Cassette for the expression of an endothiapepsin precursor in Cryphonectria parasitica

The present invention relates to a new cassette for the expression of an endothiapepsin precursor in Cryphonectria parasitica, to a strain of this species transformed with this cassette, to a process for preparing endothiapepsin using this strain and also to a process for preparing such a strain devoid of a dominant selection marker.
The filamentous fungus Cryphonectria parasitica, also known as Endothia parasitica, which belongs to the Ascomycetes group, naturally secretes an aspartic protease, namely endothiapepsin, capable of curdling milk by specifically hydrolysing the micelles of casein, and which is hence useful in the manufacture of certain cheeses, especially cooked cheeses of the Emmental type. This enzyme, whose sequence of 330 amino acids has been described by Barkolt V., 1987, Eur. J. Biochem. 167, 327-338, then replaces chymosin.
This enzyme is currently produced on an industrial scale by processes of fermentation of Cryphonectria parasitica strains chosen for their good level of expression of endothiapepsin.
These processes possess drawbacks, and in particular that of an immobilisation of a large reactor volume, since the quantity of endothiapepsin per unit of biomass, and hence the quantity of endothiapepsin per unit of reactor volume for a given quantity of biomass, is low.
Conventional mutation/selection techniques enable the quantity of endothiapepsin produced per unit of biomass to be increased by only approximately 30%.
There is hence a need for genetic engineering tools enabling Cryphonectria parasitica strains to be obtained which are overproductive of endothiapepsin with a large overproduction factor. The latter is defined here as the ratio of the quantity of endothiapepsin produced by the overproductive transformed strain to the quantity of this protein produced by the untransformed control strain, for the same quantity of biomass.
Cryphonectria parasitica is a filamentous fungus whose genetics is still very little known, in contrast to that of other filamentous fungi of the Ascomycetes group such as those of the genus Aspergillus, Neurospora or Trichoderma. Only very recently have the first transformations of Cryphonectria been described, by Churchill et al. 1990, Curr. Gen, 17, 25-31. These authors transformed laboratory strains of Cryphonectria using plasmids carrying markers for resistance to hygromycin, benomyl or G 418. No protein of commercial interest has ever been produced hitherto using a Cryphonectria recombined by genetic engineering.
Recently, at the Congress: "Annual Meeting of the American Phytopathological Society and the Canadian Phytopathological Society", Aug. 4th to 8th 1990, G. H. Choi et al. presented--apparently (according to the published abstract of their communication)--the coding sequence of endothiapepsin, an assumed prepro sequence of 88 amino acids and a portion of the endothiapepsin promoter comprising the TATA box but not the activator regions necessary for the promoter to be able to function. Such a genomic DNA fragment, but containing a prepro sequence of 89 amino acids, had already been isolated and sequenced by the Applicant in 1989, who had observed that it does not permit the expression of endothiapepsin (see Sections 1 and 6 below).
The present invention relates to a new cassette for the expression of an endothiapepsin precursor in Cryphonectria parasitica, characterised in that it comprises a functional promoter upstream of a sequence coding for the endothiapepsin precursor, endothiapepsin having the following sequence (P1)(SEQ ID NO:1):
Ser Thr Gly Ser Ala Thr Thr Thr Pro Ile Asp Ser Leu Asp Asp Ala Tyr - Ile Thr Pro Val Gln Ile Gly Thr Pro Ala Gln Thr Leu Asn Leu Asp Phe - Asp Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Ser Glu Thr Thr Ala Ser - Glu Val Asp Gly Gln Thr Ile Tyr Thr Pro Ser Lys Ser Thr Thr Ala Lys - Leu Leu Ser Gly Ala Thr Trp Ser Ile Ser Tyr Gly Asp Gly Ser Ser Ser - Ser Gly Asp Val Tyr Thr Asp Thr Val Ser Val Gly Gly Leu Thr Val Thr - Gly Gln Ala Val Glu Ser Ala Lys Lys Val Ser Ser Ser Phe Thr Glu Asp - Ser Thr Ile Asp Gly Leu Leu Gly Leu Ala Phe Ser Thr Leu Asn Thr Val - Ser Pro Thr Gln Gln Lys Thr Phe Phe Asp Asn Ala Lys Ala Ser Leu Asp - Ser Pro Val Phe Thr Ala Asp Leu Gly Tyr His Ala Pro Gly Thr Tyr Asn - Phe Gly Phe Ile Asp Thr Thr Ala Tyr Thr Gly Ser Ile Thr Tyr Thr Ala - Val Ser Thr Lys Gln Gly Phe Trp Glu Trp Thr Ser Thr Gly Tyr Ala Val - Gly Ser Gly Thr Phe Lys Ser Thr Ser Ile Asp Gly Ile Ala Asp Thr Gly - Thr Thr Leu Leu Tyr Leu Pro Ala Thr Val Val Ser Ala Tyr Trp Ala Gln - Val Ser Gly Ala Lys Ser Ser Ser Ser Val Gly Gly Tyr Val Phe Pro Cys - Ser Ala Thr Leu Pro Ser Phe Thr Phe Gly Val Gly Ser Ala Arg Ile Val - Ile Pro Gly Asp Tyr Ile Asp Phe Gly Pro Ile Ser Thr Gly Ser Ser Ser - Cys Phe Gly Gly Ile Gln Ser Ser Ala Gly Ile Gly Ile Asn Ile Phe Gly - Asp Val Ala Leu Lys Ala Ala Phe Val Val Phe Asn Gly Ala Thr Thr Pro - Thr Leu Gly Phe Ala Ser Lys.
A cassette for the expression of an endothiapepsin precursor denotes here a DNA sequence comprising the sequence coding for this precursor, flanked by signals enabling this coding sequence in Cryphonectria parasitica to be transcribed and translated.
Endothiapepsin precursor is understood to mean a protein capable of being secreted and of generating endothiapepsin in the culture medium after one or more maturation steps.
The natural precursor of endothiapepsin, referred to as preproendothiapepsin and having the following sequence (P4)(SEQ ID NO:2), will preferably be used:
Met Ser Ser Pro Leu Lys Asn Ala Leu Val Thr Ala Met Leu Ala Gly Gly - Ala Leu Ser Ser Pro Thr Lys Gln His Val Gly Ile Pro Val Asn Ala Ser - Pro Glu Val Gly Pro Gly Lys Tyr Ser Phe Lys Gln Val Arg Asn Pro Asn - Tyr Lys Phe Asn Gly Pro Leu Ser Val Lys Lys Thr Tyr Leu Lys Tyr Gly - Val Pro Ile Pro Ala Trp Leu Glu Asp Ala Val Gln Asn Ser Thr Ser Gly - Leu Ala Glu Arg Ser Thr Gly Ser Ala Thr Thr Thr Pro Ile Asp Ser Leu - Asp Asp Ala Tyr Ile Thr Pro Val Gln Ile Gly Thr Pro Ala Gln Thr Leu - Asn Leu Asp Phe Asp Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Ser Glu - Thr Thr Ala Ser Glu Val Asp Gly Gln Thr Ile Tyr Thr Pro Ser Lys Ser - Thr Thr Ala Lys Leu Leu Ser Gly Ala Thr Trp Ser Ile Ser Tyr Gly Asp - Gly Ser Ser Ser Ser Gly Asp Val Tyr Thr Asp Thr Val Ser Val Gly Gly - Leu Thr Val Thr Gly Gln Ala Val Glu Ser Ala Lys Lys Val Ser Ser Ser - Phe Thr Glu Asp Ser Thr Ile Asp Gly Leu Leu Gly Leu Ala Phe Ser Thr - Leu Asn Thr Val Ser Pro Thr Gln Gln Lys Thr Phe Phe Asp Asn Ala Lys - Ala Ser Leu Asp Ser Pro Val Phe Thr Ala Asp Leu Gly Tyr His Ala Pro - Gly Thr Tyr Asn Phe Gly Phe Ile Asp Thr Thr Ala Tyr Thr Gly Ser Ile - Thr Tyr Thr Ala Val Ser Thr Lys Gln Gly Phe Trp Glu Trp Thr Ser Thr - Gly Tyr Ala Val Gly Ser Gly Thr Phe Lys Ser Thr Ser Ile Asp Gly Ile - Ala Asp Thr Gly Thr Thr Leu Leu Tyr Leu Pro Ala Thr Val Val Ser Ala - Tyr Trp Ala Gln Val Ser Gly Ala Lys Ser Ser Ser Ser Val Gly Gly Tyr - Val Phe Pro Cys Ser Ala Thr Leu Pro Ser Phe Thr Phe Gly Val Gly Ser - Ala Arg Ile Val Ile Pro Gly Asp Tyr Ile Asp Phe Gly Pro Ile Ser Thr - Gly Ser Ser Ser Cys Phe Gly Gly Ile Gln Ser Ser Ala Gly Ile Gly Ile - Asn Ile Phe Gly Asp Val Ala Leu Lys Ala Ala Phe Val Val Phe Asn Gly - Ala Thr Thr Pro Thr Leu Gly Phe Ala Ser Lys.
By anology with what is known for other aspartic proteases such as calf chymosin (Foltmann, 1970, Methods in Enzymol., 19, 421-435), swine pepsinogen (James and Sielecki, 1986, Nature, 319, 33-38) and S. cerevisiae protease A (Woolford et al., 1986 Mol. Cel. Biol. 6, 2500-2510), it may be assumed that the natural precursor of endothiapepsin generates an inactive secreted form, referred to as proendothiapepsin, which self-activates to mature endothiapepsin.
As a result of the degeneracy of the genetic code, there is a large number of DNA sequences coding for a protein whose sequence P4 (SEQ ID NO:2) corresponds to the formula given above. Among these, a suitable sequence is that which comprises the following sequence (N4a)(SEQ ID NO:3):
ATGTCTT CCCCTCTCAA GAACGCCTTG GTGACCGCCA TGTTGGCTGG - TGGTGCTCTC AGCTCGCCTA CAAAGCAACA CGTTGGAATT CCCGTCAACG - CCTCTCCTGA AGTTGGCCCC GGAAAGTACT CGTTCAAGCA AGTCCGGAAC - CCCAACTACA AGTTCAACGG GCCTCTGTCG GTCAAGAAGA CGTACCTCAA - GTACGGCGTG CCGATCCCAG CCTGGCTGGA GGATGCTGTC CAGAACTCTA - CCTCGGGCCT GGCTGAGCGC TCGACCGGTT CTGCGACCAC AACTCCCATC - GACAGCCTCG ATGATGCTTA CATCACTCCG GTTCAGATCG GCACCCCTGC - GCAGACTCTG AACCTGGACT TTGACACTGG ATCTTCGGAT CTGTGGGTCT - TCAGCAGCGA GACTACAGCC AGCGAGGTCG ATGGGCAGAC CATCTACACC - CCCAGCAAGA GCACCACCGC CAAGCTGCTG TCGGCGCTAC CTGGTCCATC - TCCTACGGAG ACGGTAGCTC TTCCAGCGGC GATGTCTACA CTGACACCGT - CTCGGTTGGA GGCCTTACCG TGACGGGCCA GGCTGTCGAG TCGGCCAAGA - AGGTTTCTTC CAGCTTCACC GAGGACTCGA CCATTGACGG TCTCCTGGGC - CTGGCCTTCA GCACCCTGAA CACTGTGTCG CCTACCCAGC AAAAGACTTT - CTTCGACAAT GCGAAGGCGT CCTTGGACTC GCCTGTGTTC ACGGCTGATC - TTGGCTACCA TGCCCCTGGT ACCTACAACT TCGGCTTCAT CGATACCACT - GCCTACACGG GCTCCATCAC CTACACCGCT GTCTCGACCA AGCAAGGGTT - CTGGGAGTGG ACTTCGACCG GCTACGCCGT CGGCTCCGGC ACCTTCAAGT - CGACTTCCAT CGACGGCATC GCTGACACTG GCACGACCCT CCTGTACCTC - CCTGCCACCG TCGTGTCGGC CTACTGGGCC CAGGTCTCGG GCGCCAAGTC - CAGCTCTTCC GTCGGCGGCT ACGTCTTCCC CTGCAGCGCG ACCCTGCCTT - CCTTCACCTT CGGCGTTGGC TCAGCTCGCA TTGTGATTCC TGGCGACTAC - ATTGATTTCG GCCCCATCTC CACTGGAAGC TCGTCTTGCT TTGGCGGCAT - CCAGTCCAGC GCTGGTATCG GCATCAACAT CTTCGGTGAT GTCGCTCTGA - AGGCTTTGTC GTCTTCAACG GGGCTACAAC TCCCACTCTT GGCTTTGCTT - CCAAG
It is preferable for the sequence coding for the endothiapepsin precursor to be interrupted by at least one intron. It is known, in effect, that the presence of introns in the coding portion of a gene can in some cases increase the expression of the latter (see, for example, the work of J. Callis et al., 1987, Genes and Development, 1, 1183-1200).
An advantageous sequence coding for preproendothiapepsin is hence that which comprises the sequence (N4a)(SEQ ID NO:3) interrupted by at least one intron. An especially valued sequence of this type is that which comprises the following sequence (N4b)(SEQ ID NO:4):
AT GTCTTCCCCT CTCAAGAACG - CCTTGGTGAC CGCCATGTTG GCTGGTGGTG CTCTCAGCTC GCCTACAAAG - CAACACGTTG GAATTCCCGT CAACGCCTCT CCTGAAGTTG GCCCCGGAAA - GTACTCGTTC AAGCAAGGTG AGTAGAGCTG CTTCTGTGTG TTGCAACAGA - AGACCAACGC AAAAAGAAGA GGTCAAGGCA AGACGGATAT TTTACTGACA - ATTATACTTT TGAAGTCCGG AACCCCAACT ACAAGTTCAA CGGGCCTCTG - TCGGTCAAGA AGACGTACCT CAAGTACGGC GTGCCGATCC CAGCCTGGCT - GGAGGATGCT GTCCAGAACT CTACCTCGGG CCTGGCTGAG CGCTCGACCG - GTTCTGCGAC CACAACTCCC ATCGACAGCC TCGATGATGC TTACATCACT - CCGGTTCAGA TCGGCACCCC TGCGCAGACT CTGAACCTGG ACTTTGACAC - TGGATCTTCG GATCTGTGGG TCTTCAGCAG CGAGACTACA GCCAGCGAGG - TTGGTCAACC CTCGCCCGCA TTTTATTGCA TACATTTTTA GTTTTTTTGG - TAATCAGAAT ACTAACATTG GGAATTTCCC AACTGTAGGT CGATGGGCAG - ACCATCTACA CCCCCAGCAA GAGCACCACC GCCAAGCTGC TGTCGGGCGC - TACCTGGTCC ATCTCCTACG GAGACGGTAG CTCTTCCAGC GGCGATGTCT - ACACTGACAC CGTCTCGGTT GGAGGCCTTA CCGTGACGGG CCAGGCTGTC - GAGTCGGCCA AGAAGGTTTC TTCCAGCTTC ACCGAGGACT CGACCATTGA - CGGTCTCCTG GGCCTGGCCT TCAGCACCCT GAACACTGTG TCGCCTACCC - AGCAAAAGAC TTTCTTCGAC AATGCGAAGG CGTCCTTGGA CTCGCCTGTG - TTCACGGCTG ATCTTGGCTA CCATGCCCGT GAGTGACCCC TCTTGATACA - TATACTTTTT GATGAATCTT GTTGGAGAAG CATTCCCCAC TAATATGGAA - ATTGTTTGTA TCTACAGCTG GTACCTACAA CTTCGGCTTC ATCGATACCA - CTGCCTACAC GGGCTCCATC ACCTACACCG CTGTCTCGAC CAAGCAAGGG - TTCTGGGAGT GGACTTCGAC CGGCTACGCC GTCGGCTCCG GCACCTTCAA - GTCGACTTCC ATCGACGGCA TCGCTGACAC TGGCACGACC CTCCTGTACC - TCCCTGCCAC CGTCGTGTCG GCCTACTGGG CCCAGGTCTC GGGCGCCAAG - TCCAGCTCTT CCGTCGGCGG CTACGTCTTC CCCTGCAGCG CGACCCTGCC - TTCCTTCACC TTCGGCGTTG GCTCAGCTCG CATTGTGATT CCTGGCGACT - ACATTGATTT CGGCCCCATC TCCACTGGAA GCTCGTCTTG CTTTGGCGGC - ATCCAGTCCA GCGCTGGTAT CGGCATCAAC ATCTTCGGTG ATGTCGCTCT - GAAGGCCGCC TTTGTCGTCT TCAACGGGGC TACAACTCCC ACTCTTGGCT - TTGCTTCCAA G
A functional promoter means here a constitutive or regulable promoter capable of producing in Cryphonectria parasitica transcription of the sequence coding for the endothiapepsin precursor. This promoter contains a TATA element located in a zone rich in AT, a transcription initiation region downstream of this element and, upstream of the latter, sequences referred to as upstream activating sequences UAS or upstream repressing sequences URS which regulate the strength of the promoter through the effect of regulatory proteins.
To determine the functionality of a DNA sequence as a promoter, the method described in Section 11 will conveniently be used. This consists in transforming a Cryphonectria parasitica strain rendered deficient in the production of endothiapepsin by a mutation of the structural gene for this protein, with the expression cassette carrying the test sequence and a selection marker, and then in identifying among the transformants those which are producers of endothiapepsin using the selection test on agar medium containing casein described in Section 7.
A valued promoter is the promoter of the gene coding for preproendothiapepsin or a functional portion of this promoter. The portion in question comprises, for example, a portion carrying the TATA box of the following sequence (N5)(SEQ ID NO:5):
AAGCTTATCC GCCGCCGGCG GGGGAATTCT ATTGAACTTG TTCGAATCAT - TGGTCCGTGG TCTTTTCGTC CATGCGGGCT CCGCTGGCGG ATGAATGACC - TTCTGGCTTC TAGCCTGGCG AAGCGATGTT ACTCTGTTGT CTATACTATA - CGATATGGTC AAGAGAGCAC ATGTGCCGCC AGATGAAGAC ATGTATATAA - AAGGAGTGGC CTCGACGGTT GCTCAACCAT CTTCTGTCTG TCCCAACGCC - ATCGACTCTT CAACTTCTCC TTCGTGTTCC ACCACCATCA CCTTGCTCCA - GACTTAGGAC TTTCAGCAAC CTTCAAAG
and, upstream of the sequence (N5)(SEQ ID NO:5), a segment X of the fragment C bounded by the 5' end of the fragment A and the 5' end of the fragment C, chosen so that the segment X contains an activator region. The fragment C is a portion of the genomic DNA of Cryphonectria parasitica contained in the E. coli strain deposited with the CNCM on 31.08.1990 under No. I-998. Its restriction map, as well as that of the fragment A contained in the fragment C, are shown in FIG. 4. The nucleotide sequence of the fragment A, which comprises the genomic DNA of Cryphonectria parasitica coding for preproendothiapepsin, is shown in FIG. 2, and is identified in the Sequence Listing as SEQ ID NO:32.
A more precise localisation of this activator region may be effected by obtaining a series of segments of the fragment C (prepared, for example, by digestion using endonucleases or exonucleases) comprising the fragment A flanked on the 5' side by segments of different sizes of the portion of the fragment C bounded by the 5' end of the fragment A and the 5' end of the fragment C, and determining the functionality of the promoter obtained using the method mentioned above.
An example of a segment X of the fragment C containing an activator region is the fragment of sequence below (SEQ ID NO:6):
GCATGCTTGG CTCTTTAACG TCCTGCCCAT TCAGGGCCTT CAGCCGGCAC - TGGTCCTTCA TCAAGGGGGA CCTCATGACC ATGAACTAAT CTGTGATATC - TGATATATTC TAGAAGGCTT GGCTCCTCAA AGTTTCCAGC TAATGAATCA - GCGGCCCGCC GCCCTTAAAC CGCATCAGGC AAGTCGTTTG GTGTTGCCAG - GCGATGGCGA CAGGAGAGTG GTGTTGATGG GACAAGGGGA GGGAGGCTTA - GCCGACTTCA TCCATAGCAC CCACCTGCTT GGCGCCGATA AGTCTGACGA - TCCGCTTGAG CTGCAAAACG GCTCCTTGAC CTTTGTTTGG TCGACCGAGG - GAAATAGTCT CTTTTTGCGT GATCGTGCGC GCTTCGTATA GCAATAGCAG - CCAGCACCAG CAGGACGGGC CGTTGTCACG GTCACATCGT TCGCAACATG - CCGAGCGTAG GGATGAACGA ATGACTCGAG CCTTGCCTGA CAGTCTGGCA - ATCAATCTAT GGTCACGCAC GATCACAAGC CAATCGCTGT GACTGCGTTA - CTAGCCCAAT AATCCCTTGT TCGATCAGAG TGTTCTACAG ACTTCAAGTG - AGGTTCAC
Examples of functional portions of the promoter of the gene coding for preproendothiapepsin are the BglII-ScaI and BamHI-ScaI segments of the fragment C (see FIG. 4).
It can also be advantageous to use a promoter originating from another gene known to be expressed in Cryphonectria parasitica or in another filamentous fungus of the Ascomycetes group, for example the promoter of the gene coding for glyceraldehyde-3-phosphate dehydrogenase of Cryphonectria parasitica described by Choi et al., 1990, Nucleic Acids Research, 18, 18, Oxford University Press, or that of the gene coding for glyceraldehyde-3-phosphate dehydrogenase of Aspergillus nidulans described by Mullaney et al., 1985, Mol. Gen. Genet., 199, 37-45.
The expression cassette is introduced into Cryphonectria parasitica preferably by cotransformation with a vector carrying the selection gene. The expression cassette is itself carried by a vector, or preferably in the form of a linear fragment. The expression cassette is preferably maintained in the integrated state in the chromosome. The vector carrying the selection gene is maintained either by integration in the chromosome, or in extrachromosomal linear form using sequences of the telomeric sequence type. After sporulation, transformants which have lost the selection marker are preferably selected.
The invention hence also relates to a Cryphonectria parasitica strain productive of endothiapepsin, characterised in that it is transformed with the cassette defined above and overproduces endothiapepsin compared with the untransformed strain, that is to say secretes more endothiapepsin than the latter.
For use of this strain in the agri-foodstuffs industry, it is advantageous for this strain to be devoid of a dominant selection marker such as, for example, an antibiotic resistance gene.
Preferably, the host strain is the strain SEBR103 obtained as a result of a conventional mutation/selection process and deposited with the CNCM at the Institut Pasteur, 28, rue du Dr. Roux, 75724 Paris C e dex 15, France, on 31.08.1990 under No. I-997. It is then perceived that the transformed strain overproduces endothiapepsin compared with the strain SEBR103 with an overproduction ratio equal to at least two.
The invention also relates to a process for preparing endothiapepsin, characterised in that it comprises a step of culturing of the strain defined above, followed by a step of isolation and purification of this protein. This process will advantageously replace the current processes for producing endothiapepsin.
The invention also relates to a process for obtaining a Cryphonectria parasitica strain over-productive of endothiapepsin, transformed with the cassette defined above and devoid of a dominant selection marker, characterised in that it comprises at least one cycle entailing a step of cotransformation with a cassette according to one of Claims 1 to 12, and a dominant selection marker, followed by a step of purification by sporulation enabling the dominant selection marker to be removed. Preferably, this process comprises at least two cycles of this type.
A better understanding of the invention will be gained from the description below, divided into sections, which comprises experimental results and a discussion of the latter. Some of these sections relate to experiments performed with the aim of carrying out the invention, others to examples of embodiment of the invention, naturally given purely by way of illustration.
