The present invention relates to mutant Bovine Herpesvirus 4 genomes, mutant Bovine Herpesvirus 4 viruses, to mutant Bovine Herpesvirus 4 genomes and viruses carrying a heterologous DNA sequence, cells transfected with mutant Bovine Herpesvirus 4 genomes, cells infected with mutant Bovine Herpesvirus 4 viruses, vaccines and carrier vaccines comprising such mutant Bovine Herpesvirus 4 viruses, methods for the preparation of such mutant Bovine Herpesvirus 4 genomes and such mutant Bovine Herpesvirus 4 viruses and to diagnostic test kits.
Bovine Herpesvirus 4 (BoHV-4) is a member of the subfamily gammaherpesvirinae, genus rhadinovirus, that is distributed worldwide amongst i.a. ruminants. Isolates have been recovered from cattle, but also from American bison and African buffalo. Isolates have been found also in sheep. Sporadic isolations were reported in lions, cats and owl monkeys.
The virus has been isolated from both healthy and from sick animals. However, although sporadically a possible role for BoHV-4 in respiratory disease has been reported, by far most isolates of the BoHV-4 group fail to induce clinical disease in both cattle and in laboratory animals. Therefore, the pathogenic role of BoHV-4 remains unclear.
BoHV-4, although being a member of the subfamily gammaherpesvirinae, differs from other members of this subfamily in that, unlike most other gammaherpesvirinae, it replicates in a variety of primary cultures and cell lines of bovine and various other animal species. In addition, there is no evidence for oncogenicity or growth transformation by BoHV-4. Moreover, BoHV-4, like all herpesviruses is capable of accommodating significant amounts of foreign genetic material.
Finally, as mentioned above, apparently BoHV-4 does not seem to induce clinical disease. These characteristics make BoHV-4 attractive for use as a vector virus. Such use has been suggested i.a. by Donofrio, G. et al., (J. virol. Methods 101: 49-61 (2002), Donofrio, G. et al., (Microb. Infect. 8: 898-904 (2006)), Gillet, L. et al., (J. Gen. Virol. 86: 907-917 (2005)).
A recent example of such use is given by Donofrio, G. et al., (Clinical and Vaccine Immunology 13: 1246-1254 (2006)). In this paper, it is described how BoHV-4 is used for the expression of Glycoprotein D of Bovine Herpesvirus 1, an alphaherpesvirus that is known to be a major pathogen in cattle, that causes significant losses worldwide. BoHV-1 infection is known to cause infectious bovine rhinothracheitis, infectious pustular vulvovaginitis, balanoposthitis, abortion and generalized systemic infection. BoHV-1 is also known to play an important role in the bovine respiratory disease complex commonly referred to as shipping fever. This work is one of the first demonstrations of the use of BoHV-4 as a vector for vaccine purposes and provides a firm basis for BoHV-1-vaccination of cattle by using BoHV-4 as a vector.
There is however one serious drawback:
Gammaherpesviruses like all Herpesviridae exhibit two distinct phases in their life cycle; lytic replication characterised by a transcription program where immediate-early (IE), early (E) and late (L) genes are expressed successively; and latency, characterised by the maintenance of the viral genome as a non-integrated episome and the expression of a limited number of viral genes and micro RNAs (Roizman & Pellett, 2007; Weck et al., 1999; Sarid et al., 1998; Cai et al., 2005). Upon reactivation, latency turns into a lytic replication again and re excretion of infectious particles by latently infected subjects.
Therefore, since BoHV-4 has the property to establish latency and to reactivate, this makes wild type strains inappropriate to develop safe recombinant vectors. Indeed, throughout their live, infected animals could reactivate and contaminate naive animals.
Thus, from a vaccine point of view, for BoHV-4 to be used as a vector, the latency of the virus is considered to be a disadvantage.
The gammaherpesvirus human Herpesvirus 8 (HHV-8 also named KSHV for Kaposi's sarcoma-associated Herpesvirus) is the prototype of the rhadinovirus genus. During latency, HHV-8 expresses three main open reading frames (ORFs): ORF71, ORF72 and ORF73 (Sarid et al., 1998 and 1999). ORF71 and ORF72 encode viral homologues of cellular FLIP (v-FLIP) (Thome et al., 1997) and D cyclin (v-CYC) (Li et al., 1997), respectively. ORF71 and ORF72 are expressed together with ORF73 on a polycistronic mRNA.
