Causative agent of the mystery swine disease, vaccine compositions and diagnostic kits

FIELD OF THE INVENTION
The invention relates to the isolation, characterization and utilization of the causative agent of the Mystery Swine Disease (MSD). The invention utilizes the discovery of the agent causing the disease and the determination of its genome organization, the genomic nucleotide sequence and the proteins encoded by the genome, for providing protection against and diagnosis of infections, in particular protection against and diagnosis of MSD infections, and for providing vaccine compositions and diagnostic kits, either for use with MSD or with other pathogen-caused diseases.
BACKGROUND
In the winter and early spring of 1991, the Dutch pig industry was struck by a sudden outbreak of a new disease among breeding sows. Most sows showed anorexia, some aborted late in gestation (around day 110), showed stillbirths or gave birth to mummified fetuses and some had fever. Occasionally, sows with bluish ears were found, therefore the disease was commonly named "Abortus Blauw". The disease in the sows was often accompanied by respiratory distress and death of their young piglets, and often by respiratory disease and growth retardation of older piglets and fattening pigs.
The cause of this epizootic was not known, but the symptoms resembled those of a similar disease occurring in Germany since late 1990, and resembled those of the so-called "Mystery Swine Disease" as seen since 1987 in the mid-west of the United States of America and in Canada (Hill, 1990). Various other names have been used for the disease, in Germany it is known as "Seuchenhafter Sp atabort der Schweine", and in North-America it is also known as "Mystery Pig Disease", "Mysterious Reproductive Syndrome", and "Swine Infertility and Respiratory Syndrome". In North-America, Loula (1990) described the general clinical signs as:
1) Off feed, sick animals of all ages
2) Abortions, stillbirths, weak pigs, mummies
3) Post farrowing respiratory problems
4) Breeding problems.
No causative agent has as yet been identified, but encephalomyocarditis virus (EMCV), porcine parvo virus (PPV), pseudorabies virus (PRV), swine influenza virus (SIV), bovine viral diarrhea virus (BVDV), hog cholera virus (HCV), porcine entero viruses (PEV), an influenza-like virus, chlamidiae, leptospirae, have all been named as possible cause (Loula, 1990; Mengeling and Lager, 1990; among others).
SUMMARY OF THE INVENTION
The invention provides a composition of matter comprising isolated Lelystad Agent which is the causative agent of Mystery Swine Disease, said Lelystad Agent essentially corresponding to the isolate Lelystad Agent (CDI-NL-2.91) deposited 5 Jun. 1991 with the Institut Pasteur, Collection Nationale de Cultures De Microorganismes (C.N.C.M.) 25, rue du Docteur Roux, 75724-Paris Cedex 15, France, deposit number I-1102. The words "essentially corresponding" refer to variations that occur in nature and to artificial variations of Lelystad Agent, particularly those which still allow detection by techniques like hybridization, PCR and ELISA, using Lelystad Agent-specific materials, such as Lelystad Agent-specific DNA or antibodies.
The composition of matter may comprise live, killed, or attenuated isolated Lelystad Agent; a recombinant vector derived from Lelystad Agent; an isolated part or component of Lelystad Agent; isolated or synthetic protein, (poly)peptide, or nucleic acid derived from Lelystad Agent; recombinant nucleic acid which comprises a nucleotide sequence derived from the genome of Lelystad Agent; a (poly)peptide having an amino acid sequence derived from a protein of Lelystad Agent, the (poly)peptide being produced by a cell capable of producing it due to genetic engineering with appropriate recombinant DNA; an isolated or synthetic antibody which specifically recognizes a part or component of Lelystad Agent; or a recombinant vector which contains nucleic acid comprising a nucleotide sequence coding for a protein or antigenic peptide derived from Lelystad Agent.
On the DNA level, the invention specifically provides a recombinant nucleic acid, more specifically recombinant DNA, which comprises a Lelystad Agent-specific nucleotide sequence shown in FIG. 1 which includes FIGS. 1a through 1q (SEQ ID NO: 1). Preferably, said Lelystad Agent-specific nucleotide sequence is selected from anyone of the ORFs (Open Reading Frames) shown in FIG. 1 (SEQ ID NO: 1).
On the peptide/protein level, the invention specifically provides a peptide comprising a Lelystad Agent-specific amino acid sequence shown in FIG. 1.
The invention further provides a vaccine composition for vaccinating animals, in particular mammals, more in particular pigs or swines, to protect them against Mystery Swine Disease, comprising Lelystad Agent, either live, killed, or attenuated; or a recombinant vector which contains nucleic acid comprising a nucleotide sequence coding for a protein or antigenic peptide derived from Lelystad Agent; an antigenic part or component of Lelystad Agent; a protein or antigenic polypeptide derived from, or a peptide mimicking an antigenic component of, Lelystad Agent; and a suitable carrier or adjuvant.
The invention also provides a vaccine composition for vaccinating animals, in particular mammals, more in particular pigs or swines, to protect them against a disease caused by a pathogen, comprising a recombinant vector derived from Lelystad Agent, the nucleic acid of the recombinant vector comprising a nucleotide sequence coding for a protein or antigenic peptide derived from the pathogen, and a suitable carrier or adjuvant.
The invention further provides a diagnostic kit for detecting nucleic acid from Lelystad Agent in a sample, in particular a biological sample such as blood or blood serum, sputum, saliva, or tissue, derived from an animal, in particular a mammal, more in particular a pig or swine, comprising a nucleic acid probe or primer which comprises a nucleotide sequence derived from the genome of Lelystad Agent, and suitable detection means of a nucleic acid detection assay.
The invention also provides a diagnostic kit for detecting antigen from Lelystad Agent in a sample, in particular a biological sample such as blood or blood serum, sputum, saliva, or tissue, derived from an animal, in particular a mammal, more in particular a pig or swine, comprising an antibody which specifically recognizes a part or component of Lelystad Agent, and suitable detection means of an antigen detection assay.
The invention also provides a diagnostic kit for detecting an antibody which specifically recognizes Lelystad Agent in a sample, in particular a biological sample such as blood or blood serum, sputum, saliva, or tissue, derived from an animal, in particular a mammal, more in particular a pig or swine, comprising Lelystad Agent; an antigenic part or component of Lelystad Agent; a protein or antigenic polypeptide derived from Lelystad Agent; or a peptide mimicking an antigenic component of Lelystad Agent; and suitable detection means of an antibody detection assay.
The invention also relates to a process for diagnosing whether an animal, in particular a mammal, more in particular a pig or swine, is contaminated with the causative agent of Mystery Swine Disease, comprising preparing a sample, in particular a biological sample such as blood or blood serum, sputum, saliva, or tissue, derived from the animal, and examining whether it contains Lelystad Agent nucleic acid, Lelystad Agent antigen, or antibody specifically recognizing Lelystad Agent, said Lelystad Agent being the causative agent of Mystery Swine Disease and essentially corresponding to the isolate Lelystad Agent (CDI-NL-2.91) deposited 5 Jun. 1991 with the Institut Pasteur, Paris, France, deposit number I-1102.
DETAILED DESCRIPTION OF THE INVENTION
The invention is a result of combined efforts of the Central Veterinary Institute (CVI) and the Regional Animal Health Services (RAHS) in the Netherlands in trying to find the cause of the new disease MSD. Farms with pigs affected by the new disease were visited by field veterinarians of the RAHS. Sick pigs, specimens of sick pigs, and sow sera taken at the time of the acute and convalescent phase of the disease were sent for virus isolation to the RAHS and the CVI. Paired sera of affected sows were tested for antibodies against ten known pig-viruses. Three different viruses, encephalomyocarditis virus, porcine entero virus type 2, porcine entero virus type 7, and an unknown agent, Lelystad agent (LA), were isolated. Sows which had reportedly been struck with the disease mainly seroconverted to LA, and hardly to any of the other virus isolates or the known viral pathogens. In order to reproduce MSD experimentally, eight pregnant sows were inoculated intranasally with LA at day 84 of gestation. One sow gave birth to seven dead and four live but very weak piglets at day 109 of gestation; the four live piglets died one day after birth. Another sow gave birth at day 116 to three mummified fetuses, six dead piglets and three live piglets; two of the live piglets died within one day. A third sow gave birth at day 117 to two mummified fetuses, eight dead and seven live piglets. The other sows farrowed around day 115 and had less severe reproductive losses. The mean number of live piglets from all eight sows at birth was 7.3 and the mean number of dead piglets at birth was 4.6. Antibodies directed against LA were detected in 10 out of 42 serum samples collected before the pigs had sucked. LA was isolated from three piglets that died shortly after birth. These results justify the conclusion that LA is the causal agent of mystery swine disease.
LA grows with a cytopathic effect in pig lung macrophages and can be identified by staining in an immuno-peroxidase-monolayer assay (IPMA) with postinfection sera of pigs c 829 and b 822, or with any of the other postinfection sera of the SPF pigs listed in table 5. Antibodies to LA can be identified by indirect staining procedures in IPMA. LA did not grow in any other cell system tested. LA was not neutralized by homologous sera, or by sera directed against a set of known viruses (Table 3). LA did not haemagglutinate with the red blood cells tested. LA is smaller than 200 nm since it passes through a filter with pores of this size. LA is sensitive to chloroform. The above results show that Lelystad agent is not yet identified as belonging to a certain virus group or other microbiological species. It has been deposited 5 Jun. 1991 under number I-1102 at Institute Pasteur, France.
The genome organization, nucleotide sequences, and polypeptides derived therefrom, of LA have now been found. These data together with those of others (see below) justify classification of LA (hereafter also called Lelystad Virus or LV) as a member of a new virus family, the Arteriviridae. As prototype virus of this new family we propose Equine Arteritis Virus (EAV), the first member of the new family of which data regarding the replication strategy of the genome and genome organization became available (de Vries et al., 1990, and references therein). On the basis of a comparison of our sequence data with those available for Lactate Dehydrogenase-Elevating Virus (LDV; Godeny et al., 1990), we propose that LDV is also a member of the Arteriviridae.
Given the genome organization and translation strategy of Arteriviridae it seems appropriate to place this new virus family into the superfamily of coronaviruses (Snijder et al., 1990a).
Arteriviruses have in common that their primary target cells in respective hosts are macrophages. Replication of LDV has been shown to be restricted to macrophages in its host, the mouse, whereas this strict propensity for macrophages has not been resolved yet for EAV, and LV.
Arteriviruses are spherical enveloped particles having a diameter of 45-60 nm and containing an icosahedral nucleocapsid (Brinton-Darnell and Plagemann, 1975; Horzinek et al., 1971; Hyllseth, 1973).
The genome of Arteriviridae consists of a positive stranded polyadenylated RNA molecule with a size of about 12-13 kilobases (kb) (Brinton-Darnell and Plageman, 1975; van der Zeijst et al., 1975). EAV replicates via a 3' nested set of six subgenomic mRNAs, ranging in size from 0.8 to 3.6 kb, which are composed of a leader sequence, derived from the 5' end of the genomic RNA, which is joined to the 3' terminal body sequences (de Vries et al., 1990).
Here we show that the genome organization and replication strategy of LV is similar to that of EAV, coronaviruses and toroviruses, whereas the genome sizes of the latter viruses are completely different from those of LV and EAV.
The genome of LV consists of a genomic RNA molecule of about 14.5 to 15.5 kb in length (estimated on a neutral agarose gel), which replicates via a 3' nested set of subgenomic RNAs. The subgenomic RNAs consist of a leader sequence, the length of which is yet unknown, which is derived from the 5' end of the genomic RNA and which is fused to the body sequences derived from the 3' end of the genomic RNA (FIG. 2).
The nucleotide sequence of the genomic RNA of LV was determined from overlapping cDNA clones. A consecutive sequence of 15,088 bp was obtained covering nearly the complete genome of LV (FIG. 1 (SEQ ID NO: 1)). In this sequence 8 open reading frames (ORFs) were identified: ORF 1A, ORF 1B, and ORFs 2 to 7.
ORF 1A and ORF 1B are predicted to encode the viral replicase or polymerase (SEQ ID NO: 2) and (SEQ ID NO: 3), whereas ORFs 2 to 6 are predicted to encode structural viral membrane (envelope) associated proteins (SEQ ID NOS: 4-8). ORF 7 is predicted to encode the structural viral nucleocapsid protein (SEQ ID NO: 9).
Because the products of ORF 6 and ORF 7 of LV (SEQ ID NO: 8) and (SEQ ID NO: 9) show a significant similarity with VpX and Vp1 of LDV respectively, it is predicted that the sequences of ORFs 6 and 7 will also be highly conserved among antigenic variants of LV.
The complete nucleotide sequence of FIG. 1 (SEQ ID NO: 1) and all the sequences and protein products encoded by ORFs 1 to 7 (SEQ ID NOS: 1-9) and possible other ORFs located in the sequence of FIG. 1 (SEQ ID NO: 1), are especially suited for vaccine development, in whatever sense, and for the development of diagnostic tools, in whatever sense. All possible modes are well known to persons skilled in the art.
Since it is now possible to unambiguously identify LA, the causal agent of MSD, it can now be tested whether pigs are infected with LA or not. Such diagnostic tests have until now not been available.
The test can be performed by virus isolation in macro-phages, or other cell culture systems in which LA might grow, and staining the infected cultures with antibodies directed against LA (such as postinfection sera c 829 or b 822), but it is also feasible to develop and employ other types of diagnostic tests.
For instance, it is possible to use direct or indirect immunohistological staining techniques, i.e. with antibodies directed to LA that are labeled with fluorescent compounds such as isothiocyanate, or labeled with enzymes such as horseradish peroxidase. These techniques can be used to detect LA antigen in tissue sections or other samples from pigs suspected to have MSD. The antibodies needed for these tests can be c 829 or b 822 or other polyclonal antibodies directed against LA, but monoclonal antibodies directed against LA can also be used.
Furthermore, since the nature and organization of the genome of LA and the nucleotide sequence of this genome have been determined, LA specific nucleotide sequences can be identified and used to develop oligonucleotide sequences that can be used as probes or primers in diagnostic techniques such as hybridization, polymerase chain reaction, or any other techniques that are developed to specifically detect nucleotide acid sequences.
It is also possible to test for antibodies directed against LA. Table 5 shows that experimentally infected pigs rapidly develop antibodies against LA, and table 4 shows that pigs in the field also have strong antibody responses against LA. Thus it can now also be determined whether pigs have been infected with LA in the past. Such testing is of utmost importance in determining whether pigs or pig herds or pig populations or pigs in whole regions or countries are free of LA. The test can be done by using the IPMA as described, but it is also feasible to develop and employ other types of diagnostic tests for the detection of antibodies directed against LA.