A large part of the collective techniques below, which are well known to those skilled in the art, is described in detail in the work by Sambrook and Maniatis: "Molecular cloning: a Laboratory manual" published in 1989 by Cold Spring Harbor Press publications, New York (2nd edition):
A better understanding of the description below will be gained by reference to FIGS. 1 to 12.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the amino acid sequence of endothiapepsin (SEQ ID NO:1).
FIG. 2 shows the nucleotide sequence of the fragment A (SEQ ID NO:32), the BstEII site used in Section 10 being indicated by vertical broken lines, as well as the amino acid sequence (SEQ ID NO:33) translated.
FIG. 3 shows the amino acid sequence (SEQ ID NO:33) of preproendothiapepsin.
FIG. 4 shows a restriction map of the fragment C, the BamHI, HindIII, PstI, SphI, SacI, BglII and ScaI sites being symbolised by the letters B, H, P, Sp, C, G and S, as well as the fragments A, D, E and F contained in the fragment C.
FIG. 5 shows the genomic DNA sequence coding for preproendothiapepsin, interrupted by three introns which are underlined (SEQ ID NO:4).
FIG. 6 shows a restriction map of plasmid p163,1. The different restriction segments are arbitrarily labelled according to the following legend:
______________________________________ #STR1## = DNA segment emanating from plasmid pBR322 - = localisation of the origin of replication (ORI) - = DNA segment containing the sequence coding for a natural precursor of hGH - = DNA segment of phage fd containing a transcription terminator - = DNA segment containing a tryptophan/ lactose hybrid promoter/operator UV5 - = DNA segment coding for .beta.-lactamase (Ap.sup.R : ampicillin resistance).______________________________________
FIG. 7 shows the restriction map of a plasmid p160 of which the PvuI-XhoI-BamHI(1) and PvuI-ORI-BamHI(2) fragments originate, respectively, from plasmids p163,1 and pBR327, and of which the small BamHI(2)-BamHI(1) fragment is the fragment 3 described below.
FIG. 8 shows the restriction map of plasmid p373,2. The different restriction segments are arbitrarily labelled according to the following legend:______________________________________ #STR7## = PvuI-BamHI sequence emanating from plasmid pBR327 - = PvuI-XhoI sequence emanating from plasmid p163,1 - = XhoI-HincII sequence emanating from plasmid p163,1 - #STR10## - #STR11## = Fragment 3 described below - = DNA segment of phage fd containing a transcripti on terminator______________________________________
FIG. 9 shows a restriction map of plasmid p462, the synthetic BglII-HindIII fragment defined below being indicated by: ##STR13##
FIG. 10 shows a restriction map of plasmid p466, the NdeI-KpnI fragment comprising the gene coding for urate oxidase being indicated by: ##STR14##
FIG. 11 shows the complementary DNA sequence coding for preproendothiapepsin (SEQ ID NO:3).
FIG. 12 shows the sequence of the SphI-HindIII segment of the fragment F (SEQ ID NO:5).

Section 1
Isolation of the fragment A, an approximately 2.1-kb fragment of genomic DNA containing the coding sequence of the endothiapepsin precursor.
1) Preparation of the genomic DNA
The strain referred to as SEBR 103 was identified by the Centraal Bureau Voor Schimellcultures as belonging to the species Cryphonectria parasitica and deposited with the Collection Nationale de Culture de Microorganismes (National Collection of Microorganism Cultures) C.N.C.M. under No. I-997.
From conidiospores of Cryphonectria parasitica strain SEBR 103 harvested at the surface of a Petri dish containing an agar medium, referred to as medium G and whose composition is specified in Table 3 below, previously inoculated with a mycelial implant or with a suspension of conidiospores of this same strain and then incubated for 4 weeks at room temperature and in the light, a Petri dish containing 25 ml of an agar medium, referred to as medium A and whose composition is given in Table 1 below, is inoculated by plating out one drop of conidiospore suspension. After 3 days' incubation at 30.degree. C., the mycelium obtained is used to inoculate a 1--1 flask containing 100 ml of a liquid medium, referred to as medium B and whose composition is specified in Table 2 below. After 24 h of incubation at 28.degree. C. with stirring at 220 rpm, 25 ml of the culture broth are used for inoculating 250 ml of fresh medium B contained in a 1--1 flask. The following day, after incubation under the conditions already defined, the whole of the culture broth (250 ml) is centrifuged at 5,000 g for 5 min. The pellet is resuspended in 0.15M sodium acetate solution containing 1 mM EDTA. The mycelium is recovered by filtration on Whatman 3MM paper, frozen in liquid nitrogen and reduced to a powder using a mortar and pestle.
10 g of mycelium powder are taken up in 40 ml of 0.15M sodium acetate solution containing 4% of lauroylsarcosine sodium salt, pH 5. After 30 min of gentle stirring at room temperature, sodium chloride is added to a final concentration of 0.1M. After 30 min of gentle stirring at room temperature, the proteins are extracted with a phenol solution (49% v/v) containing isoamyl alcohol (2% v/v) and chloroform (49% v/v). After 3 extractions with this mixture, extraction is performed with a chloroform solution containing isoamyl alcohol (96% of chloroform/4% of isoamyl alcohol). After 2 extractions of this type, the aqueous phase is subjected to the addition of 2 volumes of ethanol. The 2 solutions are mixed gently by inversion, which causes the appearance of a filament of precipitated DNA. This filament is removed using a Pasteur pipette and deposited in an Eppendorf tube. This tube is centrifuged for 5 min at 100 g. The pellet is washed in 70% ethanol solution and then dried under vacuum. The pellet is taken up in 1 ml of buffer, referred to as TE buffer, of composition [10 mM Tris-HCl, pH 8; 1 mM EDTA].
TABLE 1______________________________________Composition of medium A Glucose, anhydrous 50 g/l Soybean flour (Soyoptim of Societe 20 g/l Industrielle des Oleagineux) Calcium nitrate 9 g/l Agar (Difco Bacto-agar) 15 g/l Saline solution 1 (composition 0.5 g/l specified below) Check or adjust the pH to 6.0 using 1N HCl or 1N NaOHComposition of saline solution 1 H.sub.3 BO.sub.3 30 ml MnCl.sub.2.4H.sub.2 O 79 ml ZnCl.sub.2 200 ml Na.sub.2 MoO.sub.4.2H.sub.2 O 20 ml FeCl.sub.3, anhydrous 50 ml CuSO.sub.4.5H.sub.2 O 200 ml Distilled water qs 500 ml (This suspension is stored for not more than one month at +4.degree. C.)______________________________________
TABLE 2______________________________________Composition of medium B Glucose 10 g/l Thiamine 2 mg/l Saline solution 2 (composition given 62.5 ml/l below) Yeast extract (Difco) 2.5 g/l Malt extract (Difco) 7.5 g/l Check or adjust the pH to 6.0 using 1N HCl or 1N NaOH Sterilise for 30 min at 110.degree. C.Composition of saline solution 2 NH.sub.4 NO.sub.3 24 g/l KH.sub.2 PO.sub.4 16 g/l NaH.sub.2 SO.sub.4 4 g/l KCl 8 g/l MgSO.sub.4.7H.sub.2 O 2 g/l CaCl.sub.2 1 g/l Saline solution 1 8 ml/l (composition specified in Table 1)______________________________________
TABLE 3______________________________________Composition of medium G______________________________________Part A Malt extract 20 g Yeast extract 2 g Agar 16 g Water 1 l Adjust to pH 5.5 Autoclave for 20 min at 120.degree. C. Part B Aspartic acid 1,000 mg Biotin 10 mg Water 1 l Dilute part B to 1/10, distribute it while filtering at a concentration of 0.2M in 1 ml fractions and store at -20.degree. C.______________________________________ At the time of use, add 1 ml of diluted part B to 1 l of part A supercooled to 45.degree. C., then distribute the mixture in Petri dishes
2) Preparation of probe 1 and probe 2
These probes are pools of synthetic oligonucleotides, comprising the collective coding sequences for two peptides chosen from within the amino acid sequence of mature endothiapepsin exported into the culture medium of C. parasitica, described by V. BARKHOLT, 1987, Eur. J. Biochem., 167, 327-338, shown in FIG. 1. The peptides chosen from within this sequence, referred to as peptide 1 and peptide 2 and corresponding, respectively, to probe 1 and probe 2, are as follows:
Peptide 1(SEQ ID NO:7): Val-Asp-Gly-Gln-Thr
Peptide 2(SEQ ID NO:8): Gly-Phe-Trp-Glu-Trp-Thr
To these peptides there correspond, respectively, 256 (4.sup.3 .times.2.sup.2) and 64 (4.sup.2 .times.2.sup.2) oligonucleotides coding for the latter, represented by the formulae below.
A A A C C C G C GT GA GG CA AC probe 1(SEQ ID NO:9) G T G A G T T T A A C C A C GG TT TGGGA TGGAC probe 2(SEQ ID NO:10) G T G G T T
3) Labelling of probe 1 and probe 2
The probes are labelled with terminal deoxynucleotidyl transferase (TdT) (marketed by Stratagene, ref.: 600 132).
The reaction is performed on 100 ng of a mixture of oligonucleotides dissolved in "Cobalt" reaction buffer (supplied at 10-fold concentration by IBI Inc.): 1.4M potassium cacodylate pH 7.2, 300 mM dithiothreitol, 1 .mu.l of terminal deoxynucleotidyl transferase enzyme (Stratagene) and 50 .mu.Ci of .sup.32 P-labelled deoxycytidine triphosphate dCTP.
The reaction is carried out at 37.degree. C. for 10 minutes and is then stopped by adding 1 .mu.l of 0.5M EDTA.
The products are extracted with phenol and the mixture is dialysed on a Biogel P 10 polyacrylamide column (Biorad: 150-1050).
Radiolabelled probe 1 and radiolabelled probe 2 are thereby obtained.
4) Hydrolysis of Cryphonectria parasitica genomic DNA
The genomic DNA obtained at the end of 1) was subjected separately to a digestion with each of the following restriction enzymes: EcoRI, HindIII and BamHI. In each case, 10 .mu.g of the digestion product were spotted on 0.8% agarose gel and subjected to electrophoresis in the presence of a series of radiolabelled size markers (Amersham ref. SJ5000). The DNA was then transferred onto a nitrocellulose filter (Biorad, ref. 162-0117) according to the technique well known to those skilled in the art under the name of Southern blotting, described in Maniatis, op. cit., this operation being repeated so as to obtain two nitrocellulose filters intended for hybridisation, one with probe 1, the other with probe 2.
5) Hybridisation
Each nitrocellulose filter treated according to the usual techniques (Maniatis et al., op. cit.) was first washed in a prehybridisation solution containing 6.times.SSC, 10.times.Denhardt's and 100 .mu.g/ml of sonicated and denatured salmon sperm DNA (Sigma D9156) for a few hours at 42.degree. C., and then incubated in the same solution and under the same conditions as those stated above in the presence of one of the labelled probes 1 and 2. The hybridisation is left to proceed overnight. The 6.times.SSC solution is obtained by dilution of a 20.times.SSC solution. The preparation of the 20.times.SSC buffer is described in Maniatis, op. cit. In brief, this buffer contains 175.3 g/l of NaCl and 88.2 g/l of sodium citrate, and is adjusted to pH 7 with a few drops of 1N NaOH. The 10.times.Denhardt's solution contains 1 g of Ficoll, 1 g of polyvinylpyrrolidone and 1 g of bovine serum albumin per 500 ml final volume.
After the hybridisation, each of the filters is washed individually in a solution containing 0.5 SSC at 42.degree. C. The filters are then exposed to a photographic film (Kodak XAR5) overnight. Analysis of the developed film shows, in the case of the hydrolysate obtained with the enzyme HindIII, that a band whose molecular weight corresponds approximately to a fragment of size slightly greater than 2.1 kb responds positively with both radio-labelled probes.
6) Cloning of an approximately 2.1-kb HindIII-HindIII DNA- fragment which hybridises with the radio-labelled probes 1 and 2
a) Formation of a library of genomic DNA.
100 .mu.g of Cryphonectria parasitica DNA are hydrolysed with the enzyme HindIII and the fragments are separated by electrophoresis on 0.8% agarose gel. The region which corresponds to the fragments of size slightly greater than 2.1 kb is cut out and the DNA is purified by adsorption on silica milk (Geneclean Tm, Biorad P.O. Box 2284, La Jolla, Calif. 92038-2284). These fragments are ligated using phage T4 DNA ligase (Gibco BRL) in pBR322 which has been hydrolysed with HindIII and dephosphorylated (Biolabs Ref. 321). Competent cells (that is to say cells capable of being transformed) (RRI cells, Gibco BRL, Ref. 520-8261 SA) are transformed, as directed by the supplier, with the ligation solution and plated out on agar medium, referred to as LB agar medium (Maniatis, op. cit.), of composition specified in Table 4 below. The collection of colonies obtained is the library of genomic DNA.
TABLE 4______________________________________Composition of LB agar medium______________________________________Bacto tryptone casein hydrolysate (Difco) 10 g/l Bacto yeast extract (Difco) 5 g/l NaCl 10 g/l Adjust the pH to 7.0 using 5N NaOH Bacto agar (Difco) 15 g/l Autoclave for 20 min at 120.degree. C.______________________________________
b) Selection of clones carrying the HindIII--HindIII fragment which hybridises with the radiolabelled probes 1 and 2, referred to as fragment A.
The colonies obtained after transformation are adsorbed on a nitrocellulose filter (Schleicher and Schull, Ref. 40117) and replicated on two other nitrocellulose filters. A first series of filters is hybridised with radiolabelled probe 1 and a second series of filters is hybridised with radiolabelled probe 2. The prehybridisation, hybridisation and washing conditions are the same as those used previously (see 5 above).
The clones which respond positively with both probes are purified. The plasmid DNA of one of these clones is isolated. The corresponding plasmid is referred to as p472. After checking that it did indeed hybridise with each of the two radiolabelled probes 1 and 2, the 2.1-kb HindIII--HindIII fragment carried on this plasmid was isolated and subcloned into M13mpl9 (Pharmacia). This fragment is referred to as fragment A. It was sequenced by the cyclone technique (IBI "Cyclone I Biosystem").
The nucleotide sequence of the fragment A is shown in FIG. 2, which also indicates the numbering of the nucleotides, chosen arbitrarily so as to assign No. 1 to the nucleotide of the 5' end of the fragment A, as well as the amino acid sequence translated.
7) Description of the sequence of the frament A (see FIG. 2 (SEQ ID NO:32))
The fragment A carries the nucleotide sequence coding for the peptide sequence of mature endothiapepsin exported into the culture medium, described by Barkolt (see FIG. 1), which begins at nucleotide 694 and ends at nucleotide 1861 and is interrupted by two introns located at nucleotides 850-938 and 1279-1367. Upstream of nucleotide 694, the open reading frame continues as far as nucleotide 566, where there is a signal characteristic of the end of an intron: AG. At nucleotides 468-469, there is a signal characteristic of the beginning of an intron: GT. It will be noted that the sequence straddling the beginning of the intron and the end of the exon, namely AAGGTGAGT, corresponds to the 5' consensus sequence of the splicing junction described by Mount S. M., 1982, Nucl. Ac. Res., 10, 459-472. Upstream of nucleotide 468, there is only a single open reading frame (frame not interrupted by a stop codon) containing at least one ATG. This frame contains an ATG at position 365-367 (the nucleotide environment of which is compatible with M. Kozak, 1984, Nucl. Ac. Res. 12, p. 2) and an ATG at position 329-331, this reading frame being interrupted by the stop codon TAG at position 305-307. University of Wisconsin software U.W.G.C.G.: Devereux et al., 1984, Nucl. Ac. Res., 12, 8711-8721-Option: Testing for a signal peptide according to the method of G. von Heijne, 1986, Nucl. Ac. Res., 14, 483-490, predicts in this open reading frame a single sequence coding for a signal peptide, the sequence below (SEQ ID NO:11), referred to as a pre nucleotide sequence (beginning at nucleotide 329):
ATGTCTT CCCCTCTCAA GAACGCCTTG GTGACCGCCA TGTTGGCTGG - TGGTGCTCTC AGC
coding for the signal peptide of 20 amino acids of the following sequence, referred to as a pre peptide sequence (SEQ ID NO:12):
Met Ser Ser Pro Leu Lys Asn Ala Leu Val Thr Ala Met Leu Ala Gly Gly Ala Leu Ser
A signal peptide is expected by those skilled in the art, since endothiapepsin is a secreted protein, which requires the presence of a signal peptide.
Between the sequence coding for the above signal peptide and that coding for the mature protein, there is the following nucleotide sequence (SEQ ID NO:13), referred to as a pro nucleotide sequence (beginning at nucleotide 389):
TCGCCTA CAAAGCAACA CGTTGGAATT CCCGTCAACG - CCTCTCCTGA AGTTGGCCCC GGAAAGTACT CGTTCAAGCA AGTCCGGAAC - CCCAACTACA AGTTCAACGG GCCTCTGTCG GTCAAGAAGA CGTACCTCAA - GTACGGCGTG CCGATCCCAG CCTGGCTGGA GGATGCTGTC CAGAACTCTA - CCTCGGGCCT GGCTGAGCGC
coding for the following peptide sequence, referred to as a pro peptide sequence (SEQ ID NO:14).
Ser Pro Thr Lys Gln His Val Gly Ile Pro Val Asn Ala Ser Pro Glu Val - Gly Pro Gly Lys Tyr Ser Phe Lys Gln Val Arg Asn Pro Asn Tyr Lys Phe - Asn Gly Pro Leu Ser Val Lys Lys Thr Tyr Leu Lys Tyr Gly Val Pro Ile - Pro Ala Trp Leu Glu Asp Ala Val Gln Asn Ser Thr Ser Gly Leu Ala Glu - Arg
A pro peptide sequence (389-693) is also expected by those skilled in the art, since it has the function of inhibiting endothiapepsin, which is probably toxic to C. parasitica, before it is exported to the outer medium, following which this sequence is cleaved off.
There is hence upstream of the sequence coding for mature endothiapepsin the sequence coding for the following prepro peptide sequence (SEQ ID NO:15):
Met Ser Ser Pro Leu Lys Asn Ala Leu Val Thr Ala Met Leu Ala Gly Gly - Ala Leu Ser Ser Pro Thr Lys Gln His Val Gly Ile Pro Val Asn Ala Ser - Pro Glu Val Gly Pro Gly Lys Tyr Ser Phe Lys Gln Val Arg Asn Pro Asn - Tyr Lys Phe Asn Gly Pro Leu Ser Val Lys Lys Thr Tyr Leu Lys Tyr Gly - Val Pro Ile Pro Ala Trp Leu Glu Asp Ala Val Gln Asn Ser Thr Ser Gly - Leu Ala Glu Arg
The nucleotide sequence beginning at nucleotide 329 (FIG. 2) and ending at nucleotide 1861 (FIG. 2), interrupted by three introns, is shown in FIG. 5, the introns being underlined, and hence codes for preproendothiapepsin, the amino acid sequence of which is shown in FIG. 3.
The fragment A comprises in addition a sequence of 328 nucleotides on the 5' side of the initiation ATG (329-331) and a sequence of 275 nucleotides on the 3' side of the TAA stop codon (1862-1864), which contains several potential polyadenylation sites.
The portion of the fragment A on the 5' side of the initiation ATG comprises, on the one hand the untranslated 5' end of the messenger RNA, and on the other hand, upstream of this end, a TATAA sequence (187-191), usually referred to as a TATA box, a consensus sequence present in most promoters of eukaryotes (Ballance D. J., 1986, Yeast, 2, 229-236). In contrast, this portion does not comprise a sequence of the type usually referred to as an upstream activating sequence (UAS) or an upstream regulatory sequence (URS), which are present, for example, in Saccharomyces (Guarente L., 1988, all, 52, 303-305) and in Neurospora (Frederick G. D., 1990,Mol. Gen. Gent., 221, 148-154). There is hence no promoter-activating region upstream of the TATA box in the fragment A. The promoter is hence not functional, as will be shown in Section 6.
Section 2
Isolation of the fragment B, an approximately 32.6-kb fragment of genomic DNA containing the coding sequence of the endothiapepsin precursor.
1) Preparation of C. parasitica DNA
Genomic DNA of C. parasitica SEBR 103 was prepared according to a protocol similar to that described by B. TURCQ (University Thesis: specialist field Life Sciences, examined orally on Jan. 6, 1989 at the University of BORDEAUX II), summarised below.
Preparation of protoplasts
The mycelium originating from 250 ml of culture broth of Cryphonectria parasitica strain SEBR 103, prepared as described in Section 1, is filtered off on gauze and then rinsed with 50 ml of 1M MgSO.sub.4. After incubation for 30 min at 37.degree. C., the mycelium is again filtered off on gauze and taken up in 20 ml of 1M MgSO.sub.4. 20 ml of 1M MgSO.sub.4 containing 10 mg/l of the enzyme mixture CAYLASE C3 (company CAYLA), consisting of chitinases and .beta.-1,3-, .beta.-1,6-, .alpha.-1,3- and .alpha.-1,4-glucanases as well as other polysaccharidases, are then added and the resulting mixture is incubated for 1 h 30 min at 37.degree. C. with gentle stirring. After filtration of the mixture, the filtrate is centrifuged for 10 min at 3,000 g, and the protoplast pellet obtained is taken up in 20 ml of a buffer, referred to as ST buffer, of composition 0.8M sorbitol, 100 mM Tris-HCl, pH 7.5.
Extraction of genomic DNA from the protoplasts
After a further centrifugation for 10 min at 3,000 g, the protoplast pellet is taken up with 14 ml of lysis buffer (100 mM Tris-HCl pH 9, 35 mM EDTA pH 8; 4% (weight/volume) SDS; proteinase K (Sigma) 600 .mu.g/ml), and the mixture is then incubated for 1 h at 50.degree. C. After a centrifugation for 10 min at 12,000 g, the supernatant volume is adjusted to 15.5 ml with TE buffer of composition 10 mM Tris-HCl pH 8, 1 mM EDTA, and 19.53 g of CsCl are then added. After an ultracentrifugation (16 h at 50,000 rpm in a vertical rotor), the gradient is collected in fractions, which are dialysed against buffer of composition 10 mM Tris-HCl pH 8, 1 mM EDTA, and analysed on 0.8% agarose gel. The fraction possessing a spectrometric ratio between the absorption at 260 nm and the absorption at 280 nm in the region of 1.8 was retained.
Construction of the cosmid library
Approximately 10 .mu.g of genomic DNA of the above fraction were subjected to a partial digestion with the restriction enzyme MboI and ligated using T4 ligase to cosmid pHC79-ura5, an approximately 8-kb cosmid vector constructed by inserting the EcoRI-EcoRI fragment containing the ura5 gene (Begueret et al., 1984, Gene, 32 487-492) at the EcoRI site of the commercially available cosmid pHC79 (marketed by BRL and constructed by HOHN B. et al., 1980, Gene, 11, 291-298), the cosmid pHC79-ura5 having been linearised beforehand with the endonuclease BamHI and dephosphorylated with alkaline phosphatase (Promega ref. CIP--M 204).
The ligation mixture was packaged in phage particles using the Stratagene "Gigapack plus" kit, and was used for transforming the E. coli receptor strain LE 392 (Murray et al., 1977,Mol. gen. Genet. 150, p. 53), com-mercially available and distributed by Genofit. After plating out on LB agar medium (see Table 4) supplemented with 100 mg/l of ampicillin, approximately 4,500 ampicillin-resistant clones thereby obtained were subcultured individually on microtitration plates containing LB liquid medium, of composition specified in Table 4 -but without agar, and stored at -80.degree. C. It was shown by digestion of cosmids extracted from some 12 clones taken at random that the average size of the inserts of the library was approximately 37 kb.