ORF73 orthologues encoded by different rhadinoviruses have been studied extensively. These studies revealed that the expression product of ORF73 (pORF73) is a multifunctional protein essential for latency. The multiple functions of the protein rely on several molecular domains (Renne et al., 2001; Fowler et al., 2003; Calderwood et al., 2005). The best-characterised pORF73 is the Latency-Associated Nuclear Antigen 1 (LANA-1) of HHV-8. LANA-1 has been shown to associate with mitotic chromosomes to enable episome tethering during division of latently infected cells and its subsequent partitioning between daughter cells (Ballestas et al., 1999; Barbera et al., 2006; Ye et al., 2004). This crucial role in latency is reinforced by the ability of LANA-1 to modulate cellular pathways implicated in cell growth and survival by targeting transcriptional regulators or co-regulators such as p53, pRB, CBP and sin3A (Friborg et al., 1999; Krithivas et al., 2000; Radkov et al., 2000; Lim et al., 2001). Moreover, LANA-1 prevents reactivation from latency by downregulating the expression of ORF50 that encodes the replication and transcriptional activator (RTA) (Lan et al., 2004, 2005; Lu et al., 2006).
BoHV-4 behaves different in many respects, as summarised above, when compared to other herpesviruses, even within the subfamily gammaherpesvirinae. Nevertheless, if any ORF73-orthologue exists in BoHV-4, it could then be possible to find out if such ORF73-orthologue, if existent at all, in BoHV-4 would play a comparable role in latency.
However, the only possibly ORF73-like orthologue gene found in BoHV-4 was considered to be a pseudo gene, for the following reasons:
1) The ORF73 orthologue region of BoHV-4 is the site of multiple recombinations (Dewals B., et al., J. Gen. Virol. 87: 1509-1519 (2006)). This is a characteristic of a pseudo gene, but certainly not of a multi-functional gene that is highly depending on full conservation of its sequence.
2) ORF73 orthologue length variations are observed between various BoHV-4 strains. E.g. a short duplication is observed in the M40 strain. Again this is fully in line with the characteristics of a pseudo gene, but it is highly unusual for a functional, let alone a multi-functional gene.
3) ORF73 of HHV-8 encodes a large and multifunctional protein, that has been shown a) to associate with mitotic chromosomes to enable episome tethering during division of latently infected cells and its subsequent partitioning between daughter cells, b) to modulate cellular pathways implicated in cell growth and survival by targeting transcriptional regulators or co-regulators such as p53, pRB, CBP and sin3A, and c) to prevent reactivation from latency by downregulating the expression of ORF50 that encodes the replication and transcriptional activator.
Within the rhadinovirus genus, BoHV-4 appeared to encode by far the shortest ORF73 orthologue with a size equivalent to only 22% of ORF73 of HHV-8 (LANA-1) (
4) By far most other known ORF73 orthologues are not much smaller in size than LANA-1, or even bigger. Only one relatively small ORF73 orthologue has been described: For murine herpesvirus-68, an ORF73 orthologue has been found. This ORF73 is however still 123% of the size of the BoHV-4 orthologue, and most strikingly, the percentage of amino acid identity is practically negligible: only 25%.
Surprisingly it was found now, that this alleged pseudo gene for unknown reasons plays a role that, with regard to its function in latency, appears to be comparable to that of ORF73 in LANA-1. This gene will for reasons of convenience be further referred to as an ORF73 orthologue.
Moreover, it was surprisingly found that deletion of BoHV-4 ORF73 did not affect the capacity of the virus to replicate in vitro, while it prevented latent infection in vivo. All together, the results of the present invention show that despite its extremely small size and the striking lack of homology to any known ORF73-orthologue, BoHV-4 ORF73 is a functional homologue of larger rhadinovirus orthologues. The sequence of BoHV-4 ORF73 is available from Genbank/EMBL/DDBJ accession numbers AY847342-AY847348.
Thus, it is one of the merits of the present invention that it provides a BoHV-4 virus from which the ORF73 gene is deleted, thus providing a vector with all advantages of BoHV-4 vector viruses without having the disadvantage of causing latent infection.
Thus, a first embodiment of the present invention relates to a mutant BoHV-4 genome that has as a characteristic that it does not encode a functional ORF73 protein.
A functional ORF73 protein is a protein that is still capable of causing latency.
A second embodiment of the present invention relates to a mutant BoHV-4 virus that it is not capable of making a functional ORF73 protein.
Preferably, the mutant BoHV-4 virus is not capable of making a functional ORF73 protein because it has a mutation in the ORF73 gene.
Therefore, a preferred form of this embodiment relates to mutant BoHV-4 virus according to the invention that has as a characteristic that it has a mutation in the ORF73 gene.
A mutation can be an insertion, a deletion or a frame shift mutation. The easiest way of making a mutation is by means of inserting a stretch of nucleotides or by deleting a part or the whole of the ORF73 coding region.
Therefore, a more preferred form of this embodiment relates to mutant BoHV-4 virus wherein said mutation is a deletion or an insertion.
