Bovine rotavirus genes

Abstract

The present invention provides the genes encoding the following BRV proteins: for group A, the VP4 and VP7 proteins of the Indiana (IND) strain, and the VP7 protein of the 2292B strain; for group B, the VP7 protein of the WD653 strain; for group C, the VP4 and VP7 proteins of the Shintoku strain. The genes are useful for producing nucleic acid probes which are complementary to the VP7 and VP4 genes. Such probes are useful for detecting the presence of group A,B, and C BRV in fecal samples from diarrheic calves and for determining the serotype of the BRV field isolates. The genes are also useful for producing partial length nucleic acid probes which are complementary to hypervariable regions of the VP4 and VP7 genes.The present invention also relates to partially purified VP2, VP4, VP6 and VP7 proteins of the IND strain and VP4 and VP7 of the 2292B strain, the partially purified VP7 protein of the WD653 strain, and partially purified VP2, VP4 and VP7 proteins of the Shintoku strain. The present invention also relates to recombinant virus-like particles (VLPs) which comprise one or more of the VP2, VP4, VP6, and VP7 proteins of the BRV strains IND, 2292B, CR, WD653, and Shintoku.

Description

BACKGROUND OF THE INVENTION

Bovine rotavirus (BRV) is a major cause of diarrhea in young calves. Infectious virions of BRV typically have a core protein designated VP2, an inner capsid protein designated VP6, and two outer capsid proteins designated VP4 and VP7. The BRV strains which infect both young and old animals are classified serologically into different groups and subgroups primarily on the basis of epitopes present on VP6. At present there are three BRV groups, designated A, B, and C, which are known to infect calves and adult cattle. The BRV groups are further classified into G serotypes on the basis of epitopes on VP7 and into P serotypes on the basis of epitopes present on VP4. This classification scheme provides important information about the strains of BRV infecting young calves.

Unfortunately, conventional serotyping methods do not permit separate analysis of rotavirus G and P types, and fail to detect subtypes or monotypes of a particular G serotype, limiting their usefulness for field samples.

Recently, a method for genotyping field isolates has been developed which is based on nucleic acid hybridization of probes to viral RNA. The genotyping permits the diagnosis of the strain infecting a particular animal. However the method is limited to diagnosing those strains for which certain genes sequences are known since the production of specific the probes requires knowledge of the gene sequence.

It would be desirable to know the sequences of genes of additional bovine rotavirus strains so as to design probes useful in the diagnosis of bovine rotavirus.

SUMMARY OF THE INVENTION

The present invention relates to novel genes of new field isolates of bovine rotavirus which permit the genotyping and thus the diagnosis of such new strains. The present invention provides the genes encoding the following BRV proteins: for group A, the VP4 and VP7 proteins of the Indiana (IND) strain, and the VP7 protein of the 2292B strain; for group B, the VP7 protein of the WD653 strain; for group C, the VP4 and VP7 proteins of the Shintoku strain. The genes are useful for producing nucleic acid probes which are complementary to the VP7 and VP4 genes. Such probes are useful for detecting the presence of group A,B, and C BRV in fecal samples from diarrheic calves and for determining the serotype of the BRV field isolates. The genes are also useful for producing partial length nucleic acid probes which are complementary to hypervariable regions of the VP4 and VP7 genes.

The present invention also relates to partially purified VP2, VP4, VP6 and VP7 proteins of the IND strain and VP4 and VP7 of the 2292B strain, the partially purified VP7 protein of the WD653 strain, and partially purified VP2, VP4 and VP7 proteins of the Shintoku strain. The present invention also relates to recombinant virus-like particles (VLPs) which comprise one or more of the VP2, VP4, VP6, and VP7 proteins of the BRV strains IND, 2292B, CR, WD653, and Shintoku.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is the nucleotide sequence of the BRV IND VP7 gene SEQ. ID. NO.1.

FIG. 2 is the nucleotide sequence of the BRV 2292B VP7 gene SEQ. ID. NO.2.

FIG. 3 is the nucleotide sequence of the BRV Shintoku VP7 gene SEQ. ID. NO.3.

FIG. 4 is the nucleotide sequence of the BRV WD653 VP7 gene SEQ. ID. NO.4.

FIG. 5 is the nucleotide sequence of the BRV Shintoku VP4 gene SEQ. ID. NO.5.

FIG. 6 is the deduced amino acid sequence of the BRV IND VP7 protein SEQ. ID. NO.6.

FIG. 7 is the deduced amino acid sequence of the BRV 2292B VP7 protein SEQ. ID. NO.7.

FIG. 8 is the deduced amino acid sequence of the BRV Shintoku VP7 protein SEQ. ID. NO.8.

FIG. 9 is the deduced amino acid sequence of the BRV WD653 VP7 protein SEQ. ID. NO.9.

FIG. 10 is the deduced amino acid sequence of the BRV Shintoku VP4 protein SEQ. ID. NO.10.

FIG. 11 is the nucleotide sequence of the BRV IND VP4 gene SEQ. ID. NO.11.

FIG. 12 is the nucleotide sequence of the BRV Cr VP4 hypervariable region SEQ. ID. NO.12.

FIG. 13 is the deduced amino acid sequence of the BRV IND VP4 protein SEQ. ID. NO.41.

DETAILED DESCRIPTION OF THE INVENTION

The genome of group A BRV, group B BRV and group C BRV comprise 11 discrete segments of linear double-stranded RNA, hereinafter referred to as "dsRNA". The dsRNA fragments are numbered 1 to 11 on the basis of their order of migration during polyacrylamide gel electrophoresis. The electrophoretic RNA migration pattern of a BRV strain is referred to as the strain's genomic electropherotype. The genome is enclosed in a triple-layered capsid which is composed of the core viral protein VP2, the inner capsid viral protein VP6, and the outer capsid proteins, VP4 and VP7. The VP4 genotype and VP7 genotype of field isolates enables the design of viral like particles useful as immunogens and vaccines, and which are specifically targeted to the BRV strains that are predominant in the field.

The genes encoding the outer capsid protein VP7 were cloned by PCR amplification from the BRV field strains BRV: Indiana (IND), 2292B, Crocker(Cr), WD653 and Shintoku BRV field strains IND, 2292B, Cr, WD653 and Shintoku were isolated from fecal samples of diarrheic calves/cows in IND, CA, OH, NY and Japan, respectively. The BRV field strains IND, 2292B, CR and Shintoku were serially propagated in monolayers of the fetal rhesus monkey kidney cell line, MA104 cells as described in Tsunemitsu et al., J. Clin. Microb. 29: 2609, 1991 and Saif et al. J. Tissue Culture Methods 11: 147-156, 1988. The cell-culture adapted BRV strain IND was deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852, on Jun. 24, 1996, and has accession number VR-2533. The cell culture adapted BRV strain 2292B was deposited with the American Type Culture Collection on Jun. 24, 1996 and has the Accession Number VR-2534. The cell culture adapted BRV strain Crocker was deposited with the American Type Culture Collection on Jun. 24, 1996 and has accession number VR-2532.

EXAMPLE 1

To prepare genomic dsRNA from the IND strain, the cell-propagated IND strain was subjected to 2 cycles of freezing and thawing, followed by centrifugation at 1,200.times.g for 30 minutes. The supernatants were centrifuged at 122,000.times.g for 3 hours at 4.degree. C. through a 40% sucrose cushion to produce viral pellets. The viral pellets were suspended in 1 ml of extraction buffer which contained 0.1M sodium acetate, pH 5, and 1% sodium dodecyl sulfate. The suspension was extracted twice with an equal volume of phenol/chloroform mixture (1:1), and 0.1 volume of 4M sodium acetate and 2 volumes of 100% ethanol were added to the aqueous phase. The RNA was allowed to precipitate overnight at -20.degree. C. and was pelleted by centrifugation at 12,000.times.g. The RNA was resuspended in diethyl pyrocarbonate (DEP)-treated water and stored at -20.degree. C. until used.

Rotavirus dsRNA in extracted samples was analyzed by polyacrylamide gel electrophoresis to confirm the presence of dsRNA and to examine the genomic electropherotypes. The discontinuous buffer system of Laemmli was utilized, and dsRNA was resolved in 10% polyacrylamide slab gels. Electrophoresis was conducted at 12 mA for 14-16 hours. The dsRNA bands were visualized by silver staining or staining with ethidium bromide having a concentration of 0.5 .mu.g/ml. The electropherotype of the dsRNA indicated that 11 segments of dsRNA were present and the migration pattern corresponded to that characteristic of the IND strain.

For PCR amplification, the extracted dsRNA was first purified using the RNAid kit from B101, La Jolla, Calif., according to the manufacturer's instructions. Thereafter the purified dsRNA was boiled in 20% dimethyl sulfoxide for 5 minutes and cooled on ice for 5 minutes.

The BRV IND strain VP7 gene was prepared by polymerase chain reaction (PCR) amplification of gene segment 9 using the purified dsRNA as a template and the following sense primer and antisense primer, respectively:

5' CCCGGGATCCATGGCCGGCTTTAAAA GCGAGAATTT 3' SEQ. ID. NO. 19 5' CGATCGCGAATTCTGCGGCAGGTC, SEQ. ID. NO 20.

Amplification of the dsRNA templates required an initial reverse transcription step. The heat-denatured dsRNA was diluted 1:4 with 5% DMSO in a reaction mixture containing 10 mM Tris (pH 8.3), 40 mM KCl, 1.5 mM MgCl.sub.2, 1 mM dithiothreitol, 200 .mu.M each of DATP, dCTP, dTTP and dGTP, 200 ng each of the sense primer and antisense primer, 10 U of AMV reverse transcriptase from Boehinger Mannheim Biochemicals, 2.5 units of Taq polymerase from Boehinger Mannheim Biochemicals and 20 units of RNASIN from Promega.

The tubes were placed in a thermocycler from Perkin Elmer Cetus and incubated at 42.degree. C. to generate cDNA copies of the BRV IND strain dsRNA. The tubes were heated at 94.degree. C. for 5 minutes and subjected to thirty amplification cycles, each consisting of 94.degree. C. for 1 minute to denature the cDNA, 42.degree. C. for 1.5 minutes to anneal the primer to the nucleic acid and 72.degree. C. for 3.5 minutes to extend the strands. The PCR products were purified and analyzed by 1% agarose gel using standard techniques. The PCR products were cloned into the PCRII plasmid from Invitrogen according to manufacturer's instructions and sequenced using the primer extension method of Sambrook et al. (1989) Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

As shown in FIG. 1, the VP7 gene of IND strain, SEQ. ID. NO. 1, comprises 1062 base pairs. An AUG codon at base 49 initiates a 978 base pair open reading frame and codes for 326 amino acids. The deduced amino acid sequence of the VP7 protein of the IND strain, SEQ. ID. NO. 6 is shown in FIG. 6.

EXAMPLE 2

Genomic dsRNA was extracted from the cell-propagated 2992B strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV 2292B strain VP7 gene was prepared by PCR amplification of gene segment 9 from the 2292 strain dsRNA template using the following sense primer and antisense primer, respectively

5' CCCGGGATCCATGGCCGGCTTTAAAA GCGAGAATTT 3' SEQ. ID. NO. 19 5' CGATCGCGAATTCTGCGGCAGGTC, SEQ. ID. NO 20.

Amplification of the template was conducted as described in Example 1. The sequence of the VP7 gene of the 2992B strain, SEQ. ID. NO. 2, is shown in FIG. 2. The deduced amino acid sequence of the VP7 protein of the 2992, SEQ. ID. NO. 7, strain is shown in FIG. 7.