2) Screening of the library by hybridisation with the fragment A
The fragment A containing the endothiapepsin structural gene was used as a probe for hybridisation experiments. Initially, the clones contained in the microtitration plates were subcultured in Petri dishes containing LB agar medium (see Table 4) with the addition of ampicillin, and then transferred onto nylon membranes (Hybond N.sup.+, Amersham). The bacteria were then lysed using a solution containing 1.5M NaCl and 0.5M NaOH. After treatment with a solution of proteinase K (Sigma) for 30 min at 37.degree. C., the filters are washed with 2.times.SSC (NaCl 17.5 g/l, sodium citrate 8.82 g/l, pH 7) and pre-hybridised at 42.degree. C. for 20 min. The filters are hybridised at 42.degree. C. overnight with the fragment A isolated in Example 1, labelled with horseradish peroxidase (Amersham), and are revealed with the "Gene detection system" ECL chemiluminescent probe kit (RPN 2101, Amersham). The hybridisation signals obtained are visualised on a suitable film. Of the 4,500 clones of the library, 2 clones gave a positive signal. These two clones, hereinafter designated 8H12 and 41H7 and containing, respectively, the cosmids referred to as p8H12 and p41H7, were subcultured on LB liquid medium containing 100 mg/l of ampicillin. After culturing overnight at 37.degree. C., the cosmids are extracted by the method of lysis in an alkaline medium and purified by ultracentrifugation with caesium chloride and ethidium bromide according to the techniques described in Maniatis, op. cit. The cosmids thus purified were digested with the enzyme HindIII and the fragments obtained were subjected to electrophoresis on 0.8% agarose gel. Southern blotting on a nylon membrane was performed, and the filter was hybridised with the fragment A using the technique described above. The presence of this fragment in each of the cosmids p8H12 and p41H7 was thereby confirmed.
3) Physical analysis of the Positive cosmids p8H12 and p41H7
It was found that the restriction profiles of cosmids p8H12 and p41H7, obtained using the enzymes NotI, SmaI, SfiI, XbaI, BamHI and PvuI, were identical, thereby indicating that this region of the genomic DNA containing the gene coding for endothiapepsin of C. parasitica was cloned without rearrangement for these two clones. The restriction profile for cosmid p8H12, the cosmid adopted for the next part of the study, is given in Table 5 below.
TABLE 5______________________________________Restriction profile of cosmid p8H12 Number of Restriction cleavage TOTAL enzyme sites Size in kb in kb______________________________________NotI 1 not determined -- SmaI 2 not determined -- SfiI 3 20; 16; 4.1 40.1 XbaI 4 23; 14; 2.9; 1.2 41.1 BamHI 5 15; 9; 7; 7; 2.6 40.6 PvuI 5 23; 7.4; 6.4; 2.1; 40.4 1.5 Average 40.6______________________________________
This profile makes it possible to calculate the average size of cosmid p8H12, equal to approximately 40.6 kb, and hence that of the genomic insert, equal to approximately 40.6-8.0=32.6 kb. This genomic insert is referred to as fragment B.
It was shown, moreover, by Southern blotting on a nylon membrane, that the approximately 9-kb BamHI--BamHI fragment (see Table 5), hereinafter referred to as fragment C, was the only BamHI--BamHI fragment to be hybridised with the fragment A used as a probe; it hence contained the whole of this fragment.
Section 3
Cloning of the fragment C, an approximately 9-kb fragment of genomic DNA containing the coding sequence of the endothiapepsin precursor.
10 .mu.g of cosmid p8H12 were digested with the endonuclease BamHI and the different fragments were separated on 0.8% agarose gel.
The product of digestion with the enzyme BamHI, containing the fragment C, was ligated using T4 DNA ligase (Gibco BRL) to plasmid pBR322 opened at the BamHI site and dephosphorylated (marketed by Biolabs--ref. 320). The ligation product was used to transform competent cells of E. coli strain K12 RR1 (Gibco BRL ref. 520-8261A). After the transformation mixture has been plated out on Petri dishes containing LB agar medium supplemented with ampicillin (100 .mu.g/ml), and incubation of the dishes at 37.degree. C. for 24 h, the colonies are replicated on nylon membranes; the bacteria are then lysed and the membranes are thereafter hybridised with the fragment A, as described above in Section 2.2). 18 colonies containing DNA which hybridises with the fragment A were thereby detected. Their plasmid DNA content was extracted and analysed on 0.8% agarose gel after digestion with the endonuclease BamHI. It was thus verified that all these colonies contained a plasmid derived from pBR322 which had an approximately 9-kb fragment inserted at the BamHI site. A clone referred to as SEBR 3104, containing the plasmid designated pEp1, was chosen for the next part of the study. The clone SEBR 3104 was deposited with the CNCM under No. I-998.
Plasmid pEp1 was subjected to single and/or multiple digestions using the enzymes BamHI, HindIII, PstI, SacI, SphI, BglII and ScaI. The restriction map obtained is shown in FIG. 4, the symbols B, H. P, Sp, C, G and S representing, respectively, BamHI, HindIII, PstI, SphI, SacI, BglII and ScaI, the initiation codon of the endothiapepsin gene of C. parasitica being indicated by an i and the arrow indicating the direction of transcription of the endothiapepsin gene. The fragment A described in Section 2, as well as the fragments D, E and F described in Sections 4 and 5, are also shown in this figure.
It is apparent that the BamHI site (B) which forms the 5' end of the fragment C is located approximately 4 kb from the initiation codon, and that the BglII site (G) on the 5' side is located approximately 3 kb from the initiation codon. It hence appears to be advantageous to isolate and clone the approximately 5.1-kb BglII-BglII fragment containing the whole of the fragment A, referred to as fragment D, and which probably contains the information necessary for expression of the endothiapepsin precursor.
Section 4
Cloning of the fragment D, an approximately 5.2-kb fragment of genomic DNA containing the coding sequence of the endothiapepsin precursor.
20 .mu.g of plasmid pEp1 were digested with the enzyme BglII (see FIG. 4) and the digestion products were separated on 0.8% low-melting-temperature agarose (Sigma --Ref. A9414) gel. After staining of the agarose gel with ethidium bromide, the agarose band containing the approximately 5.2-kb fragment D is cut out with a scalpel under ultraviolet light at 310 nm. The DNA is then extracted according to the instructions in the NACS. 52PREPAC kit (Gibco BRL), and thereafter diluted in 10 .mu.l of TE buffer of composition 10 mM Tris-HCl pH 8, 1 mM EDTA; 1 .mu.l of the suspension obtained was ligated using T4 DNA ligase (Gibco BRL) to plasmid pBT6, derived from plasmid pBT3 by the insertion of a BglII linker at the SmaI site of the polylinker of pUC12. Plasmid pBT3, described by Orbach M. J. et al., 1986,Mol. Cell. Biol., 6, 2452-2461, carries a mutated gene for .beta.-tubulin of Neurospora crassa (a filamentous ascomycete fungus) conferring benomyl resistance (dominant selection marker). Before ligation, plasmid pBT6 was linearised with the endonuclease BglII and dephosphorylated with alkaline phosphatase (Promega, Ref. CIP-M204).
The ligation product was used to transform competent cells of E. coli strain K12 RR1 (Gibco BRL Ref. 530-8261SA). After the transformation mixture has been plated out on Petri dishes containing LB agar medium supplemented with ampicillin (100 .mu.g/ml), and incubation of the dishes at 37.degree. C. for 24 h, the colonies are replicated on nylon membranes. The bacteria are then lysed, and the membranes are thereafter hybridised with the fragment A, as described in Section 2.2). Two colonies containing DNA which hybridises with the fragment A were thereby detected. Their plasmid DNA content was extracted and analysed on 0.8% agarose gel after digestion with the endonuclease BglII. It was thus verified that these two colonies contained a plasmid derived from pBT6 which had the approximately 5.2-kb fragment D inserted in both possible orientations at the BglII site. A clone containing this plasmid, designated plasmid pEp2, was chosen for the next part of the study.
Section 5
Cloning of the fragment F, an approximately 3.5-kb fragment of genomic DNA containing the coding sequence of the endothiapepsin precursor.
The cloning was carried out in two steps. First, the approximately 3.7-kb fragment E containing the whole of the fragment F was cloned into plasmid pUC18 at the SphI site of the polylinker. Plasmid pEp3 thereby obtained enabled the fragment F to be purified, which fragment was then subcloned in its turn into plasmid pUC18 at the BamHI site of the polylinker. Plasmid pEp4 was thereby obtained.
1) Construction of plasmid pEp3
1 .mu.g of plasmid pEp1 was digested with the enzyme SphI (see FIG. 4), and the DNA was then purified with 0.1 volume of 3M sodium acetate and 2 volumes of ethanol. An approximately 3.7-kb SphI fragment, referred to as fragment E, was thereby obtained. The DNA was then dissolved in 40 .mu.l of TE buffer of composition (10 mM Tris-HCl pH 8, 1 mM EDTA) and thereafter dialysed on a P10 column (Pharmacia). 1 .mu.l of the mixture obtained above was then ligated using T4 DNA ligase (Gibco BRL) with approximately 25 ng of plasmid pUC18 previously linearised with the endonuclease SphI and dephosphorylated with alkaline phosphatase (Promega, Ref. CIP-M204). The ligation product was used to transform competent cells of E. coli strain DH5a (Gibco BRL, Ref. 530-8263 SA). After the transformation mixture had been plated out on Petri dishes containing LB agar medium supplemented with ampicillin (100 .mu.g/ml), X-gal (40 .mu.g/ml) and IPTG (2 .mu.g/ml), and incubation of the dishes at 37.degree. C. for 24 h, 350 white colonies were subcultured on the same medium. The colonies were then replicated on nylon membranes, the bacteria were thereafter lysed and finally the membranes were hybridised with the fragment A as described above in Section 2.2). 37 colonies containing DNA which hybridises with the fragment A were thereby detected.
The plasmid DNA of 30 clones was extracted and analysed on 0.8% agarose gel after digestion with the endonuclease SphI. Two colonies containing a plasmid derived from pUC18 which had the 3.7-kb fragment E inserted (in both possible orientations) at the SphI site were retained. These plasmids were referred to as pEp3(a) and pEp3(b). In plasmid pEp3(b), the BglII site of the fragment E is at a distance of approximately 3.5 kb from the BamHI site located on the polylinker of pUC18.
2) Construction of plasmid pEp4
10 .mu.g of plasmid pEp3(b) were subjected to three successive digestions with the endonucleases BglII, BamHI and PvuI, and the digestion products were separated on 0.8% agarose gel. After staining of the gel with ethidium bromide, the agarose band containing the approximately 3.5-kb SphI fragment, designated fragment E, mixed with an SphI-BamHI fragment of the polylinker of pUC18, was cut out with a scalpel under ultraviolet light at 310 nm. The DNA is then extracted and thereafter dissolved in 20 .mu.l of TE buffer of composition (10 mM Tris-HCl pH 8, 1 mM EDTA). 5 .mu.l of the suspension obtained were ligated to approximately 750 ng of plasmid pUC18 previously linearised with the endonuclease BamHI and dephosphorylated with alkaline phosphatase. The ligation product was used to transform competent cells of E. coli strain DH5.alpha. according to the protocol described above. The plasmid DNA of 30 while colonies was extracted and analysed on 0.8% agarose gel after digestion with the endonucleases BamHI, BglII or SmaI. A colony was adopted which contains a plasmid derived from pUC18 which has the approximately 3.5-kb fragment F, mixed with an SphI-BamHI fragment of the polylinker of pUC18, inserted at the BamHI site. This plasmid was designated pEp4.
3) Determination of the sequence of the SphI-HindIII segment of the segment F
This sequence, determined as above (see Section 1), is shown in FIG. 12. It contains signals for activation of the promoter of the gene coding for preproendothiapepsin, as will be shown in Section 10.
Section 6
Transformation of C. parasitica with each of the vectors containing one of the fragments A, B and C.
Preparation of protoplasts
The mycelium originating from 250 ml of the culture broth of C. parasitica strain SEBR 103, prepared as described in Section 1, is rinsed with 50 ml of 1M MgSO.sub.4. After incubation for 30 min at 37.degree. C., the mycelium is filtered off on gauze and taken up in 20 ml of 1M MgSO.sub.4. 20 ml of 1M MgSO4 containing 10 mg/l of the enzyme mixture CAYLASE C3 (company CAYLA), consisting of chitinases and .beta.-1,3-, .beta.-1,6-, .alpha.-1,3- and .alpha.-1,4-glucanases as well as other polysaccharidases, are then added and the resulting mixture is incubated for 1 h 30 min at 37.degree. C. with gentle stirring. After filtration of the mixture, the filtrate is centrifuged for 10 min at 3,000 g, and the protoplast pellet obtained is then taken up in 15 ml of the buffer, referred to as ST buffer, of composition 0.8M sorbitol, 100 mM Tris-HCl, pH 7.5. After a further centrifugation for 10 min at 3,000 g, the pellet is taken up in 10 ml of a buffer, referred to as STC10 buffer, of composition 0.8M sorbitol, 100 mM Tris-HCl pH 7.5, 10 mM CaCl.sub.2. The protoplasts are then counted using a Malassez cell, so as to adjust their concentration to 10.sup.8 /ml after centrifugation for 10 min at 3,000 g and taking up the pellet in a buffer, referred to as STC50 buffer, of composition 0.8M sorbitol, 100 mM Tris-HCl pH 7.5, 50 mM CaCl.sub.2.
Cotransformation of protoplasts with cosmid p8H12 and plasmid pBT3
Cosmid p8H12 which contains the fragment B (see Section 2) does not carry a dominant selection marker (usable for direct selection). Plasmid pBT3, described by Orbach M. J. et al., 1986,Mol. Cell. Biol., 6, 2452-2461, which carries a mutated gene for .beta.-tubulin of Neurospora crassa (filamentous Ascomycete fungus) conferring resistance to benomyl (dominant selection marker) was hence used jointly with cosmid p8H12 (cotransformation method: see the work on cotransformation of Aspergillus niger of Wernars K. et al., 1987,Mol. Gen. Genet., 209, 71-77).
A mixture composed of 1 .mu.g of plasmid pBT3, previously purified by ultracentrifugation in a buffer containing caesium chloride and ethidium bromide according to the techniques described in Sambrook, op. cit., and 4 .mu.g of cosmid p8H12, purified in the same manner, in 10 ml of TE buffer of composition (10 mM Tris-HCl pH 8, 1 mM EDTA), is incubated for 20 minutes at 0.degree. C. with 100 ml of the protoplast preparation prepared above (equivalent to 10.sup.7 protoplasts). After the addition of 1 ml of a solution consisting of 60% (weight/volume) of PEG 4000 (polyethylene glycol of molecular mass 4000) and buffer of composition 20 mM Tris-HCl pH 7.5, 100 mM CaCl.sub.2, and incubation of the mixture for 10 min at room temperature, 1 ml of STC10 buffer (defined above) is mixed with the mixture. The protoplasts thus treated are included in 60 ml of agar medium containing 1 mg/l of Benlate (antifungal marketed by Dupont Nemours), referred to as medium D and whose composition is specified in Table 6 below, maintained supercooled at 45.degree. C. The supercooled mixture is plated out on Petri dishes containing an agar medium supplemented with 1 mg/l of Benlate (antifungal marketed by Dupont Nemours which contains 50% of benomyl), referred to as medium C and whose composition is specified in Table 7 below. The Petri dishes are incubated at 28.degree. C. for the time necessary for the appearance of benomyl-resistant regenerated protoplasts. The regenerated transformants thereby obtained are referred to as 29Pn, n designating the number of the clone under consideration. The benomyl resistance of the clones is confirmed by subculturing mycelial implants of each clone on medium B made into an agar medium by adding 20 g/l of agar and supplemented with 1 mg/l of Benlate.
Only the clones which grow on this medium are set up for sporulation according to the method described in Section 1.1). The conidiospres obtained are harvested in bulk in a buffer containing at least 15% of glycerol and stored at -80.degree. C.
TABLE 6______________________________________Composition of medium D______________________________________Sucrose 250 g/l Glucose 20 g/l Thiamine 2 g/l Asparagine 100 mg/l Malt extract 0.2 g/l Agar 20 g/l Saline solution 1 (composition 62.5 ml specified in Table 2) Adjust the pH to 6.0 using 1N HCl or 1N NaOH, Autoclave for 30 min at 110.degree. C., then Add 1 mg/l of Benlate to the medium cooled to 60.degree. C.______________________________________
TABLE 7______________________________________Composition of medium C______________________________________Medium D 750 ml/l STC10 buffer 250 ml/l (of composition 0.8M sorbitol, 100 mM Tris-HCl pH 7.5, 10 mM CaCl.sub.2) Adjust the pH to 6.0 Add 1 mg/l of Benlate to the medium autoclaved at 60.degree. C.______________________________________
Cotransformation of protoplasts with plasmid p472 and plasmid PBT3 on the one hand, as well as with plasmid pEp1 and plasmid pBT3 on the other hand
Neither plasmid p472 which contains the fragment A (see Section 1) nor plasmid pEp1 which contains the fragment C (see Section 3) carries a dominant selection marker.
C. parasitica strain SEBR 103 was cotransformed according to a protocol identical to that described in the subsection above, with the following mixtures of plasmids: 4 .mu.g of pEp1 and 1 .mu.g of pBT3, 4 .mu.g of p472 and 1 .mu.g of pBT3. The transformants thereby obtained are referred to as 30Pn for the cotransformation with plasmids pEp1 and pBT3, and 31Pn for the cotransformation with plasmids p472 and pBT3, n designating the number of the clone under consideration.
Section 7
Selection of transformed strains over-productive of endothiapepsin.
1) General method
a) Selection on agar medium containing casein
Mycelial implants of approximately 100 benomylresistant colonies were subcultured on an agar medium containing casein, referred to as medium E and whose composition is specified in Table 8 below. On this medium, Cryphonectria parasitica colonies which produce the protease give rise to a halo of precipitation whose area is proportional to the quantity of endothiapepsin secreted.
The overproductive strains are adopted on the basis of a ratio of the diameter of the halo of precipitation to the diameter of the colony, the ratio being significantly higher than that for the untransformed control strain. A preparation of conidiospores of these overproductive strains is made according to the method used in Section 1.1). In addition, it was verified by adding 5 .mu.g/ml of pepstatin, a substance specifically inhibiting aspartic proteases, to medium E that the increase in the halos observed in the overproductive strains was reduced. This result shows that the observed effect is indeed due to an overproduction of an aspartic protease.
b) Selection in liquid medium
.alpha.) Study in flasks:
To confirm this result, tests of production in flasks were carried out in the following manner: inoculation of 250-ml flasks containing 40 ml of medium F whose composition is specified below. The flasks are then incubated at 28.degree. C. on an eccentric rotary agitator adjusted to 220 rpm for 48 h. For each strain, culturing was carried out in 3 different flasks and the mean of the results of assay of coagulant activity for the 3 flasks was calculated. The control consists of untransformed Cryphonectria parasitica strain SEBR 103. The assay of coagulant activity is carried out according to the official method of determination of the enzyme content of coagulant solutions, published in the Journal Officiel de la Republique Fran.cedilla.aise (Official Journal of the French Republic) of Mar. 20, 1981 (section C), summarised below:
1 ml of culture supernatant diluted with water so as to obtain a coagulation time of between 5 and 10 min is added to 10 ml of standardised milk (supplied by INRA--Experimental Dairy Station-39800 POLIGNY), placed in a suitable bottle;
the coagulation time, identified by the appearance of a flocculation of the milk on the wall of the bottle when rotated in a waterbath at 30.degree. C., is measured;
the coagulant activity, designated CA, expressed in mg/l, is given by the formula: ##EQU1## with K and a factors dependent on the milk and on the enzyme under consideration (expressed in mgs/l and in s, respectively).
T: coagulation time (expressed in seconds)
.alpha.: dilution factor.
.beta.) Study under fermenter conditions
The production of endothiapepsin was assessed in a 2-1 fermenter (Biolaffite) containing 1.2 l of a culture medium obtained by concentration of medium F, sterilised by autoclaving for 45 min at 120.degree. C. The culture conditions are as follows: agitation at 800 rpm; aeration: 2 vvm (vvm: volume of air per volume of medium per min). The fermenter is inoculated in the proportion of 5% (v/v) with a flask preculture as described above (in .alpha.). The temperature is maintained at 28.degree. C. Measurement of the coagulant activity is performed after approximately 90 h of fermentation according to the assay method described above.
It is verified by determination of the dry weight of the culture that the quantity of biomass produced by the overproductive transformants does not differ significantly from that produced by the control strain.
TABLE 8______________________________________Composition of medium E______________________________________KH.sub.2 PO.sub.4 0.36 g/l Na.sub.2 HPO.sub.4.2H.sub.2 O 0.71 g/l MgSO.sub.4.7H.sub.2 O 0.50 g/l NaCl 0.10 g/l Casein hydrolysate 0.05 g/l (Difco casamino acids) Casein (Hammarsten) 6.0 g/l CaCl.sub.2 0.06 g/l Saline solution 2 10 ml/l (composition specified in Table 2 of Example 2) Leave stirring for 15 min so as to avoid foam formation. Add 15 g of agar (Difco Bacto-agar). Adjust the pH to 6.2 using 1N HCl or 1N NaOH. Autoclave for 20 min at 120.degree. C.______________________________________
TABLE 9______________________________________Composition of medium F______________________________________Cottonseed meal 10 g/l Glucose 35 g/l Ca(NO.sub.3).sub.2 3.5 g/l CaCO.sub.3 0.75 g/l Linseed oil 2.5 ml/l Sodium oleate 1.5 g/l Adjust the pH to 6.20 using 1N HCl or 1N NaOH. Autoclave for 45 min at 120.degree. C.______________________________________
Analysis of the enzyme secreted by the transformants
The fermentation must obtained after culturing (either in flasks or in fermenters) the overproductive transformants and the untransformed C. parasitica control strain SEBR 103 was subjected to a centrifugation so as to remove the mycelial mass. After denaturation of the proteins in the supernatant in the presence of SDS for 5 min at 100.degree. C., electrophoresis was performed on polyacrylamide gel in the presence of SDS. After staining with Coomassie blue, a predominant band of molecular mass in the region of 36 kDa is observed, corresponding to the molecular mass of mature endothiapepsin deduced from its sequence (see FIG. 1) and more intensely stained in the case of the overproductive transformants than in the case of the control strain; and bands of lesser importance which are identical for the overproductive transformants and the control strain.
It was verified, moreover, by an antigen-antibody reaction (Rennetest kit, France Biochem) on the culture supernatants of the overproductive transformants and of the untransformed control strain that the secreted enzyme is identical to that of Cryphonectria parasitica according to the identification method described in the Journal Officiel de la Repulique Fran.cedilla.aise (Official Journal of the French Republic) of Mar. 20, 1981.
In addition, the ratio of coagulant activity to proteolytic activity of the secreted enzyme was assessed. The coagulant activity, expressed in g/l, is measured according to the method described above in subsection b) .alpha.); the proteolytic activity, expressed as glycine milliequivalents per litre, is measured using the TNBS reagent, described by R. Fields, Biochem. J. (1971) 124: 518-590, by assaying the amino groups which have appeared after proteolysis of dimethylcasein.
This ratio is between 0.045 and 0.050 for the overproductive transformants, which is very close to that obtained with the untransformed control strain. It may be concluded from these three studies that endothiapepsin production is indeed the feature which has been specifically increased in the overproductive transformants.
c) Verification of the integration of the fragment A, B or C by Southern blotting.