It is known that several genes play a role in the virulence of herpesviruses in general, and in BoHV-4 too. The deletion of genes encoding such virulence factors improves the safety of the virus, because it behaves less virulent than the wild-type virus. Therefore, especially when using the mutant BoHV-4 virus according to the invention as a vaccine or a carrier vaccine, it may be desirable to delete one or more of such virulence factors. Such deletions are for the purpose of this patent herewith defined as second deletions.
Thus, an even more preferred form of this embodiment relates to mutant BoHV-4 virus according to the invention that comprises a second deletion.
Preferred second deletions are deletions in the ORF71-gene encoding a v-FLIP, the ORF16-gene encoding a v-Bcl-2 homologue, the Bo10 gene encoding glycoprotein gp80 or the ORF21-gene encoding thymidine kinase.
Therefore, a most preferred embodiment of the mutant BoHV-4 virus according to the invention relates to such viruses having a second deletion in the ORF71-gene encoding a v-FLIP, the ORF16-gene encoding a v-Bcl-2 homologue, the Bo10 gene encoding glycoprotein gp80 or the ORF21-gene encoding thymidine kinase.
Although the mutant BoHV-4 virus according to the invention can be used for vaccine purposes as such, merely in order to prevent susceptible animals, such as ruminants from BoHV-4 infection, it is most efficiently used as carrier virus for heterologous DNA sequences. In that case, the advantageous characteristics of the mutant BoHV-4 virus according to the invention would be fully used and in addition the virus would e.g. gain additional immunizing or adjuvating properties.
Thus, a third embodiment of the present invention relates to a mutant BoHV-4 virus according to the invention, that comprises a heterologous DNA sequence.
Preferably, such a heterologous DNA sequence encodes an immunogenic protein of another virus or microorganism that is pathogenic to animals that are sensitive to BoHV-4 infection, such as ruminants. The advantage of such a mutant BoHV-4 virus would be that by administrating such virus to such animals, e.g. ruminants, one would be able to protect against BoHV-4, and against that other pathogenic virus or microorganism. And even if there would be no interest in obtaining protection against BoHV-4 infection, such a virus would have all the advantages of a very safe live carrier virus: it is a very safe life BoHV-4 vaccine that at the same time mimics a live vaccine against that other (e.g. ruminant) pathogenic virus or microorganism. Merely as an example: a mutant BoHV-4 virus according to the invention would be a very attractive BoHV-1 gD carrier alternative instead of the BoHV-4 strain as used by Donofrio G., et al., in Clinical and Vaccine Immunology 13: 1246-1254, (2006).
Also, preferably such heterologous DNA sequence encode a cytokine. Cytokines comprise i.a. the interleukins, interferons and tumor necrosis factors. Several cytokines, e.g. interferons are known to play an important role as immune modulators in mammals, e.g. ruminants. Thus it may be advantageous to include a gene encoding this kind of molecule into said virus.
Thus, a preferred form of this embodiment relates to mutant BoHV-4 virus according to the invention comprising a heterologous DNA sequence encoding an immunogenic protein of another virus or microorganism pathogenic to animals that are sensitive to BoHV-4 infection, e.g. ruminants, and/or a cytokine.
The most common and/or important (i.a. ruminant) pathogenic microorganisms and viruses are formed by the group consisting of Bovine Herpesvirus, Bovine Viral Diarrhoea virus, Parainfluenza type 3 virus, Bovine Paramyxovirus, Foot and Mouth Disease virus, Pasteurella haemolytica, Bovine Respiratory Syncytial Virus, Theileria sp., Babesia sp., Trypanosoma species, Anaplasma sp., Neospora caninum, Staphylococcus aureus, Streptococcus agalactiae, Mycoplasma, E. coli, Enterobacter, Klebsiella, Citrobacter and Streptococcus dysgalactiae. Therefore, a more preferred form of this embodiment relates to mutant BoHV-4 virus according to the invention wherein that virus or micro-organism is selected from the group consisting of Bovine Herpesvirus, Bovine Viral Diarrhoea virus, Parainfluenza type 3 virus, Bovine Paramyxovirus, Foot and Mouth Disease virus, Pasteurella haemolytica, Bovine Respiratory Syncytial Virus, Theileria sp., Babesia sp., Trypanosoma species, Anaplasma sp., Neospora caninum, Staphylococcus aureus, Streptococcus agalactiae, Mycoplasma, E. coli, Enterobacter, Klebsiella, Citrobacter and Streptococcus dysgalactiae.
As said above, mutant BoHV-4 virus according to the invention is not capable of making a functional ORF73 protein. This can i.a. be obtained by making an insertion in the gene. It would therefore be most convenient to insert the heterologous DNA sequence directly into the ORF73 gene. That would avoid the necessity to find a suitable location in the viral genome to introduce the heterologous DNA sequence and would at the same time make the gene encoding ORF73 nonfunctional.
