The present invention belongs to the biotechnology field, especially to methods for detecting infectious diseases.
The incidence of hospital infections by opportunistic fungal pathogens has increased substantially in the last two decades, especially among patients immuno-suppressed or serious underlying diseases. Candidas are the most common fungal pathogens affecting humans. Several epidemiologic studies around the world report that the invasive infections with Candidas have increased. Therefore, for example the Center for Disease Control and Prevention (CDC) is requiring sensitive, specific and rapid detection and identification methods for this kind of fungi.
Although more than 100 Candida species are known, only four are responsible for about 95% hematological infections and 95-97% of invasive infections caused by Candida in US hospitals.
In the case of hematological infections the most frequent species are: Candida albicans (45.6%), Candida glabrata (26%), Candida parapsilosis (15.7%) and Candida tropicalis (8.1%). These proportions vary depending on the patient's condition, but are the same four species causing 95% of overall candidiasis.
Current detection methods are imprecise and take several days for determining the kind of Candida in biological samples. This provokes that the patient's treatment is inadequate and the mortality in hospitals is increased as well as health care costs. Molecular detection methods based on ITS or rDNA sequences usually have a high incidence of false positive or negative results because of the close phylogenetic relation among the different Candida species. Also, further analysis is required, since the ITS or rDNA sequences are of similar size and should be re-sequenced before a final result is provided. Examples of these kind of inventions are disclosed in EP2235214B1, AU2014202147A1, CN103740834A, US2013309683A1, which are incorporated only as reference and should not be considered as prior art for the instant invention.
Additionally, molecular methods detecting several Candida species have been designed, wherein there is a common oligonucleotide and an additional oligonucleotide specie specific, however these methods also need further analysis in order to differentiate each specie. Examples of such inventions are disclosed in CA2407226C, EP1960536B1, EP2315853B1, US8501408B2, US2013034856A1, which are incorporated only as reference and should not be considered as prior art for the instant invention.
Buchman et al. were the first to describe the use of PCR for identification of C. albicans in clinical samples (Buchman et al., Surgery 108:338-47 (1990)). These researchers used PCR to amplify part of a specific gene encoding cytochrome lanosterol 14-alpha demethylase. The predicted PCR product was approximately 240 bp, however unexplained amplification patterns were observed in several clinical samples containing DNA from C. albicans. In addition, the set of primers used by Buchman et al. amplified DNA from species other than C. albicans, resulting in PCR products with the ‘predicted’ size of 240 bp.
It has been reported that several Candida species have chromosome rearrangements that may cause loss of genetic material. (Butler, G., et al, Nature 459(7247):657-662 (2009)). This can be associated with variations in molecular diagnosis, since the target sequence may vary or lost.
In light of the above, the present invention discloses an in vitro method for detecting and identifying Candida albicans, with at least one specific oligonucleotide, but also with an in-block multiplex set of specific oligonucleotides, which allows identification of Candida albicans in clinical samples of different population subgroups.
The present invention claims and discloses oligonucleotides for the specific identification of Candida albicans, consisting of a nucleic acid having at least 90% sequence homology to one of SEQ ID NOS: 1 to 12 or a complement thereof.
In a further embodiment, it is further disclosed an in vitro method for the specific identification of C. albicans, comprising the steps of: a) amplifying DNA fragments from a biological sample with at least one oligonucleotide as above defined; and b) identify the amplified DNA fragments; wherein in an specific embodiment the amplification of DNA fragments is carried out with at least one pair of oligonucleotides or at least two pair of oligonucleotides.
In an additional embodiment, a kit for the specific identification of Candida albicans, comprising at least one oligonucleotide as above mentioned is also disclosed; wherein in an specific embodiment, said kit comprises at least one oligonucleotide pair or at least two pair of oligonucleotides.