The genomic DNA of the selected transformants is prepared according to a protocol similar to that described by Raeder and Broda, 1965, Letters in Applied Microbiology 1, 17-20, summarised below:
The mycelium originating from a flask culture performed as described in Section 1.1) is lyophilised and filtered off on gauze. After rinsing in 20 mM EDTA solution, pH 8, the mycelium is again filtered off, then frozen at -80.degree. C. and lyophilised. 50 mg of the lyophilisate obtained are then ground and thereafter resuspended in 500 .mu.l of the following extraction buffer: 200 mM Tris-HCl pH 8.5, 250 mM NaCl, 25 mM EDTA, 0.5% SDS, proteinase K (Sigma) 200 .mu.g/ml. The mixture is incubated for 45 min at 45.degree. C., and the DNA is then extracted with phenol/chloroform and then precipitated with isopropanol. The pellet is then taken up in 100 .mu.l of TE (10 mM Tris-HCl pH 8, 1 mM EDTA).
The DNA is then digested with the appropriate endonucleases and the fragments obtained are separated by electrophoresis on 0.8% agarose gel. The fragments are transferred by capillarity onto a nylon membrane (Hybon N.sup.+ -Amersham) according to the method recommended by the manufacturer. The filters are then hybridised at 42.degree. C. overnight with, successively, the fragment A and the HindIII-HindIII fragment containing the mutated gene for .beta.-tubulin of Neurospora of plasmid pBT3, these fragments being labelled with horseradish peroxidase (Amersham) and revealed with the "Gene detection system" ECL chemiluminescent probe kit (RPN 2101, Amersham). The hybridisation signals obtained are visualised on a suitable film.
2) Selection of overproducers from among the 29Pn transformants (containing cosmid p8H12 which carries the fragment B--see Section 4)
164 benomyl-resistant colonies were obtained during the cotransformation with cosmid p8H12 and plasmid pBT3. 127 clones were chosen at random from among the latter for the selection test on agar medium containing casein, which enabled 14 clones to be adopted. From among the latter, 7 chosen at random were subjected to the selection test in liquid medium. 3 clones were thereby adopted; the clones 29P1, 29P2 and 29P3, possessing after flask culture a coagulant activity of 0.9, 1.07 and 0.94 g/l, respectively, whereas the untransformed control strain possesses an activity of 0.62 g/l (the overproduction factor, namely the ratio of the coagulant activity of the overproductive strain to the coagulant activity of the control strain is hence 1.45, 1.73 and 1.54, respectively). The clones 29P2 and 29P3 were then tested in a 2-1 fermenter, and produced a coagulant activity of 1.76 and 2.19 g/l, respectively, the control strain producing only 1.20 g/l (the overproduction factor is hence +1.47 and +1.83).
The clone 29P3 and the C. parasitica control strain SEBR 103 were cultured in a 20-1 fermenter under less limiting experimental conditions, especially as regards agitation, aeration and bulk transfer, and close to the conditions used in the industrial process.
This test enabled a quantity of endothiapepsin equal to approximately twice the quantity produced by the control strain to be obtained.
The 7 clones chosen above at random were analysed by Southern blotting. Their genomic DNA and that of the untransformed C. parasitica control strain SEBR 103 were digested with the enzyme SmaI, which generates only two cleavage sites in cosmid p8H12 and none in the fragment A. After hybridisation with the latter, two hybridisation bands were observed with the clones 29P1, 29P2 and 29P3 and a single hybridisation band, identical in size to one of the two bands mentioned above, with the control strain and the other clones not adopted after the selection test in liquid medium. The three overproductive clones 29P1, 29P2 and 29P3 have hence integrated a copy of cosmid p8H12 at a different locus of their genome, since the supernumerary bands observed differ in size. Finally, the Southern blot obtained above was hybridised with the HindIII fragment of plasmid pBT3 which confers benomyl resistance, and this enabled it to be established that the 7 benomyl-resistant clones all received at least one copy of plasmid pBT3, since they show several additional hybridisation bands compared with the control strain, the latter showing only one band corresponding to the endogenous .beta.-tubulin gene (.beta.-tubulin is a structural protein present in filamentous fungi, especially Neurospora crassa and C. parasitica).
These results show that the fragment B hence contains the signals necessary for the expression (and secretion) of endothiapepsin. It hence contains a functional gene for endothiapepsin, that is to say a sequence coding for an endothiapepsin precursor, flanked by a functional promoter and a functional terminator. This functional promoter hence comprises an activator region located upstream of the TATA box localised in the fragment A (see Section 1).
The addition of a further copy of this fragment to the genome of C. parasitica strain SEBR 103 by transformation enables transformed strains which overproduce endothiapepsin with a factor in the region of 2 to be obtained.
3) Selection of overproducers from among the 30Pn transformants (containing plasmid pEp1 which carries the fragment C: see Section 6)
663 benomyl-resistant colonies were obtained during the cotransformation with plasmid pEp1 and plasmid pBT3. 108 clones were chosen at random from among the latter for the selection test in agar medium containing casein, which enabled 32 clones to be adopted. It will be noted that this test enabled a markedly higher level (32/108) of overproducers to be adopted from among the 30Pn transformants than that obtained for the 29Pn transformants (14/127). This indicates that the frequency of cotransformation obtained with the approximately 13.4-kb plasmid pEp1 is greater than that obtained with the approximately 40.6-kb cosmid p8H12.
From among these 32 clones, 12 clones chosen at random were subjected to the selection test in liquid medium. 7 clones were thereby adopted: the clones 30P.sub.1, 30P.sub.2, 30P.sub.3, 30P.sub.4, 30P.sub.5, 30P.sub.8 and 30P.sub.7, possessing after flask culture a coagulant activity of 1.12, 1.06, 0.96, 1.12, 1.05, 0.88 and 0.90 g/l, respectively, whereas the untransformed control strain possesses an activity of 0.62 g/l (the overproduction factor is hence between +1.42 and +1.81).
The clones 30P.sub.1, 30P.sub.2 and 30P.sub.5 were then tested in a 2-1 fermenter, and produced a coagulant activity of 3.05, 3.0 and 3.04 g/l, respectively, the control strain producing only 1.20 g/l (the overproduction factor is hence +2.54, +2.50 and +2.53, respectively).
It is probable (see 2 above) that, under the non-limiting experimental conditions of the 20-1 fermenter, it would be possible to achieve an overproduction factor of approximately 3.
The 7 clones chosen above at random were analysed by Southern blotting. Their genomic DNAs and that of the untransformed C. parasitica control strain SEBR 103 were digested with the enzyme SacI, chosen since it generates only a single cleavage site in plasmid pEp1, a site localised in the fragment C outside the fragment A (see FIG. 4). After hybridisation for each of the 7 clones with the fragment A, at least two hybridisation bands (2 to 4 depending on the clone) were observed, including the band of the endogenous endothiapepsin gene also present for the control strain, the profile being different for each of the clones. For the clones 30P.sub.1, 30P.sub.2 and 30P.sub.5, a hybridisation band identical in size to that of the linearised plasmid pEp1 is observed among the bands, which indicates the probable integration in tandem of at least two additional copies of this plasmid.
It is, in effect, well known to those skilled in the art that the integration in tandem of several copies of a plasmid after transformation is a common event in filamentous fungi (Fincham J. R. S., March 1989,Microbiological Reviews, 148-170), and that digestion of the genomic DNA in which the plasmid has thereby been integrated, with an endonuclease generating only a single cleavage site in this plasmid, liberates this plasmid.
These results show that the fragment C contains all the signals necessary for the expression (and secretion) of endothiapepsin. It hence contains a functional gene for endothiapepsin, and hence a complete functional promoter. The promoter-activating region is hence located in the fragment C.
The addition of at least two further copies of this fragment to the genome of C. parasitica strain SEBR 103 enables transformed strains which overproduce endothiapepsin with a factor in the region of 3 to be obtained.
4) Selection of overproducers from among the 31Pn transformants (containing plasmid p472 which carries the fragment A: see Section 6)
840 benomyl-resistant colonies were obtained during the cotransformation with plasmid p472 and plasmid pBT3. 108 clones were chosen at random for the selection test on agar medium containing casein. In contrast to the results obtained above with the 29Pn and 30Pn cotransformants, no overproducer could be detected. Nevertheless, 5 clones 30P.sub.1, 30P.sub.2, 30P.sub.3, 30P.sub.4 and 30P.sub.5, chosen from among those giving a hydrolysis halo which was large but not significantly larger than that of the untransformed control strain, were subjected to the selection test in liquid medium. The abovementioned clones possess after flask culture a coagulant activity of 0.38, 0.66, 0.66, 0.56 and 0.65 g/l, respectively, whereas the control strain possesses an activity of 0.62 g/l (the difference found is hence -38, +6, +6, -22 and +4%). No significant overproduction is detected by this test in liquid medium, confirming the negative result of the selection test in casein agar medium.
Analysis by Southern blotting showed that the 5 clones integrated at least one copy of plasmid pBT3, and 3 clones out of 5 are genuinely cotransformed by plasmid pBT3 and plasmid p472. The addition of a further copy of the fragment A contained in plasmid p472 hence does not lead to an overproduction of endothiapepsin, which indicates that DNA sequences essential for the expression of endothiapepsin are lacking in this fragment. The fragment A hence does not contain a functional gene for endothiapepsin, which confirms that the fragment A lacks an activating region upstream of the promoter necessary for rendering the latter functional (see Section 1-7).
The activating region upstream of the promoter is hence located in the fragment C between its 5' end (BamHI site) and the 5' end (HindIII site) of the fragment A which it contains.
A more precise localisation of this activator region may be determined by obtaining a series of sub-fragments of the fragment C (prepared, for example, by digestion using endonucleases or exonucleases) comprising the fragment A flanked at the 5' end by different-sized segments of the portion of the fragment C bounded by the 5' end of the fragment A and a nucleotide located between the 5' end of the fragment A and the 5' end of the fragment C, transformation of Cryphonectria parasitica SEBR 103 with these subfragments and selection of the transformants expressing the recombinant protease. Examples of such subfragments of the fragment C are the fragments D and F, the preparation of which is described in Sections 4 and 5.
Section 8
Method of purification (removal of the selection marker) of a transformant over-productive of endothiapepsin, and of amplification of the gene coding for endothiapepsin by successive transformations.
1) Background
It is known (see, in particular, Fincham J. R. S., March 1989,Microbiological Reviews, 148-170) that fungal cells comprise several nuclei, in general containing the same genetic material. The protoplasts obtained after enzymatic digestion of their walls can be anucleate (incapable of regenerating), uninucleate or multinucleate. After transformation of the latter, it is hence possible to obtain transformed cells of the heterokaryon type, containing transformed nuclei, where appropriate of different kinds (depending on the mode of integration and the nature of the integrated material, which can vary) and untransformed nuclei. In the case of C. parasitica, the conidiospores are uninucleate (Puhalla J. E. et al., Phytopathology, 1971, 61, 169-173).
The work described below employs these characteristics of fungal cells to construct strains containing only the recombinant DNA of interest and not the selection marker.
2) Purification of the transformant 29P3 (removal of the selection marker) for the purpose of testing for benomyl-sensitive overproducers
A preparation of conidiospores of the initial transformant overproductive of endothiapepsin 29P3 [see Section 1.1) and Section 7.2)], sufficiently dilute to obtain isolated colonies, was used to inoculate Petri dishes containing medium B (see Table 2 above) made into an agar medium by adding 20 g/l of agar. After incubation for 5 days at 30.degree. C., mycelial implants of 50 colonies were subcultured in parallel on the same agar medium B and on the latter supplemented with 1 .mu.g/ml of Benlate (containing 50% of benomyl). After incubation for 5 days at 30.degree. C., 6 clones show normal growth on agar medium B and zero growth on agar medium B supplemented with Benlate. These 6 benomyl-sensitive clones, each derived from the germination of one spore, are of the homokaryon type, hence pure.
The 6 clones and the initial transformant 29P3 were subjected to the test of selection of overproduction of endothiapepsin on agar medium containing casein [see Section 7.1) a)], which enabled a benomyl-sensitive clone, referred to as 29P3 benS, to be selected, which clone shows an overproduction not significantly different from that of the initial transformant. The clone 29P3 ben.sup.S, the clone 29P3 and the C. parasitica control strain SEBR 103 were subjected, after sporulation, to the selection test in liquid medium. The clones 29P3 and 29P3 ben.sup.s produce a coagulant activity which is identical (taking into account the margin of experimental error) but markedly greater than that of the control strain. In addition, Southern blotting performed on these two clones and the control strain, after digestion of their genomic DNA with the endonuclease SmaI, shows that each of the two clones have the same hybridisation profile with the fragment A as a probe, which profile contains a super-numerary band compared with the control (see Section 7.2)), indicating that in both clones the integration of the functional gene for endothiapepsin is identical, and a different hybridisation profile with the HindIII-HindIII fragment of plasmid pBT3 which confers resistance to benomyl (see Section 6), the initial transformant 29P3 showing several hybridisation bands with this fragment and the clone 29P3 ben.sup.S and also the control strain showing a single hybridisation band identical in size (corresponding to the endogenous gene for .beta.-tubulin).
These results show that the purification method made it possible to obtain a transformant which was pure (as regards its genotype) and devoid of the selection marker (gene conferring benomyl resistance), and that the character of overproduction of endothiapepsin is integrated stably in the clone 29P3 ben.sup.s since it is derived from the germination of a uninucleate conidiospore and all the mycelial cells possess nuclei which have integrated cosmid p8H12 in their DNA.
3) Amplification
Protoplasts prepared from the clone 29P3 ben.sup.S were transformed with plasmid pBT3 according to the protocol described in Section 6. 400 benomyl-resistant clones were obtained for 1 .mu.g of plasmid DNA.
It is hence possible to obtain, after cotransformation with a cosmid containing the functional gene for endothiapepsin and a plasmid containing a selection marker, a transformant which is overproductive of endothiapepsin and devoid of the selection marker, capable of being transformed again. It is hence possible, by performing several successive cycles comprising a step of cotransformation using the above two vectors followed by a step of purification enabling the selection marker to be removed, to amplify selectively in C. parasitica the gene coding for the endothiapepsin precursor.
Section 9
Testing for strains deficient in the production of endothiapepsin after transformation of C. parasitica SEER 103
An exhaustive analysis of the benomyl-resistant clones obtained after contransformation (see Section 6) of C. parasitica strain SEBR 103 with cosmid p8H12 and plasmid pBT3 enabled a clone to be obtained which did not produce a halo of hydrolysis on agar medium E containing casein. This clone was purified according to the method described in Section 8, and a large number of benomyl-sensitive clones which did not produce a halo of hydrolysis were obtained. One clone, designated 29P (end.sup.-), was chosen at random from among these benomylsensitive clones. After flask culture, the clone 29P (end.sup.-) possesses a coagulant activity of less than 0.01 g/l, whereas the untransformed Cryphonectria parasitica control strain SEBR 103 possesses a coagulant activity of 0.62 g/l (the observed fall in production is hence more than 98%). It was, in addition, observed that the morphological and physiological characteristics of this clone are modified relative to those of C. parasitica strain SEBR 103.
Southern blot analysis of the genomic DNA of the clone 29P(end.sup.-) and of the control strain SEBR 103, after hybridisation with the fragment A on the one hand and the fragment containing the benomyl resistance gene of plasmid pBT3 on the other hand, showed no differences.
These results show that the clone 29P(end.sup.-) selected and purified has been rendered deficient for the production of endothiapepsin after cotransformation of the C. parasitica strain with cosmid p8H12 and plasmid pBT3. It is seen to be obvious to those skilled in the art that transformants deficient in the production of endothiapepsin could be obtained by cotransformation of C. parasitica SEBR 103 with a selection marker, such as plasmid pBT3, and a DNA containing the preproendothiapepsin gene rendered non-functional, for example by deletion of a portion of the coding sequence, followed by selection of the benomyl-resistant transformants which do not produce a halo of hydrolysis of casein. Such a DNA carrying a non-functional gene may be readily obtained by linearisation of the DNA of plasmid pEp1, for example by performing an ScaI and SfiI double digestion, then purifying the largest fragment by electrophoresis on 0.8% agarose gel and finally treating the ends of this fragment with Klenow polymerase in the presence of the four deoxyribonucleotide triphosphates dNTP in order to permit a religation of the vector and thereby to obtain a plasmid carrying a non-functional gene for endothiapepsin.
Section 10
Construction of the strain SEBR 3700, deficient in the production of endothiapepsin and devoid of a dominant selection marker
1) Construction of a fragment, referred to as fragment EM, in which the sequence coding for endothiapepsin is interrupted by two translation stop codons.
At the beginning of the sequence coding for the endothiapepsin precursor, mutations were introduced bringing about a stoppage of translation, as a result of which endothiapepsin is no longer produced from the messenger RNA carrying these mutations. The fragment A of endothiapepsin comprises an approximately 360-bp HindIII-BstEII fragment (see FIG. 2), the BstEII site being localised 25 bp downstream of the beginning of the coding sequence. The natural sequence in question is as follows (SEQ ID NO:16):
BsteII .vertline. .vertline. 5'-G ATG TCT TCC CCT CTC AAG AAC GCC TTG GTG ACC
The underlined ATG triplet represents the codon opening the coding frame. The BstEII site is indicated by a vertical line.
The desired mutated sequence (SEQ ID NO:17) is:
BsteII .vertline. .vertline. 5'-G ATG TCT TCC CCT CTC TAA TGA ACG CCT TGG TGA CC
This sequence differs from the natural sequence by the introduction of 2T, one between the 5th and 6th codon, the other within the 6th codon (between the 2nd and the 3rd base). These introductions result in the creation of 2 stop codons stopping the reading frame of the endothiapepsin gene.
A HindIII-BstEII fragment differing from the wild-type sequence only in these two modifications was obtained by the PCR amplification technique described in Section 15, using for one of the primers an oligonucleotide carrying the desired mutations.
Oligonucleotide 1 has the following sequence (SEQ ID NO:18):
HindIII .vertline. 5' - GCT AAA GCT TAT CCG CCG CCG GCG GGG GAA TTC
This sequence is to be found at the HindIII end of the HindIII-BstEII fragment. The HindIII site is designated by a vertical line.
Oligonucleotide 2 has as its sequence (SEQ ID NO:19):
BamHIBstEII BamHI BsteII .vertline. .vertline. 5' - CAA TGG ATC CGG TCA CCA AGG CGT TCA TTA GAG AGG GGA AGA - CAT C
This oligonucleotide is complementary to the desired mutated sequence; a BamHI site flanking the natural BstEII site has been attached to it. The underlined nucleotides correspond to the additions creating the stop codons on the complementary strand.
The DNA used as a template is the DNA of plasmid p472 described in Section 1. The amplification mixture comprises:
300 ng (equivalent to 3 .mu.l) of p472 DNA
100 ng (equivalent to 1 .mu.l) of each oligonucleotide
5 .mu.l of buffer bipv2 concentrated 10-fold
40 .mu.l of water
2 units (equivalent to 0.5 .mu.l) of enzyme: Taq polymerase.
The buffer bipv2 10-fold concentrated has the following composition: 670 mM Tris-HCl pH 8.8; 165 mM ammonium sulphate; 10 mM 2-mercaptoethanol; gelatin 2 mg/ml; Triton X-100 1.5%; 67 .mu.M EDTA; 20 mM MgCl.sub.2 ; 2 mM DATP; 2 mM dCTP; 2 mM dGTP; 2 mM dTTP.
Three amplification tests are carried out in parallel. 15 amplification cycles are performed, each cycle being divided into 1 min of denaturation at 92.degree. C., 1 min of hybridisation at 55.degree. C. and 1 min of elongation at 72.degree. C. After PCR amplification, the 3 tubes are combined in 1 Eppendorf tube and precipitated with 2 volumes of absolute ethanol containing 0.3M ammonium acetate (for 20 min at 0.degree. C.), then centrifuged at 10,000 g (for 20 min). The pellet is washed with 70% ethanol and then dried under vacuum for 10 min.
The DNA is taken up in 60 .mu.l of TE solution (10 mM Tris-HCl pH 7.5, 1 mM EDTA) and analysed on agarose gel. The band corresponding to the 360-bp fragment is eluted from the gel, purified and cloned into the replicative form of a phage M13 (Ml3mpl9) between the HindIII and BamHI sites after the action of these enzymes.
The fragment thus cloned was sequenced from the single-stranded fragment, and it was verified that the sequence did indeed correspond to the fragment mutated at the expected points.
The approximately 2.1-kb fragment A described in Section 1 is bounded by 2 HindIII sites and possesses a single BstEII site localised at 360 base pairs from one end. The single BstEII site hence bounds two segments of the fragment A; the shorter corresponds to the sequence subjected to PCR amplification. By preparing the large, BstEII-HindIII segment of the fragment A and the mutated, small, HindIII-BstEII segment, and ligating the whole in pBR322 cut with HindIII, a fragment A carrying the two mutations, referred to as fragment A-M, is thereby reformed.
The fragment A-M possesses a PstI site which is unique for this fragment. This PstI site hence bounds 2 segments of the fragment A-M, including an approximately 1.67-kb HindIII-PstI segment which carries the double mutation.
Plasmid pEp3 described in Section 5 is derived from a pUC plasmid into which an approximately 3.7-kb SphI fragment, referred to as fragment E, has been cloned. This 3.7-kb fragment comprises the fragment A as a subfragment. This fragment A was replaced by the fragment A-M in the following manner:
Plasmid pEp3b was digested both with the enzymes ScaI and PstI on the one hand and the enzymes ScaI and HindIII on the other hand. From the first digestion, the approximately 2.250-kb ScaI-PstI fragment was isolated. From the second digestion, the approximately 2.42-kb ScaI-HindIII fragment was isolated. Ligation of these 2 fragments with the 1.67-kb HindIII-PstI segment carrying the double mutation enables a new plasmid, referred to as pEpM3b, which differs from pEP3b only in the double mutation, to be obtained.
The SphI fragment carrying the double mutation, referred to as fragment E-M, was prepared from an SphI digestion of pEpM3b followed by a separation of the 2 DNA fragments on 0.8% agarose gel and extraction of the mutated 3.7-kb fragment in 20 .mu.l of TE solution.
2) Cotransformation of Cryphonectria parasitica with the fragment EM and the SfiI fragment carrying a benomyl resistance gene flanked by telomeric sequences.
The purified fragment EM was used in cotransformation with the DNA of plasmid p578.12 digested with SfiI.
Plasmid p578.12 is a derivative of plasmid pBT3 already-described. The DNA of pBT3 was linearised with the endonuclease XhaI and the ends were rendered blunt with Klenow DNA polymerase. In it was integrated an XhaI fragment, repaired with the polymerase and which comprises the telomeric sequences of Tetrahymena originating from plasmid pPAT ura described by Perrot, Barreau and Begueret Mol. Cel. Biol. (1987) 7 p. 1725-1730, modified so as to replace the BamHI sites by SfiI. Digestion of p578.121 with SfiI liberates a linear fragment which carries a benomyl resistance gene and which terminates at each of its ends with a telomeric sequence. Perrot et al. (ref. above) showed that such a fragment could be maintained in the state of a linear plasmid (not integrated in the chromosome) in the filamentous fungus Podospora anserina. Moreover, Powell and Kistler (J. Bacteriology, 1990, vol. 172, pp 3163-3171) showed that repeated sequences of the telomeric type permitted the autonomous replication of linear plasmids in C. parasitica. This property was turned to good account in order to construct appropriate strains by cotransformation with the linear fragment. The absence of integration of the benomyl resistance marker in the chromosome should enable benomyl-sensitive strains to be recovered with a very great frequency from the conidia obtained after sporulation of the transformants.