EXAMPLE 3

Genomic dsRNA was extracted from the cell-propagated Shintoku strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV Shintoku strain VP7 gene was prepared by PCR amplification of gene segment 8 from the Shintoku strain dsRNA template using the following sense primer and antisense primer, respectively:

5'-GGCATTTAAAAAAGAAGAAGCTGT-3', SEQ. ID. NO. 27 5'-AGCCACATGATCTTGTTTACGC-3', SEQ. ID. NO. 28.

The dsRNA template was added to a reaction mixture as described in Example 1. The mixture was overlaid with mineral oil and then subjected to one cycle of reverse transcription at 42.degree. C. for 30 minutes and 30 cycles of PCR amplification at 94.degree. C. for 1 minute, 42.degree. C. for 1.5 minutes. and 72.degree. C. for 3 minutes and a final 7 minute incubation at 72.degree. C. The PCR products were sequenced using the Sequenase version 2 DNA sequencing kit from United States Biochemical. Single-stranded sequencing templates were prepared by digestion of the phosphorylated strand of the PCR products with lambda exonuclease from Pharmacia Biotech. Sequences of both terminal regions of the VP7 genes were determined by a modified procedure of Lambden et al. J. Virol. 66: 1817-1822, 1992. Synthetic primer 1, 5'CCCGTCGACGAATTCTTT-3'--NH.sub.2, SEQ. ID. NO. 46 was ligated to the 3' ends of the viral RNA using T4 RNA ligase from GIBCO/BRL. cDNA fragments of 400 to 600 base pairs spanning either the 5' or the 3' ends were produced by RT-PCR using primer 2 complementary to primer 1 and virus-specific primers, and were sequenced by using internal primers. The sequence of the VP7 gene of the Shintoku strain, SEQ. ID. NO. 3, is shown in FIG. 3. The deduced amino acid sequence of the VP7 protein of the Shintoku strain, SEQ. ID NO. 8, is shown in FIG. 8.

The VP7 gene of the Shintoku strain comprises 1063 nucleotides and contains one open-reading-frame encoding a polypeptide of 332 amino acids. The predicted molecular mass of the VP7 gene from the group C Shintoku BRV is 37.3 to 37.6 kDa.

EXAMPLE 4

Genomic dsRNA was extracted from the cell-propagated WD653 strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV WD653 strain VP7 gene was prepared by PCR amplification of the corresponding gene segment 9 from the 2292 strain dsRNA template using the following sense primer and antisense primer, respectively

5' GGAAATATCAGAGATGCGT 3' SEQ. ID. NO. 21. 5' TTCTTTATGCTTCGGCCTA 3' SEQ. ID. NO. 22.

Amplification of the template was conducted as described in Example 1. The sequence of the VP7 gene of the WD653 strain, SEQ. ID. NO. 4, is shown in FIG. 4. The deduced amino acid sequence of the VP7 protein of the WD653 strain, SEQ. ID. NO. 9, is shown in FIG. 9.

EXAMPLE 5

Genomic dsRNA was extracted from the cell-propagated Shintoku strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV Shintoku strain VP4 gene was prepared by PCR amplification of gene segment 4 from the Shintoku strain dsRNA template using the following sense primer and antisense primer, respectively

5' GGAAATATCAGAGATGCGT 3' SEQ. ID. NO. 23 5' TTCTTTATGCTTCGGCCTA 3' SEQ. ID. NO. 24.

Amplification of the template was conducted as described in Example 1. The sequence of the VP4 gene of the Shintoku strain, SEQ. ID. NO. 5, is shown in FIG. 5. The deduced amino acid sequence of the VP4 protein of the IND strain, SEQ. ID. NO. 10, is shown in FIG. 10.

EXAMPLE 6

Genomic dsRNA was extracted from the cell-propagated IND strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV IND strain VP4 gene was prepared by PCR amplification of gene segment 4 from the IND strain dsRNA template using the following sense primer and antisense primer, respectively

5'CCCGGGATCCGAATTCGGCTATAAA ATGGCTTGGCT 3' SEQ. ID. NO. 15 5'TCGCGAATTCTGCAGGTACATCCTCCAGAAGCT 3' SEQ. ID. NO. 16.

Amplification of the template was conducted as described in Example 1. The sequence of the VP4 gene of the IND strain, SEQ. ID. NO. 11, is shown in FIG. 11. The deduced amino acid sequence of the VP4 protein of the IND strain, SEQ. ID. NO. 13, is shown in FIG. 13.

EXAMPLE 7

Genomic dsRNA was extracted from the cell-propagated Cr strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV Cr strain VP4 gene was prepared by PCR amplification of corresponding gene segment from the Shintoku strain dsRNA template using the following sense primer and antisense primer, respectively

5'CCGGGATCCGAATTCGGCTATAAA ATGGCTTGGCT 3' SEQ. ID. NO. 15 5'TCGCGAATTCTGCAGGTACATCCTCCAGAAGCT 3' SEQ. ID. NO. 16.

Amplification of the template was conducted as described in Example 1. The sequence of the hypervariable region of the VP4 gene of the Cr strain, SEQ. ID. NO. 12 is shown in FIG. 12.

Diagnosing Infection with BRV

cDNA probes, preferably full-length cDNA probes, complementary to the VP4 or VP7-encoding gene segments isolated from BRV strains IND, 2292B, and Cr, are useful for diagnosing infection with group A virus in fecal samples from diarrheic animals. cDNA probes, preferably full-length cDNA probes, complementary to the VP7-encoding gene segment isolated from WD653 strain, are useful for diagnosing infection with Group B rotaviruses, and cDNA probes, preferably full-length cDNA probes, complementary to the VP4 and VP7 encoding gene segments from the Shintoku strain are useful for diagnosing infection with group C rotaviruses. The cDNA probes are prepared by PCR amplification of dsRNA extracted from the virus strains using primers for the 5' ends of the sense and antisense strands. The preferred primers for preparing the full-length cDNA probes of the VP4 and or VP7 genes of BRV strains IND, 2292B, Cr, WD653 and Shintoku, are shown in Table 1.

TABLE 1__________________________________________________________________________Oligonucleotide primers for PCR Amplificationof full-length cDNAs.Genes Primer Sequences__________________________________________________________________________IND,2922B,Cr(Group A)VP2 Sense 5' GGCTATTAAAGGT 3' SEQ. ID. NO. 13 Antisense 5' ggtcatatctccaca 3' SEQ. ID. NO. 14VP4 Sense 5' CCCGGGATCCGAATTCGGCTATAAA SEQ. ID. NO. 15 ATGGCTGGCT 3' Antisense 5' TCGCGAATTCTGCAGGTACATC SEQ. ID. NO. 16 CTCCAGAAGCT 3'VP6 Sense 5' GGCTTTTAAACGAAGTC 3' SEQ. ID. NO. 17 Antisense 5' GGTCACATCCTCTCACTA 3' SEQ. ID. NO. 18VP7 Sense 5' CCCGGGATCCATGGCCGGCTTTAAAA SEQ. ID. NO. 19 GCGAGAATTT 3' Antisense 5' CGATCGCGATTCTGCGGCAGGTC SEQ. ID NO. 20WD563(Group B)VP7 Sense 5' GGAAATATCAGAGATGCGT 3' SEQ. ID. NO. 21 Antisense 5' TTCTTTATGCTTCGGCCTA 3' SEQ. ID. NO. 22Shinktoku(Group C)VP4 Sense 5' GGAAATATCAGAGATGCGT 3' SEQ. ID. NO. 23 Antisense 5' TTCTTTATGCTTCGGCCTA 3' SEQ. ID. NO. 24VP6 Sense 5' 5' GCATTTAAAATCTCATTCAC 3' SEQ. ID. NO. 25 Antisense 5' AGCCACATAGTTCACATTTC 3' SEQ. ID. NO. 26VP7 Sense 5' GCATTTAAAAAAGAAGAAGCTGT 3' SEQ. ID. NO. 27 Antisense 5' AGCCACATGATCTTGTTTACGC 3' SEQ. ID. NO. 28__________________________________________________________________________

The cDNA probes are used in hybridization assays with total RNA extracted with phenol/chloroform from fecal samples of calves suspected of having a BRV infection. Preferably, the hybridizations are performed under conditions of moderate stringency, for example, for 16-24 hours at 42.degree. C., when the full length probes are used to detect the presence of Group A, B, and C BRV.

Typing BRV Infections

Probes that are complementary to the hypervariable region of the VP4 and VP7 genes are useful for characterizing the specific genotype of the BRV strain in field isolates. The hypervariable region sequence also serves as the basis for genotyping either G or P type field isolates by a method which employs reverse transcription PCR (RT-PCR) amplification of the hypervariable region and analysis of the size of the PCR product.

The P type and G type of BRV obtained from field isolates are assayed by hybridizing cDNA probes which are complementary to hypervariable regions of the VP4 and VP7 genes of different BRV strains to the dsRNA isolated from fecal samples of diarrheic animals.

The partial-length VP4 and VP7 cDNA probes used in the assays are made by PCR amplification, such as using the techniques described in Examples 1-7 of the cloned genes using primers having sequences complementary to the highly conserved regions of the VP4 and VP7 genes and which flank the hypervariable regions of the VP4 and VP7 genes. Examples of suitable primers for PCR amplification of the hypervariable regions of the VP4 and VP7 genes of BRV strains IND, Cr, 2992B, Shintoku are shown in Table 2. Alternatively, the partial length VP4 and VP7 probes are made using nucleic acid synthesizers. The purified PCR products are then radiolabeled, preferably by using a nick translation kit, such as the kits available from Bethesda Research Laboratories, Gaithersburg, Md.

The dsRNA is extracted from fecal samples obtained from the BRV infected cow or calf with phenol/chloroform as described in Parwani, et al., J. Clinical Microbiology, August 1993, Vol. 31, No. 8, pp. 2010-2015. The dsRNA isolate is then resolved by polyacrylamide gel electrophoresis and denatured by soaking the gel in 0.1M NaOH and 0.25M NaCl for 20 minutes at room temperature. The gel is then washed, preferably twice for 20 minutes each time in 4.times.TAE (I.times.TAE=0.01M Tris-acetate, 0.001M ethylenediaminetetraacetic acid) and once in 1.times.TAE for 20 minutes. The denatured RNA is electrotransferred, preferably onto Nytran membranes and immobilized using ultraviolet light cross-linking.

For dot blots, dsRNA is preferably denatured at 95.degree. C. for 5 minutes and placed on ice for 5 minutes. The RNA is preferably dotted onto nylon membranes in volumes of 5 .mu.l or less. Following application of the samples, the membranes are air dried and baked for 2 hours at 80.degree. C. in a vacuum oven.

The membranes are prehybridized for preferably 4 hours at 42.degree. C. or 52.degree. C. in hybridization buffer containing 50% formamide, 5.times.standard saline citrate, 50 mM phosphate buffer at pH 6.5, 0.2% SDS, 2.times.Denhardt's solution, 100 .mu.g/ml yeast tRNA. Hybridization is performed preferably in 3-5 ml of hybridization buffer containing 4.5% dextran sulfate and 3-5.times.10.sup.6 counts/minute of heat-denatured PCR probe of approximately 1.2.times.10.sup.7 CPM/.mu.gDNA template. Preferably, the hybridizations are performed under condition of high stringency, for example, for 16-24 hours at 52.degree. C., when the partial probes are used to genotype the field isolates. The membranes are washed 4 times at room temperature in 2.times.SSC and 0.1% SDS and 2 times at hybridization temperature in 0.4.times.SSC and 0.1% SDS. The washed membranes are rinsed once with water, blotted, and exposed to film with intensifying screens at -70.degree. C.

Alternatively, the genotypes of field isolates are determined as in the methods described in Examples 1-7 by isolating dsRNA from the field isolate, preparing cDNA molecules by RT-PCR employing the sense and antisense primers shown in Table 2, cloning the cDNA into a vector, sequencing the cDNA and comparing the sequence obtained to the disclosed sequences for the VP4 and VP7 genes of BRV strains IND, 2292B, Cr, WD653 and Shintoku.

