therapy in those patients undergoing treatment for a disease involving an EGFR modulator.

The biomarkers serve as targets for the development of therapies for disease treatment Such targets may be particularly applicable to treatment of breast disease, such as breast cancers or tumors. Indeed, because these biomarkers are differentially expressed in sensitive and resistant cells, their expression patterns are correlated with relative intrinsic sensitivity of cells to treatment with EGFR modulators. Accordingly, the biomarkers highly expressed in resistant cells may serve as targets for the development of new therapies for the tumors which are resistant to EGFR modulators, particularly EGFR inhibitors.

Microarrays

The invention also includes specialized microarrays, e.g., oligonucleotide microarrays or cDNA microarrays, comprising one or more biomarkers, showing expression profiles that correlate with either sensitivity or resistance to one or more EGFR modulators. Such microarrays can be employed in in vitro assays for assessing the expression level of the biomarkers in the test cells from tumor biopsies, and determining whether these test cells are likely to be resistant or sensitive to EGFR modulators. For example, a specialized microarray can be prepared using all the biomarkers, or subsets thereof, as described herein and shown in Table 4. Cells from a tissue or organ biopsy can be isolated and exposed to one or more of the EGFR modulators. Following application of nucleic acids isolated from both untreated and treated cells to one or more of the specialized microarrays, the pattern of gene expression of the tested cells can be determined and compared with that of the biomarker pattern from the control panel of cells used to create the biomarker set on the microarray. Based upon the gene expression pattern results from the cells that underwent testing, it can be determined if the cells show a resistant or a sensitive profile of gene expression. Whether or not the tested cells from a tissue or organ biopsy will respond to one or more of the EGFR modulators and the course of treatment or therapy can then be determined or evaluated based on the information gleaned from the results of the specialized microarray analysis.

Antibodies

The invention also includes antibodies, including polyclonal or monoclonal, directed against one or more of the polypeptide biomarkers. Such antibodies can be used in a variety of ways, for example, to purify, detect, and target the biomarkers of the invention, including both in vitro and in vivo diagnostic, detection, screening, and/or therapeutic methods.

Kits

The invention also includes kits for determining or predicting whether a patient would be susceptible or resistant to a treatment that comprises one or more EGFR modulators. The patient may have a cancer or tumor such as, for example, a breast cancer or tumor. Such kits would be useful in a clinical setting for use in testing a patient's biopsied tumor or cancer samples, for example, to determine or predict if the patient's tumor or cancer will be resistant or sensitive to a given treatment or therapy with an EGFR modulator. The kit comprises a suitable container that comprises: one or more microarrays, e.g., oligonucleotide microarrays or cDNA microarrays, that comprise those biomarkers that correlate with resistance and sensitivity to EGFR modulators, particularly EGFR inhibitors; one or more EGFR modulators for use in testing cells from patient tissue specimens or patient samples; and instructions for use. In addition, kits contemplated by the invention can further include, for example, reagents or materials for monitoring the expression of biomarkers of the invention at the level of mRNA or protein, using other techniques and systems practiced in the art such as, for example, RT-PCR assays, which employ primers designed on the basis of one or more of the biomarkers described herein, immunoassays, such as enzyme linked immunosorbent assays (ELISAs), immunoblotting, e.g., Western blots, or in situ hybridization, and the like, as further described herein.

Application of Biomarkers and Biomarker Sets

The biomarkers and biomarker sets may be used in different applications. Biomarker sets can be built from any combination of biomarkers listed in Table 4 to make predictions about the likely effect of any EGFR modulator in different biological systems. The various biomarkers and biomarker sets described herein can be used, for example, as diagnostic or prognostic indicators in disease management, to predict how patients with cancer might respond to therapeutic intervention with compounds that modulate the EGFR, and to predict how patients might respond to therapeutic intervention that modulates signaling through the entire EGFR regulatory pathway.

While the data described herein were generated in cell lines that are routinely used to screen and identify compounds that have potential utility for cancer therapy, the biomarkers have both diagnostic and prognostic value in other diseases areas in which signaling through EGFR or the EGFR pathway is of importance, e.g., in immunology, or in cancers or tumors in which cell signaling and/or proliferation controls have gone awry.

In the examples described below, the sensitivity and resistance classifications in the twenty two colon cell lines were similar for the two EGFR modulators tested. Therefore, the biomarkers of the invention are expected to have both diagnostic and prognostic value for other compounds that modulate EGFR or the EGFR signaling pathways.

Those having skill in the pertinent art will appreciate that the EGFR signaling pathway is used and functional in cell types other than cell lines of colon tissue. Therefore, the described biomarkers are expected to have utility for predicting drug sensitivity or resistance to compounds that interact with or inhibit the EGFR activity in cells from other tissues or organs associated with a disease state, or cancers or tumors derived from other tissue types. Non-limiting examples of such cells, tissues and organs include breast, colon, lung, prostate, testes, ovaries, cervix, esophagus, pancreas, spleen, liver, kidney, stomach, lymphocytic and brain, thereby providing a broad and advantageous applicability to the biomarkers described herein. Cells for analysis can be obtained by conventional procedures as known in the art, for example, tissue biopsy, aspiration, sloughed cells, e.g., colonocytes, clinical or medical tissue or cell sampling procedures.

In accordance with the invention, cells from a patient tissue sample, e.g., a tumor or cancer biopsy, can be assayed to determine the expression pattern of one or more biomarkers prior to treatment with one or more EGFR modulators. Success or failure of a treatment can be determined based on the biomarker expression pattern of the cells from the test tissue (test cells), e.g., tumor or cancer biopsy, as being relatively similar or different from the expression pattern of a control set of the one or more biomarkers. Thus, if the test cells show a biomarker expression profile which corresponds to that of the biomarkers in the control panel of cells which are sensitive to the EGFR modulator, it is highly likely or predicted that the individual's cancer or tumor will respond favorably to treatment with the EGFR modulator. By contrast, if the test cells show a biomarker expression pattern corresponding to that of the biomarkers of the control panel of cells which are resistant to the EGFR modulator, it is highly likely or predicted that the individual's cancer or tumor will not respond to treatment with the EGFR modulator.

The invention also provides a method of monitoring the treatment of a patient having a disease treatable by one or more EGFR modulators. The isolated test cells from the patient's tissue sample, e.g., a tumor biopsy or tumor sample, can be assayed to determine the expression pattern of one or more biomarkers before and after exposure to an EGFR modulator wherein, preferably, the EGFR modulator is an EGFR inhibitor. The resulting biomarker expression profile of the test cells before and after treatment is compared with that of one or more biomarkers as described and shown herein to be highly expressed in the control panel of cells that are either resistant or sensitive to an EGFR modulator. Thus, if a patient's response is sensitive to treatment by an EGFR modulator, based on correlation of the expression profile of the one or biomarkers, the patient's treatment prognosis can be qualified as favorable and treatment can continue. Also, if, after treatment with an EGFR modulator, the test cells don't show a change in the biomarker expression profile corresponding to the control panel of cells that are sensitive to the EGFR modulator, it can serve as an indicator that the current treatment should be modified, changed, or even discontinued. This monitoring process can indicate success or failure of a patient's treatment with an EGFR modulator and such monitoring processes can be repeated as necessary or desired.

The biomarkers of the invention can be used to predict an outcome prior to having any knowledge about a biological system. Essentially, a biomarker can be considered to be a statistical tool. Biomarkers are useful primarily in predicting the phenotype that is used to classify the biological system. In an embodiment of the invention, the goal of the prediction is to classify cancer cells as having an active or inactive EGFR pathway. Cancer cells with an inactive EGFR pathway can be considered resistant to treatment with an EGFR modulator. An inactive EGFR pathway is defined herein as a non-significant expression of the EGFR or by a classification as “resistant” or “sensitive” based on the IC₅₀value of each colon cell line to a compound (EGFR inhibitor compound BMS-461453) exemplified herein.

A number of the biomarker described herein are known to be regulated by EGFR, e.g., mucin 2 (J Biol Chem. 2002 Aug. 30; 277(35):32258-67). Another biomarker, betacellulin, is know to be an EGFR ligand (Biochem Biophys Res Commun. 2002 Jun. 28; 294(5):1040-6). A functional relationship of the top biomarkers to the EGFR is expected, since biomarkers that contribute to high biomarker accuracy are likely to play a functional role in the pathway that is being modulated. For example, Perception therapy (i.e., antibody that binds to the Her2 receptor and prevents function via internalization) is indicated when the Her2 gene is overexpressed. It is unlikely that a therapy will have any therapeutic effect if the target enzyme is not expressed.

However, although the complete function of all of the biomarkers are not currently known, some of the biomarkers are likely to be directly or indirectly involved in the EGFR signaling pathway. In addition, some of the biomarkers may function in the metabolic or other resistance pathways specific to the EGFR modulators tested. Notwithstanding, knowledge about the function of the biomarkers is not a requisite for determining the accuracy of a biomarker according to the practice of the invention.

Discovery of Biomarkers

An approach has been discovered in which biomarkers were identified whose expression patterns, in a subset of cell lines, correlated to and can be used as an in vitro marker of cellular response to treatment or therapy with one compound, or with a combination or series of compounds, that are known to inhibit or activate the function of a protein, enzyme, or molecule (e.g., a receptor) that is directly or indirectly involved in cell proliferation, cell responses to external stimuli, (such as ligand binding), or signal transduction, e.g., a receptor tyrosine kinase. Preferred are antagonists or inhibitors of the function of a given protein, e.g., a receptor tyrosine kinase.

Two analytical strategies were deployed to discover biomarkers useful for predicting the sensitivity or resistance of cancer cells to treatment with one or more EGFR modulators. FIG. 1 illustrates the EGFR biomarker identification and prioritization strategy. In one strategy, the mRNA expression level of EGFR was used to identify six colon cancer cell lines with, inferred from the mRNA expression level, no significant presence of the EGFR protein and hence no significant activity of the EGFR pathway (FIG. 2A). In subsequent analyses, biomarkers were identified that had no significant mRNA expression level in the six cell lines and no inferred presence of the EGFR protein. Further, it was required that these biomarkers would have a significant mRNA expression level in at least six other cell lines.

In a second strategy, an EGFR specific tyrosine kinase inhibitor compound was used to determine compound sensitivity in a panel of twenty two colon cancer cell lines following exposure of the cells to the compound. Some of the cell lines were determined to be resistant to treatment with the inhibitor compound, while others were determined to be sensitive to the inhibitor (FIG. 2B). A subset of the cell lines examined provided an expression pattern or profile of biomarkers that correlated to a response by the cells to the EGFR inhibitor compound as well as the absence of significant EGFR expression as thus could serve as biomarkers.

By combining the use of EGFR co-regulation studies in tumor cells with experimental studies in cultured cells as a model of in vivo effects, the invention advantageously focuses on cell-intrinsic properties that are exposed in cell culture to identify biomarkers that predict compound sensitivity and resistance. The discovery and identification of biomarkers in tumor cells and cell lines assayed in vitro can be used to predict responses to one or more EGFR modulators in vivo and, thus, can be extended to clinical situations in which the same biomarkers are used to predict patients' responses to one or more EGFR modulators and treatments comprising one or more EGFR modulators.

As described in the examples below, oligonucleotide microarrays were used to measure the expression levels of over 44,792 probe sets in a panel of thirty one untreated colon cancer cell lines for which the expression status of the EGFR and the drug sensitivity to EGFR inhibitor compounds was determined. This analysis was performed to determine whether the gene expression signatures of untreated cells were sufficient for the prediction of sensitivity of the disease to inhibition of the EGFR by small molecule or biological molecule compounds. Through data analysis, biomarkers were identified whose expression levels were found to be highly counter-correlated with the status of the EGFR and correlated with the drug sensitivity. In addition, the treatment of cells with a small molecule EGFR inhibitor also provided gene expression signatures predictive of sensitivity to the compound.

The means of performing the gene expression and biomarker identification analyses embraced by the invention is described in further detail and without limitation below.

IC₅₀Determination and Phenotype Classification Based on Sensitivity of Twenty-Two Colon Cancer Cell Lines to EGFR Inhibitor Compounds

Twenty two colon cell lines were treated with a small molecule EGFR inhibitor (BMS-461453) to determine the individual IC₅₀value. The IC₅₀for each cell line was assessed by MTS assays. The average IC₅₀values along with standard deviations were calculated from two to five individual determinations for each cell line. As shown in FIG. 2B, a 4-fold variation in the IC₅₀values was observed for the small molecule EGFR inhibitor among the 22 colon cancer cell lines. The IC₅₀unit is μM.

All cell lines with at least a 1.75 fold lower IC₅₀than the most resistant cell lines were considered to be sensitive to treatment with the small molecule EGFR inhibitor. FIG. 2B represents the resistance/sensitivity classifications of the twenty-two colon cell lines to the small molecule EGFR inhibitor. Five cell lines were classified as sensitive and seventeen cell lines as resistant.

Description of the Strategy for Identifying Biomarkers

Biomarkers were discovered based on two criteria: (i) the correlation of their mRNA expression level to the expression of EGFR in cell lines with insignificant EGFR expression and (ii) the correlation of the IC₅₀values for the small molecule EGFR inhibitor BMS-461453 with gene expression levels.

For each of these two biomarker selection strategies, two independent “discovery” probe set lists were established by using statistical filters with different stringency levels to identify genes whose expression correlated with either EGFR status or IC₅₀value. These statistical methods are described below and resulted in four discovery probe set lists: EGFR-A and EGFR-B (correlation with no significant EGFR expression) and IC-50-A, IC-50-B (correlation with IC₅₀expression), the A-lists containing probe sets selected by more stringent conditions. To then establish two biomarker probe set lists, probe sets that appeared in both EGFR-A and IC-50 B were selected (Biomarker Probe Set List A, Table 2) and probe sets that appeared in both EGFR-B and IC-50-A were selected (Biomarker Probe Set List B, Table 3).

Identifying Genes that Significantly Correlate with EGFR Status Classification

RT-PCR expression data for EGFR were obtained from thirty one colon cancer cell lines and six cell lines with a significantly lower expression level of EGFR compared to the other cell lines were identified as described in Example 1 below. (FIG. 2A). Expression profiling data of 44,792 probe sets represented on the HG-U133 array set for all Dirty one untreated colon cancer cell lines were obtained and analyzed for the identification of probe sets which would be correlated with the above described six cell lines with no significant mRNA expression of EGFR. For the discovery probe set list EGFR-A, all probe sets which were judged to be absent by the Affymetrix Mas 5.0 software in six of the six colon cancer cell lines with significantly lower expression of EGFR were identified. Second, it was required that these probe sets would be judged to be present in at least six cell lines of the twenty five cell lines classified as having significant mRNA expression of the EGFR This analytical strategy resulted in the identification of 280 probe sets that could be analyzed in comparison to the discovery probe set list IC-50-B.

The discovery probe set list EGFR-B was generated by selecting all probe sets which were judged to be absent by the Affymetrix Mas 5.0 software in five of the six colon cancer cell lines with significantly lower expression of EGFR and which would be present in at least six cell lines of the twenty five cell lines classified as having significant mRNA expression of the EGFR. Discovery probe set list EGR-B contains 1,852 probe sets (1133A: 876; U133B: 976).

Identifying Genes that Significantly Correlate with Drug Resistance/Sensitivity Classification

Expression profiling data of 44,792 probe sets represented on the HG-U133 array set for twenty two untreated colon cell lines were obtained and preprocessed as described in Example 1 below. These data were analyzed using the Student's TTEST to identify genes whose expression patterns were strongly correlated with the drug resistance/sensitivity classification. Table 1 provides the resistance/sensitivity phenotype classification of the twenty two colon cell lines for the EGFR antagonist BMS-461453 based on the IC₅₀results. The mean IC₅₀values along with standard deviations (SD) were calculated from 2 to 5 individual determinations for each cell line as shown. The mean IC₅₀across the twenty two colon cell lines for BMS-461453 was calculated and used to normalize the IC₅₀data for each cell line. All cell lines with at least a 1.75 fold lower IC₅₀than the most resistant cell lines were considered to be sensitive to treatment with BMS-5461453. The cell lines designated with an asterisk are defined as being sensitive to the drug treatment.

TABLE 1Resistance/Sensitivity Phenotype Classification of Twenty Two ColonCell LinesCell linesIC₅₀(μM)SDCCD_33C0*21.28LOVO*2.32.28LS174T*3.51.93Caco2*5.53.97SW403*5.74.94CCD18Co7.13.84SW8377.23.30Sk-Co-192.02MIP9.70.52SW1417100.00HT-29100.00T84100.00CX-1100.00Colo-205100.00Colo-201100.00Colo320HSR100.00HCT8100.00Colo320DM100.00SW480100.00HCT116100.00SW620100.00HCT116S542100.00

An “idealized expression pattern” corresponds to a gene that is uniformly high in one class (e.g., sensitive) and uniformly low in the other (e.g., resistant). Initially, a Student TTEST was performed in which a T value was obtained for each probe set. Once a T value was generated, its corresponding confidence value (P) was found on a standard table of significance. The confidence value is a measure of the probability to observe a certain mean expression difference between two groups by chance alone and is obtained using the following formula:

T(g·c)=(X₁−X₂)/(var₁/n₁+var₂/n₂)^1/2

wherein,

T(g,c) represents the T value between expression for gene g and the sensitivity/resistance classification c;

X₁represents mean gene expression level of samples in class 1;

X₂represents mean gene expression level of samples in class 2;

var₁represents variance of gene expression for samples in class 1;

var₂represents variance of gene expression for samples in class 2;

n₁represents number of samples in class 1;

n₂represents number of samples in class 2; and

corresponding confidence value (P) for T values are obtained from a standard table of significance.

To generate discovery probe set list IC-50-B, a confidence value of 0.05 or lower was used as the cut off for probe sets to be included in the list. Discovery probe set list IC-50-B contains 5,050 probe sets (U133A: 2,498; U133B: 2,552).

Discovery probe set list IC-50-A was generated using the Pearson correlation coefficient (a dimensionless index that ranges from −1.0 to 1.0). This value was calculated by treating the IC₅₀data as continuous variables and by utilizing a linear regression model to correlate gene expression levels with IC₅₀values for twenty-two colon cell lines. Probe sets with a correlation coefficient less than −0.5 were selected (p<0.02), a total of 902 probe sets (U133A: 467; U133B: 435).

Finally, two separate biomarker probe set lists were generated, biomarker probe set lists A and B, by identifying probe sets which were present in EGFR-A and IC-50-B (Biomarker Probe Set List A) (Table 2) or were present in EGFR-B and IC-50-A (Biomarker Probe Set List B) (Table 3).

The biomarker probe set list A (Table 2) contains a total of 74 probe sets (U133A: 43; U133B: 31) and provides the polynucleotides identified to be biomarkers of EGFR antagonist sensitivity employing strategy A. With strategy A, polynucleotides were required to satisfy a stringent criteria for EGFR status coregulation and a less stringent condition for correlation to IC₅₀values. Namely, the polynucleotides had to be called absent by the Affymetrix software in six out of the six cell lines with lowest expression of EGFR and be differentially expressed in the sensitive and resistance cell lines with a P value equal to or less than 0.05.