2 cotransformation experiments were carried out on Cryphonectria parasitica strain SEBR 103 with, for each one, approximately 0.5 .mu.g (3 .mu.l) of the fragment E-M and 0.5 .mu.g (4 .mu.l) of the SfiI fragment of plasmid p578.12. 397 benomyl-resistant colonies were obtained. 395 of these colonies were subcultured on medium E (see Section 7) to test for the presence of a halo as described in Section 7.
One colony no longer forming a halo of coagulation of casein was found; this colony, referred to as colony AJ7.272, was transferred onto sporulation (conidiation) medium according to the method described in Section 1. The conidiospores were harvested in bulk and diluted with the germination medium. 152 colonies derived from the conidiation were tested on casein medium: none of them showed a halo of coagulation. The benomyl resistance of these colonies was also tested: 58 of the 152 had lost this transformation character. 5 of the 58 were taken; they were referred to as colony AJ7272/A, colony AJ7272/B, colony AJ7272/J, colony AJ7272/L and colony AJ7272/M. The genomic DNA was extracted from each colony, and the hybridisation profiles and that of the strain SEBR 103 were compared by the Southern blotting technique, using various restriction enzymes. No difference was found between the strain SEBR 103 and the 5 mutants, probed with the fragment A (endothiapepsin gene), with pUC18 (bacterial sequences) or with the gene for beta-tubulin of Neurospora. With the fragment A, the sequences of the endothiapepsin gene are revealed; since the hybridisation profile is the same in all the strains, it may be concluded that there is no "ectopic" recombination of the mutated fragment (that is to say non-homologous recombination) in the mutants. With pUC18, no hybridisation is obtained, irrespective of the strain, which indicates that no sequence of bacterial origin remains integrated in the mutants. With the .beta.-tubulin gene, a sequence is revealed in all the strains; this very probably corresponds to the "endogenous" gene for .beta.-tubulin of C. parasitica.
In order to check that the strains derived from the colony AJ7272 were indeed mutated in the endothiapepsin structural gene, it was verified that their lack could be complemented by transformation. Each of the above colonies was used as a receptor for a cotransformation involving the DNAs of plasmid pBT3 and of plasmid pEP2.
The following table shows that the majority of benomyl-resistant transformants obtained in this manner again produce endothiapepsin.
______________________________________ Benomyl-resistant colonies Colonies productive Strain (test on casein) of protease______________________________________AJ7.272/A 2 2 AJ7.272/B 8 7 AJ7.272/J 13 11 AJ7.272/L 17 16 AJ7.272/M 10 10______________________________________ Control: transformation of the segregants with plasmid pBT3 alone gives n transformant productive of protease.
Analysis of the culture supernatants by acrylamide gel electrophoresis confirmed that the mutated strains did not produce a detectable amount of endothiapepsin before transformation.
A strain AJ7.272 which, after sporulation, gave rise to 5 colonies which differ from the strain SEBR 103 only in one or more mutations affecting the endothiapepsin structural gene was hence constructed. One of these colonies was adopted. It is referred to as SEBR 3700. It is deficient in the production of endothiapepsin and devoid of a dominant selection marker.
Section 11
Verification of the functionality of the fragments D and F by complementation of the strain SEER 3700 deficient in the production of endothiapepsin.
It was demonstrated in Section 7, subsection 3, that the fragment C contained in plasmid pEp1 carries all the signals necessary for the expression of endothiapepsin. Using the strain SEBR 3700 deficient for the production of endothiapepsin, obtained in Section 10, the functionality of the fragments D and F contained in plasmids pEp2 and pEp4 was verified.
1) Transformation of protoplasts of the strain SEBR 3700 with plasmids pEp2 and pBT3
Plasmid pEp2 carries both the benomyl resistance gene and the fragment D, and can hence be used directly for transformation. Plasmid pBT3 which does not carry a gene coding for endothiapepsin is used as a negative control. The strain SEBR 3700 was transformed according to a protocol identical to that described for the strain SEBR 103 (see Section 6) with approximately 1 .mu.g of plasmid pEp2 and 1 .mu.g of plasmid pBT3.
2) Cotransformation of protoplasts of the strain SEBR 3700 with plasmids pEp1 and PBT3 and plasmids pEp4 and pBT3.
Plasmids pEp1 and pEp4 do not carry a dominant selection marker. Plasmid pEp1 is used as a positive control-of complementation of the strain SEBR 3700.
The strain SEBR 3700 was cotransformed with the following mixtures of plasmids: 4 .mu.g of pEp1 and 1 .mu.g of pBT3, 4 .mu.g of pEp4 and 1 .mu.g of pBT3.
3) Detection of transformants producing endothiapepsin
Mycelial implants of several transformants selected for each of the transformations and cotransformations described above were subcultured on medium E, an agar medium containing casein. After incubation, the colonies showing a halo of precipitation characteristic of the secretion of endothiapepsin were identified. The results obtained are as follows:
transformants obtained with plasmid pBT3: no clone gave a halo of precipitation
transformants obtained either with plasmids pEp1 and pBT3, or with plasmids pEp4 and pBT3: a proportion of approximately 30% of the clones gave halos of precipitation
transformants obtained with plasmid pEp2: 92% of the clones tested gave halos of precipitation.
These results show that plasmids pEp1, pEp2 and pEp4 complement the strain SEBR 3700 deficient in the production of endothiapepsin, and hence that the fragments C, D and F contained in these plasmids all carry a functional promoter of endothiapepsin. However, the relative strength of the promoter present in each of the fragments cannot be deduced from this qualitative test.
It may be deduced from these results that the SphI-HindIII segment of the fragment F, the sequence of which has been determined in Section 5, possesses signals involved in the activation of the promoter of the gene coding for preproendothiapepsin.
Section 12
Selection of transformants overproductive of endothiapepsin and devoid of a dominant selection marker.
1) Selection protocol
The different steps of the protocol are shown in the table below. Its principle is as follows:
C. parasitica SEBR 103 protoplasts are cotransformed, according to a protocol identical to that described in Section 6, with a mixture composed of 0.5 to 2 .mu.g of fragment C, D or F, previously purified on agarose gel after digestion of plasmids pEp1 or pEp2 and extracted according to the instructions of the Biorad Gene-clean kit, and 0.5 .mu.g of the selection plasmid pBT3 or pBT6, either in circular form or in linear form.
After regeneration of the protoplasts on medium C, the transformants obtained, which are designated initial transformants, are simultaneously subcultured on medium B made into an agar medium by adding 20 g/l of agar (non-selective medium) and on medium E, an agar medium containing casein, where appropriate supplemented with 5 .mu.g/ml of pepstatin. The clones possessing a ratio of the diameter of the halo of precipitation to the colony diameter significantly higher than that of the untransformed control strain are designated overproductive initial transformants and are set up for sporulation. A preparation of conidiospores of these strains is made according to the method used in Section 1.1, and a dilution of each conidiospore suspension is plated out on medium G so as to obtain isolated colonies. Mycelial implants originating from about fifty colonies are subcultured for each overproductive initial transformant, simultaneously on medium B made into an agar medium by adding 20 g/l of agar, where appropriate supplemented with 0.5 mg/l of Benlate (benomyl sensitivity test) and on medium E (test on casein medium). At this stage, the clones which are sensitive to benomyl and overproductive of endothiapepsin are designated overproductive benomyl(s) segregants and are set up for sporulation. A conidiospore preparation is then made in order to verify the overproduction of endothiapepsin after culturing in flasks, to verify the integration of one or more copies of the fragment C, D or F by hybridisation of the genomic DNA with a probe consisting of the fragment A, and to check the absence of heterologous DNA using a probe consisting of all or part of the selection plasmid. The strain satisfying these three criteria positively is designated overproductive appropriate strain. A further cycle of cotransformation/selection may then be performed from this overproductive appropriate strain in order to amplify again the fragment C, D or F.
The advantage of this process, in addition to that obtained by amplification of the fragment of interest, is to construct transformants devoid of a dominant selection marker, which are more acceptable from the standpoint of statutory regulations.
Protocol for the selection of overproductive transformants devoid of a dominant selection marker ##STR15## 2) Selection of overproductive transformants devoid of a dominant selection marker after cotransformation of SEBR 103 with the fragment C, D or F and plasmid pBT3
The following table summarises the results obtained
______________________________________Cotransformation Fragment F Fragment C Fragment D______________________________________Quantity 0.5 .mu.g 2 .mu.g 0.5 .mu.g Selection plasmid circular circular linear Initial trans- 4 137 106 formants Overproductive 1 26 33 initial trans- formants Benomyl(s) 1 4 * 8 ** segregants Overproductive 0 2 7 benomyl(s) segregants overproductive 0 1 4 appropriate strains______________________________________ No overproductive appropriate strain could be obtained with the fragment C, which is not surprising in view of the low number of initial transformants. * selection performed on the progeny of 12 overproductive initial transformants ** selection performed on the progeny of 21 overproductive initial transformants
The overproductive appropriate strain obtained with the fragment D was tested in a 2-litre fermenter and produced a coagulant activity of 1.9 g/l, the control strain producing only a coagulant activity of 1.2 g/l (the overproduction factor is hence +1.58). Analysis of the genomic DNA by Southern blotting of the strain SEBR 3574 showed that it had integrated at least 3 additional copies of the fragment D, including 2 copies in tandem.
Among the four overproductive appropriate strains obtained with the fragment F, the strain SEBR 3912 was tested in a 2-litre fermenter and produced a coagulant activity of 2.4 g/l (the overproduction factor relative to the control strain is hence +2). Analysis of the genomic DNA by Southern blotting showed that it had integrated at least 5 additional copies of the fragment F, in tandem according to a head-to-tail orientation.
In the overproductive strains obtained, no integration of the selection plasmid was detected. These strains may hence be subjected to a further cycle of cotransformation/selection. Furthermore, if the over-production factor observed for these strains is compared with the presumed number of copies integrated, it is found that the ratio obtained is in the region of 0.2, whereas it is approximately 1 for the 30Pn transformants which have integrated two additional copies of plasmid pEp1 containing the fragment C. This hence suggests that, upstream of the BglII site located at the 5' end of the fragment D up to the BamHI site, there are regulatory sequences which are important for a strong expression of the endothiapepsin gene.
Section 13
Construction of plasmid pEMR713, a vector for the expression of preproendothiapepsin in C. parasitica which comprises the promoter region of the gene coding for glyceraldehyde-3-phosphate dehydrogenase of Aspergillus nidulans
Plasmid pAN52 (Punt et al., 1987, Gene, 56, 117-124) carries, in addition to the gene coding for ampicillin resistance and the origin of replication of pUC18, the promoter region of the gene coding for glyceraldehyde-3 -phosphate dehydrogenase (gpd) of Aspergillus nidulans [Punt et al., gene, 93, (1990) 101-109] and the terminator region of the trpC gene of Aspergillus nidulans [Mullaney et al., Mol. Gen. Genet. (1985) 189; 37-45]. The promoter region and the terminator region are separated by a DNA sequence which comprises nucleotide sequences recognised by the restriction enzymes NcoI and MluI, which sequences are unique in plasmid pAN52. The sequence of the NcoI site, namely CCATGG, is especially useful inasmuch as it comprises the ATG codon which codes for a methionine which is the initiation codon for the majority of proteins.
The aim of this experiment is to express the gene coding for endothiapepsin using the expression signals described above. Integration of the gene coding for endothiapepsin is carried out by the PCR (polymerase chain reaction) technique, which is described in detail in Section 15 below.
1--Description of the primers used for the PCR Gene amplification by PCR permits modification of the sequence to be amplified. This property is used in order to introduce an NcoI site at the 5' end of the prepro sequence of the gene coding for endothiapepsin, and an MluI site at the non-coding 3' end of the gene coding for endothiapepsin. The sequences of the two primers are hence as follows:
- 5' primer carrying the NcoI site SEQ ID NO:20: - 5'-ACG-TCC-ATG-GCT-TCC-CCT-CTC-AAG-AAC-GCC-3'
This primer consists mainly of:
a) The sequence recognised by the restriction enzyme NcoI: CCATGG
b) The modified sequence of the 5' end of the signal peptide of endothiapepsin.
The modification consists in the change of the first codon after the methionine; in effect, the TCT codon coding for a serine is replaced by the GCT codon coding for an alanine. This modification has no effect on the efficacy of the signal peptide.
- 3' primer carrying the MluI site SEQ ID NO:21: - 5' -ACG-TAC-GCG-TCC-ACG-CCT-ACC-CAA-CAA-GAC-3'
This primer consists mainly of:
a) The sequence recognised by the restriction enzyme MluI: ACGCGT
b) The sequence of the non-coding 3' end of endothiapepsin, which is the sequence complementary to the sequence located between nucleotides 1921 and 1940 of FIG. 2.
2--Production of the amplified fragment containing the gene coding for modified endothiapepsin Plasmid p472, the production of which is described in Section 1, is used as a template.
a) The PCR reaction
100 ng of plasmid p472, previously purified on a P10 column, are mixed with 100 ng of the 5' primer, 100 ng of the 3' primer, 2 mM MgCl.sub.2, 0.2 mM dNTP and 5 .mu.l of reaction mixture concentrated 10-fold (final quantity: 67 mM Tris-HCl pH 8.8, 16.6 mM (NH.sub.4).sub.2 SO.sub.4, 1 mM .beta.-mercaptoethanol, 6.7 mM EDTA, 0.15% Triton X-100, 200 g/ml of gelatin).
The volume of the mixture is then brought to 50 .mu.l by adding water.
The reaction mixture thereby obtained is incubated for 4 min at 94.degree. C. and then brought to a temperature of 50.degree. C., which is maintained for 4 min.
0.5 .mu.l, equivalent to 2.5 units, of Taq polymerase (Boehringer Mannheim Ref. 1146-165) is then added. The reaction mixture is then covered with paraffin in order to prevent evaporation of the aqueous solution.
The amplification is carried out during 18 reaction cylces, the steps of which are as follows:
2 min at 92.degree. C..fwdarw.denaturation
2 min at 50.degree. C..fwdarw.hybridisation
2 min at 72.degree. C..fwdarw.polymerisation.
After the 18 cycles, the enzymatic reaction is stopped by adding 20 mM EDTA solution.
The DNA fragment thus amplified, which possesses the expected size of approximately 1620 bp, is then isolated and purified on 1% agarose gel, dialysed on a P10 column (Pharmacia) and then hydrolysed simultaneously with the enzymes NcoI and MluI. After hydrolysis, the fragment is purified on a P10 column.
b) Production of plasmid pEMR713
The DNA of plasmid pAN52 is hydrolysed with the restriction enzymes NcoI and MluI. The fragment carrying the promoter region of the gpd gene, the origin of replication of E. coli, the gene coding for ampicillin resistance and the trpC terminator is purified. 100 ng of this fragment are ligated in the presence of DNA ligase to 100 ng of the amplified fragment carrying the endothiapepsin gene (see subsection 2 above). The ligation mixture is then used to transform the strain RRI. The resulting plasmid is pEMR713 in which the gene coding for modified endothiapepsin is placed under the control of the promoter region of gpd and the terminator region of trpC.
Preparation of protoplasts
see Section 6
Cotransformation of protoplasts of the strain SEBR 3700 with plasmid DEMR713 and plasmid pBT3
see Section 6
Approximately 2,000 transformants obtained are capable of growing on agar medium B containing 0.5 mg/l of Benlate, which indicates that all these colonies carry at least one plasmid pBT3.
Selection of transformed strains productive of endothiapepsin
A) General method
a) Selection on agar medium containing casein
Mycelial implants of the 2,000 benomyl-resistant colonies are subcultured on an agar medium containing casein, referred to as medium E and whose composition is specified in TABLE 8 above . On this medium, the Cryphonectria parasitica colonies which produce the protease give rise to a halo of precipitation whose area is proportional to the quantity of endothiapepsin secreted.
The productive strains are adopted on the basis of the presence of the halo of precipitation. A preparation of conidiospores of these productive strains is made according to the method used in Section 1.1). In addition, it was verified by adding 5 .mu.g/ml of pepstastin, a substance specifically inhibiting aspartic proteases, to medium E that the increase in the halos observed in the overprodutive strains was reduced. This result shows that the observed effect is indeed due to an overproduction of an aspartic protease.
3 transformants capable of producing a halo of coagulation were isolated. Control experiments show that the size of the halo of the recombinant clones transformed with plasmids pBT3 and pEMR713, referred to as clone 1, clone 2 and clone 3, is comparable to that obtained for the strain SEBR 103.
b) Selection in liquid medium by a study in flasks
To confirm this result, tests of production in flasks were carried out in the following manner: inoculation of 250-ml flasks containing 40 ml of medium F (see Section 7). The flasks are then incubated at 28.degree. C. on an eccentric rotary agitator adjusted to 220 rpm for 48 h. For each strain, culturing was carried out in 3 different flasks and the mean of the results of assay of coagulant activity for the 3 flasks was calculated. The control consists of untransformed Cryphonectria parasitica strain SEBR 103. The assay of coagulant activity is carried out according to the official method of determination of the enzyme content of coagulant solutions, published in the Journal Officiel de la Republique Fran.cedilla.aise (Official Journal of the French Republic) of Mar. 20, 1981 (section C), summarised in Section 7.
c) Analysis of the enzyme secreted by the clones 1, 2 and 3
The fermentation must obtained after culturing the productive transformants and that of the untransformed C. parasitica control strain SEBR 3700 were subjected to a centrifugation so as to remove the mycelial mass. After denaturation of the proteins in the supernatant in the presence of SDS for 5 min at 100.degree. C., an electrophoresis was performed on polyacrylamide gel in the presence of SDS. After staining with Coomassie blue, a predominant band of molecular mass in the region of 36 kDa is observed, corresponding to the molecular mass of mature endothiapepsin, deduced from its sequence (see FIG. 1), of the same intensity in the case of the productive transformants as in the case of the control strain, and bands of lesser importance which are identical for the overproductive transformants and the control strain.
It was verified, moreover, by an antigen-antibody reaction (Rennetest kit, France Biochem) on the culture supernatants of the overproductive transformants and of the untransformed control strain that the secreted enzyme is identical to that of Cryphonectria parasitica according to the identification method described in the Journal Officiel de la Republique Fran.cedilla.aise (Official Journal of the French Republic) of 20th Mar. 1981.
In addition, the ratio of coagulant activity to proteolytic activity of the secreted enzyme was assessed. The coagulant activity, expressed in g/l, is measured using the TNBS reagent, described by R. Fields, Biochem. J. (1971) 124: 581-590, by assaying the amino groups which have appeared after proteolysis of dimethylcasein.
This ratio is between 0.040 and 0.045 for the overproductive transformants, which is very close to that obtained with the untransformed control strain. It may be concluded from these three studies that endothiapepsin has indeed been specifically produced by the clones 1, 2 and 3.
This experiment shows that it is possible to express in C. parasitica the gene coding for endothiapepsin, using a promoter region and a heterologous terminator region (not belonging to C. parasitica).
Section 15
Amplification by the PCR technique of the complementary DNA coding for the endothiapepsin precursor.
1) Isolation of the messenger RNAs of C. parasitica
C. parasitica strain SEBR 103 was cultured under conditions of production of endothiapepsin. The mycelium was recovered by filtration on gauze, washed with water and frozen in liquid nitrogen.
15 g of frozen mycelium (wet weight) are suspended in 45 ml of lysis buffer and then taken up in the same volume of beads (0.45 .mu.m in diameter). The lysis buffer consists of 4M guanidine thiocyanate, 10 mM Tris-HCl pH 7.6, 10 mM EDTA and 50 mg/l .beta.-mercaptoethanol. The mycelial suspension is ground for 5 min.
The ground preparation is recovered and the beads removed after settling has taken place. Approximately 45 ml of supernatant are withdrawn, lithium chloride is added to a final concentration of 3M and the preparation is stored at 0.degree. C.
After two days, the above solution is centrifuged for 60 min at 10,000 rpm. The supernatant is withdrawn and the pellet is taken up in 40 ml of 3M LiCl. The suspension obtained is recentrifuged at 10,000 rpm for 1 h 30 min. Proteinase K (SIGMA) 40 .mu.g/ml, SDS (0.1% w/v) and 20 mM EDTA are added. The mixture is incubated at 37.degree. C. for 3 h. Precipitation is performed with 2 volumes of ethanol and the precipitate is then washed with 70% ethanol. The pellet is taken up in 0.5 ml of TE buffer (10 mM Tris-HCl, 1 mM EDTA pH 7.5), the mixture is extracted twice with chloroform and the product is precipitated with ethanol. The RNA is stored at -80.degree. C. in ethanol.
2) Purification of the poly(A).sup.+ fraction of the RNA
Approximately 1 mg of RNA is precipitated for 20 min at 4.degree. C. (15,000 rpm), then washed with 70% ethanol and then dried. The pellet is taken up in 1 ml of TE buffer and suspended by vortexing. Type 3 oligo(dT)-cellulose (marketed by Collaborative Research Inc, Biomedicals Product Division) is prepared according to the manufacturer's recommendations. The RNA is applied to the oligo(dT), agitated gently to resuspend the beads and then heated for 1 min to 65.degree. C.
The suspension is adjusted to 0.5 M NaCl and then agitated gently for 10 min. The suspension is then centrifuged for 1 min at 1,000 rpm, the supernatant is removed and the pellet is washed twice with 1 ml of TE buffer containing 0.5M NaCl. The supernatants are removed. Elution of the polyadenylated fraction of the RNA (consisting of messenger RNAs) is obtained by suspending the beads in 1 ml of TE buffer and then heating this suspension to 60.degree. C. for 1 min, followed by agitation for 10 min on a rocking-stage mixer. The mixture is then centrifuged for 1 min at 1,000 rpm, permitting recovery, on the one hand of the supernatant containing free mRNAs in solution, and on the other hand of the pellet of cellulose beads. All the above operations (beginning with elution) are repeated. The supernatants thereby obtained are combined, the excess beads are removed by centrifugation and the supernatant is precipitated with ethanol containing NaCl according to the usual techniques (Maniatis: op. cit.).
3) Description of the polymerase chain reaction (PCR) technique
The polymerase chain reaction (PCR) technique is a method, well known to those skilled in the art, which enables both strands of a previously denatured DNA sequence to be copied simultaneously using two oligonucleotides as primers (see, in particular, the work by H.A. Erlich: "PCR Technology: Principles and Applications for DNA amplification" published in 1989 by Macmillan Publishers Ltd publications, United Kingdom, and that of M. A. INNIS et al. "PCR Protocols" published in 1990 by Academic Press Inc. San Diego, Calif. 92101, USA). The principle of this technique is summarised below.
A large number of cycles, each of which consists of three steps, produce amplification of the DNA strands of interest; these three steps are:
a) denaturation of the template
b) hybridisation of the primers with the template
c) extension of the primers.
After a few hours of cycles, hundreds of thousands of copies of the original template have been produced using a heat-stable DNA polymerase of Thermus acuaticus, commonly referred to as Taq polymerase.
The PCR technique is based on the repetition of three steps.
a) Denaturation of the template
The double-stranded DNA is denatured to single-stranded DNA by incubation at high temperature (from 92.degree. C. to 96.degree. C.) for approximately 2 min.
b) Hybridisation of the primers
These primers are a pair of synthetic oligonucleotides which hybridise with the ends of the region to be amplified. The two primers hybridise with the opposite strands. The primers are added in excess so that formation of the primer-template complex is favoured.
c) Extension of the primers
The step during which Taq polymerase effects extension of the primer-template complex from 5' to 3' is performed at 72.degree. C.
In the PCR technique, the product of interest appears in the third cycle and it is then amplified significantly. As the cycles proceed, the amplification product rapidly becomes the major template with which the primers hybridise.
4) Description of the primers used
Two synthetic oligonucleotides were prepared from the sequence of the fragment A (see FIG. 2).