TABLE 2__________________________________________________________________________Sequence of oligonucleotides used forPCR-amplification of partial length VP4 and VP7 genesGene Location Strand.sup.3 Sequence__________________________________________________________________________VP4 nucleotides Sense 5.dbd.-CCGTATCAGCCGGCGCCGTT-3'- SEQ. ID. NO. 29(IND, 211 to 2302292B, Cr)VP4 nucleotides Anti-sense 5'-GGCGGCAGCCCGTTGTTTAT-3'- SEQ. ID. NO. 30(IND, 677 to 6862292B, Cr)VP7 nucleotides Sense 5'-GTATGGTATTGAATATACCAC-3'- SEQ. ID. NO. 31(IND, 51 to 712292B, Cr)VP7 nucleotides Anti-sense 5'-GATCCTGTTGGCCATCC-3'- SEQ. ID. NO. 32(IND, 376 to 3922292B, Cr)VP4 nucleotides Sense 5'-GGCTTAAAAAAGTCAGGATC-3'- SEQ. ID. NO. 33(Shintoku) 1-20VP4 nucleotides Anti-sense 5'-TCAGAATTTGTCATCCCT-3'- SEQ. ID. NO. 34(Shintoku) 408-425VP4 nucleotides Anti-sense 5'-AATGTTCATGCTCGCACT-3'40 - SEQ. ID. NO. 35(Shintoku) 640-647VP4 nucleotides Sense 5'-CCAAGAAGTACTACCGC-3'- SEQ. ID. NO. 36(Shintoku) 1768-1785VP4 nucleotides Sense 5'-CTTATGATTTGGCTACTC-3'- SEQ. ID. NO. 37(Shintoku) 1967-1984VP4 nucleotides Anti-sense 5'-AGCCACATAATAAGTCGATC-3' SEQ. ID. NO. 38(Shintoku) 2234-2253VP7 nucleotides Sense 5'-GGCATTTAAAAAAGAAGAAG-3'- SEQ. ID. NO. 39(Shintoku) 1-20VP7 nucleotides Anti-sense 5'-CAAAAAGCAATAAGTGACAA-3'- SEQ. ID. NO. 40(Shintoku) 145-163VP7 nucleotides Anti-sense 5'-GACCAGGTCGCCCCACTG-3'- SEQ. ID. NO. 42(Shintoku) 302-319VP7 nucleotides Anti-sense 5'-AGTATAAGTATTAAAATTC-3'- SEQ. ID. NO. 43(Shintoku) 411-429VP7 nucleotides Sense 5'-GTAAGAATTTCGAACTTG-3'- SEQ. ID. NO. 44(Shintoku) 844-861VP7 nucleotides Anti-sense 5'-AGCCACATGATCTTGTTTAC-3'- SEQ. ID. NO. 45(Shintoku) 1044-1063__________________________________________________________________________ Expression of the VP4 and VP7 genes

Partially-purified BRV proteins VP2, VP4, VP6 and VP7 are obtained from the IND strain, the 2292 B strain, the WD563 strain and the Shintoku strain by extracting the dsRNA of each strain from cell-culture lysates or infected gnotobiotic calf fecal material, preparing amplified cDNA from the dsRNA by reverse-transcription (RT) PCR using gene specific primers for the 5' and 3' ends of the sense and antisense strand of the dsRNA, constructing a recombinant vector with the amplified DNA, transfecting cells with the recombinant vector, lysing the cells, and centrifuging the cell lysates to provide a supernatant containing the partially purified protein. Further purification is accomplished by affinity chromatography using viral protein specific monoclonal antibodies to purify the corresponding protein. The preferred gene specific primers for RT-PCR of the genes which encode the viral proteins from the IND strain, the 2992B strain, the Cr strain, the WD563 strain and the Shintoku strain are shown in Table 1.

EXAMPLE 8

The partially-purified VP4 protein of the IND strain was prepared by first amplifying genomic dsRNA extracted from the cell-propagated IND strain as described in Example 1 using a sense primer of SEQ. ID. NO. 15 and the antisense primer SEQ. ID. NO. 16 as shown in Table 1. The PCR-amplified full length VP7 cDNA was purified by centrifugation using a centrix-AG cartridge from Advanced Genetic Technologies, Gaithersburg, and then digested with restriction enzymes BamHI and PstI. The VP4 fragments were then cloned into plasmid pVL1393 from Pharmigen, San Diego. Recombinant plasmids were identified by colony blot hybridization using radiolabeled PCR-derived IND VP4 cDNA as a probe. The probes were prepared using a nick translation kit from Bethesda Research Laboratories, Gaithersburg and .sup.32 P-deoxycytidine-5'-triphosphate from ICN Biochemicals, Irvine, Calif. Plasmid DNAs hybridizing positively with the probes were subjected to restriction enzyme digests to check the size of the inserts. The recombinant plasmids were identified by sequencing in the junction region toward 3' and 5' end of the IND VP4 cDNA using polyhedron forward primer 5'-AAATGATAACCATCTCGA-3', SEQ. ID. NO. 49 or the reverse primer 5'-GTCCAAGTTTCCCTG-3', SEQ. ID. NO. 50.

A cationic liposome mediated transfection kit from Invitrogen, San Diego was used to transfect the recombinant baculovirus into Sf9 cells. Sf9 cells were seeded in 60 mm plates and transfected with a mixture of 3 .mu.g of recombinant transfer plasmid, 1 .mu.g of linear AcMNPV viral DNA and 20 .mu.l of cationic liposome solution. The transfected cells were incubated at 27.degree. C. for 4 to 5 days. Successful transfection was confirmed by the presence of polyhedron within 6 days of transfection.

Serial dilution of the cell culture supernatants obtained from transfected Sf9 cells were used for a plaque assay. Recombinants were selected by occlusion-negative plaques. Virus in occlusion-negative plaques was subjected to three rounds of plaque purifications and used to propagate virus stock.

To confirm the recombination, the cell lysates from mock or recombinant baculovirus infected Sf9 cell monolayers was harvested and total DNA was purified by PEG/NaCl method. The presence of recombinants in the total DNA purified from infected Sf9 cells was determined by PCR using the following primers: 5'-TTTACTGTTTTCGTAACAGTTTTG-3', SEQ. ID. No. 47, and 5'-CAACAACGCACAGAATCTAGC-3', SEQ. ID. NO. 48. The PCR reactions were heated at 94.degree. C. for 2 minutes and subjected to thirty amplification cycles, each consisting of 94.degree. C. for 1 minute, 55.degree. C. for 2 minutes, 72.degree. C. for 3 minutes and one cycle at 72.degree. C. for 7 minutes. The PCR products were purified by centrix-AG cartridge from Advanced Genetic Technologies, Gaithersburg, Md., and analyzed by 1% agarose gel electrophoresis.

An indirect immunofluorescence assay was used to detect the expression of the IND VP7 protein in the infected Sf9 cells. Confluent Sf9 cells grown in 24-well plates were mock infected or infected with recombinant baculoviruses and incubated at 27.degree. C. for 2 to 3 days. After the end of the incubation, the cells were harvested, centrifuged and washed with phosphate buffered saline. The cells were placed on 8 well slides, air dried and fixed with 80% acetone. Guinea pig hyperimmune antiserum to IND BRV was used to detect the expressed proteins. Antiserum at a dilution of 1:500 was incubated with the infected cells at 37.degree. C. for 1 hr. The slides were placed in PBS for 5 minutes. The cells were then incubated with fluorescein-labeled rabbit anti guinea pig serum at a 1:1,000 dilution at 37.degree. C. for 1 hour. Following this, the cells were washed and examined using a fluorescence microscope.

Cells which exhibited a positive fluorescence were sonicated at 40 amplitude for 1 minute, centrifuged at 2000 RPM for ten minutes at 4.degree. C., and the supernatants collected from to provide the partially-purified VP7 protein of the IND strain. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10.sup.7 transfected cells.

EXAMPLE 9

The partially-purified VP7 of the IND strain was prepared first by PCR amplifying the dsRNA extracted from the cell-propagated IND strain as described in Example 1 using the sense primer having SEQ. ID. NO. 19 and the antisense primer SEQ. ID. NO. 20 as shown in Table 1. The PCR-amplified full length VP4 cDNA was purified as described in Example 8 and then digested with restriction enzymes EcoRI and BamHI and cloned into plasmid pVL1393 from Pharmigen, San Diego. Recombinant plasmids were identified as described in Example 8 and used to transfect Sf9 cells as described in Example 8. Transfected cells were identified as described in Example 8, and .times.106 transfected cells were sonicated, and centrifuged to provide a supernatant containing partially purified VP4 protein of the IND strain. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10.sup.7 transfected cells.

EXAMPLE 10

The partially-purified VP7 of the Shintoku strain was prepared first by PCR amplifying dsRNA from the cell-propagated Shintoku strain as described in Example 1 using the sense primer having SEQ. ID. NO. 25 and the antisense primer SEQ. ID. NO. 26 as shown in Table 1. The PCR-amplified full length VP7 cDNA was purified as described in Example 4 and then digested with restriction enzymes EcoRI and BamHI and cloned into plasmid pCR-Bac from Invitrogen, San Diego. Recombinant plasmids were identified by DNA sequencing in the junction region toward the 3' and 5' end of each gene using polyhedron forward primer 5'-AAATGATAACCATCTCGC-3', SEQ. ID. NO. 49 or the reverse primer, 5'-GTCCAAGTTTCCCTG-3, SEQ. ID. NO. 50.

Recombinant plasmids were used to transfect Sf9 cells as described in Example 4. Transfected cells were identified as described in Example 8, sonicated, and centrifuged to provide a supernatant containing partially purified VP7 protein of the Shintoku strain. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10.sup.7 transfected cells.

EXAMPLE 11

The partially-purified VP4 of the Shintoku strain was prepared first by PCR amplification of the dsRNA obtained from the cell-propagated Shintoku strain as described in Example 1 using the sense primer having SEQ. ID. NO. 23 and the antisense primer SEQ. ID. NO. 24 as shown in Table 1. The PCR-amplified full length VP4 cDNA was purified as described in Example 8 and then digested with restriction enzymes EcoRI and BamHI and cloned into plasmid pCR-Bac from Invitrogen, San Diego. Recombinant plasmids were identified as described in Example 10 and used to transfect Sf9 cells as described in Example 8. Transfected cells were identified as described in Example 8. The supernatant containing partially purified VP4 protein of the Shintoku strain was prepared as in Example 8. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10.sup.7 transfected cells.

EXAMPLE 12

The partially-purified VP6 protein of the Shintoku strains was prepared first by PCR amplification of the dsRNA from the cell-propagated Shintoku strain and PCR as described in Example 1 using the sense primer having SEQ. ID. NO. 25 and the antisense primer SEQ. ID. NO. 26 as shown in Table 1. The PCR-amplified full length VP6 cDNA was purified as described in Example 4 and then digested with restriction enzymes EcoRI and BamHI and cloned into plasmid pCR-Bac from Invitrogen, San Diego. Recombinant plasmids were identified as described in Example 6 and used to transfect Sf9 cells as described in Example 4. Transfected cells were identified as described in Example 4, sonicated, and centrifuged to provide a supernatant containing partially purified VP6 protein of the Shintoku strain. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10.sup.7 transfected cells.