In
b show a 2% agarose gel showing the analysis of the 36 clinical isolated samples for C. albicans detection (SC5314) using the oligonucleotides pair Ca6. There were 11 samples detected as positive; the isolated sample AN17 was not detected as positive with Ca6, but it was positive for Ca2 and Ca5;
In
The present invention discloses an in vitro method for detecting and identifying Candida albicans, with at least one set of specific oligonucleotides, but also with an in-block multiplex set of specific oligonucleotides, which allows identification of Candida albicans in clinical samples of different population subgroups with 100% of specificity and sensitivity.
Several oligonucleotides have been designed in order to specifically detect different chromosomal sites of Candida albicans. The amplified sequences are located in several chromosomes and in contigs that have unique regions that allow said specific detection. The different sizes among the amplification products of each pair of oligonucleotides allow that they are rapidly recognized in separate or a single multiplex assay. Candida albicans can be specifically detected by any amplification method, such as PCR, RT-PCR, Q-PCR, Southern blot, Dot blot, multiplex-PCR, nested-PCR, or any other amplification or nucleic acid detection methods.
“Amplification” should be interpreted as a process for artificial increasing the number of copies of a particular nucleic acid fragments into millions of copies through the replication of the target segment.
By “complementary” is meant a contiguous sequence that is capable of hybridizing to another sequence by hydrogen bonding between a series of complementary bases, which may be complementary at each position in the sequence by standard base pairing (e.g., G:C, A:T or A:U pairing) or may contain one or more positions, including a basic ones, which are not complementary bases by standard hydrogen bonding. Contiguous bases are at least 80%, preferably at least 90%, and more preferably about 100% complementary to a sequence to which an oligomer is intended to specifically hybridize. Sequences that are “sufficiently complementary” allow stable hybridization of a nucleic acid oligomer to its target sequence under the selected hybridization conditions, even if the sequences are not completely complementary.
“Sample preparation” refers to any steps or methods that prepare a sample for subsequent amplification and detection of Candida nucleic acids present in the sample. Sample preparation may include any known method of concentrating components from a larger sample volume or from a substantially aqueous mixture, e.g., any biological sample that includes nucleic acids. Sample preparation may include lysis of cellular components and removal of debris, e.g., by filtration or centrifugation, and may include use of nucleic acid oligomers to selectively capture the target nucleic acid from other sample components.
The present invention discloses several oligonucleotides for the specific identification of C. albicans, wherein said oligonucleotides comprises a continuous sequence of about 18 to 21 nucleotides of a target sequence. Said target sequence is located along the chromosomes of said C. albicans, in exclusive sites that allows non-cross reactions with any other kind of organism, including other Candida species and microbial or eukaryotic nucleic acid that can be contained in a biological sample.
Also, the oligonucleotides for the specific identification of Candida albicans, consist of a nucleic acid having at least 90% sequence homology to one of SEQ ID NOS: 1 to 12 or complements thereof.
Said oligonucleotides are sufficiently complementary to the target sequences of C. albicans. For the experimental procedures, the amplified sequences were re-sequenced in order to make sure that the amplified product corresponds to the disclosed genomic region.
This invention also discloses an in vitro method for the specific identification of C. albicans, comprising the steps of: a) amplifying nucleic acid fragments from a biological sample by an amplification method with at least one of the specifically designed oligonucleotides, such as those disclosed on SEQ ID NOS: 1 to 12 or a complement thereof; and b) identify the amplified nucleic acid fragments. In this method the biological sample is derived from one subject to study. The subject to study is a mammal, wherein as a preferred embodiment, but not limited, is a human. Additionally, in a preferred embodiment, said biological sample is selected from the group consisting of any sample containing DNA, fluids, tissue, or cell debris, midstream urine, urine culture tube, growing by nephrostomy (right and left kidney), water, hemodialysis, pleural fluid, culture pyogenic, mieloculture, bone marrow, blood lysis (peripheral blood), blood culture (blood), leukocyte concentrate, concentrated red cell, throat, nasal discharge, vaginal discharge, exudate prostate sputum, catheter, biopsies from different tissues such as lymph node, subcutaneous tissue, cornea, lung, pulmonary nodule, pancreas, jaw, skin, skin quantitative (cellulite, breast, scrotum, arm, hand), hair, nails, warm muscle, bone, breast, synovial fluid, scar, thigh, joint capsule, knee, omentum, bronchoalveolar lavage (lingula, upper and lower lobe (left and right), left and right LBA (airways)); post-mortem (liver, lung, spleen), wound swabs (perianal, vaginal, ulcer (foot, hand)), abscess (thigh, kidney, perianal) or peripancreatic.