The first oligonucleotide, referred to as primer 1 and whose sequence is as follows (SEQ ID NO:22): ##STR16## possesses two distinct regions: region 1, which carries a cloning site AAGCTT corresponding to the recognition site of the endonuclease HindIII, and region 2, which is a region intended for hybridisation with the non-coding region of the coding strand of the fragment A, located on the 3' side of the sequence coding for preproendothiapepsin (see FIG. 2--position 1870-1881).
The second oligonucleotide, referred to as primer 2 and whose sequence is as follows (SEQ ID NO:23): ##STR17## also consists of two distinct regions: region 1, which carries a cloning site CATATG corresponding to the recognition site of the endonuclease NdeI and in which is included the sequence of the initiation codon ATG, and region 2, which carries a nucleotide sequence identical to that coding for the first five amino acids of preproendothiapepsin which follow the initial methionine. This region is intended for hybridisation with the non-coding strand of the fragment A.
5) Production of the amplified fragment representing the complementary DNA of endothiapepsin
A pool of messenger RNA known to contain the messenger RNA coding for endothiapepsin is used as a template; an enzymatic reaction using reverse transcriptase is performed on the messenger RNA before amplification.
a) Demonstration of the presence of the messenger RNA coding for endothiapepsin in the total RNA preparation.
.alpha.) Northern blotting
The Northern technique is used (Maniatis). It consists essentially in separating approximately 10 .mu.g of total RNA by electrophoresis on 1.0% agarose gel under denaturing conditions (20 mM MOPS pH 7, 5 mM sodium acetate, 1 mM EDTA, 6.6% formaldehyde). The RNA thus separated is transferred onto a nitrocellulose sheet (Maniatis op. cit.). Two different nitrocellulose filters are thereby prepared, one of which is hybridised with radiolabelled probe 1 and the other with radiolabelled probe 2 [see Section 1.2) and 1.3) for the preparation of the probes and their labelling with .sup.32 P].
.beta.) Hybridisation with radiolabelled probe 1 and radiolabelled probe 2
The hybridisation conditions are the same as those described in Section 1.5). After hybridisation, each of the filters is washed individually in a solution containing 0.5.times.SSC at 42.degree. C. The filters are then exposed to a photographic film (Kodak XAR5) overnight.
Analysis of the films shows that an RNA population responds specifically to both probes, thereby indicating that the messenger RNA coding for endothiapepsin is present in the preparation.
b) The reaction using reverse transcriptase
The reaction of reverse transcriptase with 1 .mu.g of messenger RNA is performed in the presence of 10 mM dithiothreitol DTT, RNasin (RNase inhibitor, Genofit) 0.0040 U/.mu.l, a mixture of the four deoxyribonucleotide triphosphates dNTP at a concentration of 10 mM, buffer of composition 50 mM Tris-HCl pH 8.3, 20 mM KCl and 10 mM MgCl.sub.2, 0.7 unit of reverse transcriptase (Stratagene) and 0.1 ng of primer 1 as well as 0.1 ng of primer 2 for a final volume of 10 .mu.l. After incubation for half an hour at 46.degree. C., the reaction is stopped by adding 20 mM EDTA and the mixture is then incubated for 5 min at 65.degree. C.
c) The PCR reaction
The mixture described above is subjected to chromatography on a P10 polyacrylamide gel column in order to remove the small molecules (nucleotides, EDTA, and the like). The solution then obtained is incubated for 2 min at 92.degree. C. in order to denature the template composed of a strand of complementary DNA and a strand of messenger RNA. 100 ng of primer 1, 100 ng of primer 2, 2 mM MgCl.sub.2, 0.2 mM dNTP and 5 .mu.l of reaction mixture concentrated 10-fold (final quantity: 67 mM Tris-HCl pH 8.8, 16.6 mM (NH.sub.4).sub.2 SO.sub.4, 1 mM .beta.-mercaptoethanol, 6.7 mM EDTA, 0.15% Triton X-100, 200 g/ml of gelatin) are then added to the tube.
The volume of the mixture is then brought to 50 .mu.l by adding water.
The reaction mixture thereby obtained is incubated for 4 min at 94.degree. C. and then taken to a temperature of 41.degree. C., which is maintained for 4 min. The temperature of 41.degree. C. corresponds to a value 5 degrees lower than the temperature of half-denaturation of the oligonucleotide, calculated with an empirical formula well known to those skilled in the art.
0.5 .mu.l, equivalent to 2.5 units, of Taq polymerase (Boehringer Mannheim ref. 1146-165) is then added. The reaction mixture is then covered with paraffin in order to prevent evaporation of the aqueous solution.
The amplification is carried out during 30 reaction cycles, the steps of one cycle being as follows:
2 min at 92.degree. C..fwdarw.denaturation
2 min at 41.degree. C..fwdarw.hybridisation
2 min at 72.degree. C..fwdarw.polymerisation.
After the 30 cycles, the enzymatic reaction is stopped by adding 20 mM EDTA.
The DNA fragment thus amplified, which possesses the expected size of approximately 1,300 bp, is then isolated and purified on 1% agarose gel, dialysed on a P10 column and then hydrolysed simultaneously with the enzymes NdeI and HindIII according to the usual techniques well known to those skilled in the art (Maniatis, op. cit.) in order to form the NdeI and HindIII cohesive ends. After hydrolysis, the fragment is purified on a P10 column.
Section 16
Construction of plasmid p572, a vector for the cloning and expression in E. coli of the complementary DNA coding for the endothiapepsin precursor. Determination of the sequence of this complementary DNA and expression of the latter.
1) Construction of plasmid p572
Plasmid p572 was prepared from plasmid p466, a vector for the cloning and expression of the complementary DNA of urate oxidase of Aspergillus flavus in E. coli, described in Patent Application PCT-FR-90/00,532, which comprises a fragment of plasmid pBR327 including the origin of replication and the ampicillin resistance gene, a synthetic promoter of E. coli (R. RODRIGUEZ and M. CHAMBERLIN "Promoters-Structure and function" (1982) Preager), a Shine-Dalgarno sequence followed by a polylinker possessing single NdeI and HindIII sites, a transcription terminator (derived from phage fd) and the lac i gene.
a) Construction of plasmid p466
Plasmid p466, an expression vector in E. coli, was prepared. It comprises a fragment of pBR327 including the origin of replication and the ampicillin resistance gene; it also comprises a synthetic promoter of E. coli (R. RODRIGUEZ and M. CHAMBERLIN "Promoters-Structure and function" (1982) Preager), a Shine-Dalgarno sequence followed by a polylinker possessing single NdeI and KpnI sites, a transcription terminator (derived from phage fd) and the lac i gene.
This plasmid was constructed from a plasmid for the expression of hGH in E. coli (p462) by substitution of a fragment carrying the hGH gene by the cDNA of urate oxidase.
The construction of plasmid p466 will now be described in greater detail in the account below, in which reference will be made to FIGS. 6, 7, 8, 9 and 10.
1) Construction of plasmid p373,2
The strategy employed makes use of fragments obtained from pre-existing plasmids available to the public and fragments prepared synthetically according to techniques now in common use. The cloning techniques employed are those described by T. MANIATIS, E. F. FRITSCH and J. SAMBROOK, Cold Spring Harbor Laboratory (1982). Oligonucleotide synthesis is carried out using a Biosearch 4600 DNA synthesiser.
Plasmid p163,1 (FIG. 6), described in Patent Application EP-A-0,245,138 and deposited with the CNCM under reference I-530 on 17th Feb. 1986, was subjected to a digestion with the enzymes PvuI and BamhI. This plasmid contains the gene coding for hGH. The PvuI-BamHI fragment--hereinafter fragment 1--containing the site of action of the restriction enzyme XhoI, shown in FIG. 6, was purified.
Similarly, plasmid pBR327, well known to those sklilled in the art (see SOBERON, X et al., Gene, 9 (1980) 287-305), was subjected to a digestion with the enzymes PvuI and BamHI. The PvuI-BamHI fragment--herein-after fragment 2--containing the origin of replication was purified.
The fragment 3, which is a synthetic BamHI(1)-BamHI(2) fragment containing the lac i gene and its promoter and whose sequence is as follows (SEQ ID NO:24), on which sequence the two ends of the strand are identified by the numbers 1 and 2 in order to specify the orientation of the fragment in the plasmids described in FIGS. 7 and 8, was then prepared.
__________________________________________________________________________FRAGMENT 3 (SEQ ID NO: 24)__________________________________________________________________________BamHI(1) 5' GATCC GCGGAAGCAT AAAGTGTAAA GCCTGGGGTG CCTAATGAGT - GAGCTAACTT ACATTAATTG CGTTGCGCTC ACTGCCCGCT TTCCAGTCGG - GAAACCTGTC GTGCCAGCTG CATTAATGAA TCGGCCAACG CGCGGGGAGA - GGCGGTTTGC GTATTGGGCG CCAGGGTGGT TTTTCTTTTC ACCAGTGAGA - CGGGCAACAG CTGATTGCCC TTCACCGCCT GGCCCTGAGA GAGTTGCAGC - AAGCGGTCCA CGCTGGTTTG CCCCACCACC CGAAAATCCT GTTTGATGGT - GGTTAACGGC GGGATATAAC ATGAGCTGTC TTCGGTATCG TCGTATCCCA - CTACCGAGAT ATCCGCACCA ACGCGCAGCC CGGACTCGGT AATGGCGCGC - ATTGCGCCCA GCGCCATCTG ATCGTTGGCA ACCAGCATCG CAGTGGGAAC - GATGCCCTCA TTCAGCATTT GCATGGTTTG TTGAAAACCG GACATGGCAC - TCCAGTCGCC TTCCCGTTCC GCTATCGGCT GAATTTGATT GCGAGTGAGA - TATTTATGCC AGCCAGCCAG ACGCAGACGC GCCGAGACAG AACTTAATGG - GCCCGCTAAC AGCGCGATTT GCTGGTGACC CAATGCGACC AGATGCTCCA - CGCCCAGTCG CGTACCGTCT TCATGGGAGA AAATAATACT GTTGATGGGT - GTCTGGTCAG AGACATCAAG AAATAACGCC GGAACATTAG TGCAGGCAGC - TTCCACAGCA ATGGCATCCT GGTCATCCAG CGGATAGTTA ATGATCAGCC - CACTGACGCG TTGCGCGAGA AGATTGTGCA CCGCCGCTTT ACAGGCTTCG - ACGCCGCTTC GTTCTACCAT CGACACCACC ACGCTGGCAC CCAGTTGATC - GGCGCGAGAT TTAATCGCCG CGACAATTTG CGACGGCGCG TGCAGGGCCA - GACTGGAGGT GGCAACGCCA ATCAGCAACG ACTGTTTGCC CGCCAGTTGT - TGTGCCACGC GGTTGGGAAT GTAATTCAGC TCCGCCATCG CCGCTTCCAC - TTTTTCCCGC GTTTTCGCAG AAACGTGGCT GGCCTGGTTC ACCACGCGGG - AAACGGTCTG ATAACAGACA CCGGCATACT CTGCGACATC GTATAACGTT - ACTGGTTTCA CATTCACCAC CCTGAATTGA CTCTCTTCCG GGCGCTATCA - TGCCATACCG CGAAAGGTTT TGCGCCATTC GATGGTGTCC G 3' - BamHI(2)__________________________________________________________________________
The fragments 1, 2 and 3 were then ligated so as to obtain plasmid p160, shown in FIG. 7.
This plasmid was subjected to a partial digestion with the restriction enzymes HincII and PstI. The large HincII-PstI fragment, containing the origin of replication and shown in FIG. 7, was then ligated to the fragment 4 (SEQ ID NO:25), shown below, which is a synthetic DNA fragment carrying a sequence coding for the first 44 amino acids of a natural precursor of hGH and, upstream of this sequence, regulation signals (SEQ ID NO:26).
__________________________________________________________________________FRAGMENT 4 (SEQ ID NO: 25)__________________________________________________________________________ ClaI.tangle-soliddn. 5' TCGAGCTGACTGACCTGTTGCTTATATTACATCGA ----------------------------------- AGCTCGACTGACTGGACAACGAATATAATGTAGCT.tangle-solidup. NdeI.tangle-soliddn. TAGCGTATAATGTGTGGAATTGTGAGCGATAACAATTTCACACAGTTTAACTTTAAGAAGGAGATATACAT ATCGATATTACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCAAATTGAAATTCTTCCTCTATATGTA - ATG GCT ACC GGA TCC CGG ACT AGT CTG CTC CTG GCT TTT GGC CTG CTC TGCCTG TAC CGA TGG CCT AGG GCC TGA TCA GAC GAG GAC CGA AAA CCG GAC GAC ACG GAC .tangle-solidup. M A T G S R T S L L L A F G L L C L -26 - XbaI .tangle-soliddn. CCC TGG CTT CAA GAG GGC AGT GCC TTC CCA ACC ATT CCC TTA TCT AGA CTT TTT ----------------------------------------------------- GGG ACC GAA GTT CTC CCG TCA CGG AAG GGT TGG TAA GGG AAT AGA TCT GAA AAA .tangle-solidup. P W L Q E G S A F P T I P L S R L F -1 1 - GAC AAC GCT ATG CTC CGC GCC CAT CGT CTG CAC CAG CTG GCC TTT GAC ACCTAC CTG TTG CGA TAC GAG GCG CGG GTA GCA GAC GTG GTC GAC CGG AAA CTG TGG ATC D N A M L R A H R L H Q L A F L T Y PstI CAG GAG TTT GAA GAA GCC TAT ATC CCA AAG GAA CAG AAG TAT TCA TTC CTG CA GTC CTC AAA CTT CTT CGG ATA TAG GGT TTC CTT GTC TTC ATA AGT AAG G Q E F E E A Y I P K E Q K Y S F 44__________________________________________________________________________
In this fragment, the amino acids are designated by letters according to the following code:
______________________________________A = Alanine M = Methionine C = Cysteine N = Asparagine D = Aspartic acid P = Proline E = Glutamic acid Q = Glutamine F = Phenylalanine R = Arginine G = Glycine S = Serine H = Histidine T = Threonine I = Isoleucine V = Valine K = Lysine W = Tryptophan L = Leucine Y = Tyrosine______________________________________
In this fragment, the sequences -35 (TTGCTT) and -10 (TATAAT) of the promoter sequence and the Shine-Dalgarno sequence which is well known to those skilled in the art are successively underlined.
Plasmid p380,1 was thereby obtained.
Plasmid p380,1 was then subjected to a digestion with the restriction enzymes ClaI and NdeI so as to remove from it the small ClaI-NdeI fragment of the above fragment 4 and to substitute for it the ClaI-NdeI fragment below (SEQ ID NO:27):
ClaI - 5' CGATAGCGTATAATGTGTGGAATTGTGAGCGGATAACA - TATCGCATATTACACACCTTAACACTCGCCTATTGT - NdeI - ATTTCACACAGTTTTTCGCGAAGAAGGAGATATACA - TAAAGTGTGTCAAAAAGCGCTTCTTCCTCTATATGTAT 5'
2) Construction of plasmid p466
Plasmid p373,2 was subjected to a double digestion with the enzymes BglII and HindIII. The large fragment derived from this digestion was purified and ligated with a synthetic DNA fragment whose sequence (SEQ ID NO:28), given below, is intended for re-forming the end of the hGH gene followed at the 3' end by KpnI and SnaBI cloning sites.
B g l I I GATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACGAT ----+----------+----------+---- -------+---------+ AAGTTCGTCTGGATGTCGTTCAAGCTGTGTTTGAGTGTGTTGCTA GACGCACTACTCAAGAACTACG GGCTGCTCTACTGCTTCAGGAAGGACATGGA CAAGGTC ----------+----------+----------+----------+----------+--------- + CTGCGTGATGAGTTCTTGATGCCCGACGAGATGACGAAGTCCTTCCTGTACCTGTTCCAG F s p I GAGACATTCCTGCGCATCGTGC AGTGCCGCTCTGTGGAGGGCAGCTGTGGCTT CTAGTAA ----------+----------+----------+---------+-----------+--------- + CTCTGTAAGGACGCGTAGCACGTCACGGCGAGACACCTCCCGTCGACACCGAAGATCATT H i S n K n d p a I n B I I I I GGTACCCTGCCCTACGTACCA ----------+----------+----- CCATGGGACGGGATGCATGGTTCGA
This fragment comprises the BglII and HindIII cohesive ends. The new plasmid thereby formed, p462 (see FIG. 9), thus comprises a KpnI site and an NdeI site which will be used for cloning the fragment carrying the cDNA of urate oxidase into the expression vector.
The hybrid plasmid derived from pTZ19R carrying the approximately 1.2-kb cDNA (clone 9C) of urate oxidase comprises a single KpnI site. This site is localised a few base pairs downstream of the cloning site of the cDNA. Moreover, the cDNA of urate oxidase contains an AccI site situated in proximity to the 5' end.
The AccI-KpnI fragment comprising the larger part of this cDNA was hence isolated and purified. Moreover, two complementary oligonucleotides, whose sequence (SEQ ID NOS:29 and 30), given below:
5'-TATGTCTGCGGTAAAAGCAGCGCGCTACGGCAAGGACAATGTTCGCGT - ACAGACGCCATTTTCGTCGCGCGATGCCGTTCCTGTTACAAGCGCAGA-5'
is intended for re-forming the 5' end of the cDNA, were synthesised. This synthetic fragment thereby obtained possesses an NdeI end and an AccII end. The fragment and the synthetic sequence were ligated with the expression vector cut with KpnI and with NdeI. This three-fragment ligation enables the vector, designated p466, for the expression of urate oxidase for E. coli to be obtained (see FIG. 10). This plasmid was subjected to a series of enzymatic hydrolyses with restriction enzymes, which enabled the presence of the expected restriction sites to be verified, especially those carried by the gene coding for urate oxidase.
Plasmid p466 hence contains by construction a gene coding for urate oxidase, of the sequence below (SEQ ID NO:31):
ATGTCTGCGG TAAAAGCAGC GCGCTACGGC AAGGACAATG TTCGCGTCTA - CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA - CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAGGCC - GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT - CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC - TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC - AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA - CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG - ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG - ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA - GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG - ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG - CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT - GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA - AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG - TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA - GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG - ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT - AAATTG.
(The nucleotides different from the nucleotides of the cDNA isolated from A. flavus are underlined in the above sequence. These differences were introduced into the synthetic AccI-KpnI fragment so as to have, downstream of the ATG, a nucleotide sequence conforming more closely to those usually encountered in a prokaryotic gene).
Plasmid p466 was hydrolysed with the enzymes NdeI and HindIII, and the fragment carrying the lac i gene, the origin of replication and the gene coding for ampicillin resistance was purified according to the techniques known to those skilled in the art (Maniatis, op. cit.).
This fragment was ligated to the amplified complementary DNA fragment previously hydrolysed with the endonucleases NdeI and HindIII. The product of this ligation was used for transformation in E. coli strain K12 RRI. (Gibco BRL-ref.: 520-8261 SA). A transformant, referred to as clone 512, which contains the plasmid referred to as p572, was adopted.
2) Determination of the sequence of the complementary DNA
Plasmid p572 was hydrolysed, on the one hand with the endonucleases ClaI and KpnI, and on the other hand with the enzymes KpnI and HindIII. (The endonuclease KpnI cuts the coding sequence of the fragment A). The ClaI-KpnI fragment carrying the 5' end of the DNA coding for the protein and the KpnI-HindIII fragment carrying the 3' end of the DNA coding for the protein were cloned into phage M13mp19 (Pharmacia) and sequenced by the cyclone technique ("Cyclone I Biosystem" of IBI).
The nucleotide sequence of the complementary DNA thereby obtained is shown in FIG. 11. It is observed that the coding sequence of the complementary DNA is exactly identical to that of the genomic DNA, the only difference being that the latter is interrupted by three introns, which have been correctly localised (see Section 1.7)).
3) Expression of the complementary DNA of preproendothiapepsin
E. coli strain K12 RRI (Gibco BRL Ref.: 520-8261A) was transformed for ampicillin resistance with plasmid p572 carrying the complementary DNA of preproendothiapepsin, whose sequence was determined in 2), and with a negative control plasmid pBR322.
Ampicillin-resistant colonies were obtained in both cases.
1 colony of each type was cultured in LB liquid medium (of composition specified in Table 4, but without agar) supplemented with 100 .mu.g/ml of ampicillin. After stirring overnight at 37.degree. C., both cultures were diluted 100-fold in liquid LB medium supplemented with 100 .mu.g/ml of ampicillin. After 1 h of culture, IPTG (isopropyl-.beta.-D-thiogalactoside) was added to a concentration of 1 mM for 3 h.
Immunodetection of preproendothiapepsin by Western blotting
a) Procedure
An aliquot fraction corresponding to 0.2 ml with an OD=1 is withdrawn from the culture medium obtained after 3 h of induction with IPTG. The aliquot is centrifuged and the supernatant is removed. The pellet is then subjected to Western blotting, a technique well known to those skilled in the art, which comprises the following steps:
Solubilisation of the pellet by boiling for 10 min in a buffer, designated loading buffer, consisting of 0.125M Tris-HCl pH 6.8, 4% SDS, 0.002% bromophenol blue, 20% glycerol and 10% .beta.-mercaptoethanol (according to the protocol described by LAEMMLI (U. K. LAEMMLI, Nature, 227 (1970), 680-685)),
Electrophoretic separation of the different proteins contained in the solubilisate according to the protocol described by LAEMMLI (U. K. LAEMMLI, Nature, 227, (1970), 680-685),
Transfer of the said proteins contained in the gel onto a nitrocellulose filter (according to the technique of H. TOWBIN et al. Proc. Natl. Acad. Sci. USA 76 (1979) 4350-4354),
Immunodetection, carried out according to the technique of BURNETTE (W. W. BURNETTE Ana. Biochem. 112 (1981) 195-203); this involves successively:
Rinsing the nitrocellulose filter for 10 min with a buffer of composition 10 mM Tris-HCl, 170 mM NaCl, 1 mM KCl.
Bringing the nitrocellulose filter into contact for 30 min at 37.degree. C. with buffer A supplemented with bovine serum albumin in the proportion of 3 g per 100 ml.
Bringing the nitrocellulose filter into contact for 1 h at 37.degree. C. with the polyclonal antibodies of the Rennetest France Biochem kit, according to the method of identification of endothiapepsin described in the Journal Officiel de la Republique Fran.cedilla.aise (Official Journal of the French Republic) of Mar. 20, 1981.
Rinsing the nitrocellulose filter with buffer A supplemented with 3 g/100 ml of bovine serum albumin.
Bringing the nitrocellulose filter into contact for 1 h at 37.degree. C. with a solution of iodine-125-labelled protein G having an activity of 0.1 microcurie/ml.
Rinsing the filter with buffer A.
Drying the filter between two absorbent sheets.
Bringing the filter into contact with a radiographic film.
Developing the film.
b) Results
It is found that the strain transformed with plasmid p572 overproduces a protein of apparent molecular weight approximately 43 kDa corresponding to the expected molecular mass of preproendothiapepsin, which is recognised by antibodies directed towards endothiapepsin and which is absent in the control strain.