EXAMPLE 13

The partially-purified VP6 protein of the IND strain was prepared first by PCR amplification of the dsRNA from the cell-propagated IND strain as described in Example 1 using the sense primer having SEQ. ID. NO. 17 and the antisense primer SEQ. ID. NO. 18 as shown in Table 3. The PCR-amplified full length IND VP6 cDNA was purified as described in Example 4 and then digested with restriction enzymes EcoRI and BamHI cloned into plasmid pCR-Bac. Recombinant plasmids were identified as described in Example 6 and used to transfect Sf9 cells as described in Example 4. Transfected cells were identified as described in Example 4. Transfected cells were sonicated, and centrifuged to provide a cell lysate supernatant containing partially purified VP6 protein of the IND strain. Each ml of cell lysate supernatant contained the partially purified VP6 protein from 10.sup.7 transfected cells.

Immunization of animals with partially purified VP4, VP6, and VP7 proteins from recombinant baculovirus cell lysates

The partially-purified IND VP4 protein, IND VP7 protein, Shintoku VP4 protein and Shintoku VP7 protein respectively of Examples 8, 8, 10, and 11 were injected into guinea pigs. 0.5 ml of the cell lysate supernatant containing the respective partially-purified viral protein was mixed with an equal volume of Freund's complete adjuvant and the entire amount injected into multiple subcutaneous sites of each animal. Two weeks later, booster injections of the same amount of cell lysate supernatant mixed with an equal volume of Freund's incomplete adjuvant were administered. The same inoculum with adjuvant was administered intramusculary at three-week intervals after the second injection up to 4 times. The guinea pigs were bled at 3 and 7 weeks via cardiac puncture after the first injection. Serum samples were tested for the presence of virus neutralizing antibodies by plaque reduction virus neutralization (PRVN) assays and for the presence of antibodies reactive to rotavirus by ELISA, western blot and immunofluorescence assays.

The PRVN test was performed in six well plates containing MA 104 cell monolayers to determine neutralizing antibody titers of the hyperimmune antisera to the recombinant proteins. Serial four fold dilutions of antisera were mixed with equal volumes of viral suspensions containing 60 to 80 PFU/0.1 ml and incubated for one hour at 37.degree. C. The plates were washed once with serum free Earle's Minimal Essential Medium and agar medium containing 0.8% Noble agar, 0.067 mg of neutral red per ml, and 25 .mu.g of pancreatin from Gibco per ml in E-MEM was added. The PRVN titer was expressed as the reciprocal of the highest dilution of serum which produced an 80% reduction in the number of plaques, as compared with the number in virus control wells. The PVRN titers for animals mock-infected baculovirus lysates and with the partially purified proteins of Examples 4, 5, 6, and 7 are shown in Table 4.

TABLE 4______________________________________PRVN titers of Animals injected withPartially- Purified VP4 and VP7 Proteins of theIND and Shintoku BRV strainsSample(No. of Immunizations) Volume Injected PRVN Titer______________________________________Mock Sf9 cells 1 ml <4Mock Sf (2) 2 ml <4IND VP4 1 ml <64IND VP4 (2) 1 mlIND VP4 (5) 5 ml 610IND VP4 (2) 1 ml <64IND VP4 (5) 5 ml 150IND VP7 (1) 1 ml <4IND VP7 (2) 2 ml <4IND VP7 (5) 0.5 ml <64Shintoku VP7 (1) 1 ml <4Shintoku VP7 (4) 1 ml <4Shintoku VP4 (4) 1 ml 150______________________________________ Characterizing the Antibody Titer of Animals

The partially-purified VP4 and VP7 proteins of the BRV strains IND, 2992B, Cr, WD653 and Shintoku are useful for measuring the titers of VP4 and VP7 antibodies in serum samples of animals naturally infected with BRV strains having serogroups or serotypes related to each of these respective BRV strains or in animals inoculated with a vaccine made with the related whole virus. The method of measurement involves a direct ELISA testing system using the partially-purified proteins coated directly on the plates or captured on the plates via antibodies.

EXAMPLE 14

Nunc plates are coated directly with the supernatant of Examples 4, 5, 6, and 7 diluted 1:25 or with lysates of wild-type baculovirus-infected cells control diluted 1:25. Serum samples from the animals inoculated with the test vaccine are added to each plate. Then secondary antibodies consisting of biotinylated monoclonal antibodies to bovine IgGI; IgG2; and IgM diluted 1:1,000-1:2,000 are added to the plate. The indicator antibody is a peroxidase-conjugated streptavidin.sup.b diluted 1:10,000 and the substrate is 2,2 acino-di-(e-ethylbenz-thiazoline-6-sulfonate) with 0.03% H.sub.2 O.sub.2. For detection of IgA antibodies in the above system, a monoclonal antibody conjugated to alkaline phosphatase diluted 1:500 is used followed by the substrate p-nitrophenol phosphate in 10% DEA buffer. The absorbance for all assays, is determined in an ELISA reader at 405 nm for the alkaline phosphatase system or 450 nm for the peroxidase system. The ELISA antibody titers are expressed as the reciprocal of the highest sample dilution which had an absorbance of greater than 3 SD above the background control sample in mock-infected wild type control wells. Each test includes a positive and negative control serum.

Preparation of Virus-Like Particles

It is currently believed that vaccines which elicit a strong immunogenic response to the outer capsid proteins VP4 and VP7 offer greater protection than vaccines which elicit only a weak immunogenic response to these outer capsid proteins. Unfortunately, vaccines made from live and attenuated viruses do not always raise a high antibody titer to VP4 and VP7. The viruses that are used in such vaccines are obtained from tissue culture and are not always complete, that is, the tissue culture-propagated viruses lack the outer capsid layer. Moreover, the compounds which are used to inactivate the viruses used in vaccines are believed to adversely affect the epitopes which elicit a strong immune response. Accordingly, it is desirable to have a non-infectious, immunogenic virus particle which is comprised of the viral triple capsid layers and the VP2, VP4, VP6, and VP7 proteins. It is also desirable to have a method of assessing the VP4 and VP7 antigenicity of vaccines made with attenuated or inactivated viruses or with immunogenic virus-like particles.

Rotavirus virus-like particles (VLPs) are assembled in a triple-layered structure by coinfecting cells with four different recombinant vectors, wherein one of said vectors comprises a rotavirus VP2 gene, one of said vectors comprises a rotaviarus VP4 gene, one of said vectors comprises a rotavirus VP6 gene, and one of said vectors comprises a rotavirus VP7 gene, and then isolating the assembled particles from the extracellular medium or cell lysates. Preferably the cells are infected with the recombinant vector at a multiplicity of infection of from about 5 to about 10 plaque-forming units (PFUs). Preferably the VLP comprises at least one BRV protein. To form homologous VLP's, the cells are coinfected with vectors that comprise genes from the same BRV strain. Preferably, the vectors used to prepare a homologous VLP comprise the VP2, VP4, VP6, and VP7 genes from one of the following BRV strains: the IND strain, the 2292B strain, the Shintoku strain, the Cr strain, or the WD653 strain. To form heterologous VLPs, the cells are coinfected with vectors that comprise the VP2, VP4, VP6, and VP7 genes from different strains of rotavirus. For heterologous VLPs, it is preferred that the cells be coinfected with baculoviruses comprising the VP4 and VP7 genes from a single BRV strain, more preferably the IND strain, the 2292B strain, the Shintoku strain, or the WD653 strain.

EXAMPLE 15

A heterologous VLP was prepared by coinfecting Sf9 cells at a multiplicity of infection of 10 PFU per cell with baculovirus recombinants which comprised of genes encoding the core BRV proteins RF VP2, SA11 VP6, and the outer capsid proteins IND VP4, and IND VP7. The baculovirus recombinants comprising the IND VP4 protein and the IND VP7 protein were prepared as described in Examples 8 and 9, respectively. The baculovirus recombinants were prepared using rotavirus genes 2 and 6 obtained from Dr. M. K. Estes, Baylor College of Medicine, Houston, Tex. The infection was done in Hink's TNM-FH insect medium from JRH, Lenexa, Kans., containing 0.5% FBS. The cells and medium were harvested at 144 hours postinfection, and the medium was clarified by centrifugation for 10 minutes at 2,500 rpm in a Hermle centrifuge. The clarified medium was layered over a 35% sucrose cushion in TNC buffer and centrifuged for 90 minutes at 25,000 rpm in a Beckman SW28 rotor. The resulting pellet was suspended in TNC buffer containing 10 mM Tris-Cl, 140 mM NaCl, 10 mM CaCl.sub.2. Cesium chloride was added to the pellet to obtain a refractive index of 1.3640, and the mixture was centrifuged for 18 hours at 35,000 rpm in a Beckman SW50.1 rotor. The resulting cesium chloride gradients were fractionated, and fractions which contained the triple-layered VLPs were pooled. The VLPs were then concentrated by centrifugation for 2 hours at 35,000 rpm in a Beckman SW41 rotor, the supernatant removed, and the VLP pellet suspended in TNC buffer. Particle composition and integrity was determined by negative-stain electron microscopy (EM), Western blot, and ELISA.

Administering the VLP

0.5 ml of the VLP suspension of Example 10 was mixed with an equal volume of Freund's complete adjuvant and the entire amount injected into the multiple subcutaneous sites in each guinea pig. Two weeks later, booster injections of the same amount of suspension with an equal volume of Freund's incomplete adjuvant were administered. The same inoculum with adjuvant was administered intramusculary at three-week intervals after the second injection up to 4 times. The guinea pigs were bled at 3 and 7 weeks via cardiac puncture after the first injection. Serum samples were tested for the presence of virus neutralizing antibodies by PRVN assays and for the presence of antibodies to rotavirus by ELISA, western blot and immunofluorescence assays.

The PRVN test was performed in six well plates containing MA 104 cell monolayers to determine neutralizing antibody titers of the hyperimmune antisera to the VLP particles. Serial four fold dilutions of antisera were mixed with equal volumes of viral suspensions containing 60 to 80 PFU/0.1 ml and incubated for one hour at 37.degree. C. The plates were washed once with serum free Earle's Minimum Essential Medium, and agar medium containing 0.8% Noble agar, 0.067 mg of neutral red per ml, and 25 .mu.l of pancreatin from Gibco per ml in E-MEM was added. The PRVN titer was expressed as the reciprocal of the highest dilution of serum which produced an 80% reduction in the number of plaques, as compared with the number in virus control wells.

The PVRN titers for animals mock-infected baculovirus lysates were less than 4 and the PRVN titers for the animals inoculated with the VLP particles were approximately 3000 following 4 injections with the VLP suspension of Example 10.