Furthermore, a kit for the specific identification of Candida albicans, with at least one oligonucleotide or as a multiplex identification kit is disclosed. Said kits comprise at least one oligonucleotide specifically designed for the identification of Candida albicans such as those disclosed on SEQ ID NOS: 1 to 12 or complements thereof. In the multiplex embodiment, the kit comprises at least one oligonucleotide pair or more preferably, at least two oligonucleotide pairs.
The use of said oligonucleotides specifically designed for the specific identification of Candida albicans, is disclosed as well.
As an additional embodiment, the present invention discloses at least one probe useful for the specific identification of Candida albicans. Said identification is carried out by an in vitro method comprising coupling nucleic acid fragments from a biological sample with said probes and identifying the hybridized nucleic acid fragments, wherein said steps are carried out by any hybridization method.
In order to test fully the competitive advantage of the methods of the present invention against traditional diagnostic methods, below is a comparison of the times of two tests:
Traditional method of identification of Candida in urine, urine samples are analyzed in an automated urine analyzer coupled Urisys type UF-IOOi. The analysis was performed by flow cytometry with an argon laser. The UF-IOOi measures the properties of scattered light and fluorescence to count and identify the particles in the urine. The volume of the particles is determined from the impedance signals. Thus, according to the scatterplots, the result indicates which urine samples are likely to contain yeast cells. These samples are marked as YLC urine samples (yeast cells). In urine samples taken YLC marked 1 μl and plating medium Sabourand/Dextrose (SDA) and medium Sabourand/Dextrose with cefoperazone (CFP). These plates are incubated at 30° C. for 72 hours. Urine cultures with growth less than 10,000 CFU/ml, as no growth plates, are reported as not developed fungi (negative) urine cultures with equal or greater development to 10,000 CFU/ml pass germ tube test, with incubation for 2 hours at 35° C. In the case of negative germ tube is reported as Candida sp. To identify the species from the report of Candida sp. Vitek cards are used that allow the identification by means of assimilation of carbohydrates. These cards are incubated for a period of 24 to 48 hours, at which time the cards are read. The minimum total time to identify C. albicans, is 6 days, with a sensitivity of about 85%.
In the method for identifying C. albicans, of the present invention, the urine samples are analyzed in an automated urine analyzer coupled Urisys type UF-IOOi. The analysis was performed by flow cytometry with an argon laser.
The UF-IOOi measures the properties of scattered light and fluorescence to count and identify the particles in the urine. The volume of the particles is determined from the impedance signals. Thus, according to the scatterplots, the result indicates which urine samples are likely to contain yeast cells. These samples are marked as YLC urine samples (yeast cells). The time of this first stage is 2 hours. Next, in urine samples taken YLC marked as 1 ml, centrifuged, the supernatant is discarded, resuspended and boiled the pill. The genomic DNA obtained is used for PCR analysis using primers generated from the SEQ ID Nos. 1 to 12, under optimal conditions reaction. The PCR products were separated by agarose gel electrophoresis and the products are analyzed for the correct identification of C. albicans, together as an inblock multiplex or separately. The total test time is 6 hours.