TABLE 2Biomarker Probe Set List AAffymetrixUnigene TitleAffymetrix Descriptionprobe sethemoglobin,gb: BC005931.1 /DEF = Homo sapiens,211745_x_atalpha 1hemoglobin, alpha 2, clone MGC: 14541, mRNA,complete cds. /FEA = mRNA/PROD = hemoglobin, alpha 2/DB_XREF = gi: 13543547 /FL = gb: BC005931.1dipeptidylpeptidasegb: M80536.1 /DEF = H. sapiens dipeptidylpeptidase203716_s_atIV (CD26,IV (DPP4) mRNA, complete cds.adenosine/FEA = mRNA /GEN = DPP4 /PROD = dipeptidylpeptidasedeaminaseIV /DB_XREF = gi: 181569complexing/UG = Hs.44926 dipeptidylpeptidase IV (CD26,protein 2)adenosine deaminase complexing protein 2)/FL = gb: M80536.1 gb: NM_001935.1spondin 1, (f-Consensus includes gb: AI885290 /FEA = EST213994_s_atspondin)/DB_XREF = gi: 5590454extracellular/DB_XREF = est: wl92a04.x1matrix protein/CLONE = IMAGE: 2432334 /UG = Hs.5378spondin 1, (f-spondin) extracellular matrixprotein3-hydroxy-3-gb: NM_005518.1 /DEF = Homo sapiens 3-204607_atmethylglutaryl-hydroxy-3-methylglutaryl-Coenzyme A synthaseCoenzyme A2 (mitochondrial) (HMGCS2), mRNA.synthase 2/FEA = mRNA /GEN = HMGCS2 /PROD = 3-(mitochondrial)hydroxy-3-methylglutaryl-Coenzyme A synthase2(mitochondrial) /DB_XREF = gi: 5031750/UG = Hs.59889 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)/FL = gb: NM_005518.1mucin 2,gb: NM_002457.1 /DEF = Homo sapiens mucin 2,204673_atintestinal/trachea 1intestinaltracheal (MUC2), mRNA. /FEA = mRNA/GEN = MUC2 /PROD = mucin 2, intestinaltracheal/DB_XREF = gi: 4505284 /UG = Hs.315 mucin 2,intestinaltracheal /FL = gb: NM_002457.1gb: L21998.1cystic fibrosisgb: NM_000492.2 /DEF = Homo sapiens cystic205043_attransmembranefibrosis transmembrane conductance regulator,conductanceATP-binding cassette (sub-family C, member 7)regulator, ATP-(CFTR), mRNA. /FEA = mRNA /GEN = CFTRbinding cassette/PROD = cystic fibrosis transmembrane(sub-family C,conductanceregulator, ATP-binding cassette (sub-member 7)family C, member 7) /DB_XREF = gi: 6995995/UG = Hs.663 cystic fibrosis transmembraneconductance regulator, ATP-binding cassette(sub-family C, member 7) /FL = gb: NM_000492.2CUG tripletConsensus includes gb: N36839 /FEA = EST202156_s_atrepeat, RNA-/DB_XREF = gi: 1157981binding protein 2/DB_XREF = est: yy35f07.s1/CLONE = IMAGE: 273253 /UG = Hs.211610 CUGtriplet repeat, RNA-binding protein 2/FL = gb: U69546.1 gb: AF036956.1gb: AF090694.1 gb: NM_006561.1nuclear receptorgb: NM_000901.1 /DEF = Homo sapiens nuclear205259_atsubfamily 3,receptor subfamily 3, group C, member 2group C, member 2(NR3C2), mRNA. /FEA = mRNA /GEN = NR3C2/PROD = nuclear receptor subfamily 3, group C,member 2 /DB_XREF = gi: 4505198 /UG = Hs.1790nuclear receptor subfamily 3, group C, member 2/FL = gb: M16801.1 gb: NM_000901.1cystic fibrosisConsensus includes gb: W60595 /FEA = EST215702_s_attransmembrane/DB_XREF = gi: 1367354conductance/DB_XREF = est: zc91b04.s1regulator, ATP-/CLONE = IMAGE: 338479 /UG = Hs.663 cysticbinding cassettefibrosis transmembrane conductance regulator,(sub-family C,ATP-binding cassette (sub-family C, member 7)member 7)cytochromegb: NM_000775.1 /DEF = Homo sapiens205073_atP450, subfamilycytochrome P450, subfamily IIJ (arachidonic acidIIJ (arachidonicepoxygenase) polypeptide 2 (CYP2J2), mRNA.acid/FEA = mRNA /GEN = CYP2J2epoxygenase)/PROD = cytochrome P450, subfamily IIJpolypeptide 2(arachidonic acidepoxygenase) polypeptide 2/DB_XREF = gi: 4503226 /UG = Hs.152096cytochrome P450, subfamily IIJ (arachidonic acidepoxygenase) polypeptide 2 /FL = gb: U37143.1gb: NM_000775.1cystatin Sgb: NM_001899.1 /DEF = Homo sapiens cystatin S206994_at(CST4), mRNA. /FEA = mRNA /GEN = CST4/PROD = cystatin S /DB_XREF = gi: 4503108/UG = Hs.56319 cystatin S /FL = gb: NM_001899.1spondin 1, (f-Consensus includes gb: AI885290 /FEA = EST213993_atspondin)/DB_XREF = gi: 5590454extracellular/DB_XREF = est: wl92a04.x1matrix protein/CLONE = IMAGE: 2432334 /UG = Hs.5378spondin 1, (f-spondin) extracellular matrixproteinfibroblast growthgb: NM_022969.1 /DEF = Homo sapiens fibroblast203638_s_atfactor receptor 2growth factor receptor 2 (bacteria-expressed(bacteria-kinase, keratinocyte growth factor receptor,expressed kinase,craniofacial dysostosis 1, Crouzon syndrome,keratinocytePfeiffer syndrome, Jackson-Weiss syndrome)growth factor(FGFR2), transcript variant 2, mRNA.receptor,/FEA = mRNA /GEN = FGFR2 /PROD = fibroblastcraniofacialgrowth factor receptor 2, isoform 2precursordysostosis 1,/DB_XREF = gi: 13186252 /UG = Hs.278581Crouzonfibroblast growth factor receptor 2 (bacteria-syndrome,expressed kinase, keratinocyte growth factorPfeifferreceptor, craniofacial dysostosis 1, Crouzonsyndrome,syndrome, Pfeiffer syndrome, Jackson-WeissJackson-Weisssyndrome) /FL = gb: NM_022969.1 gb: M97193.1syndrome)gb: M80634.1mucin 3BConsensus includes gb: AB038783.1 /DEF = Homo214898_x_atsapiens MUC3B mRNA for intestinal mucin,partial cds. /FEA = mRNA /GEN = MUC3B/PROD = intestinal mucin /DB_XREF = gi: 9929917/UG = Hs.129782 mucin 3A, intestinalAAConsensus includes gb: AV728958 /FEA = EST212703_at/DB_XREF = gi: 10838379/DB_XREF = est: AV728958/CLONE = HTCBYF04 /UG = Hs.150443KIAA0320 proteinCUG tripletgb: NM_006561.1 /DEF = Homo sapiens CUG202158_s_atrepeat, RNA-triplet repeat, RNA-binding protein 2 (CUGBP2),binding protein 2mRNA. /FEA = mRNA /GEN = CUGBP2/PROD = CUG triplet repeat, RNA-binding protein2 /DB_XREF = gi: 5729815 /UG = Hs.211610 CUGtriplet repeat, RNA-binding protein 2/FL = gb: U69546.1 gb: AF036956.1gb: AF090694.1 gb: NM_006561.1spondin 1, (f-gb: AB051390.1 /DEF = Homo sapiens mRNA for209437_s_atspondin)VSGPF-spondin, complete cds. /FEA = mRNAextracellular/PROD = VSGPF-spondinmatrix protein/DB_XREF = gi: 11320819 /UG = Hs.5378 spondin1, (f-spondin) extracellular matrix protein/FL = gb: AB051390.1mucin 3BConsensus includes gb: AF113616 /DEF = Homo214676_x_atsapiens intestinal mucin 3 (MUC3) gene, partialcds /FEA: = mRNA /DB_XREF = gi: 6466800/UG = Hs.129782 mucin 3A, intestinalEphA1gb: NM_005232.1 /DEF = Homo sapiens EphA1205977_s_at(EPHA1), mRNA. /FEA = mRNA /GEN = EPHA1/PROD = EphA1 /DB_XREF = gi: 4885208/UG = Hs.89839 EphA1 /FL = gb: M18391.1gb: NM_005232.1matrilin 3gb: NM_002381.2 /DEF = Homo sapiens matrilin 3206091_at(MATN3) precursor, mRNA. /FEA = mRNA/GEN = MATN3 /PROD = matrilin 3 precursor/DB_XREF = gi: 13518040 /UG = Hs.278461matrilin 3 /FL = gb: NM_002381.2bonegb: NM_001200.1 /DEF = Homo sapiens bone205290_s_atmorphogeneticmorphogenetic protein 2 (BMP2), mRNA.protein 2/FEA = mRNA /GEN = BMP2 /PROD = bonemorphogenetic protein 2 precursor/DB_XREF = gi: 4557368 /UG = Hs.73853 bonemorphogenetic protein 2 /FL = gb: NM_001200.1interferonConsensus includes gb: AI073984 /FEA = EST204057_atconsensus/DB_XREF = gi: 3400628sequence binding/DB_XREF = est: oy66c05.x1protein 1/CLONE = IMAGE: 1670792 /UG = Hs.14453interferon consensus sequence binding protein 1/FL = gb: M91196.1 gb: NM_002163.1retinoic acidConsensus includes gb: AI669229 /FEA = EST221872_atreceptor/DB_XREF = gi: 4834003responder/DB_XREF = est: wc13e06.x1(tazarotene/CLONE = IMAGE: 2315074 /UG = Hs.82547induced) 1retinoic acid receptor responder (tazaroteneinduced) 1cystic fibrosisConsensus includes gb: W60595 /FEA = EST215703_attransmembrane/DB_XREF = gi: 1367354conductance/DB_XREF = est: zc91b04.s1regulator, ATP-/CLONE = IMAGE: 338479 /UG = Hs.663 cysticbinding cassettefibrosis transmembrane conductance regulator,(sub-family C,ATP-binding cassette (sub-family C, member 7)member 7)fibroblast growthgb: M87771.1 /DEF = Human secreted fibroblast208228_s_atfactor receptor 2growth factor receptor (K-sam-III) mRNA,(bacteria-complete cds. /FEA = mRNA /GEN = K-sam-IIIexpressed kinase,/PROD = fibroblast growth factor receptorkeratinocyte/DB_XREF = gi: 186781 /UG = Hs.278581growth factorfibroblast growth factor receptor 2 (bacteria-receptor,expressed kinase, keratinocyte growth factorcraniofacialreceptor, craniofacial dysostosis 1, Crouzondysostosis 1,syndrome, Pfeiffer syndrome, Jackson-WeissCrouzonsyndrome) /FL = gb: NM_022970.1 gb: M87771.1syndrome,Pfeiffersyndrome,Jackson-Weisssyndrome)myosin, heavygb: NM_003802.1 /DEF = Homo sapiens myosin,208208_atpolypeptide 13,heavy polypeptide 13, skeletal muscle (MYH13),skeletal musclemRNA. /FEA = mRNA /GEN = MYH13/PROD = myosin, heavy polypeptide 13, skeletalmuscle /DB_XREF = gi: 11321578/UG = Hs.278488 myosin, heavy polypeptide 13,skeletal muscle /FL = gb: NM_003802.1gb: AF111782.2ESTs, WeaklyConsensus includes gb: AW675655 /FEA = EST222354_atsimilar to I38022/DB_XREF = gi: 7540890hypothetical/DB_XREF = est: ba52e01.x1protein/CLONE = IMAGE: 2900184 /UG = Hs.314158[H. sapiens]ESTshypotheticalgb: NM_017699.1 /DEF = Homo sapiens219734_atproteinhypothetical protein FLJ20174 (FLJ20174),FLJ20174mRNA. /FEA = mRNA /GEN = FLJ20174/PROD = hypothetical protein FLJ20174/DB_XREF = gi: 8923170 /UG = Hs.114556hypothetical protein FLJ20174/FL = gb: NM_017699.1PTPRFConsensus includes gb: AI692180 /FEA = EST212841_s_atinteracting/DB_XREF = gi: 4969520protein, binding/DB_XREF = est: wd37f06.x1protein 2 (liprin/CLONE = IMAGE: 2330339 /UG = Hs.12953beta 2)PTPRF interacting protein, binding protein 2(liprin beta 2)ribonuclease,gb: NM_002933.1 /DEF = Homo sapiens201785_atRNase A family,ribonuclease, RNase A family, 1 (pancreatic)1 (pancreatic)(RNASE1), mRNA. /FEA = mRNA/GEN = RNASE1 /PROD = ribonuclease, RNase Afamily, 1 (pancreatic) /DB_XREF = gi: 4506546/UG = Hs.78224 ribonuclease, RNase A family, 1(pancreatic) /FL = gb: BC005324.1gb: NM_002933.1 gb: D26129.1hairless (mouse)gb: NM_018411.1 /DEF = Homo sapiens hairless220163_s_athomologprotein (putative single zinc finger transcriptionfactor protein, responsible for autosomalrecessive universal congenital alopecia, HR gene)(HSA277165), mRNA. /FEA = mRNA/GEN = HSA277165 /PROD = hairless protein/DB_XREF = gi: 11036651 /UG = Hs.272367hairless protein (putative single zinc fingertranscription factor protein, responsible forautosomal recessive universal congenitalalopecia, HR gene) /FL = gb: NM_018411.1nuclear receptorConsensus includes gb: AF228413.1 /DEF = Homo210174_atsubfamily 5,sapiens hepatocyte transcription factor mRNA,group A,3UTR. /FEA = mRNA /DB_XREF = gi: 7677372member 2/UG = Hs.183123 nuclear receptor subfamily 5,group A, member 2 /FL = gb: U93553.1gb: AB019246.1 gb: AF124247.1superoxidegb: NM_003102.1 /DEF = Homo sapiens205236_x_atdismutase 3,superoxide dismutase 3, extracellular (SOD3),extracellularmRNA. /FEA = mRNA /GEN = SOD3/PROD = superoxide dismutase 3, extracellular/DB_XREF = gi: 4507150 /UG = Hs.2420superoxide dismutase 3, extracellular/FL = gb: J02947.1 gb: NM_003102.1zinc fingergb: NM_003438.1 /DEF = Homo sapiens zinc207394_atprotein 137finger protein 137 (clone pHZ-30) (ZNF137),(clone pHZ-30)mRNA. /FEA = mRNA /GEN = ZNF137/PROD = zinc finger protein 137 (clone pHZ-30)/DB_XREF = gi: 4507988 /UG = Hs.151689 zincfinger protein 137 (clone pHZ-30)/FL = gb: NM_003438.1 gb: U09414.1Homo sapiensConsensus includes gb: AL049983.1 /DEF = Homo217288_atmRNA; cDNAsapiens mRNA; cDNA DKFZp564D042 (fromDKFZp564D042clone DKFZp564D042). /FEA = mRNA(from clone/DB_XREF = gi: 4884234 /UG = Hs.240136 HomoDKFZp564D042)sapiens mRNA; cDNA DKFZp564D042 (fromclone DKFZp564D042)Hermansky-Consensus includes gb: AL022313 /DEF = Human217354_s_atPudlak syndromeDNA sequence from clone RP5-1119A7 onchromosome 22q12.2-12.3 Contains the TXN2gene for mitochondrial thioredoxin, a novel gene,the EIF3S7 gene for eukaryotic translationinitiation factor 3 subunit 7 (zeta, 6667 kD) (EIF3-P66), the gene f . . . /FEA = CDS_3/DB_XREF = gi: 4200326 /UG = Hs.272270 HumanDNA sequence from clone RP5-1119A7 onchromosome 22q12.2-12.3 Contains the TXN2gene for mitochondrial thioredoxin, a novel gene,the EIF3S7 gene for eukaryotic translationinitiation factor 3 subunit 7 (zeta, 6667 kD) (EIF3-P66), the gene for a novperoxisomalgb: NM_018441.1 /DEF = Homo sapiens221142_s_attrans 2-enoylperoxisomal trans 2-enoyl CoA reductase;CoA reductase;putative short chain alcohol dehydrogenaseputative short(HSA250303), mRNA. /FEA = mRNAchain alcohol/GEN = HSA250303 /PROD = peroxisomal trans 2-dehydrogenaseenoyl CoA reductase; putative short chain alcoholdehydrogenase /DB_XREF = gi: 8923751/UG = Hs.281680 peroxisomal trans 2-enoyl CoAreductase; putative short chain alcoholdehydrogenase /FL = gb: NM_018441.1BTG family,gb: NM_006763.1 /DEF = Homo sapiens BTG201236_s_atmember 2family, member 2 (BTG2), mRNA. /FEA = mRNA/GEN = BTG2 /PROD = BTG family, member 2/DB_XREF = gi: 5802987 /UG = Hs.75462 BTGfamily, member 2 /FL = gb: U72649.1gb: NM_006763.1phosducingb: M33478.1 /DEF = Human 33-kDa211496_s_atphototransducing protein mRNA, complete cds./FEA = mRNA /DB_XREF = gi: 177186/UG = Hs.550 phosducin /FL = gb: NM_022577.1gb: M33478.1 gb: AF076465.1Rho GTPasegb: NM_015366.1 /DEF = Homo sapiens Rho205980_s_atactivating protein 8GTPase activating protein 8 (ARHGAP8),mRNA. /FEA = mRNA /GEN = ARHGAP8/PROD = Rho GTPase activating protein 8/DB_XREF = gi: 7656903 /UG = Hs.102336 RhoGTPase activating protein 8/FL = gb: NM_015366.1Homo sapiensConsensus includes gb: AW593996 /FEA = EST213256_atclone 24707/DB_XREF = gi: 7281254mRNA sequence/DB_XREF = est: hg41g06.x1/CLONE = IMAGE: 2948218 /UG = Hs.124969Homo sapiens clone 24707 mRNA sequencecaspase 10,gb: NM_001230.1 /DEF = Homo sapiens caspase205467_atapoptosis-related10, apoptosis-related cysteine proteasecysteine protease(CASP10), mRNA. /FEA = mRNA/GEN = CASP10 /PROD = caspase 10, apoptosis-related cysteine protease /DB_XREF = gi: 4502568/UG = Hs.5353 caspase 10, apoptosis-relatedcysteine protease /FL = gb: U60519.1gb: NM_001230.1KIAA0690Consensus includes gb: AK000238.1 /DEF = Homo216360_x_atproteinsapiens cDNA FLJ20231 fis, clone COLF5511,highly similar to AB014590 Homo sapiensmRNA for KIAA0690 protein. /FEA = mRNA/DB_XREF = gi: 7020188 /UG = Hs.60103KIAA0690 proteinHomo sapiens,Consensus includes gb: AW001287 /FEA = EST227676_atSimilar to/DB_XREF = gi: 5848203RIKEN cDNA/DB_XREF = est: wu27e06.x11810037C20/CLONE = IMAGE: 2521282 /UG = Hs.61265gene, cloneESTs, Weakly similar to G786_HUMANMGC: 21481PROTEIN GS3786 H. sapiensIMAGE: 3852062, mRNA,complete cdsESTsConsensus includes gb: AA581439 /FEA = EST244650_at/DB_XREF = gi: 2359211/DB_XREF = est: nh13c10.s1/CLONE = IMAGE: 952242 /UG = Hs.152328ESTsESTsConsensus includes gb: AI739241 /FEA = EST238984_at/DB_XREF = gi: 5101222/DB_XREF = est: wi14h02.x1/CLONE = IMAGE: 2390259 /UG = Hs.171480ESTshypotheticalConsensus includes gb: AB046810.1 /DEF = Homo232083_atproteinsapiens mRNA for KIAA1590 protein, partialFLJ23045cds. /FEA = mRNA /GEN = KIAA1590/PROD = KIAA1590 protein/DB_XREF = gi: 10047254 /UG = Hs.101774hypothetical protein FLJ23045regeneratinggb: AY007243.1 /DEF = Homo sapiens223447_atgene type IVregenerating gene type IV mRNA, complete cds./FEA = mRNA /PROD = regenerating gene type IV/DB_XREF = gi: 12621025 /UG = Hs.105484 Homosapiens regenerating gene type IV mRNA,complete cds /FL = gb: AY007243.1ESTsConsensus includes gb: AI139990 /FEA = EST231022_at/DB_XREF = gi: 3647447/DB_XREF = est: qa47d03.x1/CLONE = IMAGE: 1689893 /UG = Hs.134586ESTsESTsConsensus includes gb: AI733801 /FEA = EST237923_at/DB_XREF = gi: 5054914/DB_XREF = est: qk39c04.x5/CLONE = IMAGE: 1871334 /UG = Hs.146186ESTshypotheticalConsensus includes gb: AK002203.1 /DEF = Homo226992_atproteinsapiens cDNA FLJ11341 fis, cloneMGC20702PLACE1010786. /FEA = mRNA/DB_XREF = gi: 7023932 /UG = Hs.10260 Homosapiens cDNA FLJ11341 fis, clonePLACE1010786ESTs, WeaklyConsensus includes gb: AI457984 /FEA = EST243729_atsimilar to/DB_XREF = gi: 4312002ALU1_HUMAN/DB_XREF = est: tj66a04.x1ALU/CLONE = IMAGE: 2146446 /UG = Hs.165900SUBFAMILY JESTs, Weakly similar to ALUC_HUMAN !!!!SEQUENCEALU CLASS C WARNING ENTRY !!!CONTAMINATIONH. sapiensWARNINGENTRY[H. sapiens]Homo sapiensConsensus includes gb: T86159 /FEA = EST227724_atcDNA:/DB_XREF = gi: 714511FLJ22063 fis,/DB_XREF = est: yd84h07.s1clone HEP10326/CLONE = IMAGE: 114973 /UG = Hs.10450Homo sapiens cDNA: FLJ22063 fis, cloneHEP10326ESTsConsensus includes gb: AI806131 /FEA = EST231148_at/DB_XREF = gi: 5392697/DB_XREF = est: wf06c06.x1/CLONE = IMAGE: 2349802 /UG = Hs.99376ESTsanterior gradientConsensus includes gb: AI922323 /FEA = EST228969_at2 (Xenepus/DB_XREF = gi: 5658287laevis) homolog/DB_XREF = est: wn90h03.x1/CLONE = IMAGE: 2453141 /UG = Hs.293380ESTsESTsConsensus includes gb: AI493909 /FEA = EST235562_at/DB_XREF = gi: 4394912/DB_XREF = est: qz94e02.x1/CLONE = IMAGE: 2042234 /UG = Hs.6131 ESTshypotheticalConsensus includes gb: AI339568 /FEA = EST222727_s_atprotein/DB_XREF = gi: 4076495FLJ22233/DB_XREF = est: qk67e10.x1/CLONE = IMAGE: 1874058 /UG = Hs.286194hypothetical protein FLJ22233/FL = gb: NM_024959.1GalNAc alpha-2,6-Consensus includes gb: Y11339.2 /DEF = Homo227725_atsialyltransferasesapiens mRNA for GalNAc alpha-2,6-I, long formsialyltransferase I, long form. /FEA = mRNA/PROD = GalNAc alpha-2,6-sialyltransferase I/DB_XREF = gi: 7576275 /UG = Hs.105352GalNAc alpha-2,6-sialyltransferase I, long formESTsConsensus includes gb: AI917390 /FEA = EST240964_at/DB_XREF = gi: 5637245/DB_XREF = est: ts79a05.x1/CLONE = IMAGE: 2237456 /UG = Hs.99415ESTsHomo sapiensConsensus includes gb: AK026404.1 /DEF = Homo232321_atcDNA:sapiens cDNA: FLJ22751 fis, clone KAIA0483,FLJ22751 fis,highly similar to AF016692 Homo sapiens smallcloneintestinal mucin (MUC3) mRNA. /FEA = mRNAKAIA0483,/DB_XREF = gi: 10439257 /UG = Hs.271819 Homohighly similar tosapiens cDNA: FLJ22751 fis, clone KAIA0483,AF016692 Homohighly similar to AF016692 Homo sapiens smallsapiens smallintestinal mucin (MUC3) mRNAintestinal mucin(MUC3) mRNAHomo sapiensConsensus includes gb: AK026984.1 /DEF = Homo229021_atcDNA:sapiens cDNA: FLJ23331 fis, clone HEP12664.FLJ23331 fis,/FEA = mRNA /DB_XREF = gi: 10439980clone HEP12664/UG = Hs.50742 Homo sapiens cDNA: FLJ23331fis, clone HEP12664ESTsConsensus includes gb: AA827649 /FEA = EST235515_at/DB_XREF = gi: 2900090/DB_XREF = est: od01a12.s1/CLONE = IMAGE: 1357918 /UG = Hs.105317ESTsprostate cancerConsensus includes gb: AA633076 /FEA = EST226167_atassociated/DB_XREF = gi: 2556490protein 7/DB_XREF = est: nq38a06.s1/CLONE = IMAGE: 1146130 /UG = Hs.27495prostate cancer associated protein 7ESTsConsensus includes gb: N37023 /FEA = EST225407_at/DB_XREF = gi: 1158165/DB_XREF = est: yy40d03.s1/CLONE = IMAGE: 273701 /UG = Hs.235883ESTsESTs, WeaklyConsensus includes gb: AI864053 /FEA = EST235678_atsimilar to I38588/DB_XREF = gi: 5528160reverse/DB_XREF = est: wj55h10.x1transcriptase/CLONE = IMAGE: 2406787 /UG = Hs.39972homologESTs, Weakly similar to I38588 reverse[H. sapiens]transcriptase homolog H. sapiensESTs, WeaklyConsensus includes gb: AA557324 /FEA = EST227702_atsimilar to/DB_XREF = gi: 2327801JX0331 laurate/DB_XREF = est: nl81a02.s1omega-/CLONE = IMAGE: 1057034 /UG = Hs.26040hydroxylaseESTs, Weakly similar to fatty acid omega-[H. sapiens]hydroxylase H. sapiensESTsConsensus includes gb: BF594323 /FEA = EST238103_at/DB_XREF = gi: 11686647/DB_XREF = est: 7h79g07.x1/CLONE = IMAGE: 3322236 /UG = Hs.158989ESTsESTs, WeaklyConsensus includes gb: AI827789 /FEA = EST228241_atsimilar to/DB_XREF = gi: 5448449JE0350 Anterior/DB_XREF = est: wf33a07.x1gradient-2/CLONE = IMAGE: 2357364 /UG = Hs.100686[H. sapiens]ESTs, Weakly similar to JE0350 Anteriorgradient-2 H. sapiensESTsConsensus includes gb: AI968097 /FEA = EST237835_at/DB_XREF = gi: 5764915/DB_XREF = est: wu13a12.x1/CLONE = IMAGE: 2516830 /UG = Hs.131360ESTsESTsConsensus includes gb: H05025 /FEA = EST241874_at/DB_XREF = gi: 868577/DB_XREF = est: y174g12.s1/CLONE = IMAGE: 43864 /UG = Hs.323767 ESTsHomo sapiens,Consensus includes gb: AA524690 /FEA = EST226168_atSimilar to/DB_XREF = gi: 2265618RIKEN cDNA/DB_XREF = est: ng38e07.s11110060O18/CLONE = IMAGE: 937092 /UG = Hs.294143gene, cloneESTs, Weakly similar to predicted usingMGC: 17236Genefinder C. elegansIMAGE: 3864137,mRNA,complete cdsESTsConsensus includes gb: AI300126 /FEA = EST240830_at/DB_XREF = gi: 3959472/DB_XREF = est: qn54f02.x1/CLONE = IMAGE: 1902075 /UG = Hs.257858ESTsHomo sapiensConsensus includes gb: AA129774 /FEA = EST227019_atcDNA FLJ13137/DB_XREF = gi: 1690185fis, clone/DB_XREF = est: z116h09.s1NT2RP3003150/CLONE = IMAGE: 502145 /UG = Hs.288905Homo sapiens cDNA FLJ13137 fis, cloneNT2RP3003150ESTsConsensus includes gb: AW024656 /FEA = EST242358_at/DB_XREF = gi: 5878186/DB_XREF = est: wu78h05.x1/CLONE = IMAGE: 2526201 /UG = Hs.233382ESTs, Moderately similar to AF119917 62PRO2822 H. sapiens