__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 50- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1062 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: RNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- GGCUUUAAAA GCGAGAAUUU CCGUUUGGCU AGCGGUUACG UCCUUUUAAU GU - #AUGGUAUU 60- GAAUAUACCA CAAUUCUAAU CUUCUUGACA UCAGUUACAU UGCUAAAUUA UA - #UCUUAAAA 120- UCAAUAACAA GAGUAAUGGA CUAUAUAAUU UACAGAUUUC UGCUUAUAGU GG - #UAAUCUUG 180- GCCACCAUGA UAAAUGCGCA UAAUUAUGGA GUGAAUUUGC CAAUUACAGG UU - #CAAUGGAU 240- ACUGCAUACG CAAAUUCAUC GCAAAGUGAG CCAUUUUUAA CAUCAACUCU UU - #GUUUGUAU 300- UAUCCUGUUG AGGCAUCAAA CGAAAUAGCU GAUACUGAAU GGAAAGAUAC CU - #UAUCACUA 360- AUGUUCUUGA CAAAAGGAUG GCCAACAGGA UCGGUCUACU UUAAAGAAUA UA - #CUGAUAUA 420- GCGGCUUUUU CAGUAGAACC ACAGCUGUAC UGUGAUUAUA AUUUAGUUUU AA - #UGAAAUAU 480- GAUUCUACAC AGGAACUAGA UAUGUCUGAA UUAGCCGAUC UUAUACUGAA CG - #AAUGGCUG 540- UGCAAUCCCA UGGACAUAAC GUUGUAUUAU UAUCAGCAGA CUGAUGAAGC AA - #AUAAAUGG 600- AUAUCGAUGG GCUCUUCUUG CACAGUCAAA GUGUGUCCAU UAAAUACGCA GA - #CACUUGGU 660- AUUGGAUGUC UAAUAACUAA UCCAGACACG UUUGAAACAG UUGCGACAAC GG - #AGAAGUUG 720- GUGAUUACAG AUGUUGUAGA UGGUGUCAAC UAUAAGUUAA ACGUCACAAC AG - #CAACGUGU 780- ACCAUACGCA ACUGUCAAAA AUUAGGACCA AGGGAGAAUG UAGCUGUCAU AC - #AGGUAGGC 840- GGCGCGAAUA UUUUAGACAU CACAGCUGAU CCAACAACAU CACCACAGAC AG - #AGAGAAUG 900- AUGCGAAUAA AUUGGAAAAA AUGGUGGCAA GUAUUCUACA CAGUGGUGGA UU - #AUGUCAAU 960- CAAAUAAUUC AAACGAUGUC CAAAAGAUCU AGAUCGCUUA ACUCGUCAGC GU - #UCUAUUAC1020#1062 UUAG AUUAGAGUUG UAUGAUGUGA CC- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1062 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: RNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- GGCUUUAAAA GCGAGAAUUU CCGUUUGGCU AGCGGUUAGC UCCUUUUAAU GU - #AUGGUAUU 60- GAAUAUACCA CAUUCCUAAU CUACUUGAUA UCAAUUAUAU UACUUAAUUA CA - #UAUUAAAA 120- AGUAUAACUA GAAUGAUGGA GUACAUAAUU UACAAAUUUU UGCUUAUAGU CA - #CAAUUACU 180- UCAAUUGUUG UUAAUGCACA AAAUUACGGU AUCAAUUUAC CAAUAACCGG AU - #CAAUGGAU 240- ACAUCAUAUG UGAAUGCACC UAAAGAUGAG CCAUUUCUAA CGUCAACAUU AU - #GUUUAUAC 300- UAUCCAACAG AAGCUAGAAC AGAGAUAAAC GAUAAUGAGA GGACAAGUAC GU - #UGUCGCAG 360- CUGUUCUUAA CAAAGGGAUG GCCGACUGGA UCCGUAUACU UUAAAGAAUA UG - #AUGAUAUA 420- GCUACUUUCU CAGUGGAUCC ACAACUGUAU UGUGACUAUA AUAUAGUUCU GA - #UCAGAUAU 480- AAUUCGAGCC UAGAACUUGA UAUGUCGGAA UUAGCAAAUC UAAUAUUGAA UG - #AAUGGCUA 540- UGCAAUCCAA UGGACAUUAC AUUGUAUUAU UACCAACAGA CAGACGAGGC AA - #ACAUAUGG 600- AUAGCAAUGG GACAAUCAUG UACUAUAAAA GUGUGUCCAU UGAAUACCCA AA - #CGCUAGGA 660- AUAGGAUGUC AGACUACACA UACUGGAACG UUUGAAGAGG UCGCAACGGC UG - #AAAAAUUG 720- GUAAUUACUG AUGUAGUUGA CGGCGUAAAU CACAAACUAG AUGUUACUAC UG - #CGACCUGU 780- ACUAUUAGAA AUUGUAAGAA AUUGGGGCCA AGAGAAAAUG UAGCAGUGAU AC - #AACUGGGU 840- GGUGCUGAUA UCCUUGACAU AACAUCUGAU CCGACGACUA AUCCACAAAC UG - #AAUGGAUG 900- AUGCGAAUAA AUUGGAAGAA AUGGUGGCAA GUGUUCUACA CUAUAGUUGA UU - #ACGUGAAC 960- CAAAUUGUGC AAGCAAUGUC CAAGAGGUCC AGAUCACUGA AUUCAGCAGC GU - #UUUAUUAU1020#1062 GUAG GUUAGAGUUG UAUGAUGUGA CC- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1063 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: RNA (genomic)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- GGCAUUUAAA AAAGAAGGAG CUGUCUGACA AACUGGUCUU CUUUUUAAAU GG - #UUUGUACA 60- ACAUUGUACA CCGUUUGCGU GAUUCUCUGC AUUCUGCUAA UGUAUAUAAU AC - #UGUUCAGA 120- AAAAUGAUUC AUUUUCUAAU CGACUUGUCA CUUAUUGCUU UUGUAAUAUC AA - #GUUGCAUC 180- AGACUGUCUA AUGCUCAGUU UUUUGCUAAU GACAUGCUUU AUAAUGGUAA UG - #UUGAAGGU 240- GUAAUUAAUA CGACAAAUAU UUUUAAUGUU GAAUCUCUUU GCAUUUACUU UC - #CAAAUUCU 300- GCAGUGGGGC GACCUGGUCC AGGGAAGAGU GAUGGUUUGA UUAAUGACAA CA - #ACUACGCU 360- CAAACACUAG CAGUUCUUUU UGAAACAAAA GGAUUUCCUA AAGGAUCAGU GA - #AUUUUAAU 420- ACUUAUACUA AAAUAUCUGA CUUUAUAAAU UCAAUUGAAA UGACAUCUUC UU - #AUAACAUA 480- GUUAUAAUUC GUGAAACUCU AGCUAAUUCU GAAACGAUUG AACAAGUAGC UG - #AGUGGGUC 540- CUUAAUGUGU GGAAAUGUGA CAAUAUGAAU GUGGAUAUUU AUACUUAUGA AC - #AAAUAGGG 600- AAAGACAAUU UUUGGGCGGC AUUUGGUGAA GAUUGUGAUG UUGCGGUAUG UC - #CACUAGAC 660- ACAACAAUGA AUGGUAUCGG AUGUACGCCA GCAAGUACAG AGACGUAUGA AG - #UACUAUCA 720- AAUGACACUC AGUUGGCCCU UAUAGAUGUA GUGGAUAAUG UGAAACAUAG AA - #UACAACUG 780- AAUCAAGUAA CGUGUAAAUU GAGAAAUUGU GUGAAAGGUG AAGCAACACU UA - #ACACAGCG 840- AUUGUAAGAA UUUCGAACUU GUCCAGUUUU GAUAAUUCAU UGUCACCAUU GA - #AUAAUGGG 900- CAGAAGACAA GAUCCUUUAA AAUUAAUGCG AAGAAAUGGU GGAAAAUAUU CU - #AUACUAUA 960- AUUGAUUACA UUAAUACAUU CAUACAAUCU AUGACACCUA GGCACAGAGC CA - #UUUAUCCC1020# 106 - #3CGUAAACG AGAUUAUGUG GCU- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 752 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: RNA (genomic)- (iii) HYPOTHETICAL: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- AAATAATCAG AGATGGCGTT CGCTGCTTGT GCAAAAGCTC AATTAGTGAT TA - #CACCAATG 60- CAGCAATCCG GAGATTTGTG TGCTGCACGC TAGTACTGGA ATGTGGATAG TT - #TCGGACGA 120- CAACTTTACA AATATTTTTG AAACGTATAA TTCAGTAACT CTATCCTTTT TA - #CCGTATGA 180- TAGCACCAAC TATGATGTGA TTGATATTAT ATCTAAGAGA GATTATTCAC TG - #TGTCATAT 240- ATTGGCAATA GATGTCATAA AGCCTGAAAT GGATTTTATT ACGTTTCTTC AA - #TCAAATAA 300- TGAATGTTCA AAATATGCAG GGCAGAAAAT AGATTATCAA AAACTTTCAA CA - #AACGAAGA 360- ATGGTTTGTT TATTCAAAGA ATTTGAAATT CTGTCCACTA TCTGACAGCC TA - #ATCGGATT 420- GTATTGCGAT ACGCAGGTAA GTGGTACGTA TTTTCCATTA TCAGAGAATG AA - #AAATACGA 480- TGTTACGGAT CTACCAGAGT TTACAGAAAT GGGTTACGTC TTTTATTCGA AT - #GATGACTT 540- TTATATTTGT AAACGCATCA ATGAGGATAA TAAATGGTCG AATTATCATC TT - #TTTTACAG 600- AGAATACTCG GCATCAGGGA CGGTGTCAAG AGCTATCAGT TGGGACAACG TA - #TGGACTGG 660- TTTCAAGACA TTCGCGCAGG TTGTATATAA AATACTAGAT ATTTTTTTCA AC - #AATAGAAG 720# 752 GGCT TCGGCCTACT CG- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2240 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: RNA (genomic)- (iii) HYPOTHETICAL: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- AGCTTAAAAA AGTCAGGATC AATGGCGTCC TCACTTTACC GTCAGCTGAT AT - #CCCAGAAC 60- TATTATTCAA CTGGAAATGA AATACTACTG GATCAGCAAA CAAACAAAAC AA - #CTGTTGAT 120- TATGTAGATG CTGGGAATTA CACATATGCC CAGTTACCAC CAACAACGTG GG - #GAGCAGAG 180- TCGACATATG AATCTGCATT CAGCGCGCCA GAGATAACTG GACCATATAC AA - #ATACAGTC 240- ATAAAATTGA GTGATCTATC AGATTCGAAC GTATGGGTAT TATATCAGAA AC - #CAACTAGC 300- ACAGTTAAAT TGCTTAAAAA TGGACCAGAA AGTTATAGTT GGAACCTTGC AG - #CATTTGAA 360- TTATGGTATG GAAAGGCAAA TACAACGGTT ACATCAGATT ACTATTCAGG GA - #TGACAAAT 420- TCTGAAAAAA GTGTTGAGGT AGATCATGAT TCACTAGTAC TATTTTGGAA TG - #AAGGCTCA 480- ACAGCATTAA GTAACAAAGT GATCAATTTT TCCTGGAATG TTGGTGGCGT GT - #TAATTAAA 540- CTAACAAGTA ATACAAGGAT AGACATATGC ATGGCTAACA TGGATAATTT TA - #CTAGTGAT 600- AGCTTCAATT GGGAAGAATG GACACATAAT TTTCCTCGCA GTGCGAGCAT GA - #ACATTTAT 660- ACTGATTACT ACTTAGCTAG TGTAGATCCA TATAGTCAAA TAAGAGCATT AC - #AGCAACCA 720- ATAATAACAA CTGTTGAAAT GAAGATGGTG AAAGTTAAGA GAGAAGGATC AA - #TTAATGTA 780- GATGAAGTTG TAAGTAAGGA TTCATTATGG CAAGAGGTAA GGTACGTTAG AG - #ATATAACA 840- CTTCAGTGTA AAATTGAGTC TGAAGTTGTT AAAGGTGGTG GATGGGGTTA TG - #ACTATACT 900- AGCGTAGCCT TTAAAACCAT TAATCACACG TACTCTTATA CTAGAGCAGG AG - #AGGCTGTT 960- AATGCGCACG TTACAATTAG TTTTAACAAT TTGAAGGAAC GCTCATATGG AG - #GGTCATTA1020- CCAACTGATT TCAAAATTGG ACGGTTCGAC ATAATAGACG TTGATACATA CA - #TGTACATA1080- GATTATTGGG ATGACTCAGA AATCTTTAAA AATATGGTGT ATGTGCGTGA TT - #TGAGAGCT1140- GATATGGGTG GATTTAATTA CTCGTCAGCC ATGTCATACT ACTTTAGAAT TC - #CCGTTGGG1200- CAGTATCCTG GGTTGCATTC ATCAGGAGTA AGATTTACAT ATGAGAGGAG TC - #TATTATCT1260- CAACAATTTA CTGATCAGGT AGCGCTTAAT TCAATGAGAT TTGTGTTCAG AG - #CAACATCA1320- TCAGATGGTT GGTTTATGAC AGCAGGAAAT ATAAATGCAA GACGTATAGC GT - #CTGGAACA1380- GGATTTGCAT ATTCGGATGG TTATGTTACT GAAACTGTTG GGACGGTTTC GT - #TTATATCA1440- TTAATTCCAA GCAATCCAAA TTATCAGACA CCAATAGCTT CATCAAGTAC AG - #TGAGAATG1500- GATTTAGAAC GGAAGATTAA CGATCTACGT AATGATTTCA ATGAATTGGC TA - #GTTCTGTT1560- GCACTAGGTG ACATACTATC ACTAGCAATG TCTCCATTGA CCTTTGCTAA TC - #TACTTGAA1620- TCTGTTCCAG CAATTGCATC ATCTGTGAAA GATGTTGCGG CAAACGTCAT GA - #AAAAGTTT1680- AAAACGACGA AAATGTTTAA AAAAGCTGCA AAGCCAAAGT ATAAGGAATA TA - #TTATCGGA1740- GACTTGCTAG AAGATGTGAC AAATCTTCCA AGAAGTACTA CCGCAATGGA TT - #TTGATGAT1800- ATTACATCAG CAGTAATGGT TTCAACAACA AACAGGTTGC AGCTTACAGA TG - #TAGAAACG1860- CTGTCAGAAA TTGTAGCCAG ATCAGCAGAT GATTTCATAC CCAATAGAGC GT - #ATAGAATG1920- ATAGAGGATG GTATGGTGCA CGAAGCAACA CCTAATGGAG TTTTTTCTTA TG - #ATTTGGCT1980- ACTCTGCAGC AGAGGAATTT TGACATGGAA AAATTCATGC AGCTTGCGTC AA - #AATCACCA2040- GTAATATCAG CAATAGTAGA CTTTGCAACA TTAAAGGCTA TGAGAGATAC AT - #ATGGCGTT2100- AGTACAGACA TTATGTATAA ACTAGTGGCA TCAGATGCTC CGACAATAGT AT - #CATTCATT2160- AATAATAACA ATCCGCTGAT TAGAAATAGA ATAGAAGGAT TGTTGAGACA AT - #GTAGAATA2220# 224 - #0- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 326 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Met Tyr Gly Ile Glu Tyr Thr Thr Ile Leu Il - #e Phe Leu Thr Ser Val# 15- Thr Leu Leu Asn Tyr Ile Leu Lys Ser Ile Th - #r Arg Val Met Asp Tyr# 30- Ile Ile Tyr Arg Phe Leu Leu Ile Val Val Il - #e Leu Ala Thr Met Ile# 45- Asn Ala His Asn Tyr Gly Val Asn Leu Pro Il - #e Thr Gly Ser Met Asp# 60- Thr Ala Tyr Ala Asn Ser Ser Gln Ser Glu Pr - #o Phe Leu Thr Ser Thr#80- Leu Cys Leu Tyr Tyr Pro Val Glu Ala Ser As - #n Glu Ile Ala Asp Thr# 95- Glu Trp Lys Asp Thr Leu Ser Leu Met Phe Le - #u Thr Lys Gly Trp Pro# 110- Thr Gly Ser Val Tyr Phe Lys Glu Tyr Thr As - #p Ile Ala Ala Phe Ser# 125- Val Glu Pro Gln Leu Tyr Cys Asp Tyr Asn Le - #u Val Leu Met Lys Tyr# 140- Asp Ser Thr Gln Glu Leu Asp Met Ser Glu Le - #u Ala Asp Leu Ile Leu145 1 - #50 1 - #55 1 -#60- Asn Glu Trp Leu Cys Asn Pro Met Asp Ile Th - #r Leu Tyr Tyr Tyr Gln# 175- Gln Thr Asp Glu Ala Asn Lys Trp Ile Ser Me - #t Gly Ser Ser Cys Thr# 190- Val Lys Val Cys Pro Leu Asn Thr Gln Thr Le - #u Gly Ile Gly Cys Leu# 205- Ile Thr Asn Pro Asp Thr Phe Glu Thr Val Al - #a Thr Thr Glu Lys Leu# 220- Val Ile Thr Asp Val Val Asp Gly Val Asn Ty - #r Lys Leu Asn Val Thr225 2 - #30 2 - #35 2 -#40- Thr Ala Thr Cys Thr Ile Arg Asn Cys Gln Ly - #s Leu Gly Pro Arg Glu# 255- Asn Val Ala Val Ile Gln Val Gly Gly Ala As - #n Ile Leu Asp Ile Thr# 270- Ala Asp Pro Thr Thr Ser Pro Gln Thr Glu Ar - #g Met Met Arg Ile Asn# 285- Trp Lys Lys Trp Trp Gln Val Phe Tyr Thr Va - #l Val Asp Tyr Val Asn# 300- Gln Ile Ile Gln Thr Met Ser Lys Arg Ser Ar - #g Ser Leu Asn Ser Ser305 3 - #10 3 - #15 3 -#20- Ala Phe Tyr Tyr Arg Val 325- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 326 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- Met Tyr Gly Ile Glu Tyr Thr Thr Phe Leu Il - #e Tyr Leu Ile Ser Ile# 15- Ile Leu Leu Asn Tyr Ile Leu Lys Ser Ile Th - #r Arg Met Met Glu Tyr# 30- Ile Ile Tyr Lys Phe Leu Leu Ile Val Thr Il - #e Thr Ser Ile Val Val# 45- Asn Ala Gln Asn Tyr Gly Ile Asn Leu Pro Il - #e Thr Gly Ser Met Asp# 60- Thr Ser Tyr Val Asn Ala Pro Lys Asp Glu Pr - #o Phe Leu Thr Ser Thr#80- Leu Cys Leu Tyr Tyr Pro Thr Glu Ala Arg Th - #r Glu Ile Asn Asp Asn# 95- Glu Arg Thr Ser Thr Leu Ser Gln Leu Phe Le - #u Thr Lys Gly Trp Pro# 110- Thr Gly Ser Val Tyr Phe Lys Glu Tyr Asp As - #p Ile Ala Thr Phe Ser# 125- Val Asp Pro Gln Leu Tyr Cys Asp Tyr Asn Il - #e Val Leu Met Arg Tyr# 140- Asn Ser Ser Leu Glu Leu Asp Met Ser Glu Le - #u Ala Asn Leu Ile Leu145 1 - #50 1 - #55 1 -#60- Asn Glu Trp Leu Cys Asn Pro Met Asp Ile Th - #r Leu Tyr Tyr Tyr Gln# 175- Gln Thr Asp Glu Ala Asn Ile Trp Ile Ala Me - #t Gly Gln Ser Cys Thr# 190- Ile Lys Val Cys Pro Leu Asn Thr Gln Thr Le - #u Gly Ile Gly Cys Gln# 205- Thr Thr His Thr Gly Thr Phe Glu Glu Val Al - #a Thr Ala Glu Lys Leu# 220- Val Ile Thr Asp Val Val Asp Gly Val Asn Hi - #s Lys Leu Asp Val Thr225 2 - #30 2 - #35 2 -#40- Thr Ala Thr Cys Thr Ile Arg Asn Cys Lys Ly - #s Leu Gly Pro Arg Glu# 255- Asn Val Ala Val Ile Gln Val Gly Gly Ala As - #p Ile Leu Asp Ile Thr# 270- Ser Asp Pro Thr Thr Asn Pro Gln Thr Glu Tr - #p Met Met Arg Ile Asn# 285- Trp Lys Lys Trp Trp Gln Val Arg Tyr Thr Il - #e Val Asp Tyr Val Asn# 300- Gln Ile Val Gln Ala Met Ser Lys Arg Ser Ar - #g Ser Leu Asn Ser Ala305 3 - #10 3 - #15 3 -#20- Ala Phe Tyr Tyr Arg Val 325- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 332 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (iii) HYPOTHETICAL: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Met Val Cys Thr Thr Leu Tyr Thr Val Cys Va - #l Ile Leu Cys Ile Leu# 15- Leu Met Tyr Ile Ile Leu Phe Arg Lys Met Il - #e His Phe Leu Ile Asp# 30- Leu Ser Leu Ile Ala Phe Val Ile Ser Ser Cy - #s Ile Arg Leu Ser Asn# 45- Ala Gln Phe Phe Ala Asn Asp Met Leu Tyr As - #n Gly Asn Val Glu Gly# 60- Val Ile Asn Thr Thr Asn Ile Phe Asn Val Gl - #u Ser Leu Cys Ile Tyr#80- Phe Pro Asn Ser Ala Val Gly Arg Pro Gly Pr - #o Gly Lys Ser Asp Gly# 95- Leu Ile Asn Asp Asn Asn Tyr Ala Gln Thr Le - #u Ala Val Leu Phe Glu# 110- Thr Lys Gly Phe Pro Lys Gly Ser Val Asn Ph - #e Asn Thr Tyr Thr Lys# 125- Ile Ser Asp Phe Ile Asn Ser Ile Glu Met Th - #r Cys Ser Tyr Asn Ile# 140- Val Ile Ile Pro Glu Thr Leu Ala Asn Ser Gl - #u Thr Ile Glu Gln Val145 1 - #50 1 - #55 1 -#60- Ala Glu Trp Val Leu Asn Val Trp Lys Cys As - #p Asn Met Asn Val Asp# 175- Ile Tyr Thr Tyr Glu Gln Ile Gly Lys Asp As - #n Phe Trp Ala Ala Phe# 190- Gly Glu Asp Cys Asp Val Ala Val Cys Pro Le - #u Asp Thr Thr Met Asn# 205- Gly Ile Gly Cys Thr Pro Ala Ser Thr Glu Th - #r Tyr Glu Val Leu Ser# 220- Asn Asp Thr Gln Leu Ala Leu Ile Asp Val Va - #l Asp Asn Val Lys His225 2 - #30 2 - #35 2 -#40- Arg Ile Gln Leu Asn Gln Val Thr Cys Lys Le - #u Arg Asn Cys Val Lys# 255- Gly Glu Ala Arg Leu Asn Thr Ala Ile Val Ar - #g Ile Ser Asn Leu Ser# 270- Ser Phe Asp Asn Ser Leu Ser Pro Leu Asn As - #n Gly Gln Lys Thr Arg# 285- Ser Phe Lys Ile Asn Ala Lys Lys Trp Trp Ly - #s Ile Phe Tyr Thr Ile# 300- Ile Asp Tyr Ile Asn Thr Phe Ile Gln Ser Me - #t Thr Pro Arg His Arg305 3 - #10 3 - #15 3 -#20- Ala Ile Tyr Pro Glu Gly Trp Met Leu Arg Ty - #r Ala# 330- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 248 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (iii) HYPOTHETICAL: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- Met Ala Phe Ile Ala Ser Arg Leu Ala Ala Cy - #s Ala Lys Ala Gln Leu# 15- Val Ile Thr Pro Ile Ser Asn Pro Glu Ile Cy - #s Val Leu His Ala Ser# 30- Thr Gly Met Trp Ile Val Ser Asp Asp Asn Ph - #e Thr Asn Ile Phe Glu# 45- Thr Tyr Asn Ser Val Thr Leu Ser Phe Leu Pr - #o Tyr Asp Ser Thr Asn# 60- Tyr Asp Val Ile Asp Ile Ile Ser Lys Arg As - #p Tyr Ser Leu Cys His#80- Ile Leu Ala Ile Asp Val Ile Lys Pro Glu Me - #t Asp Phe Ile Thr Phe# 95- Leu Gln Ser Asn Asn Glu Cys Ser Lys Tyr Al - #a Gly Gln Lys Ile Asp# 110- Tyr Gln Lys Leu Ser Thr Asn Glu Glu Trp Ph - #e Val Tyr Ser Lys Asn# 125- Leu Lys Phe Cys Pro Leu Ser Asp Ser Leu Il - #e Gly Leu Tyr Cys Asp# 140- Thr Gln Val Ser Gly Thr Tyr Phe Pro Leu Se - #r Glu Asn Glu Lys Tyr145 1 - #50 1 - #55 1 -#60- Asp Val Thr Asp Leu Pro Glu Phe Thr Glu Me - #t Gly Tyr Val Phe Tyr# 175- Ser Asn Asp Asp Phe Tyr Ile Cys Lys Arg Il - #e Asn Glu Asp Asn Lys# 190- Trp Ser Asn Tyr His Leu Phe Tyr Arg Glu Ty - #r Ser Ala Ser Gly Thr# 205- Val Ser Arg Ala Ile Ser Trp Asp Asn Val Tr - #p Thr Gly Phe Lys Thr# 220- Phe Ala Gln Val Val Tyr Lys Ile Leu Asp Il - #e Phe Phe Asn Asn Arg225 2 - #30 2 - #35 2 -#40- Arg Asn Pro Gly Pro Arg Ala Met 245- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 640 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (iii) HYPOTHETICAL: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- Met Ala Ser Ser Leu Tyr Arg Gln Leu Ile Se - #r Gln Asn Tyr Tyr Ser# 15- Thr Gly Asn Glu Ile Leu Leu Asp Gln Gln Th - #r Asn Lys Thr Thr Val# 30- Asp Tyr Val Asp Ala Gly Asn Tyr Thr Tyr Al - #a Gln Leu Pro Pro Thr# 45- Thr Trp Gly Ala Glu Ser Thr Tyr Glu Ser Al - #a Phe Ser Ala Pro Glu# 60- Ile Thr Gly Pro Tyr Thr Asn Thr Val Ile Ly - #s Leu Ser Asp Leu Ser#80- Asp Ser Asn Val Trp Val Leu Tyr Gln Lys Pr - #o Thr Ser Thr Val Lys# 95- Leu Leu Lys Asn Gly Pro Glu Ser Tyr Ser Tr - #p Asn Leu Ala Ala Phe# 110- Glu Leu Trp Tyr Gly Lys Ala Asn Thr Thr Va - #l Thr Ser Asp Tyr Tyr# 125- Ser Gly Met Thr Asn Ser Glu Lys Ser Val Gl - #u Val Asp His Asp Ser# 140- Leu Val Leu Phe Trp Asn Glu Gly Ser Thr Al - #a Leu Ser Asn Lys Val145 1 - #50 1 - #55 1 -#60- Ile Asn Phe Ser Trp Asn Val Gly Gly Val Le - #u Ile Lys Leu Thr Ser# 175- Asn Thr Arg Ile Asp Ile Cys Met Ala Asn Me - #t Asp Asn Phe Thr Ser# 190- Asp Ser Phe Asn Trp Glu Glu Trp Thr His As - #n Phe Pro Arg Ser Ala# 205- Ser Met Asn Ile Tyr Thr Asp Tyr Tyr Leu Al - #a Ser Val Asp Pro Tyr# 220- Ser Gln Ile Arg Ala Leu Gln Gln Pro Ile Il - #e Thr Thr Val Glu Met225 2 - #30 2 - #35 2 -#40- Lys Met Val Lys Val Lys Arg Glu Gly Ser Il - #e Asn Val Asp Glu Val# 255- Val Ser Lys Asp Ser Leu Trp Gln Glu Val Ar - #g Tyr Val Arg Asp Ile# 270- Thr Leu Gln Cys Lys Ile Glu Ser Glu Val Va - #l Lys Gly Gly Gly Trp# 285- Gly Tyr Asp Tyr Thr Ser Val Ala Phe Lys Th - #r Ile Asn His Thr Tyr# 300- Ser Tyr Thr Arg Ala Gly Glu Ala Val Asn Al - #a His Val Thr Ile Ser305 3 - #10 3 - #15 3 -#20- Phe Asn Asn Leu Lys Glu Arg Ser Tyr Gly Gl - #y Ser Leu Pro Thr Asp# 335- Phe Lys Ile Gly Arg Phe Asp Ile Ile Asp Va - #l Asp Thr Tyr Met Tyr# 350- Ile Asp Tyr Trp Asp Asp Ser Glu Ile Phe Ly - #s Asn Met Val Tyr Val# 365- Arg Asp Leu Arg Ala Asp Met Gly Gly Phe As - #n Tyr Ser Ser Ala Met# 380- Ser Tyr Tyr Phe Arg Ile Pro Val Gly Gln Ty - #r Pro Gly Leu His Ser385 3 - #90 3 - #95 4 -#00- Ser Gly Val Arg Phe Thr Tyr Glu Arg Ser Le - #u Leu Ser Gln Gln Phe# 415- Thr Asp Gln Val Ala Leu Asn Ser Met Arg Ph - #e Val Phe Arg Ala Thr# 430- Ser Ser Asp Gly Trp Phe Met Thr Ala Gly As - #n Ile Asn Ala Arg Arg# 445- Ile Ala Ser Gly Thr Gly Phe Ala Tyr Ser As - #p Gly Tyr Val Thr Glu# 460- Thr Val Gly Thr Val Ser Phe Ile Ser Leu Il - #e Pro Ser Asn Pro Asn465 4 - #70 4 - #75 4 -#80- Tyr Gln Thr Pro Ile Ala Ser Ser Ser Thr Va - #l Arg Met Asp Leu Glu# 495- Arg Lys Ile Asn Asp Leu Arg Asn Asp Phe As - #n Glu Leu Ala Ser Ser# 510- Val Ala Leu Gly Asp Ile Leu Ser Leu Ala Me - #t Ser Pro Leu Thr Phe# 525- Ala Asn Leu Leu Glu Ser Val Pro Ala Ile Al - #a Ser Ser Val Lys Asp# 540- Val Ala Ala Asn Val Met Lys Lys Phe Lys Th - #r Thr Lys Met Phe Lys545 5 - #50 5 - #55 5 -#60- Lys Ala Ala Lys Pro Lys Tyr Lys Glu Tyr Il - #e Ile Gly Asp Leu Leu# 575- Glu Asp Val Thr Asn Leu Pro Arg Ser Thr Th - #r Ala Met Asp Phe Asp# 590- Asp Ile Thr Ser Ala Val Met Val Ser Thr Th - #r Asn Arg Leu Gln Leu# 605- Thr Asp Val Glu Thr Leu Ser Glu Ile Val Al - #a Arg Ser Ala Asp Asp# 620- Phe Ile Pro Asn Arg Ala Tyr Arg Met Ile Gl - #u Asp Gly Met Val His625 6 - #30 6 - #35 6 -#40- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2363 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: RNA (genomic)- (iii) HYPOTHETICAL: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- GGCTATAAAA TGGCTTGGCT CATATACAGA CAGCTGCTCG ATCATTCTTA CG - #CAGTAGAT 60- TTATCTGATG AGATACAGTC AGTTGGATCA GAGAAGAACC AACGCGTTAC AG - #TGAATCCA 120- GGACCATTTG CGCAGACAGG ATATGCGCCA GTGAACTGGG GGCCCGGTGA AG - #TGAATGAC 180- TCGACTGTAG TACAACCTGT GTCGGATGGA CCGTATCAAC CAGCGTCGTT TG - #ATCTACCA 240- GTAGGAAATT GGATGTTGTT AGCGCCAACA GGACCAGGTG TGGTAGTGGA AG - #GAACAGAC 300- AATTCTGGCA GATGGTTATC CGNAATTCTA ATTGAGCCAG GTGTCACATC AG - #AGACAAGA 360- ACGTATACGA TGTTTGGATC AAGTAAACAG ATGTTAGTGT CGAACGTGTC TG - #ATACGAAA 420- TGGAAATTTG TTGAAATGAT GAAGGCGGAG GTTGATGGTG ACTATGCGGA GT - #GGGGAACA 480- TTATTATCGG ACACCAAGCT CTATGGGATG ATGAAATATG GGGAGAGACT AT - #TCATATAC 540- GAAGGAGAAA CCCCAAATGC CACGACCAAC GGATACATCG TAACGAATTA TG - #CATCAGTT 600- GAGGTAAGGC CATATAGTGA CTTTTATATA ATTTCCAGAT CACAGGAGTC GG - #AGTGCACT 660- GAATATATAA ACAACGGGCT GCCACCCATT CAAAATACCA GAAATGTAGT GC - #CTGTGGCA 720- ATATCGTCAA GATCAATTAA ACCAAGAGAA GTCCAAGCTA ATGAAGATAT TG - #TAGTTTCT 780- AAAACCTCAC TATGGAAAGA AATGCAATAT AATAGAGATA TCATAATTAG AT - #TCAAGTTT 