Also from a safety point of view, it is very beneficial to insert the heterologous DNA sequence directly into ORF73: if a recombination occurs between a wild type strain and the vaccine, the recombinant that acquires the heterologous DNA sequence will also acquire the genetic defect of the vaccine and thus not be able to persist as a latent virus.
Thus a most preferred form of this embodiment relates to mutant BoHV-4 virus according to the invention, wherein the heterologous DNA sequence is inserted in the ORF73 gene.
The heterologous DNA sequence encoding the antigen or cytokine is preferably placed under the control of a functional promoter. A functional promoter is a promoter that is recognized in ruminant cells.
A large number of suitable promoters is known in the art, that are recognized for their very efficient level of expression. Such promoters are e.g. the Pseudorabies gX-promoter, the Pseudorabies TK-promoter, the Adenovirus Major Late promoter, the Retroviral Long Terminal Repeat, the SV40 Early and Late promoters, the Mouse Cytomegalovirus immediate early (MCMVie1) promoter, the Mouse Cytomegalovirus early (MCMVe1) promoter, the Human Cytomegalovirus immediate early (HCMVie1) promoter, and the BHV-gE promoter. All these promoters have been described and are known in the art for many years. Merely as an example in Donofrio G., et al. describe the use of the Human Cytomegalovirus enhancer-promoter for the expression of gD of BoHV-1. (Donofrio G., et al., Clinical and Vaccine Immunology 13: 1246-1254, (2006))
As extensively motivated above, the mutant BoHV-4 viruses according to the invention are very suitable as vaccine viruses or carrier vaccine viruses.
Therefore, again another embodiment of the present invention relates to vaccines for combating BoHV-4 infection in animals susceptible for BoHV-4 such as ruminants, wherein such vaccines comprise a mutant BoHV-4 genome according to the invention or a mutant BoHV-4 virus according to the invention, and a pharmaceutically acceptable carrier.
The pharmaceutically acceptable carrier can be as simple as water or a buffer. The pharmaceutically acceptable carrier may also comprise stabilizers. It can also comprise an adjuvant, or it can in itself be an adjuvant.
The vaccine can be safely stored for long periods of time when it is freeze-dried. Therefore, the vaccine according to the invention is preferably in a freeze-dried form.
Still another embodiment relates to mutant BoHV-4 carrier vaccines that comprise a BoHV-4 virus according to the invention comprising a heterologous DNA and a pharmaceutically acceptable carrier.
Again another embodiment of the invention relates to a mutant BoHV-4 genome according to the invention or mutant BoHV-4 virus according to the invention for use in a vaccine.
Still another embodiment of the invention relates to the use of a mutant BoHV-4 genome according to the invention or a mutant BoHV-4 virus according to the invention for the manufacture of a vaccine for the protection of susceptible animals such as ruminants against BoHV-4 infection.
And again another embodiment of the invention relates to the use of a mutant BoHV-4 genome according to the invention or a mutant BoHV-4 virus according to the invention for the manufacture of a BoHV-4 carrier vaccine.
As follows i.a. from the Examples, it is possible to make the necessary mutant BoHV-4 genome in vitro. If a cell is transfected with this genome, this leads to the generation of progeny virus. Thus, another embodiment of the present invention relates to a cell comprising a mutant BoHV-4 genome according to the invention.
The progeny virus in itself is fully infective, and therefore, that progeny virus can be propagated on susceptible cells, such as e.g. MDBK cells.
Therefore, another embodiment of the present invention relates to a cell comprising a mutant BoHV-4 virus according to the invention.
For administration to animals, the BoHV-4 mutant according to the present invention can be given inter alia intranasally, intradermally, subcutaneously or intramuscularly. The routes and methods for vaccination can be the same as for other live attenuated BHV-viruses, more specifically BoHV-4 vaccines.
The useful effective amount to be administered will vary depending on the age, weight, mode of administration and type of pathogen against which vaccination is sought.
For most applications, a very suitable dosage range is between about 103.0-107.0 pfu/animal.
Another embodiment of the present invention relates to methods for the production of a mutant BoHV-4 genome according to the invention or a mutant BoHV-4 virus according to the invention, wherein that method comprises the step of mutating the ORF73 gene so that it no longer encodes a functional ORF73 protein.
An interesting effect of the fact that mutant BoHV-4 according to the invention can carry a heterologous gene, is that it can thus be used as a marker vaccine. A marker vaccine allows to discriminate between field viruses and vaccine viruses on the basis of differences in antibody panels raised against wild-type BoHV-4 and mutant BoHV-4 virus according to the invention when carrying an additional gene.