The biomarker probe set list B (Table 3) contains 95 probe sets (U133A: 47; U133B 48). The biomarker probe set list B contains polynucleotides identified to be biomarkers of EGFR antagonist sensitivity employing strategy B. In strategy B, polynucleotides were required to satisfy a stringent criteria for correlation to IC₅₀values and a less stringent condition for EGFR status coregulation. Namely, the polynucleotides had to have a Pearsons correlation of −0.5 or less with respect to IC₅₀and be called absent by the Affymetrix software in 5 out of the 6 cell lines with lowest expression of EGFR.

TABLE 3Biomarker Probe Set List BAffymetrixUnigene TitleAffymetrix Descriptionprobe setdopaConsensus includes gb: AW772056 /FEA = EST214347_s_atdecarboxylase/DB_XREF = gi: 7704118(aromatic L-/DB_XREF = est: hn64g06.x1amino acid/CLONE = IMAGE: 3032698 /UG = Hs.150403decarboxylase)dopa decarboxylase (aromatic L-amino aciddecarboxylase)cystic fibrosisgb: NM_000492.2 /DEF = Homo sapiens cystic205043_attransmembranefibrosis transmembrane conductance regulator,conductanceATP-binding cassette (sub-family C, member 7)regulator, ATP-(CFTR), mRNA. /FEA = mRNA /GEN = CFTRbinding cassette/PROD = cystic fibrosis transmembrane(sub-family C,conductanceregulator, ATP-binding cassettemember 7)(sub-family C, member 7)/DB_XREF = gi: 6995995 /UG = Hs.663 cysticfibrosis transmembrane conductance regulator,ATP-binding cassette (sub-family C, member 7)/FL = gb: NM_000492.2carcinoembryonicgb: BC005008.1 /DEF = Homo sapiens,203757_s_atantigen-relatedcarcinoembryonic antigen-related cell adhesioncell adhesionmolecule 6 (non-specific cross reacting antigen),molecule 6 (non-clone MGC: 10467, mRNA, complete cds.specific cross/FEA = mRNA /PROD = carcinoembryonicreacting antigen)antigen-related cell adhesionmolecule 6 (non-specific cross reacting antigen)/DB_XREF = gi: 13477106 /UG = Hs.73848carcinoembryonic antigen-related cell adhesionmolecule 6 (non-specific cross reacting antigen)/FL = gb: BC005008.1 gb: M18216.1 gb: M29541.1gb: NM_002483.1hypotheticalgb: NM_017655.1 /DEF = Homo sapiens219970_atproteinhypothetical protein FLJ20075 (FLJ20075),FLJ20075mRNA. /FEA = mRNA /GEN = FLJ20075/PROD = hypothetical protein FLJ20075/DB_XREF = gi: 8923083 /UG = Hs.205058hypothetical protein FLJ20075/FL = gb: NM_017655.1ATPase, ClassConsensus includes gb: AW006935 /FEA = EST214070_s_atV, type 10B/DB_XREF = gi: 5855713/DB_XREF = est: wt08b11.x1/CLONE = IMAGE: 2506845 /UG = Hs.109358ATPase, Class V, type 10Bcystic fibrosisConsensus includes gb: W60595 /FEA = EST215702_s_attransmembrane/DB_XREF = gi: 1367354conductance/DB_XREF = est: zc91b04.s1regulator, ATP-/CLONE = IMAGE: 338479 /UG = Hs.663 cysticbinding cassettefibrosis transmembrane conductance regulator,(sub-family C,ATP-binding cassette (sub-family C, member 7)member 7)HERV-H LTR-gb: NM_007072.1 /DEF = Homo sapiens HERV-220812_s_atassociating 2H LTR-associating 2 (HHLA2), mRNA./FEA = mRNA /GEN = HHLA2 /PROD = HERV-HLTR-associating 2 /DB_XREF = gi: 5901963/UG = Hs.252351 HERV-H LTR-associating 2/FL = gb: AF126162.1 gb: NM_007072.1AAConsensus includes gb: AV728958 /FEA = EST212703_at/DB_XREF = gi: 10838379/DB_XREF = est: AV728958/CLONE = HTCBYF04 /UG = Hs.150443KIAA0320 proteinhemoglobin,Consensus includes gb: T50399 /FEA = EST214414_x_atalpha 2/DB_XREF = gi: 652259/DB_XREF = est: yb30b11.s1/CLONE = IMAGE: 72669 /UG = Hs.251577hemoglobin, alpha 1spondin 1, (f-Consensus includes gb: AI885290 /FEA = EST213993_atspondin)/DB_XREF = gi: 5590454extracellular/DB_XREF = est: w192a04.x1matrix protein/CLONE = IMAGE: 2432334 /UG = Hs.5378spondin 1, (f-spondin) extracellular matrixproteinhemoglobin,gb: BC005931.1 /DEF = Homo sapiens,211745_x_atalpha 1hemoglobin, alpha 2, clone MGC: 14541,mRNA, complete cds. /FEA = mRNA/PROD = hemoglobin, alpha 2/DB_XREF = gi: 13543547 /FL = gb: BC005931.1serine (orgb: NM_002639.1 /DEF = Homo sapiens serine204855_atcysteine)(or cysteine) proteinase inhibitor, clade Bproteinase(ovalbumin), member 5 (SERPINB5), mRNA.inhibitor, clade B/FEA = mRNA /GEN = SERPINB5 /PROD = serine(ovalbumin),(or cysteine) proteinase inhibitor, cladeBmember 5(ovalbumin), member 5 /DB_XREF = gi: 4505788/UG = Hs.55279 serine (or cysteine) proteinaseinhibitor, clade B (ovalbumin), member 5/FL = gb: NM_002639.1 gb: U04313.13-hydroxy-3-gb: NM_005518.1 /DEF = Homo sapiens 3-204607_atmethylglutaryl-hydroxy-3-methylglutaryl-Coenyme A synthaseCoenzyme A2 (mitochondrial) (HMGCS2), mRNA.synthase 2/FEA = mRNA /GEN = HMGCS2 /PROD = 3-(mitochondrial)hydroxy-3-methylglutaryl-Coenyme A synthase2(mitochondrial) /DB_XREF = gi: 5031750/UG = Hs.59889 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)/FL = gb: NM_005518.1anterior gradientgb: AF088867.1 /DEF = Homo sapiens putative209173_at2 (Xenepussecreted protein XAG mRNA, complete cds.laevis) homolog/FEA = mRNA /PROD = putative secreted proteinXAG /DB_XREF = gi: 6652811 /UG = Hs.91011anterior gradient 2 (Xenepus laevis) homolog/FL = gb: AF007791.1 gb: AF038451.1gb: NM_006408.1 gb: AF088867.1FXYD domain-gb: BC005238.1 /DEF = Homo sapiens, FXYD202489_s_atcontaining iondomain-containing ion transport regulator 3,transportclone MGC: 12265, mRNA, complete cds.regulator 3/FEA = mRNA /PROD = FXYD domain-containing ion transport regulator3/DB_XREF = gi: 13528881 /UG = Hs.301350FXYD domain-containing ion transport regulator3 /FL = gb: NM_005971.2 gb: BC005238.1dipeptidylpeptidasegb: M80536.1 /DEF = H. sapiens dipeptidylpeptidase203716_s_atIV (CD26,IV (DPP4) mRNA, complete cds.adenosine/FEA = mRNA /GEN = DPP4 /PROD = dipeptidylpeptidasedeaminaseIV /DB_XREF = gi: 181569complexing/UG = Hs.44926 dipeptidylpeptidase IV (CD26,protein 2)adenosine deaminase complexing protein 2)/FL = gb: M80536.1 gb: NM_001935.1cystic fibrosisConsensus includes gb: W60595 /FEA = EST215703_attransmembrane/DB_XREF = gi: 1367354conductance/DB_XREF = est: zc91b04.s1regulator, ATP-/CLONE = IMAGE: 338479 /UG = Hs.663 cysticbinding cassettefibrosis transmembrane conductance regulator,(sub-family C,ATP-binding cassette (sub-family C, member 7)member 7)EphA1gb: NM_005232.1 /DEF = Homo sapiens EphA1205977_s_at(EPHA1), mRNA. /FEA = mRNA /GEN = EPHA1/PROD = EphA1 /DB_XREF = gi: 4885208/UG = Hs.89839 EphA1 /FL = gb: M18391.1gb: NM_005232.1spondin 1, (f-Consensus includes gb: AI885290 /FEA = EST213994_s_atspondin)/DB_XREF = gi: 5590454extracellular/DB_XREF = est: w192a04.x1matrix protein/CLONE = IMAGE: 2432334 /UG = Hs.5378spondin 1, (f-spondin) extracellular matrixproteinCUG tripletgb: NM_006561.1 /DEF = Homo sapiens CUG202158_s_atrepeat, RNA-triplet repeat, RNA-binding protein 2binding protein 2(CUGBP2), mRNA. /FEA = mRNA/GEN = CUGBP2 /PROD = CUG triplet repeat,RNA-binding protein 2 /DB_XREF = gi: 5729815/UG = Hs.211610 CUG triplet repeat, RNA-binding protein 2 /FL = gb: U69546.1gb: AF036956.1 gb: AF090694.1gb: NM_006561.1DKFZP434C091Consensus includes gb: AL080170.1215047_atprotein/DEF = Homo sapiens mRNA; cDNADKFZp434C091 (from clone DKFZp434C091);partial cds. /FEA = mRNA/GEN = DKFZp434C091 /PROD = hypotheticalprotein /DB_XREF = gi: 5262639 /UG = Hs.51692DKFZP434C091 proteinmucin 3BConsensus includes gb: AF113616 /DEF = Homo214676_x_atsapiens intestinal mucin 3 (MUC3) gene, partialcds /FEA = mRNA /DB_XREF = gi: 6466800/UG = Hs.129782 mucin 3A, intestinalpotassiumgb: U90065.1 /DEF = Human potassium channel204678_s_atchannel,KCNO1 mRNA, complete cds. /FEA = mRNAsubfamily K,/PROD = potassium channel KCNO1member 1/DB_XREF = gi: 1916294 /UG = Hs.79351(TWIK-1)potassium channel, subfamily K, member 1(TWIK-1) /FL = gb: U33632.1 gb: U90065.1gb: U76996.1 gb: NM_002245.1nuclear receptorgb: NM_000901.1 /DEF = Homo sapiens nuclear205259_atsubfamily 3,receptor subfamily 3, group C, member 2group C, member 2(NR3C2), mRNA. /FEA = mRNA /GEN = NR3C2/PROD = nuclear receptor subfamily 3, group C,member 2 /DB_XREF = gi: 4505198/UG = Hs.1790 nuclear receptor subfamily 3,group C, member 2 /FL = gb: M16801.1gb: NM_000901.1BTG family,gb: NM_006763.1 /DEF = Homo sapiens BTG201236_s_atmember 2family, member 2 (BTG2), mRNA./FEA = mRNA /GEN = BTG2 /PROD = BTGfamily, member 2 /DB_XREF = gi: 5802987/UG = Hs.75462 BTG family, member 2/FL = gb: U72649.1 gb: NM_006763.1G protein-gb: AF062006.1 /DEF = Homo sapiens orphan G210393_atcoupled receptorprotein-coupled receptor HG38 mRNA,49complete cds. /FEA = mRNA /PROD = orphan Gprotein-coupled receptor HG38/DB_XREF = gi: 3366801 /UG = Hs.285529 Gprotein-coupled receptor 49 /FL = gb: AF062006.1gb: AF061444.1 gb: NM_003667.1hypotheticalgb: NM_017640.1 /DEF = Homo sapiens219573_atproteinhypothetical protein FLJ20048 (FLJ20048),FLJ20048mRNA. /FEA = mRNA /GEN = FLJ20048/PROD = hypothetical protein FLJ20048/DB_XREF = gi: 8923056 /UG = Hs.116470hypothetical protein FLJ20048/FL = gb: NM_017640.1cytochromegb: NM_000775.1 /DEF = Homo sapiens205073_atP450, subfamilycytochrome P450, subfamily IIJ (arachidonicIIJ (arachidonicacid epoxygenase) polypeptide 2 (CYP2J2),acidmRNA. /FEA = mRNA /GEN = CYP2J2epoxygenase)/PROD = cytochrome P450, subfamily IIJpolypeptide 2(arachidonic acidepoxygenase) polypeptide 2/DB_XREF = gi: 4503226 /UG = Hs.152096cytochrome P450, subfamily IIJ (arachidonicacid epoxygenase) polypeptide 2/FL = gb: U37143.1 gb: NM_000775.1brain-specificgb: NM_007030.1 /DEF = Homo sapiens brain-206179_s_atprotein p25 alphaspecific protein p25 alpha (p25), mRNA./FEA = mRNA /GEN = p25 /PROD = brain-specificprotein p25 alpha /DB_XREF = gi: 5902017/UG = Hs.29353 brain-specific protein p25 alpha/FL = gb: AB017016.1 gb: NM_007030.1mucin 2,gb: NM_002457.1 /DEF = Homo sapiens mucin 2,204673_atintestinal/trachea 1intestinaltracheal (MUC2), mRNA./FEA = mRNA /GEN = MUC2 /PROD = mucin 2,intestinaltracheal /DB_XREF = gi: 4505284/UG = Hs.315 mucin 2, intestinaltracheal/FL = gb: NM_002457.1 gb: L21998.1hypotheticalgb: NM_017699.1 /DEF = Homo sapiens219734_atproteinhypothetical protein FLJ20174 (FLJ20174),FLJ20174mRNA. /FEA = mRNA /GEN = FLJ20174/PROD = hypothetical protein FLJ20174/DB_XREF = gi: 8923170 /UG = Hs.114556hypothetical protein FLJ20174/FL = gb: NM_017699.1metastasis-gb: NM_004739.1 /DEF = Homo sapiens203444_s_atassociated 1-like 1metastasis-associated 1-like 1 (MTA1L1),mRNA. /FEA = mRNA /GEN = MTA1L1/PROD = metastasis-associated 1-like 1/DB_XREF = gi: 4758739 /UG = Hs.173043metastasis-associated 1-like 1/FL = gb: AB016591.1 gb: NM_004739.1gb: AF295807.1bonegb: NM_001200.1 /DEF = Homo sapiens bone205290_s_atmorphogeneticmorphogenetic protein 2 (BMP2), mRNA.protein 2/FEA = mRNA /GEN = BMP2 /PROD = bonemorphogenetic protein 2 precursor/DB_XREF = gi: 4557368 /UG = Hs.73853 bonemorphogenetic protein 2 /FL = gb: NM_001200.1heparanasegb: NM_006665.1 /DEF = Homo sapiens219403_s_atheparanase (HPSE), mRNA. /FEA = mRNA/GEN = HPSE /PROD = heparanase/DB_XREF = gi: 5729872 /UG = Hs.44227heparanase /FL = gb: AF165154.1 gb: AF152376.1gb: NM_006665.1 gb: AF084467.1gb: AF155510.1tumor necrosisgb: BC002794.1 /DEF = Homo sapiens, tumor209354_atfactor receptornecrosis factor receptor superfamily, member 14superfamily,(herpesvirus entry mediator), clone MGC: 3753,member 14mRNA, complete cds. /FEA = mRNA(herpesvirus/PROD = tumor necrosis factor receptorentry mediator)superfamily, member 14 (herpesvirus entrymediator) /DB_XREF = gi: 12803894/UG = Hs.279899 tumor necrosis factor receptorsuperfamily, member 14 (herpesvirus entrymediator) /FL = gb: BC002794.1 gb: U70321.1gb: U81232.1 gb: NM_003820.1 gb: AF153978.1CUG tripletConsensus includes gb: N36839 /FEA = EST202156_s_atrepeat, RNA-/DB_XREF = gi: 1157981binding protein 2/DB_XREF = est: yy35f07.s1/CLONE = IMAGE: 273253 /UG = Hs.211610CUG triplet repeat, RNA-binding protein 2/FL = gb: U69546.1 gb: AF036956.1gb: AF090694.1 gb: NM_006561.1ESTs,Consensus includes gb: R06655 /FEA = EST217546_atModerately/DB_XREF = gi: 757275similar to/DB_XREF = est: yf10e02.r1AF078844 1/CLONE = IMAGE: 126458 /UG = Hs.188518hqp0376 proteinESTs, Moderately similar to AF078844 1[H. sapiens]hqp0376 protein H. sapienshairless (mouse)gb: NM_018411.1 /DEF = Homo sapiens hairless220163_s_athomologprotein (putative single zinc finger transcriptionfactor protein, responsible for autosomalrecessive universal congenital alopecia, HRgene) (HSA277165), mRNA. /FEA = mRNA/GEN = HSA277165 /PROD = hairless protein/DB_XREF = gi: 