LA specific proteins, polypeptides, and peptides, or peptide sequences mimicking antigenic components of LA, can be used in such tests. Such proteins can be derived from the LA itself, but it is also possible to make such proteins by recombinant DNA or peptide synthesis techniques. These tests can use specific polyclonal and/or monoclonal antibodies directed against LA or specific components of LA, and/or use cell systems infected with LA or cell systems expressing LA antigen. The antibodies can be used, for example, as a means for immobilizing the LA antigen (a solid surface is coated with the antibody whereafter the LA antigen is bound by the antibody) which leads to a higher specificity of the test, or can be used in a competitive assay (labeled antibody and unknown antibody in the sample compete for available LA antigen).
Furthermore, the above described diagnostic possibilities can be applied to test whether other animals, such as mammals, birds, insects or fish, or plants, or other living creatures, can be, or are, or have been infected with LA or related agents.
Since LA has now been identified as the causal agent of MSD, it is possible to make a vaccine to protect pigs against this disease. Such a vaccine can simply be made by growing LA in pig lung macrophage cultures, or in other cell systems in which LA grows. LA can then be purified or not, and killed by established techniques, such as inactivation with formaline or ultra-violet light. The inactivated LA can then be combined with adjuvantia, such as Freund's adjuvans or aluminum hydroxide or others, and this composition can then be injected in pigs.
Dead vaccines can also be made with LA protein preparations derived from LA infected cultures, or derived from cell systems expressing specifically LA protein through DNA recombinant techniques. Such subunits of LA would then be treated as above, and this would result in a subunit vaccine.
Vaccines using even smaller components of LA, such as polypeptides, peptides, or peptides mimicking antigenic components of LA are also feasible for use as dead vaccine.
Dead vaccines against MSD can also be made by recombinant DNA techniques through which the genome of LA, or parts thereof, is incorporated in vector systems such as vaccinia virus, herpesvirus, pseudorabies virus, adeno virus, baculo virus or other suitable vector systems that can so express LA antigen in appropriate cells systems. LA antigen from these systems can then be used to develop a vaccine as above, and pigs, vaccinated with such products would develop protective immune responses against LA.
Vaccines against MSD can also be based on live preparations of LA. Since only young piglets and pregnant sows seem to be seriously affected by infection with LA, it is possible to use unattenuated LA, grown in pig lung macrophages, as vaccine for older piglets, or breeding gilts. In this way sows can be protected against MSD before they get pregnant, which results in protection against abortions and stillbirth, and against congenital infections of piglets. Also the maternal antibody that these vaccinated sows give to their offspring would protect their offspring against the disease.
Attenuated vaccines (modified-live-vaccines) against MSD can be made by serially passaging LA in pig lung macrophages, in lung macrophages of other species, or in other cell systems, or in other animals, such as rabbits, until it has lost its pathogenicity.
Live vaccines against MSD can also be made by recombinant DNA techniques through which the genome of LA, or parts thereof, is incorporated in vector systems such as vaccinia virus, herpesvirus, pseudorabies virus, adeno virus or other suitable vector systems that can so express LA antigen. Pigs, vaccinated with such live vector systems would then develop protective immune responses against LA.
Lelystad agent itself would be specifically suited to use as a live vector system. Foreign genes could be inserted in the genome of LA and could be expressing the corresponding protein during the infection of the macrophages. This cell, which is an antigen presenting cell, would process the foreign antigen and present it to B-lymfocytes and T-lymfocytes which will respond with the appropriate immune respons.
Since LA seems to be very cell specific and possibly also very species specific, this vector system might be a very safe system, which does not harm other cells or species.

SHORT DESCRIPTION OF THE DRAWINGS
FIGS. 1a through 1g (SEQ ID NO: 1) shows the nucleotide sequence of the LV genome. The deduced amino acid sequence of the identified ORFs (SEQ ID NOS: 2-9) are shown. The methionines encoded by the (putative) ATG start sites are indicated in bold and putative N-glycosylation sites are underlined. Differences in the nucleotide and amino acid sequence, as identified by sequencing different cDNA clones, are shown. The nucleotide sequence of primer 25, which has been used in hybridization experiments (see FIG. 2 and section "results"), is underlined.
FIG. 2 shows the organization of the LV genome. The cDNA clones, which have been used for the determination of the nucleotide sequence, are indicated in the upper part of the figure. The parts of the clones, which were sequenced, are indicated in black. In the lower part of the figure the ORFs, identified in the nucleotide sequence, and the subgenomic set of mRNAs, encoding these ORFs, shown. The dashed lines in the ORFs represent alternative initiation sites (ATGs) of these ORFs. The leader sequence of the genomic and subgenomic RNAs is indicated by a solid box.
FIG. 3 shows the growth characteristics of LA:
empty squares--titre of cell-free virus;
solid squares--titre of cell-associated virus;
solid line--percentage cytopathic effect (CPE).

MATERIALS AND METHODS
Sample collection
Samples and pigs were collected from farms where a herd epizootic of MSD seemed to occur. Important criteria for selecting the farm as being affected with MSD were: sows that were off feed, the occurrence of stillbirth and abortion, weak offspring, respiratory disease and death among young piglets. Samples from four groups of pigs have been investigated:
(1) tissue samples and an oral swab from affected piglets from the field (table 1A),
(2) blood samples and oral swabs from affected sows in the field (tables 1B and 4),
(3) tissue samples, nasal swabs and blood samples collected from specific-pathogen-free (SPF) pigs experimentally infected by contact with affected sows from the field or
(4) tissue samples, nasal swabs and blood samples collected from specific-pathogen-free (SPF) pigs experimentally infected by inoculation with blood samples of affected sows from the field (tables 2 and 5).
Sample preparation
Samples for virus isolation were obtained from piglets and sows which on clinical grounds were suspected to have MSD, and from experimentally infected SPF pigs, sows and their piglets.
Tissue samples were cut on a cryostat microtome and sections were submitted for direct immunofluorescence testing (IFT) with conjugates directed against various pig pathogens.
10% Suspensions of tissues samples were prepared in Hank's BSS supplemented with antibiotics, and oral and nasal swabs were soaked in Hank's BSS supplemented with antibiotics. After one hour at room temperature, the suspensions were clarified for 10 min at 6000 g, and the supernatant was stored at -70.degree. C. for further use. Leucocyte fractions were isolated from EDTA or heparin blood as described earlier (Wensvoort and Terpstra, 1988), and stored at -70.degree. C. Plasma and serum for virus isolation was stored at -70.degree. C.
Serum for serology was obtained from sows suspected to be in the acute phase of MSD, a paired serum was taken 3-9 weeks later. Furthermore, sera were taken from the experimentally infected SPF pigs at regular intervals and colostrum and serum was taken from experimentally infected sows and their piglets. Sera for serology were stored at -20.degree. C.
Cells
Pig lung macrophages were obtained from lungs of 5-6 weeks old SPF pigs or from lungs of adult SPF sows from the Central Veterinary Institute's own herd. The lungs were washed five to eight times with phosphate buffered saline (PBS). Each aliquot of washing fluid was collected and centrifuged for 10 min at 300 g. The resulting cell pellet was washed again in PBS and resuspended in cell culture medium (160 ml medium 199, supplemented with 20 ml 2.95% tryptose phosphate, 20 ml foetal bovine serum (FBS), and 4.5 ml 1.4% sodium bicarbonate) to a concentration of 4.times.10.sup.7 cells/ml. The cell suspension was then slowly mixed with an equal volume of DMSO mix (6.7 ml of above medium, 1.3 ml FBS, 2 ml dimethylsulfoxide 97%), aliquoted in 2 ml ampoules and stored in liquid nitrogen.
Macrophages from one ampoule were prepared for cell culture by washing twice in Earle's MEM, and resuspended in 30 ml growth medium (Earle's MEM, supplemented with 10% FBS, 200 U/ml penicillin, 0.2 mg/ml streptomycine, 100 U/ml mycostatin, and 0.3 mg/ml glutamine). PK-15 cells (American Type Culture Collection, CCL33) and SK-6 cells (Kasza et al., 1972) were grown as described by Wensvoort et al. (1989). Secondary porcine kidney (PK2) cells were grown in Earle's MEM, supplemented with 10% FBS and the above antibiotics. All cells were grown in a cell culture cabinet at 37.degree. C. and 5% CO.sub.2.
Virus isolation procedures.
Virus isolation was performed according to established techniques using PK2, PK-15 and SK-6 cells, and pig lung macrophages. The former three cells were grown in 25 ml flasks (Greiner), and inoculated with the test sample when monolayers had reached 70-80% confluency. Macrophages were seeded in 100 .mu.l aliquots in 96-well microtiter plates (Greiner) or in larger volumes in appropriate flasks, and inoculated with the test sample within one hour after seeding. The cultures were observed daily for cytopathic effects (CPE), and frozen at -70.degree. C. when 50-70% CPE was reached or after five to ten days of culture. Further passages were made with freeze-thawed material of passage level 1 and 2 or higher. Some samples were also inoculated into nine to twelve day old embryonated hen eggs. Allantoic fluid was subinoculated two times using an incubation interval of three days and the harvest of the third passage was examined by haemagglutination at 4.degree. C. using chicken red blood cells, and by an ELISA specifically detecting nucleoprotein of influenza A viruses (De Boer et al., 1990).
Serology
Sera were tested in haemagglutinating inhibition tests (HAI) to study the development of antibody against haemagglutinating encephalitis virus (HEV), and swine influenza viruses H1N1 and H3N2 according to the protocol of Masurel (1976). Starting dilutions of the sera in HAI were 1:9, after which the sera were diluted twofold.
Sera were tested in established enzyme-linked immunosorbent assays (ELISA) for antibodies against the glycoprotein gI of pseudorabies virus (PRV; Van Oirschot et al., 1988), porcine parvo virus (PPV; Westenbrink et al., 1986), bovine viral diarrhoea virus (BVDV; Westenbrink et al., 1986), and hog cholera virus (HCV; Wensvoort et al., 1988). Starting dilutions in the ELISA's were 1.5, after which the sera were diluted twofold.
Sera were tested for neutralizing antibodies against 30-300 TCID.sub.50 of encephalomyocarditis viruses (EMCV), porcine enteroviruses (PEV), and Lelystad agent (LA) according to the protocol of Terpstra (1978). Starting dilutions of the sera in the serum neutralization tests (SNT) were 1:5, after which the sera were diluted twofold.
Sera were tested for binding with LA in an immunoperoxidase-monolayer assay (IPMA). Lelystad agent (LA; code: CDI-NL-2.91) was seeded in microtiter plates by adding 50 ml growth medium containing 100 TCID.sub.50 LA to the wells of a microtiter plate containing freshly seeded lung macrophages. The cells were grown for two days and then fixed as described (Wensvoort, 1986). The test sera were diluted 1:10 in 0.15M NaCl, 0.05% Tween 80, 4% horse serum, or diluted further in fourfold steps, added to the wells and then incubated for one hour at 37.degree. C. Sheep-anti-pig immunoglobulins (Ig) conjugated to horse radish peroxidase (HRPO, DAKO) were diluted in the same buffer and used in a second incubation for one hour at 37.degree. C., after which the plates were stained as described (Wensvoort et al., 1986). An intense red staining of the cytoplasm of infected macrophages indicated binding of the sera to LA.
Virus identification procedures
The identity of cytopathic isolates was studied by determining the buoyant density in CsCl, by estimating particle size in negatively stained preparations through electron microscopy, by determining the sensitivity of the isolate to chloroform and by neutralizing the CPE of the isolate with sera with known specificity (Table 3). Whenever an isolate was specifically neutralized by a serum directed against a known virus, the isolate was considered to be a representative of this known virus.
Isolates that showed CPE on macrophage cultures were also studied by staining in IPMA with postinfection sera of pigs c 829 or b 822. The isolates were reinoculated on macrophage cultures and fixed at day 2 after inoculation before the isolate showed CPE. Whenever an isolate showed reactivity in IPMA with the postinfection sera of pigs c 829 or b 822, the isolate was considered to be a representative of the Lelystad agent. Representatives of the other isolates grown in macrophages or uninfected macrophages were also stained with these sera to check the specificity of the sera.
Further identification of Lelystad agent.
Lelystad agent was further studied by haemagglutination at 4.degree. C. and 37.degree. C. with chicken, guinea pig, pig, sheep, or human O red blood cells. SIV, subtype H3N2, was used as positive control in the haemagglutination studies.
The binding of pig antisera specifically directed against pseudorabies virus (PRV), transmissible gastroenteritis virus (TGE), porcine epidemic diarrhoea virus (PED), haemagglutinating encephalitis virus (HEV), African swine fever virus (ASFV), hog cholera virus (HCV) and swine influenza virus (SIV) type H1N1 and H3N2, of bovine antisera specifically directed against bovine herpes viruses type 1 and 4 (BHV 1 and 4), malignant catarrhal fever (MCF), parainfluenza virus 3 (PI3), bovine respiratory syncitial virus (BRSV) and bovine leukemia virus (BLV), and of avian antisera specifically directed against avian leukemia virus (ALV) and infectious bronchitis virus (IBV) was studied with species-Ig specific HRPO conjugates in an IPMA on LA infected and uninfected pig lung macrophages as described above.
We also tested in IPMA antisera of various species directed against mumps virus, Sendai virus, canine distemper virus, rinderpest virus, measles virus, pneumonia virus of mice, bovine respiratory syncytial virus, rabies virus, foamy virus, maedi-visna virus, bovine and murine leukemia virus, human, feline and simian immunodeficiency virus, lymphocytic choriomeningitis virus, feline infectious peritonitis virus, mouse hepatitis virus, Breda virus, Hantaan virus, Nairobi sheep disease virus, Eastern, Western and Venezuelan equine encephalomyelitis virus, rubella virus, equine arteritis virus, lactic dehydrogenase virus, yellow fever virus, tickborn encephalitis virus and hepatitis C virus.
LA was blindly passaged in PK2, PK-15, and SK-6 cells, and in embryonated hen eggs. After two passages, the material was inoculated again into pig lung macrophage cultures for reisolation of LA.
LA was titrated in pig lung macrophages prior to and after passing through a 0.2 micron filter (Schleicher and Schuell). The LA was detected in IPMA and by its CPE. Titres were calculated according to Reed and Muench (1938).
We further prepared pig antisera directed against LA. Two SPF pigs (21 and 23) were infected intranasally with 10.sup.5 TCID.sub.50 of a fifth cell culture passage of LA. Two other SPF pigs (25 and 29) were infected intranasally with a fresh suspension of the lungs of an LA-infected SPF piglet containing 10.sup.5 TCID.sub.50 LA. Blood samples were taken at 0, 14, 28, and 42 days postinfection (dpi).