Traditional method of identification of Candida in blood samples: Blood samples are incubated for 72 hours in the automated equipment BACTEC9240. When no growth of microorganisms metabolize these nutrients in the culture medium by releasing CO2. The release of CO2 is detected by the computer and automatically marked as blood cultures positive for yeast. Positive blood cultures for yeasts are grown on plates Sabourand/Dextrose (SDA) and Sabourand/Dextrose with cefoperazone (CFP) and incubated at 30° C. for 72 hours. Blood cultures with lower growth of 10,000 CFU/ml as well as those without growth, are reported as not develop fungus (negative), the blood cultures with growth equal to or greater than 10,000 CFU/ml was performed germ tube test for 2 hours at 35° C. In the case of negative germ tube is reported as Candida sp. To identify the species from the report of Candida sp. Vitek cards are used that allow the identification by means of assimilation of carbohydrates. These cards are incubated for 24 to 48 hours and are read to identify C. albicans. The total time for identification is a minimum of 9 days.
Method to detect C. albicans, according to the present invention in blood samples: Blood samples are incubated for 72 hours BACTEC9240 automated equipment. When no growth of microorganisms metabolize these nutrients in the culture medium by releasing CO2. The release of CO2 is detected by the computer and automatically marked as blood cultures positive for yeast. Blood samples positive for yeast marked 100 μl taken, centrifuged, the supernatant is discarded, resuspended and boiled the pill. The genomic DNA obtained from PCR annealing is used where any of the oligonucleotides generated from SEQ ID Nos. 1 to 12, in optimal reaction conditions. The PCR products were separated by agarose gel electrophoresis and the products are analyzed for the correct identification of C. albicans. The total test time is 3 days.
An alternate method is to take as the patient's blood sample without being seeded by blood culture. In this case, follow the above procedure and the total test time is 4 hours.
Thus, the critical step is to obtain sufficient genomic DNA from any of the types of samples described above, and from them, using genomic DNA obtained as the PCR template, and using any one of the oligonucleotides generable or generated in the regions above disclosed, such as, but not limited to the 12 sequences disclosed. The PCR products are obtained and analyzed by any conventional method, such as but not limited to agarose gel electrophoresis, dot-blot hybridizations, Southern blotting, Northern blotting and similar RT-PCR, PCR-ELISA, and others known in the art (for example, but not limited to, Molecular Diagnostic PCR handbook. (2005), Gerrit J. Viljoen, Louis H. and John R. Crowther Nei. Springer Publishers) to correctly identify C. albicans in a multiplex assay or single assay. Note that these oligonucleotides may comprise nucleotide unmarked or marked, such as but not limited to, radioactive labeling, brand quiomiluminiscente, luminescent, fluorescent, biotinylated.
Experimental selected examples, which must be considered only as supporting technical evidence, but without limiting the scope of the invention, are provided herein below.
Candida albicans oligonucleotides and probes were specifically designed from unique sites located on the genome. Non-limiting examples of the specifically designed oligonucleotides are disclosed in Table 1.
For example, oligonucleotide pair Ca2 is located in Chromosome R, found in CGD (Candida Genome Database) as: ALS3 orf19.1816 on Ca21 chrR_Ca_SC5314 nt 1535813-1532346. Oligonucleotide Ca5 is located at MYO5 orf19.738 on Ca21 chr4_Ca_SC5314 nt 1096185-1092235. Oligonucleotides pairs Ca3 and Ca4 are located in the intergenic region between hypothetical protein Ca019.740 mRNA and CAWG—03305, protein MYO5 mRNA. Oligonucleotides pair Ca6 is located in Chromosome R at Supercontig 2: 2296345-2296656+Broad Institute MIT Data Candida CAWG—031102.