11036651 /UG = Hs.272367hairless protein (putative single zinc fingertranscription factor protein, responsible forautosomal recessive universal congenitalalopecia, HR gene) /FL = gb: NM_018411.1branched chainConsensus includes gb: NM_005504.1214452_ataminotransferase/DEF = Homo sapiens branched chain1, cytosolicaminotransferase 1, cytosolic (BCAT1), mRNA./FEA = CDS /GEN = BCAT1 /PROD = branchedchain aminotransferase 1, cytosolic/DB_XREF = gi: 5031606 /UG = Hs.157205branched chain aminotransferase 1, cytosolic/FL = gb: U21551.1 gb: NM_005504.1pancreas-gb: NM_016341.1 /DEF = Homo sapiens205112_atenrichedpancreas-enriched phospholipase Cphospholipase C(LOC51196), mRNA. /FEA = mRNA/GEN = LOC51196 /PROD = pancreas-enrichedphospholipase C /DB_XREF = gi: 7705940/UG = Hs.6733 pancreas-enriched phospholipaseC /FL = gb: AF190642.2 gb: AF117948.1gb: NM_016341.1prostaglandin-gb: NM_000963.1 /DEF = Homo sapiens204748_atendoperoxideprostaglandin-endoperoxide synthase 2synthase 2(prostaglandin GH synthase and(prostaglandincyclooxygenase) (PTGS2), mRNA.G/H synthase/FEA-mRNA /GEN = PTGS2and/PROD = prostaglandin-endoperoxide synthasecyclooxygenase)2(prostaglandin GH synthase andcyclooxygenase) /DB_XREF = gi: 4506264/UG = Hs.196384 prostaglandin-endoperoxidesynthase 2 (prostaglandin GH synthase andcyclooxygenase) /FL = gb: M90100.1gb: L15326.1 gb: NM_000963.1phosphatase andgb: NM_000314.1 /DEF = Homo sapiens204054_attensin homologphosphatase and tensin homolog (mutated in(mutated inmultiple advanced cancers 1) (PTEN), mRNA.multiple/FEA = mRNA /GEN = PTENadvanced cancers/PROD = phosphatase and tensin homolog1)(mutated inmultiple advanced cancers 1)/DB_XREF = gi: 4506248 /UG = Hs.10712phosphatase and tensin homolog (mutated inmultiple advanced cancers 1) /FL = gb: U92436.1gb: U93051.1 gb: U96180.1 gb: NM_000314.1retinoic acidConsensus includes gb: AI669229 /FEA = EST221872_atreceptor/DB_XREF = gi: 4834003responder/DB_XREF = est: wc13e06.x1(tazarotene/CLONE = IMAGE: 2315074 /UG = Hs.82547induced) 1retinoic acid receptor responder (tazaroteneinduced) 1protease inhibitorgb: NM_002638.1 /DEF = Homo sapiens protease203691_at3, skin-derivedinhibitor 3, skin-derived (SKALP) (PI3), mRNA.(SKALP)/FEA = mRNA /GEN = PI3 /PROD = proteaseinhibitor 3, skin-derived (SKALP)/DB_XREF = gi: 4505786 /UG = Hs.112341protease inhibitor 3, skin-derived (SKALP)/FL = gb: NM_002638.1zinc fingergb: NM_003438.1 /DEF = Homo sapiens zinc207394_atprotein 137finger protein 137 (clone pHZ-30) (ZNF137),(clone pHZ-30)mRNA. /FEA = mRNA /GEN = ZNF137/PROD = zinc finger protein 137 (clone pHZ-30)/DB_XREF = gi: 4507988 /UG = Hs.151689 zincfinger protein 137 (clone pHZ-30)/FL = gb: NM_003438.1 gb: U09414.1myosin, lightgb: NM_002477.1 /DEF = Homo sapiens myosin,205145_s_atpolypeptide 5,light polypeptide 5, regulatory (MYL5), mRNA.regulatory/FEA = mRNA /GEN = MYL5 /PROD = myosin,light polypeptide 5, regulatory/DB_XREF = gi: 4505304 /UG = Hs.170482myosin, light polypeptide 5, regulatory/FL = gb: L03785.1 gb: NM_002477.1tumor necrosisgb: NM_000043.1 /DEF = Homo sapiens tumor204781_s_atfactor receptornecrosis factor receptor superfamily, member 6superfamily,(TNFRSF6), mRNA. /FEA = mRNAmember 6/GEN = TNFRSF6 /PROD = apoptosis (APO-1)antigen 1 /DB_XREF = gi: 4507582/UG = Hs.82359 tumor necrosis factor receptorsuperfamily, member 6 /FL = gb: M67454.1gb: NM_000043.1hypotheticalConsensus includes gb: AI339568 /FEA = EST222727_s_atprotein/DB_XREF = gi: 4076495FLJ22233/DB_XREF = est: qk67e10.x1/CLONE = IMAGE: 1874058 /UG = Hs.286194hypothetical protein FLJ22233/FL = gb: NM_024959.1regeneratinggb: AY007243.1 /DEF = Homo sapiens223447_atgene type IVregenerating gene type IV mRNA, completecds. /FEA = mRNA /PROD = regenerating genetype IV /DB_XREF = gi: 12621025/UG = Hs.105484 Homo sapiens regeneratinggene type IV mRNA, complete cds/FL = gb: AY007243.1Homo sapiensConsensus includes gb: AK025615.1225285_atcDNA:/DEF = Homo sapiens cDNA: FLJ21962 fis,FLJ21962 fis,clone HEP05564. /FEA = mRNAclone HEP05564/DB_XREF = gi: 10438186 /UG = Hs.7567 Homosapiens cDNA: FLJ21962 fis, clone HEP05564phosphoproteinConsensus includes gb: AK000680.1225626_atassociated with/DEF = Homo sapiens cDNA FLJ20673 fis,glycosphingolipiclone KAIA4464. /FEA = mRNAd-enriched/DB_XREF = gi: 7020924 /UG = Hs.266175microdomainsphosphoprotein associated with GEMs/FL = gb: AF240634.1 gb: NM_018440.1hypotheticalConsensus includes gb: BF111925 /FEA = EST226171_atprotein/DB_XREF = gi: 10941704FLJ20209/DB_XREF = est: 7138g05.x1/CLONE = IMAGE: 3523784 /UG = Hs.3685hypothetical protein FLJ20209Homo sapiensConsensus includes gb: AA532640 /FEA = EST226484_atmRNA for/DB_XREF = gi: 2276894KIAA1190/DB_XREF = est: nj17c04.s1protein, partial/CLONE = IMAGE: 986598 /UG = Hs.206259cdsHomo sapiens mRNA for KIAA1190 protein,partial cdsKIAA1543Consensus includes gb: AB040976.1226494_atprotein/DEF = Homo sapiens mRNA for KIAA1543protein, partial cds. /FEA = mRNA/GEN = KIAA1543 /PROD = KIAA1543 protein/DB_XREF = gi: 7959352 /UG = Hs.17686KIAA1543 proteinhypotheticalConsensus includes gb: AW138767 /FEA = EST227180_atprotein/DB_XREF = gi: 6143085 /DB_XREF = est: UI-H-FLJ23563BI1-aep-a-12-0-UI.s1/CLONE = IMAGE: 2719799 /UG = Hs.274256hypothetical protein FLJ23563ESTsConsensus includes gb: AW264333 /FEA = EST227320_at/DB_XREF = gi: 6641075/DB_XREF = est: xq98e01.x1/CLONE = IMAGE: 2758680 /UG = Hs.21835ESTsESTsConsensus includes gb: BF589359 /FEA = EST227354_at/DB_XREF = gi: 11681683/DB_XREF = est: nab25d01.x1/CLONE = IMAGE: 3266737 /UG = Hs.13256ESTsHomo sapiens,Consensus includes gb: AW001287 /FEA = EST227676_atSimilar to/DB_XREF = gi: 5848203RIKEN cDNA/DB_XREF = est: wu27e06.x11810037C20/CLONE = IMAGE: 2521282 /UG = Hs.61265gene, cloneESTs, Weakly similar to G786_HUMANMGC: 21481PROTEIN GS3786 H. sapiensIMAGE: 3852062,mRNA,complete cdsHomo sapiensConsensus includes gb: T86159 /FEA = EST227724_atcDNA:/DB_XREF = gi: 714511FLJ22063 fis,/DB_XREF = est: yd84h07.s1clone HEP10326/CLONE = IMAGE: 114973 /UG = Hs.10450Homo sapiens cDNA: FLJ22063 fis, cloneHEP10326ESTsConsensus includes gb: AI700341 /FEA = EST228653_at/DB_XREF = gi: 4988241/DB_XREF = est: wd06e10.x1/CLONE = IMAGE: 2327370 /UG = Hs.110406ESTsESTsConsensus includes gb: BG494007 /FEA = EST228716_at/DB_XREF = gi: 13455521/DB_XREF = est: 602542289F1/CLONE = IMAGE: 4673182 /UG = Hs.203213ESTsESTsConsensus includes gb: AI559300 /FEA = EST229331_at/DB_XREF = gi: 4509505/DB_XREF = est: tq43d03.x1/CLONE = IMAGE: 2211557 /UG = Hs.294140ESTshypotheticalConsensus includes gb: AI830823 /FEA = EST229439_s_atprotein/DB_XREF = gi: 5451416/DB_XREF = est: wj52b06.x1/CLONE = IMAGE: 2406419 /UG = Hs.95549hypothetical proteinESTsConsensus includes gb: BF431989 /FEA = EST229657_at/DB_XREF = gi: 11444103/DB_XREF = est: nab84a05.x1/CLONE = IMAGE: 3274280 /UG = Hs.203213ESTsESTsConsensus includes gb: BF589413 /FEA = EST229893_at/DB_XREF = gi: 11681737/DB_XREF = est: nab26b11.x1/CLONE = IMAGE: 3267020 /UG = Hs.55501ESTsbrain-specificConsensus includes gb: BG055052 /FEA = EST230104_s_atprotein p25 alpha/DB_XREF = gi: 12512386/DB_XREF = est: nac94g06.x1/CLONE = IMAGE: 3441995 /UG = Hs.29353brain-specific protein p25 alphaESTs, WeaklyConsensus includes gb: BF110588 /FEA = EST230645_atsimilar to/DB_XREF = gi: 10940278MMHUE4/DB_XREF = est: 7n39e12.x1erythrocyte/CLONE = IMAGE: 3567071 /UG = Hs.150478membraneESTs, Weakly similar to KIAA0987 proteinprotein 4.1,H. sapiensparent spliceform [H. sapiens]ESTsConsensus includes gb: BF592062 /FEA = EST230760_at/DB_XREF = gi: 11684386/DB_XREF = est: 7n98h06.x1/CLONE = IMAGE: 3572962 /UG = Hs.233890ESTshepatocyteConsensus includes gb: AI032108 /FEA = EST230914_atnuclear factor 4,/DB_XREF = gi: 3250320alpha/DB_XREF = est: ow92d11.x1/CLONE = IMAGE: 1654293 /UG = Hs.54424hepatocyte nuclear factor 4, alphaESTsConsensus includes gb: AW203959 /FEA = EST230944_at/DB_XREF = gi: 6503431 /DB_XREF = est: UI-H-BIl-aeu-b-12-0-UI.s1/CLONE = IMAGE: 2720590 /UG = Hs.149532ESTsESTsConsensus includes gb: AI139990 /FEA = EST231022_at/DB_XREF = gi: 3647447/DB_XREF = est: qa47d03.x1/CLONE = IMAGE: 1689893 /UG = Hs.134586ESTsESTsConsensus includes gb: AI806131 /FEA = EST231148_at/DB_XREF = gi: 5392697/DB_XREF = est: wf06c06.x1/CLONE = IMAGE: 2349802 /UG = Hs.99376ESTshypotheticalConsensus includes gb: AB046810.1232083_atprotein/DEF = Homo sapiens mRNA for KIAA1590FLJ23045protein, partial cds. /FEA = mRNA/GEN = KIAA1590 /PROD = KIAA1590 protein/DB_XREF = gi: 10047254 /UG = Hs.101774hypothetical protein FLJ323045Homo sapiensConsensus includes gb: AC004908 /DEF = Homo232641_atPAC clone RP5-sapiens PAC clone RP5-855D21 /FEA = CDS_3855D21/DB_XREF = gi: 4156179 /UG = Hs.249181Homo sapiens PAC clone RP5-855D21putativeConsensus includes gb: AJ251708.1234669_x_atmicrotubule-/DEF = Homo sapiens partial mRNA for putativebinding proteinmicrotubule-binding protein. /FEA = mRNA/PROD = putative microtubule-binding protein/DB_XREF = gi: 6491740 /UG = Hs.326544putative microtubule-binding proteinESTsConsensus includes gb: AI741469 /FEA = EST234970_at/DB_XREF = gi: 5109757/DB_XREF = est: wg11b01.x1/CLONE = IMAGE: 2364745 /UG = Hs.57787ESTsESTsConsensus includes gb: AI417897 /FEA = EST235444_at/DB_XREF = gi: 4261401/DB_XREF = est: tg55b06.x1/CLONE = IMAGE: 2112659 /UG = Hs.235860ESTsESTsConsensus includes gb: AI493909 /FEA = EST235562_at/DB_XREF = gi: 4394912/DB_XREF = est: qz94e02.x1/CLONE = IMAGE: 2042234 /UG = Hs.6131ESTsESTsConsensus includes gb: AV741130 /FEA = EST235651_at/DB_XREF = gi: 10858711/DB_XREF = est: AV741130/CLONE = CBCATB06 /UG = Hs.173704 ESTs,Moderately similar to ALU8_HUMAN ALUSUBFAMILY SX SEQUENCECONTAMINATION WARNING ENTRYH. sapiensESTsConsensus includes gb: AW339510 /FEA = EST235866_at/DB_XREF = gi: 6836136/DB_XREF = est: xz91h08.x1/CLONE = IMAGE: 2871615 /UG = Hs.42722ESTsESTsConsensus includes gb: AI076192 /FEA = EST236422_at/DB_XREF = gi: 3405370/DB_XREF = est: oz01g07.x1/CLONE = IMAGE: 1674108 /UG = Hs.131933ESTsESTsConsensus includes gb: AL044570 /FEA = EST236548_at/DB_XREF = gi: 5432785/DB_XREF = est: DKFZp434L082_s1/CLONE = DKFZp434L082 /UG = Hs.147975ESTsESTsConsensus includes gb: AI733801 /FEA = EST237923_at/DB_XREF = gi: 5054914/DB_XREF = est: qk39c04.x5/CLONE = IMAGE: 1871334 /UG = Hs.146186ESTsHomo sapiens,Consensus includes gb: T69015 /FEA = EST238422_atclone/DB_XREF = gi: 680163MGC: 16402/DB_XREF = est: yc31f04.s1IMAGE: 39403606,/CLONE = IMAGE: 82303 /UG = Hs.192728mRNA,ESTscomplete cdsESTsConsensus includes gb: AA502384 /FEA = EST238956_at/DB_XREF = gi: 2237351/DB_XREF = est: ne27f11.s1/CLONE = IMAGE: 898605 /UG = Hs.151529ESTsESTsConsensus includes gb: AI739241 /FEA = EST238984_at/DB_XREF = gi: 5101222/DB_XREF = est: wi14h02.x1/CLONE = IMAGE: 2390259 /UG = Hs.171480ESTsESTsConsensus includes gb: AA088446 /FEA = EST239065_at/DB_XREF = gi: 1633958/DB_XREF = est: zl89f04.s1/CLONE = IMAGE: 511807 /UG = Hs.170298ESTsESTsConsensus includes gb: AI493046 /FEA = EST239148_at/DB_XREF = gi: 4394049/DB_XREF = est: qz49b04.x1/CLONE = IMAGE: 2030191 /UG = Hs.146133ESTsESTsConsensus includes gb: AI243098 /FEA = EST239966_at/DB_XREF = gi: 3838495/DB_XREF = est: qh26e03.x1/CLONE = IMAGE: 1845820 /UG = Hs.178398ESTsESTs, WeaklyConsensus includes gb: AI633523 /FEA = EST240106_atsimilar to/DB_XREF = gi: 4684853A49175 Motch B/DB_XREF = est: th68b11.x1protein - mouse/CLONE = IMAGE: 2123805 /UG = Hs.44705[M. musculus]ESTsbetacellulinConsensus includes gb: AI620677 /FEA = EST241412_at/DB_XREF = gi: 4629803/DB_XREF = est: tu85e09.x1/CLONE = IMAGE: 2257864 /UG = Hs.154191ESTsESTsConsensus includes gb: BF696216 /FEA = EST242626_at/DB_XREF = gi: 11981624/DB_XREF = est: 602124536F1/CLONE = IMAGE: 4281632 /UG = Hs.188724ESTsESTsConsensus includes gb: N57929 /FEA = EST242978_x_at/DB_XREF = gi: 1201819/DB_XREF = est: yv61e06.s1/CLONE = IMAGE: 247234 /UG = Hs.48100ESTsESTs, WeaklyConsensus includes gb: AI457984 /FEA = EST243729_atsimilar to/DB_XREF = gi: 4312002ALU1_HUMAN/DB_XREF = est: tj66a04.x1ALU/CLONE = IMAGE: 2146446 /UG = Hs.165900SUBFAMILY JESTs, Weakly similar to ALUC_HUMAN !!!!SEQUENCEALU CLASS C WARNING ENTRY !!!CONTAMINATIONH. sapiensWARNINGENTRY[H. sapiens]ESTsConsensus includes gb: AA581439 /FEA = EST244650_at/DB_XREF = gi: 2359211/DB_XREF = est: nh13c10.s1/CLONE = IMAGE: 952242 /UG = Hs.152328ESTs