We further grew LA in porcine alveolar macrophages to determine its growth pattern over time. Porcine alveolar macrophages were seeded in F25 flasks (Greiner), infected with LA with a multiplicity of infection of 0.01 TCID.sub.50 per cell. At 8, 16, 24, 32, 40, 48, 56, and 64 h after infection, one flask was examined and the percentage of CPE in relation to a noninfected control culture was determined. The culture medium was then harvested and replaced with an equal volume of phosphate-buffered saline. The medium and the flask were stored at -70.degree. C. After all cultures had been harvested, the LA titres were determined and expressed as log TCID.sub.50 ml.sup.-1.
The morphology of LA was studied by electronmicroscopy. LA was cultured as above. After 48 h, the cultures were freeze-thawed and centrifuged for 10 min at 6000.times. g. An amount of 30 ml supernatant was then mixed with 0.3 ml LA-specific pig serum and incubated for 1.5 h at 37.degree. C. After centrifugation for 30 min at 125,000.times. g, the resulting pellet was suspended in 1% Seakem agarose ME in phosphate-buffered saline at 40.degree. C. After coagulation, the agarose block was immersed in 0.8% glutaraldehyde and 0.8% osmiumtetroxide (Hirsch et al., 1968) in veronal/acetate buffer, pH 7.4 (230 mOsm/kg H.sub.2 O), and fixed by microwave irradiation. This procedure was repeated once with fresh fixative. The sample was washed with water, immersed in 1% uranyl acetate, and stained by microwave irradiation. Throughout all steps, the sample was kept at 0.degree. C. and the microwave (Samsung RE211D) was set at defrost for 5 min. Thin sections were prepared with standard techniques, stained with lead citrate (Venable et al., 1965), and examined in a Philips CM 10 electron microscope.
We further continued isolating LA from sera of pigs originating from cases of MSD. Serum samples originated from the Netherlands (field case the Netherlands 2), Germany (field cases Germany 1 and Germany 2; courtesy Drs. Berner, M unchen and Nienhoff, M unster), and the United States [experimental case United States 1 (experiment performed with ATCC VR-2332; courtesy Drs. Collins, St. Paul and Chladek, St. Joseph), and field cases United States 2 and United States 2; courtesy Drs. van Alstine, West Lafayette and Slife, Galesburg]. All samples were sent to the "Centraal Diergeneeskundig Instituut, Lelystad" for LA diagnosis. All samples were used for virus isolation on porcine alveolar macrophages as described. Cytophatic isolates were passaged three times and identified as LA by specific immunostaining with anti-LA post infection sera b 822 and c 829.
We also studied the antigenic relationships of isolates NL1 (the first LA isolate; code CDI-NL-2.91), NL2, GE1, GE2, US1, US2, and US3. The isolates were grown in macrophages as above and were tested in IPMA with a set of field sera and two sets of experimental sera. The sera were also tested in IPMA with uninfected macrophages.
The field sera were: Two sera positive for LV (TH-187 and TO-36) were selected from a set of LA-positive Dutch field sera. Twenty-two sera were selected from field sera sent from abroad to Lelystad for serological diagnosis. The sera originated from Germany (BE-352, BE-392 and NI-f2; courtesy Dr. Berner, M unchen and Dr. Nienhoff, M unster), the United Kingdom (PA-141615, PA-141617 and PA-142440; courtesy Dr. Paton, Weybridge), Belgium (PE-1960; courtesy Prof. Pensaert, Gent), France (EA-2975 and EA-2985; courtesy Dr. Albina, Ploufragan), the United States (SL-441, SL-451, AL-RP9577, AL-P10814/33, AL-4994A, AL-7525, JC-MN41, JC-MN44 and JC-MN45; courtesy Dr. Slife, Galesburg, Dr. van Alstine, West Lafayette, and Dr. Collins, St. Paul), and Canada (RB-16, RB-19, RB-22 and RB-23; courtesy Dr. Robinson, Quebec).
The experimental sera were: The above described set of sera of pigs 21, 23, 25, and 29, taken at dpi 0, 14, 28, and 42. A set of experimental sera (obtained by courtesy of Drs. Chladek, St. Joseph, and Collins, St. Paul) that originated from four six-month-old gilts that were challenged intranasally with 10.sup.5.1 TCID.sub.50 of the isolate ATCC VR-2332. Bloodsamples were taken from gilt 2B at 0, 20, 36, and 63 dpi; from gilt 9G at 0, 30, 44, and 68 dpi; from gilt 16W at 0, 25, 40, and 64 dpi; and from gilt 16Y at 0, 36, and 64 dpi.
To study by radio-immunoprecipitation assay (RIP; de Mazancourt et al., 1986) the proteins of LA in infected porcine alveolar macrophages, we grew LA-infected and uninfected macrophages for 16 hours in the presence of labeling medium containing .sup.35 S-Cysteine. Then the labeled cells were precipitated according to standard methods with 42 dpi post-infection sera of pig b 822 and pig 23 and with serum MN8 which was obtained 26 days after infecting a sow with the isolate ATCC VR-2332 (courtesy Dr. Collins, St. Paul). The precipitated proteins were analysed by electrophoresis in a 12% SDS-PAGE gel and visualized by fluorography.
To characterize the genome of LA, we extracted nuclear DNA and cytoplasmatic RNA from macrophage cultures that were infected with LA and grown for 24 h or were left uninfected. The cell culture medium was discarded, and the cells were washed twice with phosphate-buffered saline. DNA was extracted as described (Strauss, 1987). The cytoplasmic RNA was extracted as described (Favaloro et al., 1980), purified by centrifugation through a 5.7M CsCl cushion (Setzer et al., 1980), treated with RNase-free DNase (Pharmacia), and analyzed in an 0.8% neutral agarose gel (Moormann and Hulst, 1988).
Cloning and Sequencing
To clone LV RNA, intracellular RNA of LV-infected porcine lung alveolar macrophages (10 .mu.g) was incubated with 10 mM methylmercury hydroxide for 10 minutes at room temperature. The denatured RNA was incubated at 42.degree. C. with 50 mM Tris-HCl, pH 7.8, 10 mM MgCl.sub.2, 70 mM KCl, 0.5 mM DATP, dCTP, dGTP and dTTP, 0.6 .mu.g calf thymus oligonucleotide primers pd(N) 6 (Pharmacia) and 300 units of Moloney murine leukaemia virus reverse transcriptase (Bethesda Research Laboratories) in a total volume of 100 .mu.l. 20 mM EDTA was added after 1 hr; the reaction mixture was then extracted with phenol/chloroform, passed through a Sephadex G50 column and precipitated with ethanol.
For synthesis of the second cDNA strand, DNA polymerase I (Boehringer) and RNase H (Pharmacia) were used (G ubler and Hoffman, 1983). To generate blunt ends at the termini, double-stranded cDNA was incubated with T4 DNA polymerase (Pharmacia) in a reaction mixture which contained 0.05 mM deoxynucleotide-triphosphates. Subsequently, cDNA was fractionated in a 0.8% neutral agarose gel (Moormann and Hulst, 1988). Fragments of 1 to 4 kb were electroeluted, ligated into the SmaI site of pGEM-4Z (Promega), and used for transformation of Escherichia coli strain DH5.alpha. (Hanahan, 1985). Colony filters were hybridized with a .sup.32 P-labelled single-stranded cDNA probe. The probe was reverse transcribed from LV RNA which had been fractionated in a neutral agarose gel (Moormann and Hulst, 1988). Before use the single stranded DNA probe was incubated with cytoplasmic RNA from mock-infected lung alveolar macrophages.
The relationship between LV cDNA clones was determined by restriction enzyme analysis and by hybridization of Southern blots of the digested DNA with nick-translated cDNA probes (Sambrook et al., 1989).
To obtain the 3' end of the viral genome, we constructed a second cDNA library, using oligo (dT).sub.12-18 and a 3' LV specific oligonucleotide that was complementary to the minus-strand viral genome as a primer in the first-strand reaction. The reaction conditions for first- and second-strand synthesis were identical to those described above. This library was screened with virus-specific 3' end oligonucleotide probes.
Most part (>95%) of the cDNA sequence was determined with an Automated Laser Fluorescent A.L.F..TM. sequencer from Pharmacia LKB. Fluorescent oligonucleotide primer directed sequencing was performed on double-stranded DNA using the AutoRead.TM. Sequencing Kit (Pharmacia) essentially according to procedures C and D described in the Autoread.TM. Sequencing Kit protocol. Fluorescent primers were prepared with FluorePrime.TM. (Pharamacia). The remaining part of the sequence was determined via double-stranded DNA sequencing using oligonucleotide primers in conjunction with a T7 polymerase based sequencing kit (Pharmacia) and .alpha.-.sup.32 S-dATP (Amersham). Sequence data were analysed using the sequence analysis programs PCGENE (Intelligenetics, Inc, Mountain View, USA) and FASTA (Pearson and Lipman, 1988).
Experimental reproduction of MSD.
Fourteen conventionally reared pregnant sows that were pregnant for 10-11 weeks were tested for antibody against LA in the IPMA. All were negative. Then two groups of four sows were formed and brought to the CVI. At week 12 of gestation, these sows were inoculated intranasally with 2 ml LA (passage level 3, titre 10.sup.4.8 TCID.sub.50 /ml). Serum and EDTA blood samples were taken at day 10 after inoculation. Food intake, rectal temperature, and other clinical symptoms were observed daily. At farrowing, the data of birth and the number of dead and living piglets per sow were recorded, and samples were taken for virus isolation and serology.
RESULTS
Immunofluorescence
Tissue sections of pigs with MSD were stained in an IFT with FITC-conjugates directed against African swine fever virus, hog cholera virus, pseudorabies virus, porcine parvo virus, porcine influenza virus, encephalomyocarditis virus and Chlamydia psittaci. The sections were stained, examined by fluorescent microscopy and all were found negative.
Virus isolation from piglets from MSD affected farms.
Cytopathic isolates were detected in macrophage cultures inoculated with tissue samples of MSD affected, two-to-ten day old piglets. Sixteen out of 19 piglets originating from five different farms were positive (Table 1A). These isolates all reacted in IPMA with the post-infection serum of pig c 829, whereas non-inoculated control cultures did not react. The isolates therefore were representatives of LA. One time a cytopathic isolate was detected in an SK-6 cell culture inoculated with a suspension of an oral swab from a piglet from a sixth farm (farm VE) (Table 1A). This isolate showed characteristics of the picorna viridae and was neutralized by serum specific for PEV 2, therefore the isolate was identified as PEV 2 (Table 3). PK2, PK-15 cells and hen eggs inoculated with samples from this group remained negative throughout.
Virus isolation from sows from MSD affected farms.
Cytopathic isolates were detected in macrophage cultures inoculated with samples of MSD affected sows. 41 out of 63 sows originating from 11 farms were positive (Table 1B). These isolates all reacted in IPMA with the post-infection serum of pig b 822 and were therefore representatives of LA. On one occasion a cytopathic isolate was detected in a PK2 cell culture inoculated with a suspension of a leucocyte fraction of a sow from farm HU (Table 1B). This isolate showed characteristics of the picorna viridae and was neutralized by serum specific for EMCV, therefore the isolate was identified as EMCV (Table 3). SK-6, PK-15 cells and hen eggs inoculated with samples from this group remained negative.
Virus isolation from SPF pigs kept in contact with MSD affected sows.
Cytopathic isolated were detected in macrophage cultures inoculated with samples of SPF pigs kept in contact with MSD affected sows. Four of the 12 pigs were positive (Table 2). These isolates all reacted in IPMA with the post-infection serum of pig c 829 and of pig b 822 and were therefore representatives of LA. Cytopathic isolates were also detected in Pk2, PK-15 and SK-6 cell cultures inoculated with samples of these isolates were all neutralized by serum directed against PEV 7. One of these seven isolates was studied further and other characteristics also identified the isolate as PEV 7 (Table 3).
Virus isolation from SPF pigs inoculated with blood of MSD affected sows.
Cytopathic isolates were detected in macrophage cultures inoculated with samples of SPF pigs inoculated with blood of MSD affected sows. Two out of the eight pigs were positive (Table 2). These isolates all reacted in IPMA with the post-infection serum of pig c 829 and of pig b 822 and were therefore representatives of LA. PK2, SK-6 and PK-15 cells inoculated with samples from this group remained negative.
Summarizing, four groups of pigs were tested for the presence of agents that could be associated with mystery swine disease (MSD).
In group one, MSD affected piglets, the Lelystad agent (LA) was isolated from 16 out of 20 piglets; one time PEV 2 was isolated.
In group two, MSD affected sows, the Lelystad agent was isolated from 41 out of 63 sows; one time EMCV was isolated. Furthermore, 123 out of 165 MSD affected sows seroconverted to the Lelystad agent, as tested in the IPMA. Such massive seroconversion was not demonstrated against any of the other viral pathogens tested.
In group three, SPF pigs inoculated with blood of MSD affected sows, the LA was isolated from two pigs. All eight pigs seroconverted to LA.
Serology of sows from MSD affected farms.
Paired sera from sows affected with MSD were tested against a variety of viral pathogens and against the isolates obtained during this study (Table 4). An overwhelming antibody response directed against LA was measured in the IPMA (75% of the sows seroconverted, in 23 out of the 26 farms seroconversion was found), whereas with none of the other viral pathogens a clear pattern of seroconversion was found. Neutralizing antibody directed against LA was out detected. Serology of SPF pigs kept in contact with MSD affected sows.
All eight SPF pigs showed an antibody response in the IPMA against LA (Table 5). None of these sera were positive in the IPMA performed on uninfected macrophages. None of these sera were positive in the SNT of LA. The sera taken two weeks after contact had all high neutralizing antibody titres (>1280) against PEV 7, whereas the pre-infection sera were negative (>10), indicating that all pigs had also been infected with PEV 7.
Serology of SPF pigs inoculated with blood of MSD affected sows.
All eight SPF pigs showed an antibody response in the IPMA against LA (Table 5). None of these sera were positive in the IPMA performed on uninfected macrophages. None of these sera were positive in the SNT for LA. The pre- and two weeks post-inoculation sera were negative (<10) against PEV 7.
Further identification of Lelystad agent.
LA did not haemagglutinate with chicken, guinea pig, pig, sheep, or human O red blood cells.
LA did not react in IPMA with sera directed against PRV, TGE, PED, ASFV, etc.
After two blind passages, LA did not grow in PK2, PK-15, or SK-6 cells, or in embryonated hen eggs, inoculated through the allantoic route.
LA was still infectious after it was filtered through a 0.2 micro filter, titres before and after filtration were 10.sup.5.05 and 10.sup.5.3 TCID.sub.50 as detected by IPMA.