__________________________________________________________________________# SEQUENCE LISTING - - - - (1) GENERAL INFORMATION: - - (iii) NUMBER OF SEQUENCES: 33 - - - - (2) INFORMATION FOR SEQ ID NO:1: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 330 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (v) FRAGMENT TYPE: N-terminal - - (vii) IMMEDIATE SOURCE: (B) CLONE: endothiapepsin - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: - - Ser Thr Gly Ser Ala Thr Thr Thr - # Pro Ile Asp Ser Leu AspAsp Ala 1 - # 5 - # 10 - #15 - - Tyr Ile Thr Pro Val Gln Ile Gly - # Thr Pro Ala Gln Thr LeuAsn Leu 20 - # 25 - # 30 - - Asp Phe Asp Thr Gly Ser Ser Asp - # Leu Trp Val Phe Ser SerGlu Thr 35 - # 40 - # 45 - - Thr Ala Ser Glu Val Asp Gly Gln - # Thr Ile Tyr Thr Pro SerLys Ser 50 - # 55 - # 60 - - Thr Thr Ala Lys Leu Leu Ser Gly - # Ala Thr Trp Ser Ile SerTyr Gly 65 - # 70 - # 75 - # 80 - - Asp Gly Ser Ser Ser Ser Gly Asp - # Val Tyr Thr Asp Thr ValSer Val - # 85 - # 90 - #95 - - Gly Gly Leu Thr Val Thr Gly Gln - # Ala Val Glu Ser Ala LysLys Val 100 - # 105 - # 110 - - Ser Ser Ser Phe Thr Glu Asp Ser - # Thr Ile Asp Gly Leu LeuGly Leu 115 - # 120 - # 125 - - Ala Phe Ser Thr Leu Asn Thr Val - # Ser Pro Thr Gln Gln LysThr Phe 130 - # 135 - # 140 - - Phe Asp Asn Ala Lys Ala Ser Leu - # Asp Ser Pro Val Phe ThrAla Asp 145 - # 150 - # 155 - # 160 - - Leu Gly Tyr His Ala Pro Gly Thr - # Tyr Asn Phe Gly Phe IleAsp Thr - # 165 - # 170 - #175 - - Thr Ala Tyr Thr Gly Ser Ile Thr - # Tyr Thr Ala Val Ser ThrLys Gln 180 - # 185 - # 190 - - Gly Phe Trp Glu Trp Thr Ser Thr - # Gly Tyr Ala Val Gly SerGly Thr 195 - # 200 - # 205 - - Phe Lys Ser Thr Ser Ile Asp Gly - # Ile Ala Asp Thr Gly ThrThr Leu 210 - # 215 - # 220 - - Leu Tyr Leu Pro Ala Thr Val Val - # Ser Ala Tyr Trp Ala GlnVal Ser 225 - # 230 - # 235 - # 240 - - Gly Ala Lys Ser Ser Ser Ser Val - # Gly Gly Tyr Val Phe ProCys Ser - # 245 - # 250 - #255 - - Ala Thr Leu Pro Ser Phe Thr Phe - # Gly Val Gly Ser Ala ArgIle Val 260 - # 265 - # 270 - - Ile Pro Gly Asp Tyr Ile Asp Phe - # Gly Pro Ile Ser Thr GlySer Ser 275 - # 280 - # 285 - - Ser Cys Phe Gly Gly Ile Gln Ser - # Ser Ala Gly Ile Gly IleAsn Ile 290 - # 295 - # 300 - - Phe Gly Asp Val Ala Leu Lys Ala - # Ala Phe Val Val Phe AsnGly Ala 305 - # 310 - # 315 - # 320 - - Thr Thr Pro Thr Leu Gly Phe Ala - # Ser Lys - # 325 - # 330 - - - - (2) INFORMATION FOR SEQ ID NO:2: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 419 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (v) FRAGMENT TYPE: N-terminal - - (vii) IMMEDIATE SOURCE: (B) CLONE: preproendothiap - #epsin - - (ix) FEATURE: (A) NAME/KEY: Protein (B) LOCATION: 90..419 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: - - Met Ser Ser Pro Leu Lys Asn Ala - # Leu Val Thr Ala Met LeuAla Gly - # -85 - # -80 - #-75 - - Gly Ala Leu Ser Ser Pro Thr Lys - # Gln His Val Gly Ile ProVal Asn -70 - # -65 - # -60 - - Ala Ser Pro Glu Val Gly Pro Gly - # Lys Tyr Ser Phe Lys GlnVal Arg -55 - # -50 - # -45 - - Asn Pro Asn Tyr Lys Phe Asn Gly - # Pro Leu Ser Val Lys LysThr Tyr -40 - # -35 - # -30 - - Leu Lys Tyr Gly Val Pro Ile Pro - # Ala Trp Leu Glu Asp AlaVal Gln -25 - # -20 - # -15 - # -10 - - Asn Ser Thr Ser Gly Leu Ala Glu - # Arg Ser Thr Gly Ser AlaThr Thr - # -5 - # 1 - #5 - - Thr Pro Ile Asp Ser Leu Asp Asp - # Ala Tyr Ile Thr Pro ValGln Ile 10 - # 15 - # 20 - - Gly Thr Pro Ala Gln Thr Leu Asn - # Leu Asp Phe Asp Thr GlySer Ser 25 - # 30 - # 35 - - Asp Leu Trp Val Phe Ser Ser Glu - # Thr Thr Ala Ser Glu ValAsp Gly 40 - # 45 - # 50 - # 55 - - Gln Thr Ile Tyr Thr Pro Ser Lys - # Ser Thr Thr Ala Lys LeuLeu Ser - # 60 - # 65 - #70 - - Gly Ala Thr Trp Ser Ile Ser Tyr - # Gly Asp Gly Ser Ser SerSer Gly 75 - # 80 - # 85 - - Asp Val Tyr Thr Asp Thr Val Ser - # Val Gly Gly Leu Thr ValThr Gly 90 - # 95 - # 100 - - Gln Ala Val Glu Ser Ala Lys Lys - # Val Ser Ser Ser Phe ThrGlu Asp 105 - # 110 - # 115 - - Ser Thr Ile Asp Gly Leu Leu Gly - # Leu Ala Phe Ser Thr LeuAsn Thr 120 - # 125 - # 130 - # 135 - - Val Ser Pro Thr Gln Gln Lys Thr - # Phe Phe Asp Asn Ala LysAla Ser - # 140 - # 145 - #150 - - Leu Asp Ser Pro Val Phe Thr Ala - # Asp Leu Gly Tyr His AlaPro Gly 155 - # 160 - # 165 - - Thr Tyr Asn Phe Gly Phe Ile Asp - # Thr Thr Ala Tyr Thr GlySer Ile 170 - # 175 - # 180 - - Thr Tyr Thr Ala Val Ser Thr Lys - # Gln Gly Phe Trp Glu TrpThr Ser 185 - # 190 - # 195 - - Thr Gly Tyr Ala Val Gly Ser Gly - # Thr Phe Lys Ser Thr SerIle Asp 200 - # 205 - # 210 - # 215 - - Gly Ile Ala Asp Thr Gly Thr Thr - # Leu Leu Tyr Leu Pro AlaThr Val - # 220 - # 225 - #230 - - Val Ser Ala Tyr Trp Ala Gln Val - # Ser Gly Ala Lys Ser SerSer Ser 235 - # 240 - # 245 - - Val Gly Gly Tyr Val Phe Pro Cys - # Ser Ala Thr Leu Pro SerPhe Thr 250 - # 255 - # 260 - - Phe Gly Val Gly Ser Ala Arg Ile - # Val Ile Pro Gly Asp TyrIle Asp 265 - # 270 - # 275 - - Phe Gly Pro Ile Ser Thr Gly Ser - # Ser Ser Cys Phe Gly GlyIle Gln 280 - # 285 - # 290 - # 295 - - Ser Ser Ala Gly Ile Gly Ile Asn - # Ile Phe Gly Asp Val AlaLeu Lys - # 300 - # 305 - #310 - - Ala Ala Phe Val Val Phe Asn Gly - # Ala Thr Thr Pro Thr LeuGly Phe 315 - # 320 - # 325 - - Ala Ser Lys 330 - - - - (2) INFORMATION FOR SEQ ID NO:3: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1252 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: DNA coding - #for preproendothiapepsin having SEQ ID - #NO:2 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: - - ATGTCTTCCC CTCTCAAGAA CGCCTTGGTG ACCGCCATGT TGGCTGGTGG TG -#CTCTCAGC 60 - - TCGCCTACAA AGCAACACGT TGGAATTCCC GTCAACGCCT CTCCTGAAGT TG -#GCCCCGGA 120 - - AAGTACTCGT TCAAGCAAGT CCGGAACCCC AACTACAAGT TCAACGGGCC TC -#TGTCGGTC 180 - - AAGAAGACGT ACCTCAAGTA CGGCGTGCCG ATCCCAGCCT GGCTGGAGGA TG -#CTGTCCAG 240 - - AACTCTACCT CGGGCCTGGC TGAGCGCTCG ACCGGTTCTG CGACCACAAC TC -#CCATCGAC 300 - - AGCCTCGATG ATGCTTACAT CACTCCGGTT CAGATCGGCA CCCCTGCGCA GA -#CTCTGAAC 360 - - CTGGACTTTG ACACTGGATC TTCGGATCTG TGGGTCTTCA GCAGCGAGAC TA -#CAGCCAGC 420 - - GAGGTCGATG GGCAGACCAT CTACACCCCC AGCAAGAGCA CCACCGCCAA GC -#TGCTGTCG 480 - - GCGCTACCTG GTCCATCTCC TACGGAGACG GTAGCTCTTC CAGCGGCGAT GT -#CTACACTG 540 - - ACACCGTCTC GGTTGGAGGC CTTACCGTGA CGGGCCAGGC TGTCGAGTCG GC -#CAAGAAGG 600 - - TTTCTTCCAG CTTCACCGAG GACTCGACCA TTGACGGTCT CCTGGGCCTG GC -#CTTCAGCA 660 - - CCCTGAACAC TGTGTCGCCT ACCCAGCAAA AGACTTTCTT CGACAATGCG AA -#GGCGTCCT 720 - - TGGACTCGCC TGTGTTCACG GCTGATCTTG GCTACCATGC CCCTGGTACC TA -#CAACTTCG 780 - - GCTTCATCGA TACCACTGCC TACACGGGCT CCATCACCTA CACCGCTGTC TC -#GACCAAGC 840 - - AAGGGTTCTG GGAGTGGACT TCGACCGGCT ACGCCGTCGG CTCCGGCACC TT -#CAAGTCGA 900 - - CTTCCATCGA CGGCATCGCT GACACTGGCA CGACCCTCCT GTACCTCCCT GC -#CACCGTCG 960 - - TGTCGGCCTA CTGGGCCCAG GTCTCGGGCG CCAAGTCCAG CTCTTCCGTC GG -#CGGCTACG 1020 - - TCTTCCCCTG CAGCGCGACC CTGCCTTCCT TCACCTTCGG CGTTGGCTCA GC -#TCGCATTG 1080 - - TGATTCCTGG CGACTACATT GATTTCGGCC CCATCTCCAC TGGAAGCTCG TC -#TTGCTTTG 1140 - - GCGGCATCCA GTCCAGCGCT GGTATCGGCA TCAACATCTT CGGTGATGTC GC -#TCTGAAGG 1200 - - CTTTGTCGTC TTCAACGGGG CTACAACTCC CACTCTTGGC TTTGCTTCCA AG - # 1252 - - - - (2) INFORMATION FOR SEQ ID NO:4: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1533 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: DNA sequence - # coding for endothiapepsin - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: - - ATGTCTTCCC CTCTCAAGAA CGCCTTGGTG ACCGCCATGT TGGCTGGTGG TG -#CTCTCAGC 60 - - TCGCCTACAA AGCAACACGT TGGAATTCCC GTCAACGCCT CTCCTGAAGT TG -#GCCCCGGA 120 - - AAGTACTCGT TCAAGCAAGG TGAGTAGAGC TGCTTCTGTG TGTTGCAACA GA -#AGACCAAC 180 - - GCAAAAAGAA GAGGTCAAGG CAAGACGGAT ATTTTACTGA CAATTATACT TT -#TGAAGTCC 240 - - GGAACCCCAA CTACAAGTTC AACGGGCCTC TGTCGGTCAA GAAGACGTAC CT -#CAAGTACG 300 - - GCGTGCCGAT CCCAGCCTGG CTGGAGGATG CTGTCCAGAA CTCTACCTCG GG -#CCTGGCTG 360 - - AGCGCTCGAC CGGTTCTGCG ACCACAACTC CCATCGACAG CCTCGATGAT GC -#TTACATCA 420 - - CTCCGGTTCA GATCGGCACC CCTGCGCAGA CTCTGAACCT GGACTTTGAC AC -#TGGATCTT 480 - - CGGATCTGTG GGTCTTCAGC AGCGAGACTA CAGCCAGCGA GGTTGGTCAA CC -#CTCGCCCG 540 - - CATTTTATTG CATACATTTT TAGTTTTTTT GGTAATCAGA ATACTAACAT TG -#GGAATTTC 600 - - CCAACTGTAG GTCGATGGGC AGACCATCTA CACCCCCAGC AAGAGCACCA CC -#GCCAAGCT 660 - - GCTGTCGGGC GCTACCTGGT CCATCTCCTA CGGAGACGGT AGCTCTTCCA GC -#GGCGATGT 720 - - CTACACTGAC ACCGTCTCGG TTGGAGGCCT TACCGTGACG GGCCAGGCTG TC -#GAGTCGGC 780 - - CAAGAAGGTT TCTTCCAGCT TCACCGAGGA CTCGACCATT GACGGTCTCC TG -#GGCCTGGC 840 - - CTTCAGCACC CTGAACACTG TGTCGCCTAC CCAGCAAAAG ACTTTCTTCG AC -#AATGCGAA 900 - - GGCGTCCTTG GACTCGCCTG TGTTCACGGC TGATCTTGGC TACCATGCCC GT -#GAGTGACC 960 - - CCTCTTGATA CATATACTTT TTGATGAATC TTGTTGGAGA AGCATTCCCC AC -#TAATATGG 1020 - - AAATTGTTTG TATCTACAGC TGGTACCTAC AACTTCGGCT TCATCGATAC CA -#CTGCCTAC 1080 - - ACGGGCTCCA TCACCTACAC CGCTGTCTCG ACCAAGCAAG GGTTCTGGGA GT -#GGACTTCG 1140 - - ACCGGCTACG CCGTCGGCTC CGGCACCTTC AAGTCGACTT CCATCGACGG CA -#TCGCTGAC 1200 - - ACTGGCACGA CCCTCCTGTA CCTCCCTGCC ACCGTCGTGT CGGCCTACTG GG -#CCCAGGTC 1260 - - TCGGGCGCCA AGTCCAGCTC TTCCGTCGGC GGCTACGTCT TCCCCTGCAG CG -#CGACCCTG 1320 - - CCTTCCTTCA CCTTCGGCGT TGGCTCAGCT CGCATTGTGA TTCCTGGCGA CT -#ACATTGAT 1380 - - TTCGGCCCCA TCTCCACTGG AAGCTCGTCT TGCTTTGGCG GCATCCAGTC CA -#GCGCTGGT 1440 - - ATCGGCATCA ACATCTTCGG TGATGTCGCT CTGAAGGCCG CCTTTGTCGT CT -#TCAACGGG 1500 - - GCTACAACTC CCACTCTTGG CTTTGCTTCC AAG - # -# 1533 - - - - (2) INFORMATION FOR SEQ ID NO:5: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 328 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (ix) FEATURE: (A) NAME/KEY: TATA.sub.-- - #signal (B) LOCATION: 1..328 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: - - AAGCTTATCC GCCGCCGGCG GGGGAATTCT ATTGAACTTG TTCGAATCAT TG -#GTCCGTGG 60 - - TCTTTTCGTC CATGCGGGCT CCGCTGGCGG ATGAATGACC TTCTGGCTTC TA -#GCCTGGCG 120 - - AAGCGATGTT ACTCTGTTGT CTATACTATA CGATATGGTC AAGAGAGCAC AT -#GTGCCGCC 180 - - AGATGAAGAC ATGTATATAA AAGGAGTGGC CTCGACGGTT GCTCAACCAT CT -#TCTGTCTG 240 - - TCCCAACGCC ATCGACTCTT CAACTTCTCC TTCGTGTTCC ACCACCATCA CC -#TTGCTCCA 300 - - GACTTAGGAC TTTCAGCAAC CTTCAAAG - # - # 328 - - - - (2) INFORMATION FOR SEQ ID NO:6: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 608 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: segment X - #of fragment C having an activator region - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: - - GCATGCTTGG CTCTTTAACG TCCTGCCCAT TCAGGGCCTT CAGCCGGCAC TG -#GTCCTTCA 60 - - TCAAGGGGGA CCTCATGACC ATGAACTAAT CTGTGATATC TGATATATTC TA -#GAAGGCTT 120 - - GGCTCCTCAA AGTTTCCAGC TAATGAATCA GCGGCCCGCC GCCCTTAAAC CG -#CATCAGGC 180 - - AAGTCGTTTG GTGTTGCCAG GCGATGGCGA CAGGAGAGTG GTGTTGATGG GA -#CAAGGGGA 240 - - GGGAGGCTTA GCCGACTTCA TCCATAGCAC CCACCTGCTT GGCGCCGATA AG -#TCTGACGA 300 - - TCCGCTTGAG CTGCAAAACG GCTCCTTGAC CTTTGTTTGG TCGACCGAGG GA -#AATAGTCT 360 - - CTTTTTGCGT GATCGTGCGC GCTTCGTATA GCAATAGCAG CCAGCACCAG CA -#GGACGGGC 420 - - CGTTGTCACG GTCACATCGT TCGCAACATG CCGAGCGTAG GGATGAACGA AT -#GACTCGAG 480 - - CCTTGCCTGA CAGTCTGGCA ATCAATCTAT GGTCACGCAC GATCACAAGC CA -#ATCGCTGT 540 - - GACTGCGTTA CTAGCCCAAT AATCCCTTGT TCGATCAGAG TGTTCTACAG AC -#TTCAAGTG 600 - - AGGTTCAC - # - #- # 608 - - - - (2) INFORMATION FOR SEQ ID NO:7: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (v) FRAGMENT TYPE: N-terminal - - (vii) IMMEDIATE SOURCE: (B) CLONE: peptide 1 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: - - Val Asp Gly Gln Thr 1 - # 5 - - - - (2) INFORMATION FOR SEQ ID NO:8: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (v) FRAGMENT TYPE: N-terminal - - (vii) IMMEDIATE SOURCE: (B) CLONE: peptide 2 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: - - Gly Phe Trp Glu Trp Thr 1 - # 5 - - - - (2) INFORMATION FOR SEQ ID NO:9: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - # / probe - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: - - GTNGAYGGNC ARACN - # - # - # 15 - - - - (2) INFORMATION FOR SEQ ID NO:10: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotid - #/ probe - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: - - GGNTTYTGGG ARTGGACN - # - # - # 18 - - - - (2) INFORMATION FOR SEQ ID NO:11: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 60 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: - - ATGTCTTCCC CTCTCAAGAA CGCCTTGGTG ACCGCCATGT TGGCTGGTGG TG -#CTCTCAGC 60 - - - - (2) INFORMATION FOR SEQ ID NO:12: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (v) FRAGMENT TYPE: N-terminal - - (vii) IMMEDIATE SOURCE: (B) CLONE: peptide sign - #al - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: - - Met Ser Ser Pro Leu Lys Asn Ala - # Leu Val Thr Ala Met LeuAla Gly 1 - # 5 - # 10 - #15 - - Gly Ala Leu Ser 20 - - - - (2) INFORMATION FOR SEQ ID NO:13: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 207 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: pro nucleoti - #de sequence - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: - - TCGCCTACAA AGCAACACGT TGGAATTCCC GTCAACGCCT CTCCTGAAGT TG -#GCCCCGGA 60 - - AAGTACTCGT TCAAGCAAGT CCGGAACCCC AACTACAAGT TCAACGGGCC TC -#TGTCGGTC 120 - - AAGAAGACGT ACCTCAAGTA CGGCGTGCCG ATCCCAGCCT GGCTGGAGGA TG -#CTGTCCAG 180 - - AACTCTACCT CGGGCCTGGC TGAGCGC - # - # 207 - - - - (2) INFORMATION FOR SEQ ID NO:14: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 69 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (v) FRAGMENT TYPE: N-terminal - - (vii) IMMEDIATE SOURCE: (B) CLONE: pro peptide - #sequence - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: - - Ser Pro Thr Lys Gln His Val Gly - # Ile Pro Val Asn Ala SerPro Glu 1 - # 5 - # 10 - #15 - - Val Gly Pro Gly Lys Tyr Ser Phe - # Lys Gln Val Arg Asn ProAsn Tyr 20 - # 25 - # 30 - - Lys Phe Asn Gly Pro Leu Ser Val - # Lys Lys Thr Tyr Leu LysTyr Gly 35 - # 40 - # 45 - - Val Pro Ile Pro Ala Trp Leu Glu - # Asp Ala Val Gln Asn SerThr Ser 50 - # 55 - # 60 - - Gly Leu Ala Glu Arg 65 - - - - (2) INFORMATION FOR SEQ ID NO:15: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 89 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: peptide - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (v) FRAGMENT TYPE: N-terminal - - (vii) IMMEDIATE SOURCE: (B) CLONE: prepro pepti - #de sequence - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: - - Met Ser Ser Pro Leu Lys Asn Ala - # Leu Val Thr Ala Met LeuAla Gly 1 - # 5 - # 10 - #15 - - Gly Ala Leu Ser Ser Pro Thr Lys - # Gln His Val Gly Ile ProVal Asn 20 - # 25 - # 30 - - Ala Ser Pro Glu Val Gly Pro Gly - # Lys Tyr Ser Phe Lys GlnVal Arg 35 - # 40 - # 45 - - Asn Pro Asn Tyr Lys Phe Asn Gly - # Pro Leu Ser Val Lys LysThr Tyr 50 - # 55 - # 60 - - Leu Lys Tyr Gly Val Pro Ile Pro - # Ala Trp Leu Glu Asp AlaVal Gln 65 - # 70 - # 75 - # 80 - - Asn Ser Thr Ser Gly Leu Ala Glu - # Arg - # 85 - - - - (2) INFORMATION FOR SEQ ID NO:16: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: Start of - #natural seq. coding for precursor of endothiapeps - #in - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: - - GATGTCTTCC CCTCTCAAGA ACGCCTTGGT GACC - # -# 34 - - - - (2) INFORMATION FOR SEQ ID NO:17: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: Fragment EM - #in which the sequence coding for endothiapeps - #in - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: - - GATGTCTTCC CCTCTCTAAT GAACGCCTTG GTGACC - # -# 36 - - - - (2) INFORMATION FOR SEQ ID NO:18: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: - - GCTAAAGCTT ATCCGCCGCC GGCGGGGGAA TTC - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO:19: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 46 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: - - CAATGGATCC GGTCACCAAG GCGTTCATTA GAGAGGGGAA GACATC - # 46 - - - - (2) INFORMATION FOR SEQ ID NO:20: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - # /primer 5' carrying site NcoI - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: - - ACGTCCATGG CTTCCCCTCT CAAGAACGCC - # - # 30 - - - - (2) INFORMATION FOR SEQ ID NO:21: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - # / primer 3' carrying site MluI - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: - - ACGTACGCGT CCACGCCTAC CCAACAAGAC - # - # 30 - - - - (2) INFORMATION FOR SEQ ID NO:22: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - # / primer 1 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: - - AGAAAGCTTG GAGGAGCGAG GGCCC - # - # 25 - - - - (2) INFORMATION FOR SEQ ID NO:23: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - # / primer 2 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: - - GCAGAATTCA CATATGTCTT CCCCTCTCAA G - # - # 31 - - - - (2) INFORMATION FOR SEQ ID NO:24: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1236 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: Fragment 3:s - #ynthetic fragment BamHI(1)-Bam - #HI(2) containing - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: - - GATCCGCGGA AGCATAAAGT GTAAAGCCTG GGGTGCCTAA TGAGTGAGCT AA -#CTTACATT 60 - - AATTGCGTTG CGCTCACTGC CCGCTTTCCA GTCGGGAAAC CTGTCGTGCC AG -#CTGCATTA 120 - - ATGAATCGGC CAACGCGCGG GGAGAGGCGG TTTGCGTATT GGGCGCCAGG GT -#GGTTTTTC 180 - - TTTTCACCAG TGAGACGGGC AACAGCTGAT TGCCCTTCAC CGCCTGGCCC TG -#AGAGAGTT 240 - - GCAGCAAGCG GTCCACGCTG GTTTGCCCCA CCACCCGAAA ATCCTGTTTG AT -#GGTGGTTA 300 - - ACGGCGGGAT ATAACATGAG CTGTCTTCGG TATCGTCGTA TCCCACTACC GA -#GATATCCG 360 - - CACCAACGCG CAGCCCGGAC TCGGTAATGG CGCGCATTGC GCCCAGCGCC AT -#CTGATCGT 420 - - TGGCAACCAG CATCGCAGTG GGAACGATGC CCTCATTCAG CATTTGCATG GT -#TTGTTGAA 480 - - AACCGGACAT GGCACTCCAG TCGCCTTCCC GTTCCGCTAT CGGCTGAATT TG -#ATTGCGAG 540 - - TGAGATATTT ATGCCAGCCA GCCAGACGCA GACGCGCCGA GACAGAACTT AA -#TGGGCCCG 600 - - CTAACAGCGC GATTTGCTGG TGACCCAATG CGACCAGATG CTCCACGCCC AG -#TCGCGTAC 660 - - CGTCTTCATG GGAGAAAATA ATACTGTTGA TGGGTGTCTG GTCAGAGACA TC -#AAGAAATA 720 - - ACGCCGGAAC ATTAGTGCAG GCAGCTTCCA CAGCAATGGC ATCCTGGTCA TC -#CAGCGGAT 780 - - AGTTAATGAT CAGCCCACTG ACGCGTTGCG CGAGAAGATT GTGCACCGCC GC -#TTTACAGG 840 - - CTTCGACGCC GCTTCGTTCT ACCATCGACA CCACCACGCT GGCACCCAGT TG -#ATCGGCGC 900 - - GAGATTTAAT CGCCGCGACA ATTTGCGACG GCGCGTGCAG GGCCAGACTG GA -#GGTGGCAA 960 - - CGCCAATCAG CAACGACTGT TTGCCCGCCA GTTGTTGTGC CACGCGGTTG GG -#AATGTAAT 1020 - - TCAGCTCCGC CATCGCCGCT TCCACTTTTT CCCGCGTTTT CGCAGAAACG TG -#GCTGGCCT 1080 - - GGTTCACCAC GCGGGAAACG GTCTGATAAC AGACACCGGC ATACTCTGCG AC -#ATCGTATA 1140 - - ACGTTACTGG TTTCACATTC ACCACCCTGA ATTGACTCTC TTCCGGGCGC TA -#TCATGCCA 1200 - - TACCGCGAAA GGTTTTGCGC CATTCGATGG TGTCCG - #- # 1236 - - - - (2) INFORMATION FOR SEQ ID NO:25: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 321 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (ix) FEATURE: (A) NAME/KEY: -35.sub.