The two biomarker probe sets A and B were then combined, a total of 161 different probe sets, and the redundant polynucleotides were removed, representing 125 unique polynucleotides which are provided below in Table 4. The Table 4 polynucleotides are biomarkers of the invention.

TABLE 4BiomarkersUnigene TitleAffymetrixAnd SEQ ID NO:Affymetrix Descriptionprobe set3-hydroxy-3-gb: NM_005518.1 /DEF = Homo sapiens 3-204607_atmethylglutaryl-hydroxy-3-methylglutaryl-Coenzyme ACoenzyme Asynthase 2 (mitochondrial) (HMGCS2),synthase 2mRNA. /FEA = mRNA /GEN = HMGCS2(mitochondrial)/PROD = 3-hydroxy-3-methylglutaryl-SEQ ID NOS: 1Coenzyme A synthase 2(mitochondrial)(DNA) and 126/DB_XREF = gi: 5031750 /UG = Hs.59889 3-(amino acid)hydroxy-3-methylglutaryl-Coenzyme Asynthase 2 (mitochondrial)/FL = gb: NM_005518.1ATPase, Class V,Consensus includes gb: AW006935214070_s_attype 10B/FEA = EST /DB_XREF = gi: 5855713/DB_XREF = est: wt08b11.x1SEQ ID NO: 2/CLONE = IMAGE: 2506845 /UG = Hs.109358(DNA)ATPase, Class V, type 10Bbone morphogeneticgb: NM_001200.1 /DEF = Homo sapiens bone205290_s_atprotein 2morphogenetic protein 2 (BMP2), mRNA.SEQ ID NOS: 3/FEA = mRNA /GEN = BMP2 /PROD = bone(DNA) and 127morphogenetic protein 2 precursor(amino acid)/DB_XREF = gi: 4557368 /UG = Hs.73853 bonemorphogenetic protein 2/FL = gb: NM_001200.1brain-specific proteingb: NM_007030.1 /DEF = Homo sapiens brain-206179_s_atp25 alphaspecific protein p25 alpha (p25), mRNA.SEQ ID NOS: 4/FEA = mRNA /GEN = p25 /PROD = brain-(DNA) and 128specific protein p25 alpha(amino acid)/DB_XREF = gi: 5902017 /UG = Hs.29353brain-specific protein p25 alpha/FL = gb: AB017016.1 gb: NM_007030.1branched chainConsensus includes gb: NM_005504.1214452_ataminotransferase 1,/DEF = Homo sapiens branched chaincytosolicaminotransferase 1, cytosolic (BCAT1),SEQ ID NOS: 5mRNA. /FEA = CDS /GEN = BCAT1(DNA) and 129/PROD = branched chain aminotransferase 1,(amino acid)cytosolic /DB_XREF = gi: 5031606/UG = Hs.157205 branched chainaminotransferase 1, cytosolic/FL = gb: U21551.1 gb: NM_005504.1BTG family, member 2gb: NM_006763.1 /DEF = Homo sapiens BTG201236_s_atSEQ ID NOS: 6family, member 2 (BTG2), mRNA.(DNA) and 130/FEA = mRNA /GEN = BTG2 /PROD = BTG(amino acid)family, member 2 /DB_XREF = gi: 5802987/UG = Hs.75462 BTG family, member 2/FL = gb: U72649.1 gb: NM_006763.1Carcinoembryonicgb: BC005008.1 /DEF = Homo sapiens,203757_s_atantigen-related cellcarcinoembryonic antigen-related celladhesion molecule 6adhesion molecule 6 (non-specific cross(non-specific crossreacting antigen), clone MGC: 10467, mRNA,reacting antigen)complete cds. /FEA = mRNASEQ ID NOS: 7/PROD = carcinoembryonic antigen-related(DNA) and 131cell adhesionmolecule 6 (non-specific cross(amino acid)reacting antigen) /DB_XREF = gi: 13477106/UG = Hs.73848 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specificcross reacting antigen) /FL = gb: BC005008.1gb: M18216.1 gb: M29541.1 gb: NM_002483.1caspase 10, apoptosis-gb: NM_001230.1 /DEF = Homo sapiens205467_atrelated cysteinecaspase 10, apoptosis-related cysteineproteaseprotease (CASP10), mRNA. /FEA = mRNASEQ ID NOS: 8/GEN = CASP10 /PROD = caspase 10,(DNA) and 132apoptosis-related cysteine protease(amino acid)/DB_XREF = gi: 4502568 /UG = Hs.5353caspase 10, apoptosis-related cysteineprotease /FL = gb: U60519.1 gb: NM_001230.1CUG triplet repeat,gb: NM_006561.1 /DEF = Homo sapiens CUG202158_s_atRNA-binding protein 2triplet repeat, RNA-binding protein 2SEQ ID NOS: 9(CUGBP2), mRNA. /FEA = mRNA(DNA) and 133/GEN = CUGBP2 /PROD = CUG triplet repeat,(amino acid)RNA-binding protein 2/DB_XREF = gi: 5729815 /UG = Hs.211610CUG triplet repeat, RNA-binding protein 2/FL = gb: U69546.1 gb: AF036956.1gb: AF090694.1 gb: NM_006561.1cystatin Sgb: NM_001899.1 /DEF = Homo sapiens206994_atSEQ ID NOS: 10cystatin S (CST4), mRNA. /FEA = mRNA(DNA) and 134/GEN = CST4 /PROD = cystatin S(amino acid)/DB_XREF = gi: 4503108 /UG = Hs.56319cystatin S /FL = gb: NM_001899.1cystic fibrosisgb: NM_000492.2 /DEF = Homo sapiens cystic205043_attransmembranefibrosis transmembrane conductanceconductanceregulator, ATP-binding cassette (sub-familyregulator, ATP-C, member 7) (CFTR), mRNA.binding cassette (sub-/FEA = mRNA /GEN = CFTR /PROD = cysticfamily C, member 7)fibrosis transmembrane conductanceregulator,SEQ ID NOS: 11ATP-binding cassette (sub-family C, member(DNA) and 1357) /DB_XREF = gi: 6995995 /UG = Hs.663(amino acid)cystic fibrosis transmembrane conductanceregulator, ATP-binding cassette (sub-familyC, member 7) /FL = gb: NM_000492.2cytochrome P450,gb: NM_000775.1 /DEF = Homo sapiens205073_atsubfamily IIJcytochrome P450, subfamily IIJ (arachidonic(arachidonic acidacid epoxygenase) polypeptide 2 (CYP2J2),epoxygenase)mRNA. /FEA = mRNA /GEN = CYP2J2polypeptide 2/PROD = cytochrome P450, subfamily IIJSEQ ID NOS: 12(arachidonic acidepoxygenase) polypeptide 2(DNA) and 136/DB_XREF = gi: 4503226 /UG = Hs.152096(amino acid)cytochrome P450, subfamily IIJ (arachidonicacid epoxygenase) polypeptide 2/FL = gb: U37143.1 gb: NM_000775.1dipeptidylpeptidasegb: M80536.1 /DEF = H. sapiens dipeptidylpeptidase203716_s_atIV (CD26, adenosineIV (DPP4) mRNA, complete cds.deaminase/FEA = mRNA /GEN = DPP4complexing protein 2)/PROD = dipeptidyl peptidase IVSEQ ID NOS 13/DB_XREF = gi: 181569 /UG = Hs.44926(DNA) and 137dipeptidylpeptidase IV (CD26, adenosine(amino acid)deaminase complexing protein 2)/FL = gb: M80536.1 gb: NM_001935.1DKFZP434C091Consensus includes gb: AL080170.1215047_atprotein/DEF = Homo sapiens mRNA; cDNASEQ ID NO: 14DKFZp434C091 (from clone(DNA)DKFZp434C091); partial cds. /FEA = mRNA/GEN = DKFZp434C091 /PROD = hypotheticalprotein /DB_XREF = gi: 5262639/UG = Hs.51692 DKFZP434C091 proteindopa decarboxylaseConsensus includes gb: AW772056214347_s_at(aromatic L-amino/FEA = EST /DB_XREF = gi: 7704118acid decarboxylase)/DB_XREF = est: hn64g06.x1SEQ ID NO: 15/CLONE = IMAGE: 3032698 /UG = Hs.150403(DNA)dopa decarboxylase (aromatic L-amino aciddecarboxylase)EphA1gb: NM_005232.1 /DEF = Homo sapiens205977_s_atSEQ ID NOS: 16EphA1 (EPHA1), mRNA. /FEA = mRNA(DNA) and 138/GEN = EPHA1 /PROD = EphA1(amino acid)/DB_XREF = gi: 4885208 /UG = Hs.89839EphA1 /FL = gb: M18391.1 gb: NM_005232.1ESTs, ModeratelyConsensus includes gb: R06655 /FEA = EST217546_atsimilar to AF078844/DB_XREF = gi: 7572751 hqp0376 protein/DB_XREF = est: yf10e02.r1[H. sapiens]/CLONE = IMAGE: 126458 /UG = Hs.188518SEQ ID NO: 17ESTs, Moderately similar to AF078844 1(DNA)hqp0376 protein H. sapiensESTs, Weakly similarConsensus includes gb: AW675655222354_atto I38022/FEA = EST /DB_XREF = gi: 7540890hypothetical protein/DB_XREF = est: ba52e01.x1[H. sapiens]/CLONE = IMAGE: 2900184 /UG = Hs.314158SEQ ID NO: 18ESTs(DNA)fibroblast growthgb: NM_022969.1 /DEF = Homo sapiens203638_s_atfactor receptor 2fibroblast growth factor receptor 2 (bacteria-(bacteria-expressedexpressed kinase, keratinocyte growth factorkinase, keratinocytereceptor, craniofacial dysostosis 1, Crouzongrowth factorsyndrome, Pfeiffer syndrome, Jackson-Weissreceptor, craniofacialsyndrome) (FGFR2), transcript variant 2,dysostosis 1, CrouzonmRNA. /FEA = mRNA /GEN = FGFR2syndrome, Pfeiffer/PROD = fibroblast growth factor receptor 2,syndrome, Jackson-isoform 2precursor /DB_XREF = gi: 13186252Weiss syndrome)/UG = Hs.278581 fibroblast growth factorSEQ ID NOS: 19receptor 2 (bacteria-expressed kinase,(DNA) and 139keratinocyte growth factor receptor,(amino acid)craniofacial dysostosis 1, Crouzon syndrome,Pfeiffer syndrome, Jackson-Weiss syndrome)/FL = gb: NM_022969.1 gb: M97193.1gb: M80634.1FXYD domain-gb: BC005238.1 /DEF = Homo sapiens, FXYD202489_s_atcontaining iondomain-containing ion transport regulator 3,transport regulator 3clone MGC: 12265, mRNA, complete cds.SEQ ID NOS: 20/FEA = mRNA /PROD = FXYD domain-(DNA) and 140containing ion transport regulator3(amino acid)/DB_XREF = gi: 13528881 /UG = Hs.301350FXYD domain-containing ion transportregulator 3 /FL = gb: NM_005971.2gb: BC005238.1G protein-coupledgb: AF062006.1 /DEF = Homo sapiens orphan210393_atreceptor 49G protein-coupled receptor HG38 mRNA,SEQ ID NOS: 21complete cds. /FEA = mRNA /PROD = orphan(DNA) and 141G protein-coupled receptor HG38(amino acid)/DB_XREF = gi: 3366801 /UG = Hs.285529 Gprotein-coupled receptor 49/FL = gb: AF062006.1 gb: AF061444.1gb: NM_003667.1hairless (mouse)gb: NM_018411.1 /DEF = Homo sapiens220163_s_athomologhairless protein (putative single zinc fingerSEQ ID NOS: 22transcription factor protein, responsible for(DNA) and 142autosomal recessive universal congenital(amino acid)alopecia, HR gene) (HSA277165), mRNA./FEA = mRNA /GEN = HSA277165/PROD = hairless protein/DB_XREF = gi: 11036651 /UG = Hs.272367hairless protein (putative single zinc fingertranscription factor protein, responsible forautosomal recessive universal congenitalalopecia, HR gene) /FL = gb: NM_018411.1hemoglobin, alpha 1gb: BC005931.1 /DEF = Homo sapiens,211745_x_atSEQ ID NOS: 23hemoglobin, alpha 2, clone MGC: 14541,(DNA) and 143mRNA, complete cds. /FEA = mRNA(amino acid)/PROD = hemoglobin, alpha 2/DB_XREF = gi: 13543547/FL = gb: BC005931.1hemoglobin, alpha 2Consensus includes gb: T50399 /FEA = EST214414_x_atSEQ ID NO: 24/DB_XREF = gi: 652259(DNA)/DB_XREF = est: yb30b11.s1/CLONE = IMAGE: 72669 /UG = Hs.251577hemoglobin, alpha 1heparanasegb: NM_006665.1 /DEF = Homo sapiens219403_s_atSEQ ID NOS: 25heparanase (HPSE), mRNA. /FEA = mRNA(DNA) and 144/GEN = HPSE /PROD = heparanase(amino acid)/DB_XREF = gi: 5729872 /UG = Hs.44227heparanase /FL = gb: AF165154.1gb: AF152376.1 gb: NM_006665.1gb: AF084467.1 gb: AF155510.1Hermansky-PudlakConsensus includes gb: AL022313217354_s_atsyndrome/DEF = Human DNA sequence from cloneSEQ ID NOS: 26RP5-1119A7 on chromosome 22q12.2-12.3(DNA) and 145Contains the TXN2 gene for mitochondrial(amino acid)thioredoxin, a novel gene, the EIF3S7 genefor eukaryotic translation initiation factor 3subunit 7 (zeta, 6667 kD) (EIF3-P66), thegene f . . . /FEA = CDS_3/DB_XREF = gi: 4200326 /UG = Hs.272270Human DNA sequence from clone RP5-1119A7 on chromosome 22q12.2-12.3Contains the TXN2 gene for mitochondrialthioredoxin, a novel gene, the EIF3S7 genefor eukaryotic translation initiation factor 3subunit 7 (zeta, 6667 kD) (EIF3-P66), thegene for a novHERV-H LTR-gb: NM_007072.1 /DEF = Homo sapiens220812_s_atassociating 2HERV-H LTR-associating 2 (HHLA2),SEQ ID NOS: 27mRNA. /FEA = mRNA /GEN = HHLA2(DNA) and 146/PROD = HERV-H LTR-associating 2(amino acid)/DB_XREF = gi: 5901963 /UG = Hs.252351HERV-H LTR-associating 2/FL = gb: AF126162.1 gb: NM_007072.1Homo sapiens cloneConsensus includes gb: AW593996213256_at24707 mRNA/FEA = EST /DB_XREF = gi: 7281254sequence/DB_XREF = est: hg41g06.x1SEQ ID NO: 28/CLONE = IMAGE: 2948218 /UG = Hs.124969(DNA)Homo sapiens clone 24707 mRNA sequenceHomo sapiensConsensus includes gb: AL049983.1217288_atmRNA; cDNA/DEF = Homo sapiens mRNA; cDNADKFZp564D042DKFZp564D042 (from clone(from cloneDKFZp564D042). /FEA = mRNADKFZp564D042)/DB_XREF = gi: 4884234 /UG = Hs.240136SEQ ID NO: 29Homo sapiens mRNA; cDNA(DNA)DKFZp564D042 (from cloneDKFZp564D042)hypothetical proteingb: NM_017640.1 /DEF = Homo sapiens219573_atFLJ20048hypothetical protein FLJ20048 (FLJ20048),SEQ ID NOS: 30mRNA. /FEA = mRNA /GEN = FLJ20048(DNA) and 147/PROD = hypothetical protein FLJ20048(amino acid)/DB_XREF = gi: 8923056 /UG = Hs.116470hypothetical protein FLJ20048/FL = gb: NM_017640.1hypothetical proteingb: NM_017655.1 /DEF = Homo sapiens219970_atFLJ20075hypothetical protein FLJ20075 (FLJ20075),SEQ ID NOS: 31mRNA. /FEA = mRNA /GEN = FLJ20075(DNA) and 148/PROD = hypothetical protein FLJ20075(amino acid)/DB_XREF = gi: 8923083 /UG = Hs.205058hypothetical protein FLJ20075/FL = gb: NM_017655.1interferon consensusConsensus includes gb: AI073984 /FEA = EST204057_atsequence binding/DB_XREF = gi: 3400628protein 1/DB_XREF = est: oy66c05.x1SEQ ID NO: 32/CLONE = IMAGE: 1670792 /UG = Hs.14453(DNA)interferon consensus sequence binding protein1 /FL = gb: M91196.1 gb: NM_002163.1KIAA0690 proteinConsensus includes gb: AK000238.1216360_x_atSEQ ID NO: 33/DEF = Homo sapiens cDNA FLJ20231 fis,(DNA)clone COLF5511, highly similar toAB014590 Homo sapiens mRNA forKIAA0690 protein. /FEA = mRNA/DB_XREF = gi: 7020188 /UG = Hs.60103KIAA0690 proteinmatrilin 3gb: NM_002381.2 /DEF = Homo sapiens206091_atSEQ ID NOS: 34matrilin 3 (MATN3) precursor, mRNA.