Growth curve of LA (see FIG. 3). Maximum titres of cell-free virus were approximately 10.sup.5.5 TCID.sub.50 ml.sup.-1 from 34-48 h after inoculation. After that time the macrophages were killed by the cytopathic effect of LA.
Electronmicroscopy. Clusters of spherical LA particles were found. The particles measured 45-55 nm in diameter and contained a 30-35 nm nucleocapsid that was surrounded by a lipid bilayer membrane. LA particles were not found in infected cultures that were treated with negative serum or in negative control preparations.
Isolates from the Netherlands, Germany, and the United States. All seven isolates were isolated in porcine alveolar macrophages and passaged three to five times. All isolates caused a cytopathic effect in macrophage and could be specifically immunostained with anti-LA sera b 822 and the 42 dpi serum 23. The isolates were named NL2, GE1, GE2, US1, US2, and US3.
Antigenic relationships of isolates NL1, NL2, GE1, GE2, US1, US2, and US3. None of the field sera reacted in IPMA with uninfected macrophages but all sera contained antibodies directed against one or more of the seven isolates (Table 7). None of the experimental sera reacted in IPMA with uninfected macrophages, and none of the 0 dpi experimental sera reacted with any of the seven isolates in IPMA (Table 8). All seven LA isolates reacted with all or most of the sera from the set of experimental sera of pigs 21, 23, 25, and 29, taken after 0 dpi. Only the isolates US1, US2, and US3 reacted with all or most of the sera from the set of experimental sera of gilts 2B, 9G, 16W, and 16Y, taken after 0 dpi.
Radioimmunoprecipitation studies. Seven LA-specific proteins were detected in LA-infected macrophages but not in uninfected macrophages precipitated with the 42 dpi sera of pigs b 822 and 23. The proteins had estimated molecular weights of 65, 39, 35, 26, 19, 16, and 15 kilodalton. Only two of these LA-specific proteins, of 16 and 15 kilodalton, were also precipitated by the 26 dpi serum MN8.
Sequence and oraganization of the genome of LV
The nature of the genome of LV was determined by analyzing DNA and RNA from infected porcine lung alveolar macrophages. No LV-specific DNA was detected. However, we did detect LV-specific RNA. In a 0.8% neutral agarose gel LV RNA migrated slightly slower than a preparation of hog cholera virus RNA of 12.3 kb (Moormann et al., 1990) did. Although no accurate size determination can be performed in neutral agarose gels, it was estimated that the LV-specific RNA is about 14.5 to 15.5 kb in length.
To determine the complexity of the LV-specific RNAs in infected cells and to establish the nucleotide sequence of the genome of LV, we prepared cDNA from RNA of LV-infected porcine lung alveolar macrophages and selected and mapped LV-specific cDNA clones as described under Materials and Methods. The specificity of the cDNA clones was reconfirmed by hybridizing specific clones, located throughout the overlapping cDNA sequence, to Northern blots carrying RNA of LV-infected and uninfected macrophages. Remarkably, some of the cDNA clones hybridized with the 14.5 to 15.5 kb RNA detected in infected macrophages only, whereas others hybridized with the 14.5 to 15.5 kb RNA as well as with a panel of 4 or 5 RNAs of lower molecular weight (estimated size, 1 to 4 kb). The latter clones were all clustered at one end of the cDNA map and covered about 4 kb of DNA. These data suggested that the genome organization of LV may be similar to that of coronaviridae (Spaan et al., 1988), Berne virus (BEV; Snijder et al., 1990b), a torovirus, and EAV (de Vries et al., 1990), i.e. besides a genomic RNA there are subgenomic mRNAs which form a nested set which is located at the 3' end of the genome. This assumption was confirmed when sequences of the cDNA clones became available and specific primers could be selected to probe the blots with. A compilation of the hybridization data obtained with cDNA clones and specific primers, which were hybridized to Northern blots carrying the RNA of LV-infected and uninfected macrophages, is shown in FIG. 2. Clones 12 and 20 which are located in the 5' part and the centre of the sequence respectively hybridize to the 14.5 to 15.5 kb genomic RNA detected in LV-infected cells only. Clones 41 and 39, however, recognize the 14.5 to 15.5 kb genomic RNA and a set of 4 and 5 RNAs of lower molecular weight, respectively. The most instructive and conclusive hybridization pattern, however, was obtained with primer 25, which is located at the ultimate 5' end in the LV sequence (compare FIG. 1). Primer 25 hybridized to a panel of 7 RNAs, with an estimated molecular weight ranging in size from 0.7 to 3.3 kb (subgenomic mRNAs), as well as the genomic RNA. The most likely explanation for the hybridization pattern of primer 25 is that 5' end genomic sequences, the length of which is yet unknown, fuse with the body of the mRNAs which are transcribed from the 3' end of the genome. In fact, the hybridization pattern obtained with primer 25 suggests that 5' end genomic sequences function as a so called "leader sequence" in subgenomic mRNAs. Such a transcription pattern is a hallmark of replication of coronaviridae (Spaan et al., 1988), and of EAV (de Vries et al., 1990).
The only remarkable discrepancy between LV and EAV which could be extracted from the above data is that the genome size of LV is about 2.5 kb larger than that of EAV.
The consensus nucleotide sequence of overlapping cDNA clones is shown in FIG. 1 (SEQ ID NO: 1). The length of the sequence is 15,088 basepairs, which is in good agreement with the estimated size of the genomic LV RNA.
Since the LV cDNA library was made by random priming of the reverse transcriptase reaction with calf thymus pd(N) 6 primers, no cDNA clones were obtained which started with a poly-A stretch at their 3' end. To clone the 3' end of the viral genome, we constructed a second cDNA library, using oligo (dT) and primer 39U183R in the reverse transcriptase reaction. Primer 39U183R is complementary to LV minus-strand RNA, which is likely present in a preparation of RNA isolated from LV-infected cells. This library was screened with virus-specific probes (nick-translated cDNA clone 119 and oligonucleotide 119R64R), resulting in the isolation of five additional cDNA clones (e.g., cDNA clone 151, FIG. 2). Sequencing of these cDNA clones revealed that LV contains a 3' poly(A) tail. The length of the poly(A) tail varied between the various cDNA clones, but its maximum length was twenty nucleotides. Besides clone 25 and 155 (FIG. 2), four additional cDNA clones were isolated at the 5' end of the genome, which were only two to three nucleotides shorter than the ultimate 5' nucleotide shown in FIG. 1 (SEQ ID NO: 1). Given this finding and given the way cDNA was synthesized, we assume to be very close to the 5' end of the sequence of LV genomic RNA.
Nearly 75% of the genomic sequence of LV encodes ORF 1A and ORF 1A probably initiates at the first AUG (nucleotide position 212, FIG. 1) encountered in the LV sequence. The C-terminus of ORF 1A overlaps the putative N-terminus of ORF 1B over a small distance of 16 nucleotides. It thus seems that translation of ORF 1B proceeds via ribosomal frameshifting, a hallmark of the mode of translation of the polymerase or replicase gene of coronaviruses (Boursnell et al. 1987; Bredenbeek et al. 1990) and the torovirus BEV (Snijder et al., 1990a). The characteristic RNA pseudoknot structure which is predicted to be formed at the site of the ribosomal frameshifting is also found at this location in the sequence of LV (results not shown).
ORF 1B encodes an amino acid sequence (SEQ ID NO: 3) or nearly 1400 residues which is much smaller than ORF 1B of the coronaviruses MHV and IBV (about 3,700 amino acid residues; Bredenbeek et al., 1990; Boursnell et al., 1987) and BEV (about 2,300 amino acid residues; Snijder et al., 1990a). Characteristic features of the ORF 1B product (SEQ ID NO: 3) or members of the superfamily of coronaviridae like the replicase motif and the Zinc finger domain can also be found in ORF 1B of LV (results not shown).
Whereas ORF 1A and ORF 1B encode the viral polymerase (SEQ ID NO: 2) and (SEQ ID NO: 3) and therefore are considered to encode a non-structural viral protein, ORFs 2 to 7 are believed to encoded structural viral proteins (SEQ ID NOS: 4-9).
The products of ORFs 2 to 6 (SEQ ID NOS: 4-8) all show features reminiscent of membrane (envelope) associated proteins. ORF 2 encodes a protein (SEQ ID NO: 4) of 249 amino acids containing two predicted N-linked glycosylation sites (Table 9). At the N-terminus a hydrophobic sequence, which may function as a so called signal sequence, is identified. The C-terminus also ends with a hydrophobic sequence which in this case may function as a transmembrane region which anchors the ORF 2 product (SEQ ID NO: 4) in the viral envelope membrane.
ORF 3 may initiate at the AUG starting at nucleotide position 12394 or at the AUG starting at nucleotide position 12556 and then encodes proteins (SEQ ID NO: 5) of 265 and 211 amino acids respectively. The protein of 265 residues contains seven putative N-linked glycosylation sites, whereas the protein of 211 residues contains four (Table 9). At the N-terminus of the protein (SEQ ID NO: 5) of 265 residues a hydrophobic sequence is identified.
Judged by hydrophobicity analysis, the topology of the protein encoded by ORF 4 (SEQ ID NO: 6) is similar to that encoded by ORF 2 (SEQ ID NO: 4) if the product of ORF 4 (SEQ ID NO: 6) initiates at the AUG starting at nucleotide position 12936. However, ORF 4 may also initiate at two other AUG codons (compare FIGS. 1 and 2) starting at positions 12981 and 13068 in the sequence respectively. Up to now it is unclear which startcodon is used. Depending on the startcodon used, ORF 4 may encode proteins (SEQ ID NO: 6) of 183 amino acids containing four putative N-linked glycosylation sites, of 168 amino acids containing four putative N-linked glycosylation sites, or of 139 amino acids containing three putative N-linked glycosylation sites (Tables 9).
ORF 5 is predicted to encode a protein (SEQ ID NO: 7) of 201 amino acids having two putative N-linked glycosylation sites (Table 9). A characteristic feature of the ORF 5 product (SEQ ID NO: 7) is the internal hydrophobic sequence between amino acid 108 to amino acid 132.
Analysis for membrane spanning segments and hydrophilicity of the product of ORF 6 (SEQ ID NO: 8) shows that it contains three transmembrane spanning segments in the N-terminal 90 amino acids of its sequence. This remarkable feature is also a characteristic of the small envelope glycoprotein M or E1 of several coronaviruses e.g. Infectious Bronchitis Virus (IBV; Boursnell et al., 1984)_and Mouse Hepatitis Virus (MHV; Rottier et al., 1986). It is therefore predicted that the protein encoded by ORF 6 (SEQ ID NO: 8) has a membrane topology analogous to that of the M of E1 protein of coronaviruses (Rottier et al., 1986). A second characteristic of the M or E1 protein is a so called surface helix which is located immediately adjacent to the presumed third transmembrane region. This sequence of about 25 amino acids which is very well conserved among coronaviruses is also recognized, although much more degenerate, in LV. Yet we predict the product of LV ORF 6 (SEQ ID NO: 8) to have an analogous membrane associated function as the coronavirus M or E1 protein. Furthermore, the protein encoded by ORF (SEQ ID NO: 8) showed a strong similarity (53% identical amino acids) with VpX (Godeny et al., 1990) of LDV.
The protein encoded by ORF 7 (SEQ ID NO: 9) has a length of 128 amino acid residues (Table 9) which is 13 amino acids longer than Vp1 of LDV (Godeny et al., 1990). Yet a significant similarity (43% identical amino acids) was observed between the protein encoded by ORF 7 (SEQ ID NO: 9) and Vp1. Another shared characteristic between the product of ORF 7 and Vp1 is the high concentration of basis residues (Arg, Lys and His) in the N-terminal half of the protein. Up to amino acid 55 the LV sequence contains 26% Arg, Lys and His. This finding is fully in line with the proposed function of the ORF 7 product (SEQ ID NO: 9) or Vp1 (Godeny et al., 1990), namely encapsidation of the viral genomic RNA. On the basis of above data, we propose the LV ORF 7 product (SEQ ID NO: 9) to be the nucleocapsid protein N of the virus.
A schematic representation of the organization of the LV genome is shown in FIG. 2. The map of overlapping clones used to determine the sequence of LV is shown in the top panel. A linear compilation of this map indicating the 5' and 3' end of the nucleotide sequence of LV, shown in FIG. 1 (SEQ ID NO: 1), including a division in kilobases is shown below the map of cDNA clones and allows the positioning of these clones in the sequence. The position of the ORFs identified in the LV genome is indicated below the linear map of the LV sequence. The bottom panel shows the nested set of subgenomic mRNAs and the position of these RNAs relative to the LV sequence.
In line with the translation strategy of coronavirus, torovirus and arterivirus subgenomic mRNAs it is predicted that ORFs 1 to 6 are translated from the unique 5' end of their genomic or mRNAs. This unique part of the mRNAs is considered to be that part of the RNA that is obtained when a lower molecular weight RNA is "subtracted" from the higher molecular weight RNA which is next in line. Although RNA 7 forms the 3' end of all the other genomic and subgenomic RNAs, and thus does not have a unique region, it is believed that ORF 7 is only translated from this smallest sized mRNA. The "leader sequence" at the 5' end of the subgenomic RNAs is indicated with a solid box. The length of this sequence is about 200 bases, but the precise site of fusion with the body of the genomic RNAs still has to be determined.
Experimental reproduction of MSD
Eight pregnant sows were inoculated with LA and clinical signs of MSD such as inappetance and reproductive losses were reproduced in these sows. From day four to day 10-12 post-inoculation (p.i.), all sows showed a reluctance to eat. None of the sows had elevated body temperatures. Two sows had bluish ears at day 9 and 10 p.i. In Table 6 the day of birth and the number of living and dead piglets per sow is given. LA was isolated from 13 of the born piglets.