Sera from mammals infected with a mutant BoHV-4 strain according to the invention that carries a heterologous gene will react with immunogenic BoHV-4-proteins and with an immunogenic protein encoded by a heterologous gene inserted in mutant BoHV-4 according to the invention. Sera from mammals infected with an BoHV-4 field strain however will only react with immunogenic BoHV-4-proteins. Tests based upon purified protein encoded by the heterologous gene directly show the presence or absence of antibodies against the protein encoded by the heterologous gene. Therefore, mutant BoHV-4 viruses according to the present invention that carry a heterologous gene turn out to be very suitable marker vaccines, i.e. vaccines that can be serologically discriminated from a field strain. They can be discriminated by using specific diagnostic tests.
Therefore still another embodiment of the invention relates to diagnostic test kits for differentiating BoHV-4 field-virus infected mammals from mammals vaccinated with a vaccine comprising mutant BoHV-4 according to the invention and carrying a heterologous gene. Such tests comprise the testing of serum for the absence or presence of antibodies against the protein encoded by the heterologous gene.
A diagnostic test kit for the differentiation between animals vaccinated with mutant BoHV-4 strains according to the invention and carrying a heterologous gene, and animals infected with BoHV-4 field strains can comprise e.g. a simple blocking-ELISA test in which a mutant BoHV-4 strain according to the invention and carrying a heterologous gene is coated to the wall of a microtiter-plate. Such a plate is then incubated with serum of the animal to be tested. Subsequently, the plate is incubated with a specific and labeled antiserum against the heterologous protein. If the labeled antiserum reacts with the coated virus, i.e. it is not blocked by the antiserum of the animal to be tested, this shows that that antiserum does not contain antibodies against the heterologous protein. It can then be concluded that the animal was infected by a field strain.
Alternatively, such a diagnostic test kit can comprise an ELISA-test in which possibly purified heterologous protein is coated to the wall of separate wells of an ELISA-plate. Incubation with serum from mammals to be tested, followed by e.g. incubation with a labeled antibody against the heterologous protein can then reveal the presence or absence of antibodies against the heterologous protein in the respective wells. Another example of a diagnostic test system is e.g. the incubation of a Western blot comprising the heterologous protein with serum of mammals to be tested, followed by analysis of the blot.
Detection of specific anti-heterologous protein antibodies indicates that the tested mammal has been vaccinated with a mutant BoHV-4 strain according to the invention and carrying a heterologous gene, whereas the lack of antibody-reaction with the heterologous protein band indicates that the mammal has been infected with a BoHV-4 field strain.
Therefore, in another embodiment the present invention relates to a diagnostic kit for the detection of antibodies against a mutant BoHV-4 strain according to the invention and carrying a heterologous gene, in which the kit comprises purified heterologous protein or a fragment thereof still comprising an antigenic determinant.
Another approach for using mutant BoHV-4 virus according to the invention in marker vaccines is to discriminate between field viruses and vaccine viruses on the basis of differences in reactions in PCR tests between wild-type BoHV-4 and mutant BoHV-4 virus according to the invention. Such a test in a very basic form could comprise a first set of PCR-primers against any wild-type BoHV-4 sequence and a second set of PCR-primers against a region of ORF73 that has been deleted from the mutant BoHV-4 virus according to the invention.
If blood or tissue from an animal shows a reaction with both the first and the second primer set, this indicates that the animal was infected with a field virus. If blood or tissue from an animal however only shows a reaction with the first and not with the second primer set, this indicates that the animal was vaccinated with a mutant BoHV-4 virus according to the invention.
Merely to exemplify aspects of the invention, the Examples below will explain (without being restrictive in any way) various aspects of the invention in more detail.
Computational analysis. Protein sequences were analysed with ClustaiX sequence alignment program (Thompson et al., 1997).
Cells and Viruses. Madin-Darby bovine kidney cell line (MDBK; ATCC CCL-22) was cultured in minimum essential medium (MEM, Invitrogen) containing 5% fetal calf serum (FCS, Harlan). Embryonic bovine lung (EBL, German collection of micro-organisms and cell culture DSMZ ACC192), EBL stably expressing the Cre recombinase (EBL-NLS-Cre) (Gillet et al., 2005) and bovine macrophage (BOMAC) (Stabel & Stabel, 1995) cell lines were cultured in Dulbecco's modified Eagle medium (DMEM, Invitrogen) containing 10% FCS. The BoHV-4 V. test strain and the V. test BAC G derived bacterial artificial chromosome (BAC) clone were described elsewhere (Gillet et al., 2005).
RT-PCR, determination of kinetic class of transcription. For the determination of kinetic class of transcription, cycloheximide (CHX, 100 μg/ml, Sigma) or phosphonoacetic acid (PAA, 300 μg/ml, Sigma) were added to the culture medium at the time of infection to inhibit de novo protein synthesis or viral DNA polymerase, respectively. 24 h post infection (p.i.) of MDBK cells (multiplicity of infection (MOI) of 1 plaque forming unit (PFU)/cell), cytoplasmic RNA was extracted using the RNeasy Mini Kit (Qiagen) with on-column DNase I digestion. Reverse transcription and PCR reactions were performed using the SuperScript III One-step RT-PCR System with Platinium Taq DNA polymerase Kit (Invitrogen). Gene-specific primers (Table S1) were used to detect viral mRNAs. The absence of DNA template was verified by replacing the RT/Taq mix by the Taq DNA polymerase only.