(DNA) and 149/FEA = mRNA /GEN = MATN3(amino acid)/PROD = matrilin 3 precursor/DB_XREF = gi: 13518040 /UG = Hs.278461matrilin 3 /FL = gb: NM_002381.2metastasis-associatedgb: NM_004739.1 /DEF = Homo sapiens203444_s_at1-like 1metastasis-associated 1-like 1 (MTA1L1),SEQ ID NOS: 35mRNA. /FEA = mRNA /GEN = MTA1L1(DNA) and 150/PROD = metastasis-associated 1-like 1(amino acid)/DB_XREF = gi: 4758739 /UG = Hs.173043metastasis-associated 1-like 1/FL = gb: AB016591.1 gb: NM_004739.1gb: AF295807.1mucin 2,gb: NM_002457.1 /DEF = Homo sapiens mucin204673_atintestinal/tracheal2, intestinaltracheal (MUC2), mRNA.SEQ ID NOS: 36/FEA = mRNA /GEN = MUC2 /PROD = mucin(DNA) and 1512, intestinaltracheal /DB_XREF = gi: 4505284(amino acid)/UG = Hs.315 mucin 2, intestinaltracheal/FL = gb: NM_002457.1 gb: L21998.1mucin 3BConsensus includes gb: AB038783.1214898_x_atSEQ ID NOS: 37/DEF = Homo sapiens MUC3B mRNA for(DNA) and 152intestinal mucin, partial cds. /FEA = mRNA(amino acid)/GEN = MUC3B /PROD = intestinal mucin/DB_XREF = gi: 9929917 /UG = Hs.129782mucin 3A, intestinalmyosin, heavygb: NM_003802.1 /DEF = Homo sapiens208208_atpolypeptide 13,myosin, heavy polypeptide 13, skeletalskeletal musclemuscle (MYH13), mRNA. /FEA = mRNASEQ ID NOS: 38/GEN = MYH13 /PROD = myosin, heavy(DNA) and 153polypeptide 13, skeletal muscle(amino acid)/DB_XREF = gi: 11321578 /UG = Hs.278488myosin, heavy polypeptide 13, skeletalmuscle /FL = gb: NM_003802.1gb: AF111782.2myosin, lightgb: NM_002477.1 /DEF = Homo sapiens205145_s_atpolypeptide 5,myosin, light polypeptide 5, regulatoryregulatory(MYL5), mRNA. /FEA = mRNASEQ ID NOS: 39/GEN = MYL5 /PROD = myosin, light(DNA) and 154polypeptide 5, regulatory(amino acid)/DB_XREF = gi: 4505304 /UG = Hs.170482myosin, light polypeptide 5, regulatory/FL = gb: L03785.1 gb: NM_002477.1nuclear receptorgb: NM_000901.1 /DEF = Homo sapiens205259_atsubfamily 3, group C,nuclear receptor subfamily 3, group C,member 2member 2 (NR3C2), mRNA. /FEA = mRNASEQ ID NOS: 40/GEN = NR3C2 /PROD = nuclear receptor(DNA) and 155subfamily 3, group C, member 2(amino acid)/DB_XREF = gi: 4505198 /UG = Hs.1790nuclear receptor subfamily 3, group C,member 2 /FL = gb: M16801.1gb: NM_000901.1nuclear receptorConsensus includes gb: AF228413.1210174_atsubfamily 5, group A,/DEF = Homo sapiens hepatocyte transcriptionmember 2factor mRNA, 3UTR. /FEA = mRNASEQ ID NOS: 41/DB_XREF = gi: 7677372 /UG = Hs.183123(DNA) and 156nuclear receptor subfamily 5, group A,(amino acid)member 2 /FL = gb: U93553.1 gb: AB019246.1gb: AF124247.1pancreas-enrichedgb: NM_016341.1 /DEF = Homo sapiens205112_atphospholipase Cpancreas-enriched phospholipase CSEQ ID NOS: 42(LOC51196), mRNA. /FEA = mRNA(DNA) and 157/GEN = LOC51196 /PROD = pancreas-enriched(amino acid)phospholipase C /DB_XREF = gi: 7705940/UG = Hs.6733 pancreas-enrichedphospholipase C /FL = gb: AF190642.2gb: AF117948.1 gb: NM_016341.1peroxisomal trans 2-gb: NM_018441.1 /DEF = Homo sapiens221142_s_atenoyl CoA reductase;peroxisomal trans 2-enoyl CoA reductase;putative short chainputative short chain alcohol dehydrogenasealcohol(HSA250303), mRNA. /FEA = mRNAdehydrogenase/GEN = HSA250303 /PROD = peroxisomalSEQ ID NOS: 43trans 2-enoyl CoA reductase; putative short(DNA) and 158chain alcohol dehydrogenase(amino acid)/DB_XREF = gi: 8923751 /UG = Hs.281680peroxisomal trans 2-enoyl CoA reductase;putative short chain alcohol dehydrogenase/FL = gb: NM_018441.1phosducingb: M33478.1 /DEF = Human 33-kDa211496_s_atSEQ ID NOS: 44phototransducing protein mRNA, complete(DNA) and 159cds. /FEA = mRNA /DB_XREF = gi: 177186(amino acid)/UG = Hs.550 phosducin/FL = gb: NM_022577.1 gb: M33478.1gb: AF076465.1phosphatase andgb: NM_000314.1 /DEF = Homo sapiens204054_attensin homologphosphatase and tensin homolog (mutated in(mutated in multiplemultiple advanced cancers 1) (PTEN),advanced cancers 1)mRNA. /FEA = mRNA /GEN = PTENSEQ ID NOS: 45/PROD = phosphatase and tensin homolog(DNA) and 160(mutated inmultiple advanced cancers 1)(amino acid)/DB_XREF = gi: 4506248 /UG = Hs.10712phosphatase and tensin homolog (mutated inmultiple advanced cancers 1)/FL = gb: U92436.1 gb: U93051.1 gb: U96180.1gb: NM_000314.1potassium channel,gb: U90065.1 /DEF = Human potassium204678_s_atsubfamily K, memberchannel KCNO1 mRNA, complete cds.1 (TWIK-1)/FEA = mRNA /PROD = potassium channelSEQ ID NOS: 46KCNO1 /DB_XREF = gi: 1916294(DNA) and 161/UG = Hs.79351 potassium channel, subfamily(amino acid)K, member 1 (TWIK-1) /FL = gb: U33632.1gb: U90065.1 gb: U76996.1 gb: NM_002245.1prostaglandin-gb: NM_000963.1 /DEF = Homo sapiens204748_atendoperoxideprostaglandin-endoperoxide synthase 2synthase 2(prostaglandin GH synthase and(prostaglandin G/Hcyclooxygenase) (PTGS2), mRNA.synthase and/FEA = mRNA /GEN = PTGS2cyclooxygenase)/PROD = prostaglandin-endoperoxide synthaseSEQ ID NOS: 472(prostaglandin GH synthase and(DNA) and 162cyclooxygenase) /DB_XREF = gi: 4506264(amino acid)/UG = Hs.196384 prostaglandin-endoperoxidesynthase 2 (prostaglandin GH synthase andcyclooxygenase) /FL = gb: M90100.1gb: L15326.1 gb: NM_000963.1protease inhibitor 3,gb: NM_002638.1 /DEF = Homo sapiens203691_atskin-derivedprotease inhibitor 3, skin-derived (SKALP)(SKALP)(PI3), mRNA. /FEA = mRNA /GEN = PI3SEQ ID NOS: 48/PROD = protease inhibitor 3, skin-derived(DNA) and 163(SKALP) /DB_XREF = gi: 4505786(amino acid)/UG = Hs.112341 protease inhibitor 3, skin-derived (SKALP) /FL = gb: NM_002638.1PTPRF interactingConsensus includes gb: AI692180 /FEA = EST212841_s_atprotein, binding/DB_XREF = gi: 4969520protein 2 (liprin beta/DB_XREF = est: wd37f06.x12)/CLONE = IMAGE: 2330339 /UG = Hs.12953SEQ ID NO: 49PTPRF interacting protein, binding protein 2(DNA)(liprin beta 2)retinoic acid receptorConsensus includes gb: AI669229 /FEA = EST221872_atresponder (tazarotene/DB_XREF = gi: 4834003induced) 1/DB_XREF = est: wc13e06.x1SEQ ID NO: 50/CLONE = IMAGE: 2315074 /UG = Hs.82547(DNA)retinoic acid receptor responder (tazaroteneinduced) 1Rho GTPasegb: NM_015366.1 /DEF = Homo sapiens Rho205980_s_atactivating protein 8GTPase activating protein 8 (ARHGAP8),SEQ ID NOS: 51mRNA. /FEA = mRNA /GEN = ARHGAP8(DNA) and 164/PROD = Rho GTPase activating protein 8(amino acid)/DB_XREF = gi: 7656903 /UG = Hs.102336Rho GTPase activating protein 8/FL = gb: NM_015366.1ribonuclease, RNasegb: NM_002933.1 /DEF = Homo sapiens201785_atA family, 1ribonuclease, RNase A family, 1 (pancreatic)(pancreatic)(RNASE1), mRNA. /FEA = mRNASEQ ID NOS: 52/GEN = RNASE1 /PROD = ribonuclease,(DNA) and 165RNase A family, 1 (pancreatic)(amino acid)/DB_XREF = gi: 4506546 /UG = Hs.78224ribonuclease, RNase A family, 1 (pancreatic)/FL = gb: BC005324.1 gb: NM_002933.1gb: D26129.1serine (or cysteine)gb: NM_002639.1 /DEF = Homo sapiens serine204855_atproteinase inhibitor,(or cysteine) proteinase inhibitor, clade Bclade B (ovalbumin),(ovalbumin), member 5 (SERPINB5),member 5mRNA. /FEA = mRNA /GEN = SERPINB5SEQ ID NOS: 53/PROD = serine (or cysteine) proteinase(DNA) and 166inhibitor, cladeB (ovalbumin), member 5(amino acid)/DB_XREF = gi: 4505788 /UG = Hs.55279serine (or cysteine) proteinase inhibitor, cladeB (ovalbumin), member 5/FL = gb: NM_002639.1 gb: U04313.1spondin 1, (f-spondin)Consensus includes gb: AI885290 /FEA = EST213994_s_atextracellular matrix/DB_XREF = gi: 5590454protein/DB_XREF = est: wl92a04.x1SEQ ID NO: 54/CLONE = IMAGE: 2432334 /UG = Hs.5378(DNA)spondin 1, (f-spondin) extracellular matrixproteinsuperoxide dismutasegb: NM_003102.1 /DEF = Homo sapiens205236_x_at3, extracellularsuperoxide dismutase 3, extracellular (SOD3),SEQ ID NOS: 55mRNA. /FEA = mRNA /GEN = SOD3(DNA) and 167/PROD = superoxide dismutase 3, extracellular(amino acid)/DB_XREF = gi: 4507150 /UG = Hs.2420superoxide dismutase 3, extracellular/FL = gb: J02947.1 gb: NM_003102.1tumor necrosis factorgb: BC002794.1 /DEF = Homo sapiens, tumor209354_atreceptor superfamily,necrosis factor receptor superfamily, membermember 1414 (herpesvirus entry mediator), clone(herpesvirus entryMGC: 3753, mRNA, complete cds.mediator)/FEA: = mRNA /PROD = tumor necrosis factorSEQ ID NOS: 56receptor superfamily, member 14 (herpesvirus(DNA) and 168entry mediator) /DB_XREF = gi: 12803894(amino acid)/UG = Hs.279899 tumor necrosis factorreceptor superfamily, member 14 (herpesvirusentry mediator) /FL = gb: BC002794.1gb: U70321.1 gb: U81232.1 gb: NM_003820.1gb: AF153978.1tumor necrosis factorgb: NM_000043.1 /DEF = Homo sapiens tumor204781_s_atreceptor superfamily,necrosis factor receptor superfamily, membermember 66 (TNFRSF6), mRNA. /FEA = mRNASEQ ID NOS: 57/GEN = TNFRSF6 /PROD = apoptosis (APO-1)(DNA) and 169antigen 1 /DB_XREF = gi: 4507582(amino acid)/UG = Hs.82359 tumor necrosis factor receptorsuperfamily, member 6 /FL = gb: M67454.1gb: NM_000043.1zinc finger proteingb: NM_003438.1 /DEF = Homo sapiens zinc207394_at137 (clone pHZ-30)finger protein 137 (clone pHZ-30) (ZNF137),SEQ ID NOS: 58mRNA. /FEA = mRNA /GEN = ZNF137(DNA) and 170/PROD = zinc finger protein 137 (clone pHZ-(amino acid)30) /DB_XREF = gi: 4507988 /UG = Hs.151689zinc finger protein 137 (clone pHZ-30)/FL = gb: NM_003438.1 gb: U09414.1hypothetical proteinConsensus includes gb: AI339568 /FEA = EST222727_s_atFLJ22233/DB_XREF = gi: 4076495SEQ ID NO: 59/DB_XREF = est: qk67e10.x1(DNA)/CLONE = IMAGE: 1874058 /UG = Hs.286194hypothetical protein FLJ22233/FL = gb: NM_024959.1regenerating genegb: AY007243.1 /DEF = Homo sapiens223447_attype IVregenerating gene type IV mRNA, completeSEQ ID NOS: 60cds. /FEA = mRNA /PROD = regenerating gene(DNA) and 171type IV /DB_XREF = gi: 12621025(amino acid)/UG = Hs.105484 Homo sapiens regeneratinggene type IV mRNA, complete cds/FL = gb: AY007243.1Homo sapiens cDNA:Consensus includes gb: AK025615.1225285_atFLJ21962 fis, clone/DEF = Homo sapiens cDNA: FLJ21962 fis,HEP05564clone HEP05564. /FEA = mRNASEQ ID NO: 61/DB_XREF = gi: 10438186 /UG = Hs.7567(DNA)Homo sapiens cDNA: FLJ21962 fis, cloneHEP05564ESTsConsensus includes gb: N37023 /FEA = EST225407_atSEQ ID NO: 62/DB_XREF = gi: 1158165(DNA)/DB_XREF = est: yy40d03.s1/CLONE = IMAGE: 273701 /UG = Hs.235883ESTsphosphoproteinConsensus includes gb: AK000680.1225626_atassociated with/DEF = Homo sapiens cDNA FLJ20673 fis,glycosphingolipid-clone KAIA4464. /FEA = mRNAenriched/DB_XREF = gi: 7020924 /UG = Hs.266175microdomainsphosphoprotein associated with GEMsSEQ ID NOS: 63/FL = gb: AF240634.1 gb: NM_018440.1(DNA) and 172(amino acid)prostate cancerConsensus includes gb: AA633076 /FEA = EST226167_atassociated protein 7/DB_XREF = gi: 2556490SEQ ID NO: 64/DB_XREF = est: nq38a06.s1(DNA)/CLONE = IMAGE: 1146130 /UG = Hs.27495prostate cancer associated protein 7Homo sapiens,Consensus includes gb: AA524690 /FEA = EST226168_atSimilar to RIKEN/DB_XREF = gi: 2265618cDNA 1110060O18/DB_XREF = est: ng38e07.s1gene, clone/CLONE = IMAGE: 937092 /UG = Hs.294143MGC: 17236ESTs, Weakly similar to predicted usingIMAGE: 3864137,Genefinder C. elegansmRNA, complete cdsSEQ ID NO: 65(DNA)hypothetical proteinConsensus includes gb: BF111925 /FEA = EST226171_atFLJ20209/DB_XREF = gi: 10941704SEQ ID NO: 66/DB_XREF = est: 7138g05.x1(DNA)/CLONE = IMAGE: 3523784 /UG = Hs.3685hypothetical protein FLJ20209Homo sapiens mRNAConsensus includes gb: AA532640 /FEA = EST226484_atfor KIAA1190/DB_XREF = gi: 2276894protein, partial cds/DB_XREF = est: nj17c04.s1SEQ ID NOS: 67/CLONE = IMAGE: 986598 /UG = Hs.206259(DNA) and 173Homo sapiens mRNA for KIAA1190 protein,(amino acid)partial cdsKIAA1543 proteinConsensus includes gb: AB040976.1226494_atSEQ ID NOS: 68/DEF = Homo sapiens mRNA for KIAA1543(DNA) and 174protein, partial cds. /FEA = mRNA(amino acid)/GEN = KIAA1543 /PROD = KIAA1543protein /DB_XREF = gi: 