840- GATAACTCGA TAATAAAATC TGGAGGTTTG GGCTATAAGT GGGCTGAAAT CT - #CATTTAAA 900- GCTGCAAATT ATCAATACAA TTACATAAGA GACGGAGAAG AAGTCACAGC GC - #ATACGACG 960- TGCTCAGTTA ATGGTCTTAA TGATTTTAGC TTTAACGGAG GCTCATTACC AA - #CGGATTTC1020- GCAATATCGA GATATGAAGT AATTAAAGAA AATTCGTATG TATACGTGGA CT - #ACTGGGAC1080- GATTCACAAG CATCCAGGAA TCTGGTCTAC GTACTATTAT TAGCAGCGAA TT - #TGAATGAC1140- GTAATGTGTT CTGGTGGAGA TTATAGCTTC GCTTTACCTG TTCCACAGTG GC - #CAGTGATC1200- AAACCAGGGA CGGTGACGTT GCACACAGCG GGAGTAACAT TATCTACACA AT - #TCACCGAC1260- TTCGTATCAC TGAATTCACT AAGATTTAGG TTTAGACTGG CGGTCGAGGA AC - #CCTCATTC1320- ACGATAACCA GAACACGTGT GTCAAAGCCG TATGGCCTAC CAGCAGCCAA CC - #CAAACGGC1380- GGAAAAGAGT CCTATGAAGT GGCTGGAAGG TTTCCGTTCA ATTCATTGGT GC - #CATCAAAT1440- GACGATTACC CAACGCCAAT TACGAACTCA GTAACAGTAA GGCAAGCATT GG - #AAAGGCGC1500- TTAAATGAAT CGAGAGAAGA ATTCAATAAC TTGTCACAAG AGACAGCCGT GT - #CACAGTTA1560- ATTGACTTAG CTATGTGGCC ACTAGACATG TTTCCGATGT TCTCGGAAAT TG - #AGAGTACC1620- GTGATTGCAG CAAAACCAAT GGCTACCAAT GTGATGAGGA AGCTTAAGAG TT - #CAAAACTC1680- GCGTCACCAG TGTCGATGTT AAGCGACTCT TTATCCGATG CGGCCTACTC TA - #TCGCAAGA1740- AGTACACCAG TACGATCAAT AGGACCAACA GCATCACGTT GGGCTAATAT TC - #CAGAACAG1800- ACACAAGACG CTGTTAGTGA AGTTGCCACA ATATCATCAC AAGTGTCACA AA - #TAAGTCCA1860- AAATTAAGAT TGAAAGAAAT TCCGACTCCA ACAGAGGGAT TGAATTTCGA TG - #ACATATCA1920- CGGCGGTATT CAAAAGCCAA GATAGAAAGA TCAATACAGG TCGCCCCAAA TG - #CATTACCA1980- GACGTCATCA CAGAAGCGTC AGAGAAATTC ATCCGTAATA GGGCGTATAG AG - #TAATAGAC2040- GGGGATGAAG CATTTGAGGC GGGCACTGAC GGAAGATTTT TCGCGTACAG GG - #TGGAAACG2100- CTTGAGGAAA TGCCATTCAA TATAGAAAAA TTTGCAGACT TAGTTACCAA CT - #CACCAGTG2160- ATATCAGCAA TAATAGACTT TAAGACATTG AAAAACCTGA ATGACAATTA TG - #GGATAACT2220- AGAGAGCAAG CATTTAGTTT GTTACGGTCA GACCCAAAAG TTTTGCGTGG AT - #TTATCGCC2280- CAAAACAATC CAATTATAAA AAATAGGATA GAACAGTTGA TCATGCAATG TA - #GATTGTGA2340# 2363GTGA ACC- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 475 base (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: RNA (genomic)- (iii) HYPOTHETICAL: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- CCATATACAC CAGATAGTTC ATTCTTGCCA TCTAACTATT GGTATTTAGT CA - #ATCCATCG 60- AATGACGGTG TGGCGTTCTC AGTAACGGAT AACAGCACGT CTTGGATGTT TA - #CTTATCTA 120- GCCTTACCAA ATACAGCTCA GACTAATGTC ACAGTAAATG TGTTGAATGA GA - #CAGTGAAT 180- ATATCAATAG ACAATTCGGG CTCGACATAT AGGTTTGTGG ATTACATTAA GA - #CTAGCTCC 240- ACACAAGCGT ATGGATCGAG GAACTATCTA AATACTGCAC ATAGATTACA AG - #CTTACAGA 300- AGAGATGGAG ATGGAAATAT ATCAAATTAT TGGGGTGCGG ATACACAAGG TG - #ACTTAAGG 360- GTTGGGACAT ATTCTAATCC GGTGCCAAAT GCAGTGATCA ATCTAAATGC AG - #ATTTTTAC 420- GTCATACCAG ATTCGCAACA AGAGATATGT ACAGAATACA TAAGGGGAGG AT - #TGC 475- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 13 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: YES- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:# 13- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:# 15- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:# 36 GGCT ATAAAATGGC TTGGCT- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 33 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:# 33 TACA TCCTCCAGAA GCT- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:# 17 C- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:# 18 TA- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 36 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:# 36 GGCT TTAAAAGCGA GAATTT- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:# 24GGCA GGTC- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:# 19 CGT- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:# 19 CTA- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:# 19 CGT- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:# 19 CTA- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:# 20 TCAC- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:# 20 TTTC- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:# 23AAGC TGT- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:# 22TAC GC- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:# 20 CGTT- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:# 20 TTAT- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:#21 ACCA C- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:# 17 C- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:# 20 GATC- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:# 18 CT- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:# 18 CT- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:# 17 C- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:# 18 TC- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:# 20 GATC- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:# 20 GAAG- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (iii) HYPOTHETICAL: NO- (iv) ANTI-SENSE: YES- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:# 19 CAA- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 776 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (iii) HYPOTHETICAL: NO- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:- Met Ala Trp Leu Ile Tyr Arg Gln Leu Leu As - #p Asn Ser Tyr Ala Val# 15- Asp Leu Ser Asp Glu Ile Gln Ser Val Gly Se - #r Glu Lys Asn Gln Arg# 30- Val Thr Val Asn Pro Gly Pro Phe Ala Gln Th - #r Gly Tyr Ala Pro Val# 45- Asn Trp Gly Pro Gly Glu Val Asn Asp Ser Th - #r Val Val Gln Pro Val# 60- Ser Asp Gly Pro Tyr Gln Pro Ala Ser Phe As - #p Leu Pro Val Gly Asn#80- Trp Met Leu Leu Ala Pro Thr Gly Pro Gly Va - #l Val Val Glu Gly Thr# 95- Asp Asn Ser Gly Arg Trp Leu Ser Xaa Ile Le - #u Ile Glu Pro Gly Val# 110- Thr Ser Glu Thr Arg Thr Tyr Thr Met Phe Gl - #y Ser Ser Lys Gln Met# 125- Leu Val Ser Asn Val Ser Asp Thr Lys Trp Ly - #s Phe Val Glu Met Met# 140- Lys Ala Glu Val Asp Gly Asp Tyr Ala Glu Tr - #p Gly Thr Leu Leu Ser145 1 - #50 1 - #55 1 -#60- Asp Thr Lys Leu Tyr Gly Met Met Lys Tyr Gl - #y Glu Arg Leu Phe Ile# 175- Tyr Glu Gly Glu Thr Pro Asn Ala Thr Thr As - #n Gly Tyr Ile Val Thr# 190- Asn Tyr Ala Ser Val Glu Val Arg Pro Tyr Se - #r Asp Phe Tyr Ile Ile# 205- Ser Arg Ser Gln Glu Ser Glu Cys Thr Glu Ty - #r Ile Asn Asn Gly Leu# 220- Pro Pro Ile Gln Asn Thr Arg Asn Val Val Pr - #o Val Ala Ile Ser Ser225 2 - #30 2 - #35 2 -#40- Arg Ser Ile Lys Pro Arg Glu Val Gln Ala As - #n Glu Asp Ile Val Val# 255- Ser Lys Thr Ser Leu Trp Lys Glu Met Gln Ty - #r Asn Arg Asp Ile Ile# 270- Ile Arg Phe Lys Phe Asp Asn Ser Ile Ile Ly - #s Ser Gly Gly Leu Gly# 285- Tyr Lys Trp Ala Glu Ile Ser Phe Lys Ala Al - #a Asn Tyr Gln Tyr Asn# 300- Tyr Ile Arg Asp Gly Glu Glu Val Thr Ala Hi - #s Thr Thr Cys Ser Val305 3 - #10 3 - #15 3 -#20- Asn Gly Leu Asn Asp Phe Ser Phe Asn Gly Gl - #y Ser Leu Pro Thr Asp# 335- Phe Ala Ile Ser Arg Tyr Glu Val Ile Lys Gl - #u Asn Ser Tyr Val Tyr# 350- Tyr Asp Tyr Trp Asp Asp Ser Gln Ala Ser Ar - #g Asn Leu Val Tyr Val# 365- Leu Leu Leu Ala Ala Asn Leu Asn Asp Val Me - #t Cys Ser Gly Gly Asp# 380- Tyr Ser Phe Ala Leu Pro Val Pro Gln Trp Ph - #e Val Ile Lys Pro Gly385 3 - #90 3 - #95 4 -#00- Thr Val Thr Leu His Thr Ala Gly Val Thr Le - #u Ser Thr Gln Phe Thr# 415- Asp Phe Val Ser Leu Asn Ser Leu Arg Phe Ar - #g Phe Arg Leu Ala Val# 430- Glu Glu Pro Ser Phe Thr Ile Thr Arg Thr Ar - #g Val Ser Lys Pro Tyr# 445- Gly Leu Pro Ala Ala Asn Pro Asn Gly Gly Ly - #s Glu Ser Tyr Glu Val# 460- Ala Gly Arg Phe Pro Phe Asn Ser Leu Val Pr - #o Ser Asn Asp Asp Tyr465 4 - #70 4 - #75 4 -#80- Pro Thr Pro Ile Thr Asn Ser Val Thr Val Ar - #g Gln Ala Leu Glu Arg# 495- Arg Leu Asn Glu Ser Arg Glu Glu Phe Asn As - #n Leu Ser Gln Glu Thr# 510- Ala Val Ser Gln Leu Ile Asp Leu Ala Met Tr - #p Pro Leu Asp Met Phe# 525- Pro Met Phe Ser Glu Ile Glu Ser Thr Val Il - #e Ala Ala Lys Pro Met# 540- Ala Thr Asn Val Met Arg Lys Leu Lys Ser Se - #r Lys Leu Ala Ser Pro545 5 - #50 5 - #55 5 -#60- Val Ser Met Leu Ser Asp Ser Leu Ser Asp Al - #a Ala Tyr Ser Ile Ala# 575- Arg Ser Thr Pro Val Arg Ser Ile Gly Pro Th - #r Ala Ser Arg Trp Ala# 590- Asn Ile Pro Glu Gln Thr Gln Asp Ala Val Se - #r Glu Val Ala Thr Ile# 605- Ser Ser Gln Val Ser Gln Ile Ser Pro Lys Le - #u Arg Leu Lys Glu Ile# 620- Pro Thr Pro Thr Glu Gly Leu Asn Phe Asp As - #p Ile Ser Arg Arg Tyr625 6 - #30 6 - #35 6 -#40- Ser Lys Ala Lys Ile Glu Arg Ser Ile Gln Va - #l Ala Pro Asn Ala Leu# 655- Pro Asp Val Ile Thr Glu Ala Ser Lys Glu Ph - #e Ile Arg Asn Arg Ala# 670- Tyr Arg Val Ile Asp Gly Asp Glu Ala Phe Gl - #u Ala Gly Thr Asp Gly# 685- Arg Phe Phe Ala Tyr Arg Val Glu Thr Leu Gl - #u Glu Met Pro Phe Asn# 700- Ile Glu Lys Phe Ala Asp Leu Val Thr Asn Se - #r Pro Val Ile Ser Ala705 7 - #10 7 - #15 7 -#20- Ile Ile Asp Phe Lys Thr Leu Lys Asn Leu As - #n Asp Asn Tyr Gly Ile# 735- Thr Arg Glu Gln Ala Phe Ser Leu Leu Arg Se - #r Asp Pro Lys Val Leu# 750- Arg Gly Phe Ile Ala Gln Asn Asn Pro Ile Il - #e Lys Asn Arg Ile Glu# 765- Gln Leu Ile Met Gln Cys Arg Leu# 775- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:# 18 TG- (2) INFORMATION FOR SEQ ID NO:43:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 19 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:# 19 TTC- (2) INFORMATION FOR SEQ ID NO:44:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:# 18 TG- (2) INFORMATION FOR SEQ ID NO:45:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:# 20 TTAC- (2) INFORMATION FOR SEQ ID NO:46:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:# 18 TT- (2) INFORMATION FOR SEQ ID NO:47:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:# 24CAGT TTTG- (2) INFORMATION FOR SEQ ID NO:48:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:#21 CTAG C- (2) INFORMATION FOR SEQ ID NO:49:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:# 18 GA- (2) INFORMATION FOR SEQ ID NO:50:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 15 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:# 15__________________________________________________________________________