Northern blotting. MDBK cells were mock-infected or infected with BoHV-4 V. test strain at a MOI of 4 PFU/cell. After an incubation period of 90 min, cells were washed with PBS and then overlaid with MEM containing 5% FCS. Cells were scrapped at 4, 8 and 24h p.i. RNA was then purified from the cells and analysed by northern blotting according to standard protocol (Sambrook & Russell, 2001). The entire ORF73 was used as probe to detect the RNAs encoding ORF73.
Production of BoHV-4 ORF73 recombinant strains. BoHV-4 recombinants were produced using BAC cloning and prokaryotic recombination technologies as described before (Gillet et al., 2005). The V. test BAC G plasmid was used as parental plasmid (Gillet et al., 2005). The V. test BAC G ΔORF73 and the V. test BAC G ORF73 revertant plasmids were produced using a two step galactokinase (galK) positive/negative selection in bacteria (Warming et al., 2005,
Virus purification. Virus grown on MDBK cells was semi-purified as described previously (Vanderplasschen et al., 1993). Briefly, after removal of the cell debris, the virus present in the cell supernatant was pelleted by ultracentrifugation through a 30% (w/v) sucrose cushion.
Southern blotting. Southern blot analysis was performed as described previously using ORF73 and galK cassette as probes (Costes et al., 2008).
Plaque size assay. MDBK cells were infected at a MOI of 0.5 PFU/cell. After an incubation period of 90 min, cells were washed with PBS and then overlaid with MEM containing 5% FCS and 0.6% (w/v) carboxymethylcellulose (CMC, Sigma) in order to obtain isolated plaques as described elsewhere (Vanderplasschen et al., 1993). At successive intervals after infection, plaques were stained by indirect immunofluorescent staining (see below) and observed by epifluorescent microscopy.
Multi-step growth curves. Triplicate cultures of MDBK cells were infected at a MOI of 0.5 PFU/cell. After an incubation period of 90 min, cells were washed with PBS and then overlaid with MEM containing 5% FCS. Supernatant of infected cultures was harvested at successive intervals after infection and the amount of infectious virus was determined by plaque assay on MDBK cells as described previously (Vanderplasschen et al., 1993).
Episome persistence assay. BOMAC cells were infected at a MOI of 0.5 PFU/cell. After an incubation period of 90 min, cells were washed with PBS and then overlaid with MEM containing 5% FCS. The cells were then passaged every other day (1:2 split ratio) for 20 days. At each passage, a fraction of the cells was fixed in PBS containing 4% (w/v) paraformaldehyde (Merck) at 4° C. for 30 min. Fixed cells were then washed with PBS, resuspended in the same buffer and analysed by flow cytometry for EGFP protein expression (EGFP is encoded by the BAC cassette).
Animals. Specific-pathogen-free New-Zealand white rabbits were housed individually throughout this study. Four groups were used, each comprising three rabbits. Animals from group 1 were mock-infected intravenously with PBS. Animals from groups 2, 3 and 4 were inoculated intravenously with 108 PFU of V. test BAC G excised, V. test BAC G ΔORF73 excised and V. test BAC G ORF73 revertant excised strains, respectively. At the end of the experiment, rabbits were euthanized and a necropsy examination was performed during which the spleen was collected.
Isolation of peripheral blood mononuclear cells and preparation of spleen cell suspension. Blood samples were collected and peripheral blood mononuclear cells (PBMC) were separated by Ficoll (Ficoll-Paque Plus, GE Healthcare) density gradient as described previously (Dewals et al., 2008) Immediately after euthanasia, spleen was removed and half-part of it was homogenized using a tissue grinder (VWR), passed through a stainless steel sieve and washed in FCS-free MEM before further analyses.
Viral genome detection by Real time-PCR. DNA was purified from the spleen and PBMC using the QIAamp DNA Mini kit (Qiagen). Real-time PCR was performed as described elsewhere (Boudry et al., 2007). A 103 by fragment corresponding to BoHV-4 ORF8 was amplified with the forward primer 8startfw and the reverse primer 8middlerev (Table S1) in the presence of the fluorescent probe 5′-FAM-AACACGTCAACA AGCAAGCCATCCACTG-TAMRA-3′. Purified BoHV-4 V. test genome was used to establish standard curves. PCR amplifications and fluorescence reactions were carried out in a iCycler system (Bio-Rad) under the following conditions: initial activation of the Taq polymerase (Bio-Rad) at 94° C. for 5 min followed by 50 cycles at 94° C. for 1 min, 50 cycles at 51° C. for 30 sec and 50 cycles at 72° C. for 1 min. For cellular quantitative amplification, a 178 by fragment of the rabbit beta-globin gene was used (Genbank accession no. V00882) and amplified as described earlier (Boudry et al., 2007).