7959352/UG: Hs.17686 KIAA1543 proteinhypothetical proteinConsensus includes gb: AK002203.1226992_atMGC20702/DEF = Homo sapiens cDNA FLJ11341 fis,SEQ ID NO: 69clone PLACE1010786. /FEA = mRNA(DNA)/DB_XREF = gi: 7023932 /UG = Hs.10260Homo sapiens cDNA FLJ11341 fis, clonePLACE1010786Homo sapiens cDNAConsensus includes gb: AA129774 /FEA = EST227019_atFLJ13137 fis, clone/DB_XREF = gi: 1690185NT2RP3003150/DB_XREF = est: zl16h09.s1SEQ ID NO: 70/CLONE = IMAGE: 502145 /UG = Hs.288905(DNA)Homo sapiens cDNA FLJ13137 fis, cloneNT2RP3003150hypothetical proteinConsensus includes gb: AW138767227180_atFLJ23563/FEA = EST /DB_XREF = gi: 6143085SEQ ID NO: 71/DB_XREF = est: UI-H-BI1-aep-a-12-0-UI.s1(DNA)/CLONE = IMAGE: 2719799 /UG = Hs.274256hypothetical protein FLJ23563ESTsConsensus includes gb: AW264333227320_atSEQ ID NO: 72/FEA = EST /DB_XREF = gi: 6641075(DNA)/DB_XREF = est: xq98e01.x1/CLONE = IMAGE: 2758680 /UG = Hs.21835ESTsESTsConsensus includes gb: BF589359 /FEA = EST227354_atSEQ ID NO: 73/DB_XREF = gi: 11681683(DNA)/DB_XREF = est: nab25d01.x1/CLONE = IMAGE: 3266737 /UG = Hs.13256ESTsHomo sapiens,Consensus includes gb: AW001287227676_atSimilar to RIKEN/FEA = EST /DB_XREF = gi: 5848203cDNA 1810037C20/DB_XREF = est: wu27e06.x1gene, clone/CLONE = IMAGE: 2521282 /UG = Hs.61265MGC: 21481ESTs, Weakly similar to G786_HUMANIMAGE: 3852062,PROTEIN GS3786 H. sapiensmRNA, complete cdsSEQ ID NO: 74(DNA)ESTs, Weakly similarConsensus includes gb: AA557324 /FEA = EST227702_atto JX0331 laurate/DB_XREF = gi: 2327801omega-hydroxylase/DB_XREF = est: nl81a02.s1[H. sapiens]/CLONE = IMAGE: 1057034 /UG = Hs.26040SEQ ID NO: 75ESTs, Weakly similar to fatty acid omega-(DNA)hydroxylase H. sapiensHomo sapiens cDNA:Consensus includes gb: T86159 /FEA = EST227724_atFLJ22063 fis, clone/DB_XREF = gi: 714511HEP10326/DB_XREF = est: yd84h07.s1SEQ ID NO: 76/CLONE = IMAGE: 114973 /UG = Hs.10450(DNA)Homo sapiens cDNA: FLJ22063 fis, cloneHEP10326GalNAc alpha-2,6-Consensus includes gb: Y11339.2227725_atsialyltransferase I,/DEF = Homo sapiens mRNA for GalNAclong formalpha-2,6-sialyltransferase I, long form.SEQ ID NOS: 77/FEA = mRNA /PROD = GalNAc alpha-2,6-(DNA) and 175sialyltransferase I /DB_XREF = gi: 7576275(amino acid)/UG = Hs.105352 GalNAc alpha-2,6-sialyltransferase I, long formESTs, Weakly similarConsensus includes gb: AI827789 /FEA = EST228241_atto JE0350 Anterior/DB_XREF = gi: 5448449gradient-2/DB_XREF = est: wf33a07.x1[H. sapiens]/CLONE = IMAGE: 2357364 /UG = Hs.100686SEQ ID NO: 78ESTs, Weakly similar to JE0350 Anterior(DNA)gradient-2 H. sapiensESTsConsensus includes gb: AI700341 /FEA = EST228653_atSEQ ID NO: 79/DB_XREF = gi: 4988241(DNA)/DB_XREF = est: wd06e10.x1/CLONE = IMAGE: 2327370 /UG = Hs.110406ESTsESTsConsensus includes gb: BG494007 /FEA = EST228716_atSEQ ID NO: 80/DB_XREF = gi: 13455521(DNA)/DB_XREF = est: 602542289F1/CLONE = IMAGE: 4673182 /UG = Hs.203213ESTsanterior gradient 2Consensus includes gb: AI922323 /FEA = EST228969_at(Xenepus laevis)/DB_XREF = gi: 5658287homolog/DB_XREF = est: wn90h03.x1SEQ ID NO: 81/CLONE = IMAGE: 2453141 /UG = Hs.293380(DNA)ESTsHomo sapiens cDNA:Consensus includes gb: AK026984.1229021_atFLJ23331 fis, clone/DEF = Homo sapiens cDNA: FLJ23331 fis,HEP12664clone HEP12664 /FEA = mRNASEQ ID NO: 82/DB_XREF = gi: 10439980 /UG = Hs.50742(DNA)Homo sapiens cDNA: FLJ23331 fis, cloneHEP12664ESTsConsensus includes gb: AI559300 /FEA = EST229331_atSEQ ID NO: 83/DB_XREF = gi: 4509505(DNA)/DB_XREF = est: tq43d03.x1/CLONE = IMAGE: 2211557 /UG = Hs.294140ESTshypothetical proteinConsensus includes gb: AI830823 /FEA = EST229439_s_atSEQ ID NO: 84/DB_XREF = gi: 5451416(DNA)/DB_XREF = est: wj52b06.x1/CLONE = IMAGE: 2406419 /UG = Hs.95549hypothetical proteinESTsConsensus includes gb: BF431989 /FEA = EST229657_atSEQ ID NO: 85/DB_XREF = gi: 11444103(DNA)/DB_XREF = est: nab84a05.x1/CLONE = IMAGE: 3274280 /UG = Hs.203213ESTsESTsConsensus includes gb: BF589413 /FEA = EST229893_atSEQ ID NO: 86/DB_XREF = gi: 11681737(DNA)/DB_XREF = est: nab26b11.x1/CLONE = IMAGE: 3267020 /UG = Hs.55501ESTsbrain-specific proteinConsensus includes gb: BG055052 /FEA = EST230104_s_atp25 alpha/DB_XREF = gi: 12512386SEQ ID NO: 87/DB_XREF = est: nac94g06.x1(DNA)/CLONE = IMAGE: 3441995 /UG = Hs.29353brain-specific protein p25 alphaESTs, Weakly similarConsensus includes gb: BF110588 /FEA = EST230645_atto MMHUE4/DB_XREF = gi: 10940278erythrocyte/DB_XREF = est: 7n39e12.x1membrane protein/CLONE = IMAGE: 3567071 /UG = Hs.1504784.1, parent spliceESTs, Weakly similar to KIAA0987 proteinform [H. sapiens]H. sapiensSEQ ID NO: 88(DNA)ESTsConsensus includes gb: BF592062 /FEA = EST230760_atSEQ ID NO: 89/DB_XREF = gi: 11684386(DNA)/DB_XREF = est: 7n98h06.x1/CLONE = IMAGE: 3572962 /UG = Hs.233890ESTshepatocyte nuclearConsensus includes gb: AI032108 /FEA = EST230914_atfactor 4, alpha/DB_XREF = gi: 3250320SEQ ID NO: 90/DB_XREF = est: ow92d11.x1(DNA)/CLONE = IMAGE: 1654293 /UG = Hs.54424hepatocyte nuclear factor 4, alphaESTsConsensus includes gb: AW203959230944_atSEQ ID NO: 91/FEA = EST /DB_XREF = gi: 6503431(DNA)/DB_XREF = est: UI-H-BI1-aeu-b-12-0-UI.s1/CLONE = IMAGE: 2720590 /UG = Hs.149532ESTsESTsConsensus includes gb: AI139990 /FEA = EST231022_atSEQ ID NO: 92/DB_XREF = gi: 3647447(DNA)/DB_XREF = est: qa47d03.x1/CLONE = IMAGE: 1689893 /UG = Hs.134586ESTsESTsConsensus includes gb: AI806131 /FEA = EST231148_atSEQ ID NO: 93/DB_XREF = gi: 5392697(DNA)/DB_XREF = est: wf06c06.x1/CLONE = IMAGE: 2349802 /UG = Hs.99376ESTshypothetical proteinConsensus includes gb: AB046810.1232083_atFLJ23045/DEF = Homo sapiens mRNA for KIAA1590SEQ ID NO: 94protein, partial cds. /FEA = mRNA(DNA)/GEN = KIAA1590 /PROD = KIAA1590protein /DB_XREF = gi: 10047254/UG = Hs.101774 hypothetical proteinFLJ23045Homo sapiens cDNA:Consensus includes gb: AK026404.1232321_atFLJ22751 fis, clone/DEF = Homo sapiens cDNA: FLJ22751 fis,KAIA0483, highlyclone KAIA0483, highly similar to AF016692similar to AF016692Homo sapiens small intestinal mucin (MUC3)Homo sapiens smallmRNA. /FEA = mRNAintestinal mucin/DB_XREF = gi: 10439257 /UG = Hs.271819(MUC3) mRNAHomo sapiens cDNA: FLJ22751 fis, cloneSEQ ID NO: 95KAIA0483, highly similar to AF016692(DNA)Homo sapiens small intestinal mucin (MUC3)mRNAHomo sapiens PACConsensus includes gb: AC004908232641_atclone RP5-855D21/DEF = Homo sapiens PAC clone RP5-SEQ ID NOS: 96855D21 /FEA = CDS_3(DNA), 176 (amino/DB_XREF = gi: 4156179 /UG = Hs.249181acid), 177 (aminoHomo sapiens PAC clone RP5-855D21acid), and 178 (aminoacid)putative microtubule-Consensus includes gb: AJ251708.1234669_x_atbinding protein/DEF = Homo sapiens partial mRNA forSEQ ID NO: 97putative microtubule-binding protein.(DNA)/FEA = mRNA /PROD = putative microtubule-binding protein /DB_XREF = gi: 6491740/UG = Hs.326544 putative microtubule-bindingproteinESTsConsensus includes gb: AI741469 /FEA = EST234970_atSEQ ID NO: 98/DB_XREF = gi: 5109757(DNA)/DB_XREF = est: wg11b01.x1/CLONE = IMAGE: 2364745 /UG = Hs.57787ESTsESTsConsensus includes gb: AI417897 /FEA = EST235444_atSEQ ID NO: 99/DB_XREF = gi: 4261401(DNA)/DB_XREF = est: tg55b06.x1/CLONE = IMAGE: 2112659 /UG = Hs.235860ESTsESTsConsensus includes gb: AA827649 /FEA = EST235515_atSEQ ID NO: 100/DB_XREF = gi: 2900090(DNA)/DB_XREF = est: od01a12.s1/CLONE = IMAGE: 1357918 /UG = Hs.105317ESTsESTsConsensus includes gb: AI493909 /FEA = EST235562_atSEQ ID NO: 101/DB_XREF = gi: 4394912(DNA)/DB_XREF = est: qz94e02.x1/CLONE = IMAGE: 2042234 /UG = Hs.6131ESTsESTsConsensus includes gb: AV741130 /FEA = EST235651_atSEQ ID NO: 102/DB_XREF = gi: 10858711(DNA)/DB_XREF = est: AV741130/CLONE = CBCATB06 /UG = Hs.173704ESTs, Moderately similar to ALU8_HUMANALU SUBFAMILY SX SEQUENCECONTAMINATION WARNING ENTRYH. sapiensESTs, Weakly similarConsensus includes gb: AI864053 /FEA = EST235678_atto I38588 reverse/DB_XREF = gi: 5528160transcriptase homolog/DB_XREF = est: wj55h10.x1[H. sapiens]/CLONE = IMAGE: 2406787 /UG = Hs.39972SEQ ID NO: 103ESTs, Weakly similar to I38588 reverse(DNA)transcriptase homolog H. sapiensESTsConsensus includes gb: AW339510235866_atSEQ ID NO: 104/FEA = EST /DB_XREF = gi: 6836136(DNA)/DB_XREF = est: xz91h08.x1/CLONE = IMAGE: 2871615 /UG = Hs.42722ESTsESTsConsensus includes gb: AI076192 /FEA = EST236422_atSEQ ID NO: 105/DB_XREF = gi: 3405370(DNA)/DB_XREF = est: oz01g07.x1/CLONE = IMAGE: 1674108 /UG = Hs.131933ESTsESTsConsensus includes gb: AL044570 /FEA = EST236548_atSEQ ID NO: 106/DB_XREF = gi: 5432785(DNA)/DB_XREF = est: DKFZp434L082_s1/CLONE = DKFZp434L082 /UG = Hs.147975ESTsESTsConsensus includes gb: AI968097 /FEA = EST237835_atSEQ ID NO: 107/DB_XREF = gi: 5764915(DNA)/DB_XREF = est: wu13a12.x1/CLONE = IMAGE: 2516830 /UG = Hs.131360ESTsESTsConsensus includes gb: AI733801 /FEA = EST237923_atSEQ ID NO: 108/DB_XREF = gi: 5054914(DNA)/DB_XREF = est: qk39c04.x5/CLONE = IMAGE: 1871334 /UG = Hs.146186ESTsESTsConsensus includes gb: BF594323 /FEA = EST238103_atSEQ ID NO: 109/DB_XREF = gi: 11686647(DNA)/DB_XREF = est: 7h79g07.x1/CLONE = IMAGE: 3322236 /UG = Hs.158989ESTsHomo sapiens, cloneConsensus includes gb: T69015 /FEA = EST238422_atMGC: 16402/DB_XREF = gi: 680163IMAGE: 3940360,/DB_XREF = est: yc31f04.s1mRNA, complete cds/CLONE = IMAGE: 82303 /UG = Hs.192728SEQ ID NO: 110ESTs(DNA)ESTsConsensus includes gb: AA502384 /FEA = EST238956_atSEQ ID NO: 111/DB_XREF = gi: 2237351(DNA)/DB_XREF = est: ne27f11.s1/CLONE = IMAGE: 898605 /UG = Hs.151529ESTsESTsConsensus includes gb: AI739241 /FEA = EST238984_atSEQ ID NO: 112/DB_XREF = gi: 5101222(DNA)/DB_XREF = est: wi14h02.x1/CLONE = IMAGE: 2390259 /UG = Hs.171480ESTsESTsConsensus includes gb: AA088446 /FEA = EST239065_atSEQ ID NO: 113/DB_XREF = gi: 1633958(DNA)/DB_XREF = est: zl89f04.s1/CLONE = IMAGE: 511807 /UG = Hs.170298ESTsESTsConsensus includes gb: AI493046 /FEA = EST239148_atSEQ ID NO: 114/DB_XREF = gi: 4394049(DNA)/DB_XREF = est: qz49b04.x1/CLONE = IMAGE: 2030191 /UG = Hs.146133ESTsESTsConsensus includes gb: AI243098 /FEA = EST239966_atSEQ ID NO: 115/DB_XREF = gi: 3838495(DNA)/DB_XREF = est: qh26e03.x1/CLONE = IMAGE: 1845820 /UG = Hs.178398ESTsESTs, Weakly similarConsensus includes gb: AI633523 /FEA = EST240106_atto A49175 Motch B/DB_XREF = gi: 4684853protein - mouse/DB_XREF = est: th68b11.x1[M. musculus]/CLONE = IMAGE: 2123805 /UG = Hs.44705SEQ ID NO: 116ESTs(DNA)ESTsConsensus includes gb: AI300126 /FEA = EST240830_atSEQ ID NO: 117/DB_XREF = gi: 3959472(DNA)/DB_XREF = est: qn54f02.x1/CLONE = IMAGE: 1902075 /UG = Hs.257858ESTsESTsConsensus includes gb: AI917390 /FEA = EST240964_atSEQ ID NO: 118/DB_XREF = gi: 5637245(DNA)/DB_XREF = est: ts79a05.x1/CLONE = IMAGE: 2237456 /UG = Hs.99415ESTsbetacellulinConsensus includes gb: AI620677 /FEA = EST241412_atSEQ ID NO: 119/DB_XREF = gi: 4629803(DNA)/DB_XREF = est: tu85e09.x1/CLONE = IMAGE: 2257864 /UG = Hs.154191ESTsESTsConsensus includes gb: H05025 /FEA = EST241874_atSEQ ID NO: 120/DB_XREF = gi: 868577(DNA)/DB_XREF = est: yl74g12.s1/CLONE = IMAGE: 43864 /UG = Hs.323767ESTsESTsConsensus includes gb: AW024656242358_atSEQ ID NO: 121/FEA = EST /DB_XREF = gi: 5878186(DNA)/DB_XREF = est: wu78h05.x1/CLONE = IMAGE: 2526201 /UG = Hs.233382ESTs, Moderately similar to AF119917 62PRO2822 H. sapiensESTsConsensus includes gb: BF696216 /FEA = EST242626_atSEQ ID NO: 122/DB_XREF = gi: 11981624(DNA)/DB_XREF = est: 602124536F1/CLONE = IMAGE: 4281632 /UG = Hs.188724ESTsESTsConsensus includes gb: N57929 /FEA = EST242978_x_atSEQ ID NO: 123/DB_XREF = gi: 1201819(DNA)/DB_XREF = est: yv61e06.s1/CLONE = IMAGE: 247234 /UG = Hs.48100ESTsESTs, Weakly similarConsensus includes gb: AI457984 /FEA = EST243729_atto ALU1_HUMAN/DB_XREF = gi: 4312002ALU SUBFAMILY J/DB_XREF = est: tj66a04.x1SEQUENCE/CLONE = IMAGE: 2146446 /UG = Hs.165900CONTAMINATIONESTs, Weakly similar to ALUC_HUMANWARNING ENTRY!!!! ALU CLASS C WARNING ENTRY !!![H. sapiens]H. sapiensSEQ ID NO: 124(DNA)ESTsConsensus includes gb: AA581439 /FEA = EST244650_atSEQ ID NO: 125/DB_XREF = gi: 2359211(DNA)/DB_XREF = est: nh13c10.s1/CLONE = IMAGE: 952242 /UG = Hs.152328ESTs