-- - #signal (B) LOCATION: 18..23 - - (ix) FEATURE: (A) NAME/KEY: -10.sub.-- - #signal (B) LOCATION: 41..46 - - (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: 107..184 - - (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: 185..316 - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 107..316 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: - - TCGAGCTGAC TGACCTGTTG CTTATATTAC ATCGATAGCG TATAATGTGT GG -#AATTGTGA 60 - - GCGATAACAA TTTCACACAG TTTAACTTTA AGAAGGAGAT ATACAT ATG - #GCT ACC 115 - # - # Met Ala - #Thr - # - # -26 -25 - - GGA TCC CGG ACT AGT CTG CTC CTG GCT TTT GG - #C CTG CTC TGC CTG CCC 163 Gly Ser Arg Thr Ser Leu Leu Leu Ala Phe Gl - #y Leu Leu Cys Leu Pro -20 - # -15 - # -10 - - TGG CTT CAA GAG GGC AGT GCC TTC CCA ACC AT - #T CCC TTA TCT AGA CTT 211 Trp Leu Gln Glu Gly Ser Ala Phe Pro Thr Il - #e Pro Leu Ser Arg Leu -5 - # 1 - # 5 - - TTT GAC AAC GCT ATG CTC CGC GCC CAT CGT CT - #G CAC CAG CTG GCC TTT 259 Phe Asp Asn Ala Met Leu Arg Ala His Arg Le - #u His Gln Leu Ala Phe 10 - # 15 - # 20 - # 25 - - GAC ACC TAC CAG GAG TTT GAA GAA GCC TAT AT - #C CCA AAG GAA CAG AAG 307 Asp Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Il - #e Pro Lys Glu Gln Lys 30 - # 35 - # 40 - - TAT TCA TTC CTGCA - # - # - # 321 Tyr Ser Phe - - - - (2) INFORMATION FOR SEQ ID NO:26: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 70 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: - - Met Ala Thr Gly Ser Arg Thr Ser Leu Leu Le - #u Ala Phe Gly Leu Leu26 -25 - # -20 - # -15 - - Cys Leu Pro Trp Leu Gln Glu Gly Ser Ala Ph - #e Pro Thr Ile Pro Leu10 - #-5 - # 1 5 - - Ser Arg Leu Phe Asp Asn Ala Met Leu Arg Al - #a His Arg Leu His Gln 10 - # 15 - # 20 - - Leu Ala Phe Asp Thr Tyr Gln Glu Phe Glu Gl - #u Ala Tyr Ile Pro Lys 25 - # 30 - # 35 - - Glu Gln Lys Tyr Ser Phe 40 - - - - (2) INFORMATION FOR SEQ ID NO:27: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 74 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: - - CGATAGCGTA TAATGTGTGG AATTGTGAGC GGATAACAAT TTCACACAGT TT -#TTCGCGAA 60 - - GAAGGAGATA TACA - # - # - # 74 - - - - (2) INFORMATION FOR SEQ ID NO:28: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 190 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: - - GATCTTCAAG CAGACCTACA GCAAGTTCGA CACAAACTCA CACAACGATG AC -#GCACTACT 60 - - CAAGAACTAC GGGCTGCTCT ACTGCTTCAG GAAGGACATG GACAAGGTCG AG -#ACATTCCT 120 - - GCGCATCGTG CAGTGCCGCT CTGTGGAGGG CAGCTGTGGC TTCTAGTAAG GT -#ACCCTGCC 180 - - CTACGTACCA - # - # - # 190 - - - - (2) INFORMATION FOR SEQ ID NO:29: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 48 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - # complementary to SEQ ID NO:30 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: - - TATGTCTGCG GTAAAAGCAG CGCGCTACGG CAAGGACAAT GTTCGCGT - # 48 - - - - (2) INFORMATION FOR SEQ ID NO:30: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 48 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: oligonucleotide - # complementary to SEQ ID NO:29 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30: - - AGACGCGAAC ATTGTCCTTG CCGTAGCGCG CTGCTTTTAC CGCAGACA - # 48 - - - - (2) INFORMATION FOR SEQ ID NO:31: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 906 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: - - ATGTCTGCGG TAAAAGCAGC GCGCTACGGC AAGGACAATG TTCGCGTCTA CA -#AGGTTCAC 60 - - AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GC -#TTCTGGAG 120 - - GGTGAGATTG AGACCTCTTA CACCAAGGCC GACAACAGCG TCATTGTCGC AA -#CCGACTCC 180 - - ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CG -#AGCTGTTC 240 - - GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CG -#CTCACGTC 300 - - AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CC -#CTCACTCC 360 - - TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GG -#GCAAGGGC 420 - - ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCGTGCTGA AGAGCACCAA CT -#CGCAGTTC 480 - - TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TA -#TCCTGAGC 540 - - ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GG -#TCCGCTCG 600 - - CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GA -#AGACTTTT 660 - - GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GC -#AAATCCTG 720 - - GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CT -#ATTTCGAA 780 - - ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA AGAACGCCGA GG -#TCTTCGCT 840 - - CCTCAGTCGG ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TC -#TGAAGTCT 900 - - AAATTG - # - # -# 906 - - - - (2) INFORMATION FOR SEQ ID NO:32: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2140 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (iii) HYPOTHETICAL: NO - - (iv) ANTI-SENSE: NO - - (vii) IMMEDIATE SOURCE: (B) CLONE: base pairs - #402-405 : site BstIII - - (ix) FEATURE: (A) NAME/KEY: intron (B) LOCATION: 468..565 (D) OTHER INFORMATION: - #/standard.sub.-- name= "intron 1" - - (ix) FEATURE: (A) NAME/KEY: intron (B) LOCATION: 850..938 (D) OTHER INFORMATION: - #/standard.sub.-- name= "intron 2" - - (ix) FEATURE: (A) NAME/KEY: intron (B) LOCATION: 1279..1367 (D) OTHER INFORMATION: - #/standard.sub.-- name= "intron 3" - - (ix) FEATURE: (A) NAME/KEY: sig.sub.-- - #peptide (B) LOCATION: join(329..46 - #7, 566..693) - - (ix) FEATURE: (A) NAME/KEY: mat.sub.-- - #peptide (B) LOCATION: join(694..84 - #9, 939..1278, 1368..1861) - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: join(329..46 - #7, 566..849, 939..1278, 1368..1861) - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: - - AAGCTTATCC GCCGCCGGCG GGGGAATTCT ATTGAACTTG TTCGAATCAT TG -#GTCCGTGG 60 - - TCTTTTCGTC CATGCGGGCT CCGCTGGCGG ATGAATGACC TTCTGGCTTC TA -#GCCTGGCG 120 - - AAGCGATGTT ACTCTGTTGT CTATACTATA CGATATGGTC AAGAGAGCAC AT -#GTGCCGCC 180 - - AGATGAAGAC ATGTATATAA AAGGAGTGGC CTCGACGGTT GCTCAACCAT CT -#TCTGTCTG 240 - - TCCCAACGCC ATCGACTCTT CAACTTCTCC TTCGTGTTCC ACCACCATCA CC -#TTGCTCCA 300 - - GACTTAGGAC TTTCAGCAAC CTTCAAAG ATG TCT TCC CCT CTC - #AAG AAC GCC 352 - # Met Ser Ser - #Pro Leu Lys Asn Ala - # -89 - # -85 - - TTG GTG ACC GCC ATG TTG GCT GGT GGT GCT CT - #C AGC TCG CCT ACA AAG 400 Leu Val Thr Ala Met Leu Ala Gly Gly Ala Le - #u Ser Ser Pro Thr Lys -80 - # -75 - # -70 - - CAA CAC GTT GGA ATT CCC GTC AAC GCC TCT CC - #T GAA GTT GGC CCC GGA 448 Gln His Val Gly Ile Pro Val Asn Ala Ser Pr - #o Glu Val Gly Pro Gly65 - - #60 - - #55 - -#50 - - AAG TAC TCG TTC AAG CAA G GTGAGTAGAG CTGCTTC - #TGT GTGTTGCAAC 497 Lys Tyr Ser Phe Lys Gln -45 - - AGAAGACCAA CGCAAAAAGA AGAGGTCAAG GCAAGACGGA TATTTTACTG AC -#AATTATAC 557 - - TTTTGAAG TC CGG AAC CCC AAC TAC AAG TTC A - #AC GGG CCT CTG TCGGTC 606 Val Arg Asn Pro Asn T - #yr Lys Phe Asn Gly Pro Leu Ser Val -42 - #-40 - #-35 -#-30 - - AAG AAG ACG TAC CTC AAG TAC GGC GTG CCG AT - #C CCA GCC TGG CTGGAG 654 Lys Lys Thr Tyr Leu Lys Tyr Gly Val Pro Il - #e Pro Ala Trp Leu Glu -25 - # -20 - # -15 - - GAT GCT GTC CAG AAC TCT ACC TCG GGC CTG GC - #T GAG CGC TCG ACC GGT 702 Asp Ala Val Gln Asn Ser Thr Ser Gly Leu Al - #a Glu Arg Ser Thr Gly -10 - # -5 - # 1 - - TCT GCG ACC ACA ACT CCC ATC GAC AGC CTC GA - #T GAT GCT TAC ATC ACT 750 Ser Ala Thr Thr Thr Pro Ile Asp Ser Leu As - #p Asp Ala Tyr Ile Thr 5 - # 10 - # 15 - - CCG GTT CAG ATC GGC ACC CCT GCG CAG ACT CT - #G AAC CTG GAC TTT GAC 798 Pro Val Gln Ile Gly Thr Pro Ala Gln Thr Le - #u Asn Leu Asp Phe Asp 20 - # 25 - # 30 - # 35 - - ACT GGA TCT TCG GAT CTG TGG GTC TTC AGC AG - #C GAG ACT ACA GCC AGC 846 Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Se - #r Glu Thr Thr Ala Ser 40 - # 45 - # 50 - - GAG GTTGGTCAAC CCTCGCCCGC ATTTTATTGC ATACATTTTT AGTTTTTTT - #G 899 Glu - - GTAATCAGAA TACTAACATT GGGAATTTCC CAACTGTAG GTC GAT GGG - # CAG ACC 953 - # - # Val Asp Gly Gln Thr - # - # 55 - - ATC TAC ACC CCC AGC AAG AGC ACC ACC GCC AA - #G CTG CTG TCG GGC GCT 1001 Ile Tyr Thr Pro Ser Lys Ser Thr Thr Ala Ly - #s Leu Leu Ser Gly Ala 60 - # 65 - # 70 - - ACC TGG TCC ATC TCC TAC GGA GAC GGT AGC TC - #T TCC AGC GGC GAT GTC 1049 Thr Trp Ser Ile Ser Tyr Gly Asp Gly Ser Se - #r Ser Ser Gly Asp Val 75 - # 80 - # 85 - - TAC ACT GAC ACC GTC TCG GTT GGA GGC CTT AC - #C GTG ACG GGC CAG GCT 1097 Tyr Thr Asp Thr Val Ser Val Gly Gly Leu Th - #r Val Thr Gly Gln Ala 90 - # 95 - #100 - #105 - - GTC GAG TCG GCC AAG AAG GTT TCT TCC AGC TT - #C ACC GAG GAC TCG ACC 1145 Val Glu Ser Ala Lys Lys Val Ser Ser Ser Ph - #e Thr Glu Asp Ser Thr 110 - # 115 - # 120 - - ATT GAC GGT CTC CTG GGC CTG GCC TTC AGC AC - #C CTG AAC ACT GTG TCG 1193 Ile Asp Gly Leu Leu Gly Leu Ala Phe Ser Th - #r Leu Asn Thr Val Ser 125 - # 130 - # 135 - - CCT ACC CAG CAA AAG ACT TTC TTC GAC AAT GC - #G AAG GCG TCC TTG GAC 1241 Pro Thr Gln Gln Lys Thr Phe Phe Asp Asn Al - #a Lys Ala Ser Leu Asp 140 - # 145 - # 150 - - TCG CCT GTG TTC ACG GCT GAT CTT GGC TAC CA - #T GCC C GTGAGTGACC 1288 Ser Pro Val Phe Thr Ala Asp Leu Gly Tyr Hi - #s Ala 155 - # 160 - # 165 - - CCTCTTGATA CATATACTTT TTGATGAATC TTGTTGGAGA AGCATTCCCC AC -#TAATATGG 1348 - - AAATTGTTTG TATCTACAG CT GGT ACC TAC AAC TTC - #GGC TTC ATC GATACC 1399 - # Pro Gly Thr Tyr Asn Phe Gly Phe Ile - # Asp Thr - # - # 170 - # 175 - - ACT GCC TAC ACG GGC TCC ATC ACC TAC ACC GC - #T GTC TCG ACC AAG CAA 1447 Thr Ala Tyr Thr Gly Ser Ile Thr Tyr Thr Al - #a Val Ser Thr Lys Gln 180 - # 185 - # 190 - - GGG TTC TGG GAG TGG ACT TCG ACC GGC TAC GC - #C GTC GGC TCC GGC ACC 1495 Gly Phe Trp Glu Trp Thr Ser Thr Gly Tyr Al - #a Val Gly Ser Gly Thr 195 - # 200 - # 205 - - TTC AAG TCG ACT TCC ATC GAC GGC ATC GCT GA - #C ACT GGC ACG ACC CTC 1543 Phe Lys Ser Thr Ser Ile Asp Gly Ile Ala As - #p Thr Gly Thr Thr Leu 210 - # 215 - # 220 - - CTG TAC CTC CCT GCC ACC GTC GTG TCG GCC TA - #C TGG GCC CAG GTC TCG 1591 Leu Tyr Leu Pro Ala Thr Val Val Ser Ala Ty - #r Trp Ala Gln Val Ser 225 2 - #30 2 - #35 2 -#40 - - GGC GCC AAG TCC AGC TCT TCC GTC GGC GGC TA - #C GTC TTC CCC TGCAGC 1639 Gly Ala Lys Ser Ser Ser Ser Val Gly Gly Ty - #r Val Phe Pro Cys Ser 245 - # 250 - # 255 - - GCG ACC CTG CCT TCC TTC ACC TTC GGC GTT GG - #C TCA GCT CGC ATT GTG 1687 Ala Thr Leu Pro Ser Phe Thr Phe Gly Val Gl - #y Ser Ala Arg Ile Val 260 - # 265 - # 270 - - ATT CCT GGC GAC TAC ATT GAT TTC GGC CCC AT - #C TCC ACT GGA AGC TCG 1735 Ile Pro Gly Asp Tyr Ile Asp Phe Gly Pro Il - #e Ser Thr Gly Ser Ser 275 - # 280 - # 285 - - TCT TGC TTT GGC GGC ATC CAG TCC AGC GCT GG - #T ATC GGC ATC AAC ATC 1783 Ser Cys Phe Gly Gly Ile Gln Ser Ser Ala Gl - #y Ile Gly Ile Asn Ile 290 - # 295 - # 300 - - TTC GGT GAT GTC GCT CTG AAG GCC GCC TTT GT - #C GTC TTC AAC GGG GCT 1831 Phe Gly Asp Val Ala Leu Lys Ala Ala Phe Va - #l Val Phe Asn Gly Ala 305 3 - #10 3 - #15 3 -#20 - - ACA ACT CCC ACT CTT GGC TTT GCT TCC AAG TA - #AATTAAGG GCCCTCGCTC 1881 Thr Thr Pro Thr Leu Gly Phe Ala Ser Lys 325 - # 330 - - CTCCATAGCT GCGATAAATG AGGCAGGCTC AAGTGGAAAG TCTTGTTGGG TA -#GGCGTGGA 1941 - - TACGTATTGT CTACTTAATT AATTAATGCC AAAGCAGACC TGAAGATAGC TT -#TAGTAATT 2001 - - AATTCAATAA GCACATGGAG ATCCTTCGGA TCAATATGCT AACTCGGTCT TC -#ATCTCTAA 2061 - - ACGAATGTGT TGTTGCTTGA GTTTCAGATG AATTTCCTGC TGTGATATCC CT -#CTAAGGTG 2121 - - TAGTATGGAC AGTAAGCTT - # - # 214 - #0 - - - - (2) INFORMATION FOR SEQ ID NO:33: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 419 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: - - Met Ser Ser Pro Leu Lys Asn Ala Leu Val Th - #r Ala Met Leu Ala Gly89 -85 - # -80 - # -75 - - Gly Ala Leu Ser Ser Pro Thr Lys Gln His Va - #l Gly Ile Pro Val Asn -70 - # -65 - # -60 - - Ala Ser Pro Glu Val Gly Pro Gly Lys Tyr Se - #r Phe Lys Gln Val Arg -55 - # -50 - # -45 -42 - - Asn Pro Asn Tyr Lys Phe Asn Gly Pro Leu Se - #r Val Lys Lys Thr Tyr -40 - # -35 - # -30 - - Leu Lys Tyr Gly Val Pro Ile Pro Ala Trp Le - #u Glu Asp Ala Val Gln25 - - #20 - - #15 - -#10 - - Asn Ser Thr Ser Gly Leu Ala Glu Arg Ser Th - #r Gly Ser Ala ThrThr -5 - # 1 - # 5 - - Thr Pro Ile Asp Ser Leu Asp Asp Ala Tyr Il - #e Thr Pro Val GlnIle 10 - # 15 - # 20 - - Gly Thr Pro Ala Gln Thr Leu Asn Leu Asp Ph - #e Asp Thr Gly SerSer 25 - # 30 - # 35 - - Asp Leu Trp Val Phe Ser Ser Glu Thr Thr Al - #a Ser Glu Val AspGly 40 - #45 - #50 - #55 - - Gln Thr Ile Tyr Thr Pro Ser Lys Ser Thr Th - #r Ala Lys Leu LeuSer 60 - # 65 - # 70 - - Gly Ala Thr Trp Ser Ile Ser Tyr Gly Asp Gl - #y Ser Ser Ser Ser Gly 75 - # 80 - # 85 - - Asp Val Tyr Thr Asp Thr Val Ser Val Gly Gl - #y Leu Thr Val Thr Gly 90 - # 95 - # 100 - - Gln Ala Val Glu Ser Ala Lys Lys Val Ser Se - #r Ser Phe Thr Glu Asp 105 - # 110 - # 115 - - Ser Thr Ile Asp Gly Leu Leu Gly Leu Ala Ph - #e Ser Thr Leu Asn Thr 120 1 - #25 1 - #30 1 -#35 - - Val Ser Pro Thr Gln Gln Lys Thr Phe Phe As - #p Asn Ala Lys AlaSer 140 - # 145 - # 150 - - Leu Asp Ser Pro Val Phe Thr Ala Asp Leu Gl - #y Tyr His Ala Pro Gly 155 - # 160 - # 165 - - Thr Tyr Asn Phe Gly Phe Ile Asp Thr Thr Al - #a Tyr Thr Gly Ser Ile 170 1 - #75 1 - #80 - - Thr Tyr Thr Ala Val Ser Thr Lys Gln Gly Ph - #e Trp Glu Trp Thr Ser 185 - # 190 - # 195 - - Thr Gly Tyr Ala Val Gly Ser Gly Thr Phe - #Lys Ser Thr Ser Ile Asp 200 2 - #05 2 - #10 2 -#15 - - Gly Ile Ala Asp Thr Gly Thr Thr Leu Leu Ty - #r Leu Pro Ala ThrVal 220 - # 225 - # 230 - - Val Ser Ala Tyr Trp Ala Gln Val Ser Gly Al - #a Lys Ser Ser Ser Ser 235 - # 240 - # 245 - - Val Gly Gly Tyr Val Phe Pro Cys Ser Ala Th - #r Leu Pro Ser Phe Thr 250 - # 255 - # 260 - - Phe Gly Val Gly Ser Ala Arg Ile Val Ile Pr - #o Gly Asp Tyr Ile Asp 265 - # 270 - # 275 - - Phe Gly Pro Ile Ser Thr Gly Ser Ser Ser Cy - #s Phe Gly Gly Ile Gln 280 2 - #85 2 - #90 2 -#95 - - Ser Ser Ala Gly Ile Gly Ile Asn Ile Phe Gl - #y Asp Val Ala LeuLys 300 - # 305 - # 310 - - Ala Ala Phe Val Val Phe Asn Gly Ala Thr Th - #r Pro Thr Leu Gly Phe 315 - # 320 - # 325 - - Ala Ser Lys 330__________________________________________________________________________

Cassette for the expression of an endothiapepsin precursor in Cryphonectria parasitica

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (1)

Parent Case Info

US Referenced Citations (1)

Foreign Referenced Citations (1)

Continuations (1)