Infectious centre assay. Viral detection in spleen cell suspension was assayed by infectious centre assay (ICA) as follows. 5.105 MDBK cells grown in 6 well cluster dishes (Becton Dickinson) were co-cultured for 4 days at 37° C. with 5.106, 5.105 or 5.104 spleen cells in MEM containing 5% FCS, 2% PS, 0.6% CMC and 5.10−5M of β-mercaptoethanol (Merck). Cells were then fixed and stained for indirect immunofluorescent detection of viral antigen as described below.
Quantification of anti-BoHV-4 antibodies by ELISA. Nunc Maxisorp ELISA plates (Nalge Nunc) were coated for 18 h at 37° C. with 0.1% Tween 20 (v/v)—disrupted BoHV-4 virions (2.106 PFU/well), blocked in PBS containing 0.1% Tween-20 (v/v) and 3% BSA (w/v), and incubated with rabbit sera (diluted 1/300 in PBS containing 0.1% Tween-20 (v/v) and 3% BSA (w/v)). Bound antibodies were detected with Alkaline Phosphatase conjugated goat anti-rabbit Ig polyclonal antibody (Sigma). Washing were performed with PBS containing 0.1% Tween-20 (v/v) and 3% BSA (w/v). Nitrophenylphosphatate (Sigma) was used as substrate and absorbance was read at 405 nm using a Benchmark ELISA plate reader (Thermo).
Indirect immunofluorescent staining. Indirect immunofluorescent staining was performed as described previously (Gillet et al. 2005). Mouse monoclonal antibody (Mab) 35 (diluted 1:100) raised against the BoHV-4 glycoprotein complex gp6/gp10/gp17 and Alexa Fluor 568 goat anti-mouse IgG (H+L) (Invitrogen, 2 μg ml−1) were used as primary and secondary antibodies, respectively.
Microscopy analysis. Samples were examined using an epifluorescence microscope TE2000-S Nikon and a Leica DC300F CCD camera system.
Flow cytometry. Flow cytometry acquisitions and analyses were performed using a three lasers Becton Dickinson fluorescence-activated cell sorter (FACSAria).
Statistical analysis. The linear model y=μ+groupi+timej+groupi*timej+experimentk+errorijkl was used to analyse viral multi-step growth curves and rabbit anti-BoHV-4 humoral responses. For multi-step growth curves comparison, the experiment factor was not significant and was therefore not included in the model. For analysis of anti-BoHV-4 humoral responses, correlation between successive measurements made on the same animal was taken into account using compound symmetry structure. Anova-2 test was used to determine the significance of the data obtained with the episome persistence assay (P<0.0005).
Results
BoHV-4 ORF73 is Expressed as an IE Gene.
To determine if BoHV-4 ORF73 is a bona fide gene, it was determined whether it is transcribed during BoHV-4 infection. RT-PCR was performed using first-strand cDNA made from BoHV-4-infected and mock-infected MDBK cells (
BoHV-4 ORF73 is expressed as polycistronic mRNAs encompassing ORF71. To characterise ORF73 transcript(s), Northern blot analysis was performed on total RNA extracted from BoHV-4-infected and mock-infected MDBK cells using full-length ORF73 as probe (
ORF71 is expressed as a polycistronic RNA encompassing at least ORF73. The polyadenylation signal (AATAAA) of the transcript is located 104 by downstream of ORF71 stop codon. RT-PCR reactions were performed on cytoplasmic RNA extracted from BoHV-4-infected MDBK cells in order to further characterise polycistronic RNA molecules encoding ORF71 and ORF73 (
Production and characterisation of BoHV-4 ORF73 recombinants. In order to investigate the importance of ORF73 in virus replication in vitro and the biology of the infection in vivo, a BoHV-4 strain deleted for ORF73 and a derived revertant strain were produced (
ORF73 deletion does not affect viral growth in vitro. In order to address the role of ORF73 in BoHV-4 growth in vitro, V. test BAC G, V. test BAC G AORF73 and V. test BAC G ORF73 revertant excised strains were compared using multi-step growth and plaque size assays (
ORF73 deletion affects viral persistence in vitro in a “latency-like” model. BOMAC cells have been shown to support a BoHV-4 non replicative persistent infection mimicking latency (Donofrio & van Santen, 2001). Using this “latency-like” model, it was investigated whether ORF73 deletion affects the persistence of BoHV-4 infection in BOMAC cells. BOMAC cells were infected with the V. test BAC G, V. test BAC G ΔORF73 and V. test BAC G ORF73 revertant strains and viral persistence was monitored over time by flow cytometry quantification of EGFP expressing cells (