TABLE 1______________________________________Description and results of virus isolation of field samples.______________________________________A Samples of piglets suspected of infection with MSD. number agefarm of pigs days material used results*______________________________________RB 5 2 lung, tonsil, and brains 5 .times. LADV 4 3 lung, brains, 3 .times. LA pools of kidney, spleenTH 3 3-5 lung, pools of kidney, 3 .times. LA tonsilDO 3 10 lung, tonsil 2 .times. LAZA 4 1 lung, tonsil 3 .times. LAVE 1 ? oral swab 1 .times. PEV 2TOTAL 20 16 .times. LA, 1 .times. PEV 2______________________________________B Samples of sows suspected of infection with MSD. numberfarm of sows material used results______________________________________TH 2 plasma and leucocytes 1 .times. LAHU 5 plasma and leucocytes 2 .times. LA, 1 .times. EMCVTS 10 plasma and leucocytes 6 .times. LAHK 5 plasma and leucocytes 2 .times. LALA 6 plasma and leucocytes 2 .times. LAVL 6 serum and leucocytes 5 .times. LATA 15 serum 11 .times. LALO 4 plasma and leucocytes 2 .times. LAJA 8 plasma and leucocytes 8 .times. LAVD 1 plasma and leucocytes 1 .times. LAVW 1 serum 1 .times. LATOTAL 63 41 .times. LA, 1 .times. EMCV______________________________________ *Results are given as the number of pigs from which the isolation was made. Sometimes the isolate was detected in more then one sample per pig. LA = Lelystad agent PEV 2 = porcine entero virus type 2 EMCV = encephalomyocarditis virus
TABLE 2______________________________________Description and results of virus isolation of samples of pigswith experimentally induced infections.sow pig@ material used results*______________________________________A (LO) # c 835 lung, tonsil 2 .times. LA c 836 nasal swabs 2 .times. PEV 7 c 837 nasal swabsB (JA) c 825 lung, tonsil c 821 nasal swabs 1 .times. PEV 7 c 823 nasal swabs 4 .times. PEV 7C (JA) c 833 lung tonsil 1 .times. LA, 1 .times. PEV 7 c 832 nasal swabs 2 .times. PEV 7 c 829 nasal swabs, plasma 3 .times. LA, 2 .times. PEV 7 and leucocytesD (VD) c 816 lung, tonsil c 813 nasal swabs 1 .times. LA c 815 nasal swabs 1 .times. PEV 7TOTAL isolates from contact pigs 7 .times. LA, 13 .times. PEV 7______________________________________A b 809 nasal swabs b 817 nasal swabsB b 818 nasal swabs, plasma 1 .times. LA and leucocytes b 820 nasal swabsC b 822 nasal swabs b 826 nasal swabsD b 830 nasal swabs 1 .times. LA b 834 nasal swabsTOTAL isolates from blood 2 .times. LAinoculated pigs______________________________________ @ SPF pigs were either kept in contact (c) with a sow suspected to be infected with MSD, or were given 10 ml EDTA blood (b) of that sow intramuscularly at day 0 of the experiment. Groups of one sow and three SPF pigs (c) were kept in one pen, and all four of these groups were housed in one stable. At day 6, one SPF pig in each group was killed and tonsil and lungs were used for virus isolation. The four groups of SPF pigs inoculated with blood (b) were housed in four other pens in a separate stable. Nasal swabs of the SPF pigs were taken at day 2, 5, 7 an 9 of the experiment, and EDTA blood for virus isolation from plasma and leucocytes was taken whenever a pig had fever. *Results are given as number of isolates per pig. LA = Lelystad agent PEV 7 = porcine entero virus type 7 # In brackets the initials of the farm of origin of the sow are given.
TABLE 3______________________________________Identification of viral isolates buoyant.sup.1 particle.sup.2 neutralized by.sup.4origin and density size in sens.sup.3. to serum directedcell culture in CsCl FM (nm) chloroform against (titre)______________________________________leucocytes 1.33 g/ml 28-30 not sens. EMCV ( 1280)sow farmHU PK15,PK2, SK6oral swab ND 28-30 not sens. PEV 2 (>1280)piglet farmVE SK6nasal ND 28-30 not sens. PEV 7 (>1280)swabs,tonsilSPF pigsCVIPK-15,PK2, SK6various 1.19 g/ml pleomorf sens. none (all <5)samplesvariousfarmspiglungmacro-phages______________________________________ .sup.1 Buoyant density in preformed lineair gradients of CsCl in PBS was determined according to standard techniques (Brakke; 1967). Given is the density where the peak of infectivity was found. .sup.2 Infected and noninfected cell cultures of the isolate under study were freezethawed. Cell lysates were centrifuged for 30 min at 130,000 g, the resulting pellet was negatively stained according to standard techniques (Brenner and Horne; 1959), and studied with a Philips CM 10 electron microscope. Given is the size of particles that were present in infected and not present in noninfected cultures. .sup.3 Sensitivity to chloroform was determined according to standard techniques (Grist, Ross, and Bell; 1974). .sup.4 Hundred to 300 TCID.sub.50 of isolates were mixed with varying dilutions of specific antisera and grown in the appropriate cell system until full CPE was observed. Sera with titres higher then 5 were retested and sera which blocked with high titres the CPE were considered specific for the isolate. The isolates not sensitive to chloroform were tested wit sera specifically directed against porcine entero viruses (PEV) 1 to 11 (courtesy Dr. Knowles, Pirbright, UK), against encephalomyocarditis virus (EMCV; courtesy Dr. Ahl, Tubingen, Germany), against porcine parvo virus, and against swine vesicular disease. The isolate (code: CDINL-2.91) sensitive to chloroform was tested with antisera specifically directed against pseudorabies virus, bovine herpes virus 1, bovine herpes virus 4, malignant catarrhal virus, bovine viral diarrhoea virus, hog cholera virus, swine influenza virus H1N1 and H3N2, parainfluenza 3 virus, bovine respiratory syncitial virus, transmissible gastroenteritis virus, porcine epidemic diarrhoea virus, haemaglutinating encephalitis virus, infectious bronchitis virus, bovine leukemia virus, avian leukemia virus, maedivisna virus, and with the experimental sera obtained from the SPFpigs (see Table 5).
TABLE 4__________________________________________________________________________Results of serology of paired field sera taken from sowssuspected to have MSD. Sera were taken in the acute phase ofthe disease and 3-9 weeks later. Given is the number of sowswhich showed a fourfold or higher rise in titre/number of sowstested.__________________________________________________________________________ Interval.sup.i HAI ELISAFarm in weeks HEV H1N1 H3N2 PBV PPV BVDV HCV__________________________________________________________________________TH 3 0/6 0/6 0/6 0/6 0/6 0/5 0/6RB 5 0/13 1/13 0/13 1/9 0/7 0/6 0/9HU 4 0/5 0/5 3/5 0/5 0/5 0/5 0/5TS 3 1/10 0/10 0/10 0/10 0/10 0/4 0/10VL 3 0/5 0/5 0/5 0/5 1/5 0/5 0/5JA 3 0/11 1/11 3/11 0/11 2/11 0/11 0/11WE 4 1/6 1/6 1/6 3/7 3/7 0/7 0/7GI 4 0/4 1/4 0/4 0/4 0/4 0/4 0/4SE 5 0/8 0/8 0/8 0/8 0/6 0/3 0/8KA 5 0/1 0/1 0/1 0/1 0/1 ND 0/1HO 3 1/6 0/5 1/6 0/6 0/6 0/6 0/6NY 4 0/5 1/5 1/5 0/3 0/4 0/2 0/4JN 3 0/10 5/10 0/10 0/10 1/10 0/10 0/10KO.sup.f 3 1/10 0/10 0/10 0/10 2/10 0/10 0/10OE 9 ND ND ND 0/6 0/6 0/6 0/6LO 6 ND ND ND 0/3 0/3 0/2 0/3WI 4 ND ND ND 0/1 1/1 0/1 0/3RR 3 ND ND ND 1/8 0/8 0/8 0/8RY 4 ND ND ND 0/3 0/4 0/3 0/4BE 5 ND ND ND 10 0/10 0/10 0/10BU 3 ND ND ND 1/6 0/6 0/6 0/6KR 3 ND ND ND 1/4 0/4 0/4 0/4KW 5 ND ND ND 0/10 0/10 0/10 0/10VR 5 ND ND ND 1/6 0/6 0/6 0/6HU 4 ND ND ND 1/4 0/3 0/3 0/4ME 3 ND ND ND 0/5 1/5 0/5 0/5total negative.sup.n 19 41 29 97 16 140 165total positive.sup.p 77 48 62 55 131 1 0total sero- 4 10 9 9 11 0 0converted.sup.stotal tested 100 99 100 161 158 141 165__________________________________________________________________________ The sera were tested in haemagglutinating inhibition (HAI) tests for the detection of antibody against haemagglutinating encephalitis virus (HEV), and swine influenza viruses H1N1 and H3N2, in enzymelinked-immuno sorbent assays (ELISA) for the detection of antibody against the glycoprotein gI of pseudorabies virus (PRV), against porcine parvo virus (PPV), bovine viral diarrhoea virus (BVDV), and hog cholera virus (HCV).
Interval SNT IPMAFarm in weeks FMCV FMCVi PEV2 PEV2i PEV7 PEV7i LA LA__________________________________________________________________________TH 3 0/6 0/6 0/5 0/5 0/6 0/5 0/6 6/6RB 5 1/7 1/9 0/6 2/6 1/8 0/6 0/13 7/9HU 4 ND 0/5 0/5 0/5 ND 0/5 0/5 3/5TS 3 0/10 0/10 0/7 0/4 0/10 0/7 ND 10/10VL 3 ND ND 1/5 0/5 ND 0/5 ND 5/5JA 3 0/11 0/11 0/11 0/11 1/11 2/11 0/5 8/11WE 4 1/7 1/6 1/6 1/7 1/7 1/7 0/7 7/7GI 4 0/4 0/4 0/4 0/4 0/4 0/4 0/4 4/4SE 5 0/8 0/8 0/6 1/8 0/8 1/5 0/8 6/8KA 5 0/1 0/1 0/1 0/1 0/1 0/1 0/1 0/1HO 3 0/6 0/6 0/6 0/6 0/6 0/6 0/6 4/6NY 4 0/4 0/4 0/2 0/2 0/4 0/3 0/4 4/4JN 3 0/10 0/10 1/10 0/9 0/10 0/10 0/10 5/10KO.sup.f 3 0/10 0/10 2/10 2/10 1/10 3/10 ND 8/10OE 9 0/6 0/6 1/6 1/5 ND 1/6 ND 4/6LO 6 0/3 0/3 0/3 0/3 0/3 0/3 ND 3/3WI 4 ND ND 0/1 0/1 ND 0/1 ND 0/3RR 3 0/8 1/8 0/8 0/8 0/8 0/8 ND 8/8RY 4 0/4 ND 0/4 0/1BE 5 ND ND 0/10 0/10 ND 1/10 ND 0/10BU 3 ND ND 0/6 0/6 ND 0/6 ND 6/ 6KR 3 ND ND 0/4 0/4 ND 0/4 ND 1/4KW 5 ND ND 0/10 0/10 ND 1/10 ND 10/10VR 5 ND ND 0/6 1/6 ND 0/6 Nn 6/6HU 4 ND ND 0/3 0/4 ND 0/3 ND 3/4ME 3 ND ND 0/5 0/5 ND 0/5 ND 2/5total neg..sup.n 15 29 0 0 2 1 69 15total pos..sup.p 88 74 144 138 90 136 0 27total sero- 2 3 6 8 4 10 0 123converted.sup.stotal tested 105 107 150 146 96 147 69 165__________________________________________________________________________ The sera were tested in serum neutralization tests (SNT) for the detectio of neutralizing antibody directed against encephalomyocarditis virus (EMCV), the isolated (i) EMCV, porcine entero viruses (PEV) 2 and 7 and the PEV isolates (i), and against the Lelystad agent (LA), and were teste in an immunoperoxidase-monolayer-assay (IPMA) for the detection of antibody directed against the Lelystad agent (LA). .sup.f fattening pigs. .sup.i time between sampling of the first and second serum. .sup.n total number of pigs of which the first serum was negative in the test under study, and of which the second serum was also negative or showed a less then fourfold rise in titre. .sup.p total numbe of pigs of which the first serum was fourfold rise in titre. .sup.s total number of pigs of which the second serum had a fourfold or higher titre then the first serum in the test under study. ND = not done.
TABLE 5______________________________________Development of antibody directed against Lelystad agent asmeasured by IPMA.______________________________________A contact pigsWeeks post contact: serum titres in IPMAPig 0 2 3 4 5______________________________________c 836 0 10 640 640 640c 837 0 10 640 640 640c 821 0 640 640 640 640c 823 0 160 2560 640 640c 829 0 160 640 10240 10240c 832 0 160 640 640 2560c 813 0 640 2560 2560 2560c 815 0 160 640 640 640______________________________________B blood inoculated pigs serum titres in IPMAWeeks post inoculation: 0 2 3 4 6______________________________________b 809 0 640 2560 2560 2560b 817 0 160 640 640 640b 818 0 160 640 640 640b 820 0 160 640 640 640b 822 0 640 2560 2560 10240b 826 0 640 640 640 10240B 830 0 640 640 640 2560B 834 0 160 640 2560 640______________________________________ See Table 2 for description of the experiment. All pigs were bled at regular intervals and all sera were tested in an immunoperoxidase-monolayer-assay (IPMA) for the detection of antibody directed against the Lelystad agent (LA).
TABLE 6______________________________________Experimental reproduction of MSD. No. of pigletslength at birth No. of LA.sup.1 in pigletsof alive dead deaths born died insow gestation (number Ab pos).sup.2 week 1 dead week 1______________________________________ 52 113 12(5) 3(2) 6 2 4965 116 3(0) 9(3) 2 4997 114 9(0) 1(0) 01305 116 7(0) 2(0) 1134 109 4(4) 7(4) 4 3941 117 7 101056 113 7(1) 3(0) 41065 115 9 2______________________________________ .sup.1 LA was isolated from lung, liver, spleen, kidney, or ascitic fluids. .sup.2 Antibodies directed against LA were detected in serum samples take before the piglets had sucked, or were detected in ascitic fluids of piglets born dead.