Biological Validation of Biomarker Candidates: Modulation of Expression by Treatment with Ligands for EGFR or by Treatment with Inhibitors for EGFR

To validate the significance of the biomarker candidates to predict the activity of the EGFR pathway and thereby the sensitivity of cancer cell to inhibition of EGFR by therapy, genes that would be regulated by the EGFR pathway were identified. Demonstration of that property for the EGFR biomarker candidates described above would add additional credibility as it would link these genes functionally to the EGFR pathway. Colon cancer and a lung cancer cell lines were treated with epidermal growth factor, in the absence of serum or, in the presence of serum with the EGFR modulator BMS-461453 or the EGFR modulator cetuximab (also known as C225, a chimeric monoclonal EGFR antibody). To identify genes induced by epidermal growth factor, serum starved cells were treated with 20 ng/ml EGF for 0.5, 6, and 18 hours. Control cells were treated with media alone. The expression profiling was performed, and data was analyzed using GeneChip® Expression Analysis software MAS 5.0 (Affymetrix, Santa Clara, Calif.).

Genes inhibited by EGFR antagonists were identified by treating cells in the presence of 10% serum with 0.5 uM of BMS-461453 or 1 ug/ml or 5 ug/ml of C225 for 6 and 24 hours. Cells exposed to 0.05% DMSO were used as the experimental control. Expression profiling was performed, and data were analyzed using GeneChip® Expression Analysis software MAS 5.0.

The gene expression of the inhibitor or EGFR treated cell lines was compared pair-wise to the untreated controls. Polynucleotides from the biomarker list, in which expression was increased two fold with EGFR exposure or decreased two fold with EGFR inhibitor treatment compared to the untreated controls, were considered to be modulated by EGFR. These biomarkers are provided in Table 4. Examples of the biomarkers include EphA1, B-cell translocation gene 2, prostaglandin-endoperoxide synthase 2 and serine (or cysteine) proteinase inhibitor (clade B), which are highly expressed in sensitive cells and up regulated by treatment with EGFR. On the other hand, spondin 1, talin 2 and nuclear receptor subfamily 3 are genes whose expression levels correlate with sensitivity or resistance of colon cancer cell lines and are consistently down regulated by treatment with EGFR inhibitors BMS-461453 and C225. It appears that these biomarkers are likely to be directly or indirectly involved in the EGFR signaling pathway, based on their expression modulation by EGF or EGFR inhibitor treatment

Identification of Top Biomarkers

In an attempt to further prioritize biomarkers for use in predicting response of cancer cells to treatment with one or more EGFR modulators, the following filter criteria were used on the Table 4 biomarkers to identity a total of fourteen biomarkers (Table 5) as the top biomarkers:

(1) results from the highly significant correlation of gene expression with IC₅₀: A p-value<0.01 in the student TTEST or a Pearson value<−0.6 described above;

(2) results from the modulation of expression by EGFR ligand and/or EGFR inhibitor treatment described above; and

(3) biomarkers supported by literature revealing a direct relationship between the EGFR pathway and the biomarkers.

TABLE 5Top Fourteen BiomarkersLiterature SupportInduced by EGF/Biomarker NameCitationInhibited by EGFR antagonistmucin 2,J Biol Chem. 2002 AugExpression inhibited 2 fold by EGFRintestinal/tracheal30; 277(35): 32258-67antagonist in GEO colon cancer cell(MUC2)lineintestinal mucin 3NoExpression inhibited 2 fold by EGFR(MUC3)antagonist in GEO colon cancer celllineHomo sapiens cysticNoExpression stimulated 2 fold byfibrosisEGFR in H292 lung cancer cell linetransmembraneconductanceregulatorATP-bindingcassette (sub-familyC, member 7)(CFTR)f-spondinNoExpression inhibited 2 fold by EGFR(KIAA0762) proteinantagonist in LOVO colon cancer cellline3-hydroxy-3-J Invest Dermatol. 2000Expression stimulated 3 fold bymethylglutaryl-Jan; 114(1): 83-7EGFR in H292 lung cancer cell lineCoenzyme Asynthase 2serine (or cysteine)Electrophoresis. 2001Expression stimulated 2 fold byproteinase inhibitor,Aug; 22(14): 3001-8.EGFR in H292 lung cancer cell lineclade B(ovalbumin),member 5(SERPINB5BTG family,NoExpression stimulated 2 fold bymember 2 (BTG2)EGFR in H292 lung cancer cell linetalin 2 (TLN2)NoExpression inhibited 2 fold by EGFRantagonist in GEO colon cancer celllinearachidonic acidJ Biol Chem. 1994 Augnoepoxygenase26; 269(34): 21786-92.prostaglandin G/HJ Biol Chem. 1994 AugExpression stimulated 6 fold bysynthase and26; 269(34): 21786-92.EGFR in H292 lung cancer cell linecyclooxygenaseEphA1 (EPHA1)NoExpression stimulated 2 fold byEGFR in CACO2 colon cancer celllinehemoglobin, alpha 1NoExpression inhibited 2 fold by EGFR(HBA1)antagonist in GEO colon cancer celllinebone morphogeneticDevelopment 2000noprotein 2Nov; 127(22): 4993-5005betacellulin (BTC)*Biochem Biophys ResnoCommun. 2002 Jun28; 294(5): 1040-6
*The gene betacellulin showed counter regulation with EGFR expression as defined for the EGFR-A list but had just a p value of 0.04 in the Student's TTest for correlation with IC₅₀. It was still selected as a top biomarker for the strong literature support, as betacellulin is one of the published ligands of EGFR.

Utility of Biomarkers

Polynucleotides that correlate to a specific property of a biological system can be used to make predictions about that biological system and other biological systems. To show the predictive utility of biomarkers that correlate to EGFR modulator sensitivity and resistance, these polynucleotides were tested for their ability to predict the response of twenty two colon cancer cell lines to a small molecule EGFR modulator.

The invention includes single biomarkers including, for example, the fourteen top biomarkers which were tested in a voting scheme. For that purpose, the mean expression value was calculated for all fourteen biomarkers. Colon cancer cell lines which showed an expression level above the mean were then voted to be sensitive, and colon cancer cell lines with expression levels below the mean were voted to be resistant. After this procedure, the voting was compared to the actual sensitivity/resistance status according to the definition based on IC₅₀(see above) and an error rate was calculated. The error rates of the fourteen top biomarkers are shown in Table 6.

TABLE 6Error Rates of Fourteen Top BiomarkersPearsonsTTESTPredictionBiomarker NamevalueP valueerror ratemucin 2,−0.5310.0083 20%intestinal/tracheal(MUC2)intestinal mucin 3−0.6390.000411.72% (MUC3)Homo sapiens cystic−0.6469E−05 5.9%fibrosistransmembraneconductanceregulatorATP-bindingcassette (sub-familyC, member 7)(CFTR)f-spondin−0.6220.000412.8%(KIAA0762) protein3-hydroxy-3-−0.5750.002921.75% methylglutaryl-Coenzyme Asynthase 2serine (or cysteine)−0.620.002821.75% proteinase inhibitor,clade B(ovalbumin),member 5(SERPINB5BTG family,−0.5440.004220.5%member 2 (BTG2)talin 2 (TLN2)−0.8743E−05 8.8%EphA1 (EPHA1)−0.6470.0021 22%hemoglobin, alpha 1−0.7448E−05 20%(HBA1)bone morphogenetic−0.5550.009131.8%protein 2betacellulin (BTC)−0.5360.047 43.5%

The biomarkers talin, the Cystic fibrosis conductance regulator (CFTR), and mucin 3 were the best single biomarkers with error rates below 12%.

EXAMPLES
Example 1
Methods

IC₅₀Determination—In Vitro Cytotoxicity Assay

A small molecule EGFR inhibitor, erlotinib HCl (BMS-461453), was tested for cytoxicity in vitro against a panel of twenty-two human colon cancer cell lines available from the American Type Culture Collection. Cytotoxicity was assessed in cells by MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulphenyl)-2H-tetrazolium, inner salt) assay (T. L. Riss et al., 1992, Mol. Biol. Cell, 3 (Suppl.): 184a).

To carry out the assays, the colon cells were plated at 4,000 cell/well in 96 well microtiter plates and 24 hours later serial diluted drugs were added. The concentration range for the EGFR inhibitor was from 5 μg/ml to 0.0016 μg/ml (roughly 10 μM to 0.0032 μM). The cells were incubated at 37° C. for 72 hours at which time the tetrazolium dye MTS (333 μg/ml final concentration) in combination with the electron coupling agent phenazine methosulfate (25 μM final concentration) was added. A dehydrogenase enzyme in live cells reduces the MTS to a form that absorbs light at 492 nm that can be quantified spectrophotometrically. The greater the absorbency, the greater the number of live cells. The results were expressed as an IC₅₀, which is the drug concentration required to inhibit cell proliferation (i.e., absorbance at 450 mm) to 50% of that of untreated control cells. The mean IC₅₀and standard deviation (SD) from multiple tests for each cell line were calculated.

Resistant/Sensitive Classification

The cell lines with IC₅₀below 6 μM were defined as sensitive to the EGFR inhibitor, whereas those with IC₅₀above 6 μM were considered to be resistant. The resistant/sensitive classification are shown above in Table 1, with five cell lines classified as sensitive and seventeen cell lines classified as resistant.

Gene Expression Profiling

The colon cells were grown using standard cell culture conditions: RPMI 1640 supplemented to contain 10% fetal bovine serum, 100 IU/ml penicillin, 100 mg/ml streptomycin, 2 mM L-glutamine and 10 mM Hepes (all from GibcoBRL, Rockville, Md.). RNA was isolated from 50-70% confluent cells or drug-treated cells using the RNeasy™ kits commercially available from Qiagen (Valencia, Calif.). Quality of the RNA was checked by measuring the 28s:18s ribosomal RNA ratio using Agilent 2100 bioanalyzer (Agilent, Technologies, Rockville, Md.). Concentration of total RNA was determined spectrophotometrically. 10 μg of total RNA from each cell line was used to prepare biotinylated probe according to the Affymetrix Genechip® Expression Analysis Technical Manual, 2001. Targets were hybridized to Affymetrix high density oligonucleotide array human HG-U133 set chips (Affymetrix, Santa Clara, Calif.). Arrays were then washed, and stained using the GeneChip Fluidics station according to the manufacture's instructions. The HG-U133 set consisting of two GeneChip® arrays contains nearly 45,000 probe sets representing more than 39,000 transcripts derived from approximately 33,000 well-substantiated human genes.

Preprocessing of Microarray Data for Selecting Biomarkers

Scanned image files were visually inspected for artifacts and analyzed with GeneChip® Expression Analysis software MAS 5.0 (Affymetrix, Santa Clara, Calif.). The “Detection Call” (see Affymetrix manual) was used to determine whether a transcript was detected within one sample, as well as the “Signal” (see Affymetrix Genechip® Expression Analysis Technical Manual, 2001) which measured the relative abundance of a transcript. The trimmed mean intensity for each chip was scaled to 1,500 (see Affymetrix manual) in order to account for any minor differences in global chip intensity, so that the overall expression level for each cell line is comparable. Affymetrix control sequences were removed prior to analysis.

Induction Studies of Colon and Breast Cell Lines with EGFR Inhibitors or EGFR Ligand and Selection of Genes Modulated by the Inductions

The five colon cell lines and one lung cell line indicated with asterisks in Table 1 were used in the drug induction study. Three of the colon cell lines express EGFR and are sensitive to the EGFR inhibitor BMS461453. The SW480 cell line, while expressing EGFR, is insensitive to the EGFR inhibitor, and the COLO320_DM does not express EGFR and is EGFR inhibitor resistant. The lung cancer cell line H292 expresses EGFR, but its sensitivity status is unknown. Cells were seeded in a 10 cm²culture plate with the medium described above and cultured for 24 hours.

For the EGF induction studies, the colon cell line CACO2 and the lung cancer H292 cell line were washed 2×PBS, and the media was changed to RPMI without serum. The next day the cells were treated with 20 ng/ml EGF, and eventually lysed for RNA isolation 0.5, 6 and 18 hours post treatment. Gene expression was profiled as described below.

EGFR inhibition studies were conducted on the colon cell lines GEO, CCD33-CO, SW480 and COLO320DM. The expression profiling was performed as described above and data was analyzed using GeneChip® Expression Analysis software MAS 5.0. The expression data of EGFR inhibitor treated cell lines were compared pair-wise to that of untreated same cell line. A change was considered significant if a two fold difference in expression was demonstrated between the treated and the untreated control. Analysis was done for all four cell lines to compare the gene expression with or without EGFR inhibitor treatment.

Example 2
RT-PCR Expression Profiling

RNA quantification was performed using the SYBR Green real-time PCR. The SYBR Green real-time PCR assay is one of the most precise methods for assaying the concentration of nucleic acid templates.

RNA can be prepared using standard methods, preferably, employing the RNeasy Kit commercially available from Qiagen (Valencia, Calif.). cDNA template for real-time PCR can be generated using the Superscript™ First Strand Synthesis system for RT-PCR. SYBR Green real-time PCR reactions are prepared as follows: the reaction mix contains 20 ng first strand cDNA; 50 nM Forward Primer; 50 nM Reverse Primer; 0.75×SYBR Green I (Sigma); 1×SYBR Green PCR Buffer (50 mMTris-HCl pH 8.3, 75 mM KCl); 10% DMSO; 3 mM MgCl₂; 300 μM each dATP, dGTP, dTTP, dCTP; 1 U Platinum® Taq DNA Polymerase High Fidelity (Cat# 11304-029; Life Technologies; Rockville, Md.). Real-time PCR is performed using an Applied Biosystems 5700 Sequence Detection System. Conditions are 95° C. for 10 minutes (denaturation and activation of Platinum® Taq DNA Polymerase), 40 cycles of PCR (95° C. for 15 seconds, 60° C. for 1 minute). PCR products are analyzed for uniform melting using an analysis algorithm built into the 5700 Sequence Detection System.

cDNA quantification used in the normalization of template quantity is performed using SYBR Green real-time PCR Expression of EGFR is normalized to GAPDH expression as described below.

The sequences for the GAPDH oligonucleotides used in the SYBR Green real-time PCR reactions are:

GAPDH-F: 5′-AGCCGAGCCACATCGCT-3′(SEQ ID NO: 191)GAPDH-R: 5′-GTGACCAGGCGCCCAATAC-3′(SEQ ID NO: 192)

The sequences for the EGFR oligonucleotides used in the SYBR Green real-time PCR reactions are:

(SEQ ID NO: 193)EGFR-F: 5′-GCGTCTCTTGCCGGAATGT-3′(SEQ ID NO: 194)EGFR-R: 5′-AGCCGAGGCAGGGAATGCGTG-3′

The Sequence Detection System generates a Ct (threshold cycle) value that is used to calculate a concentration for each input cDNA template. cDNA levels for each gene of interest are normalized to GAPDH cDNA levels to compensate for variations in total cDNA quantity in the input sample. This is done by generating GAPDH Ct values for each cell line. Ct values for the gene of interest and GAPDH are inserted into a modified version of the δδCt equation (Applied Biosystems Prism® 5700 Sequence Detection System User Manual) which is used to calculate a GAPDH normalized relative cDNA level for each specific cDNA. The δδCt equation is: relative quantity of nucleic acid template=2^δδCt=2^{(δCta−δCtb)}, where δCta=Ct target−Ct GAPDH, and δCtb=Ct reference−Ct GAPDH.

Example 3
Production of Antibodies Against the Biomarkers

Antibodies against the biomarkers can be prepared by a variety of methods. For example, cells expressing an biomarker polypeptide can be administered to an animal to induce the production of sera containing polyclonal antibodies directed to the expressed polypeptides. In one aspect, the biomarker protein is prepared and isolated or otherwise purified to render it substantially free of natural contaminants, using techniques commonly practiced in the art. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity for the expressed and isolated polypeptide.

In one aspect, the antibodies of the invention are monoclonal antibodies (or protein binding fragments thereof). Cells expressing the biomarker polypeptide can be cultured in any suitable tissue culture medium, however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented to contain 10% fetal bovine serum (inactivated at about 56° C.), and supplemented to contain about 10 g/l nonessential amino acids, about 1,00 U/ml penicillin, and about 100 μg/ml streptomycin.

The splenocytes of immunized (and boosted) mice can be extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line can be employed in accordance with the invention, however, it is preferable to employ the parent myeloma cell line (SP2/0), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (1981, Gastroenterology, 80:225-232). The hybridoma cells obtained through such a selection are then assayed to identify those cell clones that secrete antibodies capable of binding to the polypeptide immunogen, or a portion thereof.

Alternatively, additional antibodies capable of binding to the biomarker polypeptide can be produced in a two-step procedure using anti-idiotypic antibodies. Such a method makes use of the fact that antibodies are themselves antigens and, therefore, it is possible to obtain an antibody that binds to a second antibody. In accordance with this method, protein specific antibodies can be used to immunize an animal, preferably a mouse. The splenocytes of such an immunized animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones that produce an antibody whose ability to bind to the protein-specific antibody can be blocked by the polypeptide. Such antibodies comprise anti-idiotypic antibodies to the protein-specific antibody and can be used to immunize an animal to induce the formation of further protein-specific antibodies.

Example 4
Immunofluorescence Assays

The following immunofluorescence protocol may be used, for example, to verify EGFR biomarker protein expression on cells or, for example, to check for the presence of one or more antibodies that bind EGFR biomarkers expressed on the surface of cells. Briefly, Lab-Tek II chamber slides are coated overnight at 4° C. with 10 micrograms/milliliter (μg/ml) of bovine collagen Type II in DPBS containing calcium and magnesium (DPBS++). The slides are then washed twice with cold DPBS++ and seeded with 8000 CHO-CCR5 or CHO pC4 transfected cells in a total volume of 125 μl and incubated at 37° C. in the presence of 95% oxygen/5% carbon dioxide.

The culture medium is gently removed by aspiration and the adherent cells are washed twice with DPBS+ at ambient temperature. The slides are blocked with DPBS++ containing 0.2% BSA (blocker) at 0-4° C. for one hour. The blocking solution is gently removed by aspiration, and 125 μl of antibody containing solution (an antibody containing solution may be, for example, a hybridoma culture supernatant which is usually used undiluted, or serum/plasma which is usually diluted, e.g., a dilution of about 1/100 dilution). The slides are incubated for 1 hour at 0-4° C. Antibody solutions are then gently removed by aspiration and the cells are washed five times with 400 μl of ice cold blocking solution. Next, 125 μl of 1 μg/ml rhodamine labeled secondary antibody (e.g., anti-human IgG) in blocker solution is added to the cells. Again, cells are incubated for 1 hour at 0-4° C.

The secondary antibody solution is then gently removed by aspiration and the cells are washed three times with 400 μl of ice cold blocking solution, and five times with cold DPBS++. The cells are then fixed with 125 μl of 3.7% formaldehyde in DPBS++ for 15 minutes at ambient temperature. Thereafter, the cells are washed five times with 400 μl of DPBS++ at ambient temperature. Finally, the cells are mounted in 50% aqueous glycerol and viewed in a fluorescence microscope using rhodamine filters.

Biomarkers and methods for determining sensitivity to epidermal growth factor receptor modulators

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

PCT Information