At least two hypotheses that are not mutually exclusive could explain the faster decay of EGFP positive cells in V. test BAC G ΔORF73 infected culture in comparison to V. test BAC G and V. test BAC G ORF73. Firstly, it is likely that the deletion of ORF73 impaired the persistence of the viral episome in the culture through cell division. Secondly, it is possible that the absence of ORF73 could induce lytic replication (by release of the inhibition on ORF50) of BoHV-4 in BOMAC cells and consequently eradication of infected cells from the culture. To test the latter hypothesis, BOMAC cells were infected with V. test BAC G, V. test BAC G ΔORF73 and V. test BAC G ORF73 revertant strains, then analysed 48 h p.i. by flow cytometry for expression of the structural protein gB. The data presented in
BoHV-4 ORF73 is essential for viral persistence in vivo. To investigate the importance of BoHV-4 ORF73 during latency in vivo, the rabbit model was used. Rabbits were inoculated with the V. test BAC G, V. test BAC G ΔORF73 and V. test BAC G ORF73 revertant excised strains (
Finally, the humoral immune response induced by the ORF73 deleted strain was compared to those observed with the wild type parental and the revertant strains (
This statistical difference was not observed when the Student's t-test was used. However, these data demonstrate that the immune response raised against the ORF73 deleted recombinant is at least comparable to the responses induced by the wild type and the revertant strains. Absence of response in the mock-infected group confirmed absence of cross-contamination between the groups (
Several features make BoHV-4 a good candidate as a gene delivery vector and previous studies showed evidence that BoHV-4 can successfully be used to transduce expression of foreign proteins (Gillet et al., 2005; Donofrio et al., 2006). BoHV-4 (i) possesses a less complex genome than other herpesviruses (Zimmermann et al., 2001), (ii) can accommodate large amounts of foreign genetic material (Gillet et al., 2005), (iii) in contrast to most gammaherpesviruses, is able to replicate in a broad range of host species both in vitro and in vivo (Thiry et al., 1992), and (iv) BoHV-4 exhibits limited or no pathogenicity in natural and experimental hosts (Thiry et al., 1992). However, the property of BoHV-4 to establish latency and to reactivate makes wild type strains inappropriate to develop safe recombinant vectors. Indeed, throughout their live, infected animals could reactivate and contaminate naive animals. The results of the present study demonstrate that ORF73 deletion abolishes the property of BoHV-4 to establish persistent infection at least in a laboratory animal model (
In conclusion, the results of the present study demonstrate that despite its very small size, BoHV-4 ORF73 is a functional homologue of larger rhadinovirus ORF73 orthologues that is essential for latency in vivo. BoHV-4 ORF73 deleted strains represent excellent basis vectors for the development of BoHV-4 vectors in vaccinology.
ATTCAAAAATATTCAAATCAGGTGTCAGCACTGTCCTG
GTGAATTTTCTTTCTGCCAAAGGCCTGTTGACAATTAAT
Three days p.i., plaques were revealed by indirect immunofluorescent staining using Mab 35 and Alexa Fluor 568-conjugated goat anti-mouse as primary and secondary antibodies, respectively. Each set of three horizontal panels represents analysis of the same plaques. EGFP and Alexa Fluor 568 fluorescences are shown in the first and the second column, respectively; while the merged EGFP and Alexa Fluor 568 signals are shown in the third column. The side of each panel corresponds to 75 μm of the specimen. (b) Replication kinetics of recombinant strains. Replication kinetics of V. test BAC G AORF73 excised strain (triangle) and V. test BAC G ORF73 revertant excised strain (cross) were compared with those of the parental V. test BAC G excised strain (square) as described in Methods. The data presented are the means+/−SD of triplicate measurements.
Recombinant bovine herpesvirus 4 (BoHV-4) expressing glycoprotein D of BoHV-1 is immunogenic and elicits serum-neutralizing antibodies against BoHV-1 in a rabbit model. Clin Vaccine Immunol 13, 1246-54.
Vanderplasschen, A. & Pastoret, P. P. (1992). Molecular biology of bovine herpesvirus type 4. Vet Microbiol 33, 79-92.
DNA of cervid herpesvirus 1 and cervid herpesvirus 2, two viruses related to bovine herpesvirus 1. Arch Virol 128, 379-88.
Number | Date | Country | Kind |
---|---|---|---|
09169358.0 | Sep 2009 | EP | regional |
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/EP10/62846 | 9/2/2010 | WO | 00 | 3/1/2012 |
Number | Date | Country | |
---|---|---|---|
61239894 | Sep 2009 | US |