Claims

1. A bovine rotavirus gene encoding a bovine rotavirus protein having a sequence selected from the group consisting of SEQ. ID. NO. 6, SEQ. ID. NO. 7, SEQ. ID. NO. 9, and SEQ. ID. NO. 41.

2. The bovine rotavirus gene of claim 1, wherein the gene comprises a nucleotide sequence selected from the group consisting of SEQ. ID. NO. 1, SEQ. ID. NO. 2, SEQ. ID. NO. 4, and SEQ. ID. NO. 11.

3. The bovine rotavirus gene of claim 1 wherein the gene encodes a protein having the sequence set forth in SEQ. ID. NO. 6.

4. The bovine rotavirus gene of claim 1 wherein the gene encodes a protein having the sequence set forth in SEQ. ID. NO. 7.

5. The bovine rotavirus gene of claim 1 wherein the gene encodes a protein having the sequence set forth in SEQ. ID. NO. 9.

6. The bovine rotavirus gene of claim 1 wherein the gene encodes a protein having the sequence set forth in SEQ. ID. NO. 41.

7. The bovine rotavirus gene of claim 1 wherein the gene comprises the sequence set forth in SEQ. ID. NO. 1.

8. The bovine rotavirus gene of claim 1 wherein the gene comprises the sequence set forth in SEQ. ID. NO. 2.

9. The bovine rotavirus gene of claim 1 wherein the gene comprises the sequence set forth in SEQ. ID. NO. 4.

10. The bovine rotavirus gene of claim 1 wherein the gene comprises the sequence set forth in SEQ. ID. NO. 11.