TABLE 7______________________________________Reactivity in IPMA of a collection of field sera from Europeand North-America tested with LA isolates from the Netherlands(NL1 and NL2), Germany (GE1 and GE2), and the United States(US1, US2 and US3).Isolates: NL1 NL2 GE1 GE2 US1 US2 US3______________________________________Sera from:The NetherlandsTH-187 3.5.sub.t 3.5 2.5 3.5 - - -TO-36 3.5 3.0 2.5 3.0 - 1.0 -GermanyBE-352 4.0 3.5 2.5 3.0 - 1.5 -BE-392 3.5 3.5 2.5 2.5 1.5 1.5 0.5NI-f2 2.5 1.5 2.0 2.5 - - -United KingdomPA-141615 4.0 3.0 3.0 3.5 - - -PA-141617 4.0 3.5 3.0 3.5 - 2.5 2.0PA-142440 3.5 3.0 2.5 3.5 - 2.0 2.5BelgiumPE-1960 4.5 4.5 3.0 4.0 1.5 - -FranceEA-2975 4.0 3.5 3.0 3.0 2.0 - -EA-2985 3.5 3.0 3.0 2.5 - - -United StatesSL-441 3.5 1.5 2.5 2.5 3.5 3.5 3.0SL-451 3.0 2.0 2.5 2.5 3.5 4.5 4.0AL-RP9577 1.5 - - 1.0 3.0 4.0 2.5AL-P10814/33 0.5 2.5 - - 2.5 3.5 3.0AL-4094A - - - - 1.0 2.0 0.5AL-7525 - - - - - 1.0 -JC-MN41 - - - - 1.0 3.5 1.0JC-MN44 - - - - 2.0 3.5 2.0JC-MN45 - - - - 2.0 3.5 2.5CanadaRB-16 2.5 - 3.0 2.0 3.0 3.5 -RB-19 1.0 - 1.0 - 2.5 1.5 -RB-22 1.5 - 2.0 2.5 2.5 3.5 -RB-23 - - - - - 3.0 -______________________________________ .sub.t = titre expressed as negative log; - = negative
TABLE 8______________________________________Reactivity in IPMA of a collection of experimental sera raisedagainst LA and SIRSV tested with LA isolates from theNetherlands (NL1 and NL2), Germany (GE1 and GE2), and theUnited States (US1, US2 and US3).Isolates: NL1 NL2 GE1 GE2 US1 US2 US3______________________________________ Sera: anti-LA:21 14 dpi 2.5.sup.t 2.0 2.5 3.0 1.5 2.0 1.5 28 dpi 4.0 3.5 3.5 4.0 - 2.5 1.5 42 dpi 4.0 3.5 3.0 3.5 1.5 2.5 2.023 14 dpi 3.0 2.0 2.5 3.0 1.0 2.0 1.0 28 dpi 3.5 3.5 3.5 4.0 1.5 2.0 2.0 42 dpi 4.0 4.0 3.0 4.0 - 2.5 2.525 14 dpi 2.5 2.0 2.5 3.0 1.5 2.0 1.0 28 dpi 4.0 3.5 4.0 3.5 - 1.5 2.0 42 dpi 3.5 4.0 3.5 3.5 1.5 2.0 2.029 14 dpi 3.5 3.5 3.0 3.5 - 2.0 1.5 28 dpi 3.5 3.5 3.0 3.5 - 2.5 2.0 42 dpi 4.0 3.5 3.5 4.0 1.5 2.5 2.5 anti- SISRV:2B 20 dpi - - - - 2.0 2.0 - 36 dpi - - - - 1.5 2.0 - 63 dpi - - - - 1.0 1.0 -9G 30 dpi - - - - 2.5 3.0 - 44 dpi - - - - 2.5 3.5 - 68 dpi - - - - 2.0 3.5 1.516W 25 dpi - - - - 2.0 3.0 - 40 dpi - - - - 2.0 3.0 - 64 dpi - - - - 2.5 2.5 1.516Y 36 dpi - - - - 1.0 3.0 1.0 64 dpi - - - - 2.5 3.0 -______________________________________ .sup.t = titer expressed as negative log; - = negative
TABLE 9__________________________________________________________________________Characteristics of the ORFs of Lelystad Virus. Calculated size of the number of Nucleotides No. of amino unmodified glycosylationORF (first-last) acids peptide (kDa) sites__________________________________________________________________________ORF1A 212-7399 2396 260.0 3 (SEQ ID NO: 2)ORF1B 7384-11772 1463 161.8 3 (SEQ ID NO: 3)ORF2 11786-12532 249 28.4 2 (SEQ ID NO: 4)ORF3 12394-13188 265 30.6 7 (SEQ ID NO: 5) 12556-13188 211 24.5 4 (SEQ ID NO: 6)ORF4 12936-13484 183 20.0 4 12981-13484 168 18.4 4 13068-13484 139 15.4 3ORF5 13484-14086 201 22.4 2 (SEQ ID NO: 7)ORF6 14077-14595 173 18.9 2 (SEQ ID NO: 8)ORF7 14588-14971 128 13.8 1 (SEQ ID NO: 9)__________________________________________________________________________
References
Boer, G. F. de, Back, W., and Osterhaus, A. D. M. E., (1990) An ELISA for detection of antibodies against influenza A nucleoprotein in human and various animal species, Arch. Virol. 115, 47-61.
Boursnell, M. E. G., Brown, T. D. K., and Binns, M. M., (1984) Sequence of the membrane protein gene from avian coronavirus IBV, Virus Res. 1, 303-314.
Boursnell, M. E. G., Brown, T. D. K., Foulds, I. J., Green, P. F., Tomley F. M., and Binns, M. M., (1987) Completion of the sequence of the genome of the coronavirus avian infectious bronchitis virus, J. Gen. Virol. 68, 57-77.
Brakke, M. K., (1967) In: Methods in Virology, Volume II, pp. 93-117 (Edited by K. Maramorosch and H. Koprowski) New York, Academic Press.
Bredenbeek, P. J., Pachuk, C. J., Noten, J. F. H., Charit e, J., Luytjes, W., Weiss, S. R., and Spaan, W. J. M., (1990) The primary structure and expression of the second open reading frame of the polymerase gene of coronavirus MHV-A59. Nucleic Acids Res. 18, 1825-1832.
Brenner, S., and Horne, R. W., (1959) A negative staining method for high resolution electron microscopy of viruses, Biochimica et Biophysica Acta 34, 103-110.
Brinton-Darnell, M., and Plagemann, P. G., (1975) Structure and chemical-physical characteristics of lactate dehydrogenase-elevating virus and its RNA, J. Virol. 16, 420-433.
Favaloro, J., Treisman, R. & Kamen, R., (1980) In: Methods in Enzymology, vol. 65, 718-749 (eds. Grossman, L. & Moldave, K.) Academic Press, New York.
Godeny, E. K., Speicher, D. W., and Brinton, M. A., (1990) Map location of lactate dehydrogenase-elevating virus (LDV) capsid protein (Vp1) gene, Virology, 177, 768-771.
Grist, N. R., Ross, C. A., and Bell, E. J., (1974) In: Diagnostic Methods in Clinical Virology, p. 120, Oxford, Blackwell Scientific Publications.
G ubler, U., and Hoffman, B. J., (1983) A simple and very efficient method for generating cDNA libraries, Gene 25, 263-269.
Hanahan, D., (1985) In: DNA Cloning I; A Practical Approach, Chapter 6, 109-135.
Hill, H., (1990) Overview and History of Mystery Swine Disease (Swine Infertility Respiratory Syndrome), In: Proceedings of the Mystery Swine Disease Committee Meeting, Oct. 6, 1990, Denver, Colo., Livestock Conservation Institute, Madison Wis., USA.
Hirsch, J. G. & Fedorko, M. E., (1968) Ultrastructure of human leucocytes after simultaneous fixation with glutaraldehyde and osmiumtetroxide and postfixation in uranylacetate, Journal of Cellular Biology 38, 615.
Horzinek, M. C., Maess, J., and Laufs, R., (1971) Studies on the substructure of togaviruses II. Analysis of equine arteritis, rubella, bovine viral diarrhea and hog cholera viruses, Arch. Gesamte Virusforsch. 33, 306-318.
Hyllseth, B., (1973) Structural proteins of equine arteritis virus, Arch. Gesamte Virusforsch. 40, 177-188.
Kasza, L., Shadduck, J. A., and Christoffinis, G. J., (1972) Establishment, viral susceptibility and biological characteristics of a swine kidney cell line SK-6, Res. Vet. Sci. 13, 46-51.
Loula, T., (1990) Clinical Presentation of Mystery Pig Disease in the breeding herd and suckling piglets, In: Proceedings of the Mystery Swine Disease Committee Meeting, Oct. 6, 1990, Denver, Colo., Livestock Conservation Institute, Madison, Wis., USA.
Masurel, N., (1976) Swine influenza virus and the recycling of influenza A viruses in man, Lancet ii, 244-247.
Mazancourt, A. de, Waxham, M. N., Nicholas, J. C., & Wolinsky, J. S., (1986) Antibody response to the rubella virus structural proteins in infants with the congenital rubella syndrome. J. Med. Virol. 19, 111-122.
Mengeling, W. L., and Lager, K. M., (1990) Mystery Pig Disease: Evidence and considerations for its etiology, In: Proceedings of the Mystery Swine Disease Committee Meeting, Oct. 6, 1990, Denver, Colo., Livestock Conservation Institute, Madison, Wis., USA.
Moormann, R. J. M., and Hulst, M. M., (1988) Hog cholera virus: identification and characterization of the viral RNA and virus-specific RNA synthesized in infected swine kidney cells, Virus Res. 11, 281-291.
Moormann, R. J. M., Warmerdam, P. A. M., van der Meer, B., Schaaper, W. M. M., Wensvoort, G., and Hulst, M. M., (1990) Molecular cloning and nucleotide sequence of hog cholera virus strain Brescia and mapping of the genomic region encoding envelope protein E1, Virology, 177, 184-198.
Oirschot, J. T. van, Houwers, D. J., Rziha, H. J., and Moonen, P. J. L. M., (1988) Development of an ELISA for detection of antibodies to glycoprotein I of Aujeszky's disease virus: a method for the serological differentiation between infected and vaccinated pigs, J. Virol. Meth. 22, 191-206.
Pearson, W. R., and Lipman, D. J., (1988) Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85, 2444-2448.
Reed, L. J., and Muench, H., (1938) A simple method of estimating fifty percent endpoints, Am. J. Hyg. 27, 493-497.
Rottier, P. J. M., Welling, G. W., Welling-Wester, S., Niesters, H. G. M., Lenstra, J. M., and van der Zeijst, B. A. M., (1986) Predicted membrane topology of the coronavirus protein E1. Biochemistry 25, 1335-1339.
Sambrook, J., Fritsch, E. F., and Maniatis, T., (1989) Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Lab., Cold Spring Harbor, N.Y.
Sethna, P. B., Hung, S.-L., and Brian, D. A., (1989) Coronavirus subgenomic minus-strand RNAs and the potential for mRNA replicons, Proc. Natl. Acad. Sci. USA, 86, 5626-5630.
Setzer, D. R., McGrogan, M., Nunberg, J. H. & Schimke, R. T., (1980) Size heterogeneity in the 3'-end of the dehydrofolate reductase messenger RNA's in mouse cells, Cell 22, 361-370.
Snijder, E. J., den Boon, J. A., Bredenbeek, P. J., Horzinek, M. C., Rijnbrand, R., and Spaan, W. J. M., (1990a) The carboxyl-terminal part of the putative Berne virus polymerase is expressed by ribosomal frameshifting and contains sequence motifs which indicate that toro- and coronaviruses are evolutionary related, Nucleic Acids Res. 18, 4535-4542.
Snijder, E. J., Horzinek, M. C., and Spaan, W. J. M., (1990b) A 3'-coterminal nested set of independently transcribed messenger RNAs is generated during Berne virus replication. J. Virol. 64, 355-363.
Spaan, W. J. M., Cavanagh, D., and Horzinek, M. C., (1988) Coronaviruses: structure and genome expression. J. Gen. Virol. 69, 2939-2952.
Strauss, W. M., (1987) Preparation of genomic DNA from mammalian tissue, In: Current protocols in molecular biology (eds. Ausubel F. M. et al.) 2.2.1 John Wiley & Sons, New York.
Terpstra, C., (1978) Detection of Border disease antigen in tissues of affected sheep and in cell cultures by immunofluorescence, Res. Vet. Sci. 25, 350-355.
Venable, J. H. & Coggeshall, R., (1965) A simplified lead citrate stain for use in electronmicroscopy, Journal of Cellular Biology 25, 407.
Vries, A. A. F. de, Chirnside, E. D., Bredenbeek, P. J., Gravestein, L. A., Horzinek, M. C., and Spaan, W. J. M., (1990) All subgenomic mRNAs of equine arteritis virus contain a common leader sequence, Nucleic Acids Res. 18, 3241-3247.
Wensvoort, G., and Terpstra, C., (1988) Bovine viral diarrhoea infections in piglets from sows vaccinated against swine fever with contaminated vaccine, Res. Vet. Sci. 45, 143-148.
Wensvoort, G., Terpstra, C., and Bloemraad, M., (1988) An enzyme immunoassay, employing monoclonal antibodies and detecting specifically antibodies against classical swine fever virus, Vet. Microbiol. 17, 129-140.
Wensvoort, G., Terpstra, C., Boonsta, J., Bloemraad, M., and Zaane, D. van, (1986) Production of monoclonal antibodies against swine fever virus and their use in laboratory diagnosis, Vet. Microbiol. 12, 101-108.
Wensvoort, G., Terpstra, C., and Kluyver, E. P. de, (1988) Characterization of porcine and some ruminant pestiviruses by cross-neutralization, Vet. Microbiol. 20, 291-306.
Westenbrink, F., Middel, W. G. J., Straver, P., and Leeuw, P. W. de, (1986) A blocking enzyme-linked immunosorbent assay (ELISA) for bovine virus diarrhoea virus serology, J. Vet. Med. B33, 354-361.
Westenbrink, F., Veldhuis, M. A., and Brinkhof, J. M. A., (1989) An enzyme-linked immunosorbent assay for detection of antibodies to porcine parvo virus, J. Virol. Meth. 23, 169-178.