Said oligonucleotide pairs were tested for optimizing the amplification conditions. Thus, oligonucleotide pairs Ca1 to Ca 6 have annealing temperatures from about 54° C. to 61° C. These oligonucleotide pairs were tested on genomic DNA for amplification testing carrying out PCR reactions. For example the oligonucleotide pairs were analyzed in a final product volume of 30 μL, as follows:
As a control, the quality of the genomic DNA was evaluated by amplifying rDNA regions with universal oligonucleotides ITS1 and ITS4 (Table 3), using the same concentrations and final volume as above disclosed. The genomic DNA was pure, non-degraded and free of molecules that could interfere with further PCR reactions. (
TCCGTAGGTGAACCTGCGG
TCCTCCGCTTATTGATATGC
The amplified fragments resulting from the PCR reactions of each oligonucleotide pairs were tested on 2% agarose gels during 60 minutes at 100-130 volts.
During electrophoresis, the samples belonging to other Candida species different to Candida albicans, were loaded at higher concentrations to those used for positive and negative controls. This was made in order to be sure of the oligonucleotide's sensitivity.
Herein below, standardization results from some selected oligonucleotides are shown. This selection should not be taken as limiting the scope of the invention, but to illustrate the applicability of all the designed oligonucleotides.
3 oligonucleotide pairs are shown in order to reflect the sensitivity and selectivity of the 12 oligonucleotides and probes for identifying C. albicans. These examples are illustrative but not limitative for the scope of the invention.
Optimal PCR reaction conditions: 3 selected oligonucleotide pairs were tested for optimal PCR reaction conditions.
Firstly, annealing conditions were tested with a temperature threshold. Results are shown in Table 4.
Annealing temperatures were tested for each oligonucleotide pairs, the maximum and minimum temperatures wherein the reaction is effective was pointed out in the termocycling and the intermediate temperatures were calculated.
Oligonucleotide Concentration
Once the optimal annealing temperature has been selected for each oligonucleotide pair, the optimal oligonucleotide concentration was determined for PCR reactions.
The concentrations tested were: 100 nM, 200 nM, 400 nM, 500 nM, 600 nM, 800 nM, 1000 nM y 1200 nM.
The minimal oligonucleotide concentration wherein a clear band was detected in the positive control, was selected. Table 5 shows the best concentrations.
Genomic DNA Detected.
The amount of genomic DNA that can be detected for each oligonucleotide pair was tested from 100 ng to 0.02 ng with a control without DNA. For C. albicans, genomic DNA can be detected in an amount of at least 1 ng.
The above exemplified oligonucleotide pairs were tested to detect Candida albicans on clinical isolated samples from hospitalized patients.
Comparing PCR results with Vitek identification methods reveals that PCR test has a sensibility of 98% and a specificity of 100% in contrast to VITEK tests with an 85% and 33% respectively.
Since it is possible to have rearrangements within the genome of C. albicans, as shown with clinical sample 17 (see
Finally, from the totality of clinical samples tested, 12 were classified as C. albicans with a 100% sensitivity and specificity, compared with Vitek tests.
A positive control was generated by subcloning amplicons derived from the oligonucleotides pairs within a suitable vector, according to manufacturer's instructions. DNA concentration was calculated by 260/280 absorbance readings. Suitable negative controls were also included.
Real-time PCR reactions were performed as follows: Annealing temperature 67° C., oligonucleotide concentration 150 nM (forward and reverse), each point of the standard curve was run in duplicate at 108, 106, 104, 102 dilutions. 40 cycles were run. The linear detection range was from 108 to less than 100 copies per reaction. To confirm amplification quality, the real time PCR products were resequenced and they correspond to the predicted amplicon sequence in at least 5 repeats. Since the samples did not form any primer dimers, this indicates the ability of real-time PCR to efficiently amplify a specific target not only from the positive-control plasmid, but also from more complex DNAs, such as clinical samples. In clinical samples, no significant difference in CT score was apparent (data not shown).
This application claims the benefit of priority to U.S. Provisional Application No. 61/894,974 filed Oct. 24, 2013, the contents of which are incorporated herein by reference.
| Number | Date | Country | |
|---|---|---|---|
| 61894974 | Oct 2013 | US |