Zeijst, B. A. M. van der, Horzinek, M. C., and Moenning, V., (1975) The genome of equine arteritis virus, Virology, 68, 418-425.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 9(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15108 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 212..7399(D) OTHER INFORMATION:(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 7384..11772(D) OTHER INFORMATION:(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 11786..12532(D) OTHER INFORMATION:(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 12394..13188(D) OTHER INFORMATION:(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 12936..13484(D) OTHER INFORMATION:(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 13484..14086(D) OTHER INFORMATION:(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 14077..14595(D) OTHER INFORMATION:(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 14588..14971(D) OTHER INFORMATION:(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GGGTATTCCCCCTACATACACGACACTTCTAGTGTTTGTGTACCTTGGAGGCGTGGGTAC60AGCCCCGCCCCACCCCTTGGCCCCTGTTCTAGCCCAACAGGTATCCTTCTCTCTCGGGGC120GAGTGCGCCGCCTGCTGCTCCCTTGCAGCGGGAAGGACCTCCCGAGTATTTCCGGAGAGC180ACCTGCTTTACGGGATCTCCACCCTTTAACCATGTCTGGGACGTTCTCCCG231GTGCATGTGCACCCCGGCTGCCCGGGTATTTTGGAACGCCGGCCAAGTCTTTTGCACACG291GTGTCTCAGTGCGCGGTCTCTTCTCTCTCCAGAGCTTCAGGACACTGACCTCGGTGCAGT351TGGCTTGTTTTACAAGCCTAGGGACAAGCTTCACTGGAAAGTCCCTATCGGCATCCCTCA411GGTGGAATGTACTCCATCCGGGTGCTGTTGGCTCTCAGCTGTTTTCCCTTTGGCGCGTAT471GACCTCCGGCAATCACAACTTCCTCCAACGACTTGTGAAGGTTGCTGATGTTTTGTACCG531TGACGGTTGCTTGGCACCTCGACACCTTCGTGAACTCCAAGTTTACGAGCGCGGCTGCAA591CTGGTACCCGATCACGGGGCCCGTGCCCGGGATGGGTTTGTTTGCGAACTCCATGCACGT651ATCCGACCAGCCGTTCCCTGGTGCCACCCATGTGTTGACTAACTCGCCTTTGCCTCAACA711GGCTTGTCGGCAGCCGTTCTGTCCATTTGAGGAGGCTCATTCTAGCGTGTACAGGTGGAA771GAAATTTGTGGTTTTCACGGACTCCTCCCTCAACGGTCGATCTCGCATGATGTGGACGCC831GGAATCCGATGATTCAGCCGCCCTGGAGGTACTACCGCCTGAGTTAGAACGTCAGGTCGA891AATCCTCATTCGGAGTTTTCCTGCTCATCACCCTGTCGACCTGGCCGACTGGGAGCTCAC951TGAGTCCCCTGAGAACGGTTTTTCCTTCAACACGTCTCATTCTTGCGGTCACCTTGTCCA1011GAACCCCGACGTGTTTGATGGCAAGTGCTGGCTCTCCTGCTTTTTGGGCCAGTCGGTCGA1071AGTGCGCTGCCATGAGGAACATCTAGCTGACGCCTTCGGTTACCAAACCAAGTGGGGCGT1131GCATGGTAAGTACCTCCAGCGCAGGCTTCAAGTTCGCGGCATTCGTGCTGTAGTCGATCC1191TGATGGTCCCATTCACGTTGAAGCGCTGTCTTGCCCCCAGTCTTGGATCAGGCACCTGAC1251TCTGGATGATGATGTCACCCCAGGATTCGTTCGCCTGACATCCCTTCGCATTGTGCCGAA1311CACAGAGCCTACCACTTCCCGGATCTTTCGGTTTGGAGCGCATAAGTGGTATGGCGCTGC1371CGGCAAACGGGCTCGTGCTAAGCGTGCCGCTAAAAGTGAGAAGGATTCGGCTCCCACCCC1431CAAGGTTGCCCTGCCGGTCCCCACCTGTGGAATTACCACCTACTCTCCACCGACAGACGG1491GTCTTGTGGTTGGCATGTCCTTGCCGCCATAATGAACCGGATGATAAATGGTGACTTCAC1551GTCCCCTCTGACTCAGTACAACAGACCAGAGGATGATTGGGCTTCTGATTATGATCTTGT1611TCAGGCGATTCAATGTCTACGACTGCCTGCTACCGTGGTTCGGAATCGCGCCTGTCCTAA1671CGCCAAGTACCTTATAAAACTTAACGGAGTTCACTGGGAGGTAGAGGTGAGGTCTGGAAT1731GGCTCCTCGCTCCCTTTCTCGTGAATGTGTGGTTGGCGTTTGCTCTGAAGGCTGTGTCGC1791ACCGCCTTATCCAGCAGACGGGCTACCTAAACGTGCACTCGAGGCCTTGGCGTCTGCTTA1851CAGACTACCCTCCGATTGTGTTAGCTCTGGTATTGCTGACTTTCTTGCTAATCCACCTCC1911TCAGGAATTCTGGACCCTCGACAAAATGTTGACCTCCCCGTCACCAGAGCGGTCCGGCTT1971CTCTAGTTTGTATAAATTACTATTAGAGGTTGTTCCGCAAAAATGCGGTGCCACGGAAGG2031GGCTTTCATCTATGCTGTTGAGAGGATGTTGAAGGATTGTCCGAGCTCCAAACAGGCCAT2091GGCCCTTCTGGCAAAAATTAAAGTTCCATCCTCAAAGGCCCCGTCTGTGTCCCTGGACGA2151GTGTTTCCCTACGGATGTTTTAGCCGACTTCGAGCCAGCATCTCAGGAAAGGCCCCAAAG2211TTCCGGCGCTGCTGTTGTCCTGTGTTCACCGGATGCAAAAGAGTTCGAGGAAGCAGCCCC2271RGAAGAAGTTCAAGAGAGTGGCCACAAGGCCGTCCACTCTGCACTCCTTGCCGAGGGTCC2331TAACAATGAGCAGGTACAGGTGGTTGCCGGTGAGCAACTGAAGCTCGGCGGTTGTGGTTT2391GGCAGTCGGGAATGCTCATGAAGGTGCTCTGGTCTCAGCTGGTCTAATTAACCTGGTAGG2451CGGGAATTTGTCCCCCTCAGACCCCATGAAAGAAAACATGCTCAATAGCCGGGAAGACGA2511ACCACTGGATTTGTCCCAACCAGCACCAGCTTCCACAACGACCCTTGTGAGAGAGCAAAC2571ACCCGACAACCCAGGTTCTGATGCCGGTGCCCTCCCCGTCACCGTTCGAGAATTTGTCCC2631GACGGGGCCTATACTCTGTCATGTTGAGCACTGCGGCACGGAGTCGGGCGACAGCAGTTC2691GCCTTTGGATCTATCTGATGCGCAAACCCTGGACCAGCCTTTAAATCTATCCCTGGCCGC2751TTGGCCAGTGAGGGCCACCGCGTCTGACCCTGGCTGGGTCCACGGTAGGCGCGAGCCTGT2811CTTTGTAAAGCCTCGAAATGCTTTCTCTGATGGCGATTCAGCCCTTCAGTTCGGGGAGCT2871TTCTGAATCCAGCTCTGTCATCGAGTTTGACCGGACAAAAGATGCTCCGGTGGTTGACGC2931CCCTGTCGACTTGACGACTTCGAACGAGGCCCTCTCTGTAGTCGATCCTTTCGAATTTGC2991CGAACTCAAGCGCCCGCGTTTCTCCGCACAAGCCTTAATTGACCGAGGCGGTCCACTTGC3051CGATGTCCATGCAAAAATAAAGAACCGGGTATATGAACAGTGCCTCCAAGCTTGTGAGCC3111CGGTAGTCGTGCAACCCCAGCCACCAGGGAGTGGCTCGACAAAATGTGGGATAGGGTGGA3171CATGAAAACTTGGCGCTGCACCTCGCAGTTCCAAGCTGGTCGCATTCTTGCGTCCCTCAA3231ATTCCTCCCTGACATGATTCAAGACACACCGCCTCCTGTTCCCAGGAAGAACCGAGCTAG3291TGACAATGCCGGCCTGAAGCAACTGGTGGCACAGTGGGATAGGAAATTGAGTGTGACCCC3351CCCCCCAAAACCGGTTGGGCCAGTGCTTGACCAGATCGTCCCTCCGCCTACGGATATCCA3411GCAAGAAGATGTCACCCCCTCCGATGGGCCACCCCATGCGCCGGATTTTCCTAGTCGAGT3471GAGCACGGGCGGGAGTTGGAAAGGCCTTATGCTTTCCGGCACCCGTCTCGCGGGGTCTAT3531CAGCCAGCGCCTTATGACATGGGTTTTTGAAGTTTTCTCCCACCTCCCAGCTTTTATGCT3591CACACTTTTCTCGCCGCGGGGCTCTATGGCTCCAGGTGATTGGTTGTTTGCAGGTGTCGT3651TTTACTTGCTCTCTTGCTCTGTCGTTCTTACCCGATACTCGGATGCCTTCCCTTATTGGG3711TGTCTTTTCTGGTTCTTTGCGGCGTGTTCGTCTGGGTGTTTTTGGTTCTTGGATGGCTTT3771TGCTGTATTTTTATTCTCGACTCCATCCAACCCAGTCGGTTCTTCTTGTGACCACGATTC3831GCCGGAGTGTCATGCTGAGCTTTTGGCTCTTGAGCAGCGCCAACTTTGGGAACCTGTGCG3891CGGCCTTGTGGTCGGCCCCTCAGGCCTCTTATGTGTCATTCTTGGCAAGTTACTCGGTGG3951GTCACGTTATCTCTGGCATGTTCTCCTACGTTTATGCATGCTTGCAGATTTGGCCCTTTC4011TCTTGTTTATGTGGTGTCCCAGGGGCGTTGTCACAAGTGTTGGGGAAAGTGTATAAGGAC4071AGCTCCTGCGGAGGTGGCTCTTAATGTATTTCCTTTCTCGCGCGCCACCCGTGTCTCTCT4131TGTATCCTTGTGTGATCGATTCCAAACGCCAAAAGGGGTTGATCCTGTGCACTTGGCAAC4191GGGTTGGCGCGGGTGCTGGCGTGGTGAGAGCCCCATCCATCAACCACACCAAAAGCCCAT4251AGCTTATGCCAATTTGGATGAAAAGAAAATGTCTGCCCAAACGGTGGTTGCTGTCCCATA4311CGATCCCAGTCAGGCTATCAAATGCCTGAAAGTTCTGCAGGCGGGAGGGGCCATCGTGGA4371CCAGCCTACACCTGAGGTCGTTCGTGTGTCCGAGATCCCCTTCTCAGCCCCATTTTTCCC4431AAAAGTTCCAGTCAACCCAGATTGCAGGGTTGTGGTAGATTCGGACACTTTTGTGGCTGC4491GGTTCGCTGCGGTTACTCGACAGCACAACTGGTYCTGGGCCGGGGCAACTTTGCCAAGTT4551AAATCAGACCCCCCCCAGGAACTCTATCTCCACCAAAACGACTGGTGGGGCCTCTTACAC4611CCTTGCTGTGGCTCAAGTGTCTGCGTGGACTCTTGTTCATTTCATCCTCGGTCTTTGGTT4671CACATCACCTCAAGTGTGTGGCCGAGGAACCGCTGACCCATGGTGTTCAAATCCTTTTTC4731ATATCCTACCTATGGCCCCGGAGTTGTGTGCTCCTCTCGACTTTGTGTGTCTGCCGACGG4791GGTCACCCTGCCATTGTTCTCAGCCGTGGCACAACTCTCCGGTAGAGAGGTGGGGATTTT4851TATTTTGGTGCTCGTCTCCTTGACTGCTTTGGCCCACCGCATGGCTCTTAAGGCAGACAT4911GTTAGTGGTCTTTTCGGCTTTTTGTGCTTACGCCTGGCCCATGAGCTCCTGGTTAATCTG4971CTTCTTTCCTATACTCTTGAAGTGGGTTACCCTTCACCCTCTTACTATGCTTTGGGTGCA5031CTCATTCTTGGTGTTTTGTCTGCCAGCAGCCGGCATCCTCTCACTAGGGATAACTGGCCT5091TCTTTGGGCAATTGGCCGCTTTACCCAGGTTGCCGGAATTATTACACCTTATGACATCCA5151CCAGTACACCTCTGGGCCACGTGGTGCAGCTGCTGTGGCCACAGCCCCAGAAGGCACTTA5211TATGGCCGCCGTCCGGAGAGCTGCTTTAACTGGGCGAACTTTAATCTTCACCCCGTCTGC5271AGTTGGATCCCTTCTCGAAGGTGCTTTCAGGACTCATAAACCCTGCCTTAACACCGTGAA5331TGTTGTAGGCTCTTCCCTTGGTTCCGGAGGGGTTTTCACCATTGATGGCAGAAGAACTGT5391CGTCACTGCTGCCCATGTGTTGAACGGCGACACAGCTAGAGTCACCGGCGACTCCTACAA5451CCGCATGCACACTTTCAAGACCAATGGTGATTATGCCTGGTCCCATGCTGATGACTGGCA5511GGGCGTTGCCCCTGTGGTCAAGGTTGCGAAGGGGTACCGCGGTCGTGCCTACTGGCAAAC5571ATCAACTGGTGTCGAACCCGGTATCATTGGGGAAGGGTTCGCCTTCTGTTTTACTAACTG5631CGGCGATTCGGGGTCACCCGTCATCTCAGAATCTGGTGATCTTATTGGAATCCACACCGG5691TTCAAACAAACTTGGTTCTGGTCTTGTGACAACCCCTGAAGGGGAGACCTGCACCATCAA5751AGAAACCAAGCTCTCTGACCTTTCCAGACATTTTGCAGGCCCAAGCGTTCCTCTTGGGGA5811CATTAAATTGAGTCCGGCCATCATCCCTGATGTAACATCCATTCCGAGTGACTTGGCATC5871GCTCCTAGCCTCCGTCCCTGTAGTGGAAGGCGGCCTCTCGACCGTTCAACTTTTGTGTGT5931CTTTTTCCTTCTCTGGCGCATGATGGGCCATGCCTGGACACCCATTGTTGCCGTGGGCTT5991CTTTTTGCTGAATGAAATTCTTCCAGCAGTTTTGGTCCGAGCCGTGTTTTCTTTTGCACT6051CTTTGTGCTTGCATGGGCCACCCCCTGGTCTGCACAGGTGTTGATGATTAGACTCCTCAC6111GGCATCTCTCAACCGCAACAAGCTTTCTCTGGCGTTCTACGCACTCGGGGGTGTCGTCGG6171TTTGGCAGCTGAAATCGGGACTTTTGCTGGCAGATTGTCTGAATTGTCTCAAGCTCTTTC6231GACATACTGCTTCTTACCTAGGGTCCTTGCTATGACCAGTTGTGTTCCCACCATCATCAT6291TGGTGGACTCCATACCCTCGGTGTGATTCTGTGGTTRTTCAAATACCGGTGCCTCCACAA6351CATGCTGGTTGGTGATGGGAGTTTTTCAAGCGCCTTCTTCCTACGGTATTTTGCAGAGGG6411TAATCTCAGAAAAGGTGTTTCACAGTCCTGTGGCATGAATAACGAGTCCCTAACGGCTGC6471TTTAGCTTGCAAGTTGTCACAGGCTGACCTTGATTTTTTGTCCAGCTTAACGAACTTCAA6531GTGCTTTGTATCTGCTTCAAACATGAAAAATGCTGCCGGCCAGTACATTGAAGCAGCGTA6591TGCCAAGGCCCTGCGCCAAGAGTTGGCCTCTCTAGTTCAGATTGACAAAATGAAAGGAGT6651TTTGTCCAAGCTCGAGGCCTTTGCTGAAACAGCCACCCCGTCCCTTGACATAGGTGACGT6711GATTGTTCTGCTTGGGCAACATCCTCACGGATCCATCCTCGATATTAATGTGGGGACTGA6771AAGGAAAACTGTGTCCGTGCAAGAGACCCGGAGCCTAGGCGGCTCCAAATTCAGTGTTTG6831TACTGTCGTGTCCAACACACCCGTGGACGCCTTRACCGGCATCCCACTCCAGACACCAAC6891CCCTCTTTTTGAGAATGGTCCGCGTCATCGCAGCGAGGAAGACGATCTTAAAGTCGAGAG6951GATGAAGAAACACTGTGTATCCCTCGGCTTCCACAACATCAATGGCAAAGTTTACTGCAA7011AATTTGGGACAAGTCTACCGGTGACACCTTTTACACGGATGATTCCCGGTACACCCAAGA7071CCATGCTTTTCAGGACAGGTCAGCCGACTACAGAGACAGGGACTATGAGGGTGTGCAAAC7131CACCCCCCAACAGGGATTTGATCCAAAGTCTGAAACCCCTGTTGGCACTGTTGTGATCGG7191CGGTATTACGTATAACAGGTATCTGATCAAAGGTAAGGAGGTTCTGGTCCCCAAGCCTGA7251CAACTGCCTTGAAGCTGCCAAGCTGTCCCTTGAGCAAGCTCTCGCTGGGATGGGCCAAAC7311TTGCGACCTTACAGCTGCCGAGGTGGAAAAGCTAAAGCGCATCATTAGTCAACTCCAAGG7371TTTGACCACTGAACAGGCTTTAAACTGTTAGCCGCCAGCGGCTTGACCCGCTGTGGCC7429GCGGCGGCCTAGTTGTGACTGAAACGGCGGTAAAAATTATAAAATACCACAGCAGAACTT7489TCACCTTAGGCCCTTTAGACCTAAAAGTCACTTCCGAGGTGGAGGTAAAGAAATCAACTG7549AGCAGGGCCACGCTGTTGTGGCAAACTTATGTTCCGGTGTCATCTTGATGAGACCTCACC7609CACCGTCCCTTGTCGACGTTCTTCTGAAACCCGGACTTGACACAATACCCGGCATTCAAC7669CAGGGCATGGGGCCGGGAATATGGGCGTGGACGGTTCTATTTGGGATTTTGAAACCGCAC7729CCACAAAGGCAGAACTCGAGTTATCCAAGCAAATAATCCAAGCATGTGAAGTTAGGCGCG7789GGGACGCCCCGAACCTCCAACTCCCTTACAAGCTCTATCCTGTTAGGGGGGATCCTGAGC7849GGCATAAAGGCCGCCTTATCAATACCAGGTTTGGAGATTTACCTTACAAAACTCCTCAAG7909ACACCAAGTCCGCAATCCACGCGGCTTGTTGCCTGCACCCCAACGGGGCCCCCGTGTCTG7969ATGGTAAATCCACACTAGGTACCACTCTTCAACATGGTTTCGAGCTTTATGTCCCTACTG8029TGCCCTATAGTGTCATGGAGTACCTTGATTCACGCCCTGACACCCCTTTTATGTGTACTA8089AACATGGCACTTCCAAGGCTGCTGCAGAGGACCTCCAAAAATACGACCTATCCACCCAAG8149GATTTGTCCTGCCTGGGGTCCTACGCCTAGTACGCAGATTCATCTTTGGCCATATTGGTA8209AGGCGCCGCCATTGTTCCTCCCATCAACCTATCCCGCCAAGAACTCTATGGCAGGGATCA8269ATGGCCAGAGGTTCCCAACAAAGGACGTTCAGAGCATACCTGAAATTGATGAAATGTGTG8329CCCGCGCTGTCAAGGAGAATTGGCAAACTGTGACACCTTGCACCCTCAAGAAACAGTACT8389GTTCCAAGCCCAAAACCAGGACCATCCTGGGCACCAACAACTTTATTGCCTTGGCTCACA8449GATCGGCGCTCAGTGGTGTCACCCAGGCATTCATGAAGAAGGCTTGGAAGTCCCCAATTG8509CCTTGGGGAAAAACAAATTCAAGGAGCTGCATTGCACTGTCGCCGGCAGGTGTCTTGAGG8569CCGACTTGGCCTCCTGTGACCGCAGCACCCCCGCCATTGTAAGATGGTTTGTTGCCAACC8629TCCTGTATGAACTTGCAGGATGTGAAGAGTACTTGCCTAGCTATGTGCTTAATTGCTGCC8689ATGACCTCGTGGCAACACAGGATGGTGCCTTCACAAAACGCGGTGGCCTGTCGTCCGGGG8749ACCCCGTCACCAGTGTGTCCAACACCGTATATTCACTGGTAATTTATGCCCAGCACATGG8809TATTGTCGGCCTTGAAAATGGGTCATGAAATTGGTCTTAAGTTCCTCGAGGAACAGCTCA8869AGTTCGAGGACCTCCTTGAAATTCAGCCTATGTTGGTATACTCTGATGATCTTGTCTTGT8929ACGCTGAAAGACCCACMTTTCCCAATTACCACTGGTGGGTCGAGCACCTTGACCTGATGC8989TGGGTTTCAGAACGGACCCAAAGAAAACCGTCATAACTGATAAACCCAGCTTCCTCGGCT9049GCAGAATTGAGGCAGGGCGACAGCTAGTCCCCAATCGCGACCGCATCCTGGCTGCTCTTG9109CATATCACATGAAGGCGCAGAACGCCTCAGAGTATTATGCGTCTGCTGCCGCAATCCTGA9169TGGATTCATGTGCTTGCATTGACCATGACCCTGAGTGGTATGAGGACCTCATCTGCGGTA9229TTGCCCGGTGCGCCCGCCAGGATGGTTATAGCTTCCCAGGTCCGGCATTTTTCATGTCCA9289TGTGGGAGAAGCTGAGAAGTCATAATGAAGGGAAGAAATTCCGCCACTGCGGCATCTGCG9349ACGCCAAAGCCGACTATGCGTCCGCCTGTGGGCTTGATTTGTGTTTGTTCCATTCGCACT9409TTCATCAACACTGCCCYGTCACTCTGAGCTGCGGTCACCATGCCGGTTCAAAGGAATGTT9469CGCAGTGTCAGTCACCTGTTGGGGCTGGCAGATCCCCTCTTGATGCCGTGCTAAAACAAA9529TTCCATACAAACCTCCTCGTACTGTCATCATGAAGGTGGGTAATAAAACAACGGCCCTCG9589ATCCGGGGAGGTACCAGTCCCGTCGAGGTCTCGTTGCAGTCAAGAGGGGTATTGCAGGCA9649ATGAAGTTGATCTTTCTGATGGRGACTACCAAGTGGTGCCTCTTTTGCCGACTTGCAAAG9709ACATAAACATGGTGAAGGTGGCTTGCAATGTACTACTCAGCAAGTTCATAGTAGGGCCAC9769CAGGTTCCGGAAAGACCACCTGGCTACTGAGTCAAGTCCAGGACGATGATGTCATTTACA9829YACCCACCCATCAGACTATGTTTGATATAGTCAGTGCTCTCAAAGTTTGCAGGTATTCCA9889TTCCAGGAGCCTCAGGACTCCCTTTCCCACCACCTGCCAGGTCCGGGCCGTGGGTTAGGC9949TTATTGCCAGCGGGCACGTCCCTGGCCGAGTATCATACCTCGATGAGGCTGGATATTGTA10009ATCATCTGGACATTCTTAGACTGCTTTCCAAAACACCCCTTGTGTGTTTGGGTGACCTTC10069AGCAACTTCACCCTGTCGGCTTTGATTCCTACTGTTATGTGTTCGATCAGATGCCTCAGA10129AGCAGCTGACCACTATTTACAGATTTGGCCCTAACATCTGCGCACGCATCCAGCCTTGTT10189ACAGGGAGAAACTTGAATCTAAGGCTAGGAACACTAGGGTGGTTTTTACCACCCGGCCTG10249TGGCCTTTGGTCAGGTGCTGACACCATACCATAAAGATCGCATCGGCTCTGCGATAACCA10309TAGATTCATCCCAGGGGGCCACCTTTGATATTGTGACATTGCATCTACCATCGCCAAAGT10369CCCTAAATAAATCCCGAGCACTTGTAGCCATCACTCGGGCAAGACACGGGTTGTTCATTT10429ATGACCCTCATAACCAGCTCCAGGAGTTTTTCAACTTAACCCCTGAGCGCACTGATTGTA10489ACCTTGTGTTCAGCCGTGGGGATGAGCTGGTAGTTCTGAATGCGGATAATGCAGTCACAA10549CTGTAGCGAAGGCCCTTGAGACAGGTCCATCTCGATTTCGAGTATCAGACCCGAGGTGCA10609AGTCTCTCTTAGCCGCTTGTTCGGCCAGTCTGGAAGGGAGCTGTATGCCACTACCGCAAG10669TGGCACATAACCTGGGGTTTTACTTTTCCCCGGACAGTCCAACATTTGCACCTCTGCCAA10729AAGAGTTGGCGCCACATTGGCCAGTGGTTACCCACCAGAATAATCGGGCGTGGCCTGATC10789GACTTGTCGCTAGTATGCGCCCAATTGATGCCCGCTACAGCAAGCCAATGGTCGGTGCAG10849GGTATGTGGTCGGGCCGTCCACCTTTCTTGGTACTCCTGGTGTGGTGTCATACTATCTCA10909CACTATACATCAGGGGTGAGCCCCAGGCCTTGCCAGAAACACTCGTTTCAACAGGGCGTA10969TAGCCACAGATTGTCGGGAGTATCTCGACGCGGCTGAGGAAGAGGCAGCAAAAGAACTCC11029CCCACGCATTCATTGGCGATGTCAAAGGTACCACGGTTGGGGGGTGTCATCACATTACAT11089CAAAATACCTACCTAGGTCCCTGCCTAAGGACTCTGTTGCCGTAGTTGGAGTAAGTTCGC11149CCGGCAGGGCTGCTAAAGCCGTGTGCACTCTCACCGATGTGTACCTCCCCGAACTCCGGC11209CATATCTGCAACCTGAGACGGCATCAAAATGCTGGAAACTCAAATTAGACTTCAGGGACG11269TCCGACTAATGGTCTGGAAAGGAGCCACCGCCTATTTCCAGTTGGAAGGGCTTACATGGT11329CGGCGCTGCCCGACTATGCCAGGTTYATTCAGCTGCCCAAGGATGCCGTTGTATACATTG11389ATCCGTGTATAGGACCGGCAACAGCCAACCGTAAGGTCGTGCGAACCACAGACTGGCGGG11449CCGACCTGGCAGTGACACCGTATGATTACGGTGCCCAGAACATTTTGACAACAGCCTGGT11509TCGAGGACCTCGGGCCGCAGTGGAAGATTTTGGGGTTGCAGCCCTTTAGGCGAGCATTTG11569GCTTTGAAAACACTGAGGATTGGGCAATCCTTGCACGCCGTATGAATGACGGCAAGGACT11629ACACTGACTATAACTGGAACTGTGTTCGAGAACGCCCACACGCCATCTACGGGCGTGCTC11689GTGACCATACGTATCATTTTGCCCCTGGCACAGAATTGCAGGTAGAGCTAGGTAAACCCC11749GGCTGCCGCCTGGGCAAGTGCCGTGAATTCGGGGTGATGCAATGGGGTCACTG11802TGGAGTAAAATCAGCCAGCTGTTCGTGGACGCCTTCACTGAGTTCCTTGTTAGTGTGGTT11862GATATTGYCATTTTCCTTGCCATACTGTTTGGGTTCACCGTCGCAGGATGGTTACTGGTC11922TTTCTTCTCAGAGTGGTTTGCTCCGCGCTTCTCCGTTCGCGCTCTGCCATTCACTCTCCC11982GAACTATCGAAGGTCCTATGAAGGCTTGTTGCCCAACTGCAGACCGGATGTCCCACAATT12042TGCAGTCAAGCACCCATTGGGYATGTTTTGGCACATGCGAGTTTCCCACTTGATTGATGA12102GRTGGTCTCTCGTCGCATTTACCAGACCATGGAACATTCAGGTCAAGCGGCCTGGAAGCA12162GGTGGTTGGTGAGGCCACTCTCACGAAGCTGTCAGGGCTCGATATAGTTACTCATTTCCA12222ACACCTGGCCGCAGTGGAGGCGGATTCTTGCCGCTTTCTCAGCTCACGACTCGTGATGCT12282AAAAAATCTTGCCGTTGGCAATGTGAGCCTACAGTACAACACCACGTTGGACCGCGTTGA12342GCTCATCTTCCCCACGCCAGGTACGAGGCCCAAGTTGACCGATTTCAGACAATGGCTCAT12402CAGTGTGCACGCTTCCATTTTTTCCTCTGTGGCTTCATCTGTTACCTTGTTCATAGTGCT12462TTGGCTTCGAATTCCAGCTCTACGCTATGTTTTTGGTTTCCATTGGCCCACGGCAACACA12522TCATTCGAGCTGACCATCAACTACACCATATGCATGCCCTGTTCTACCAGTCAAGCGGCT12582CGCCAAAGGCTCGAGCCCGGTCGTAACATGTGGTGCAAAATAGGGCATGACAGGTGTGAG12642GAGCGTGACCATGATGAGTTGTTAATGTCCATCCCGTCCGGGTACGACAACCTCAAACTT12702GAGGGTTATTATGCTTGGCTGGCTTTTTTGTCCTTTTCCTACGCGGCCCAATTCCATCCG12762GAGTTGTTCGGGATAGGGAATGTGTCGCGCGTCTTCGTGGACAAGCGACACCAGTTCATT12822TGTGCCGAGCATGATGGACACAATTCAACCGTATCTACCGGACACAACATCTCCGCATTA12882TATGCGGCATATTACCACCACCAAATAGACGGGGGCAATTGGTTCCATTTGGAATGGCTG12942CGGCCACTCTTTTCTTCCTGGCTGGTGCTCAACATATCATGGTTTCTGAGGCGTTCGCCT13002GTAAGCCCTGTTTCTCGACGCATCTATCAGATATTGAGACCAACACGACCGCGGCTGCCG13062GTTTCATGGTCCTTCAGGACATCAATTGTTTCCGACCTCACGGGGTCTCAGCAGCGCAAG13122AGAAAATTTCCTTCGGAAAGTCGTCCCAATGTCGTGAAGCCGTCGGTACTCCCCAGTACA13182TCACGATAACGGCTAACGTGACCGACGAATCATACTTGTACAACGCGGACCTGCTG13238ATGCTTTCTGCGTGCCTTTTCTACGCCTCAGAAATGAGCGAGAAAGGCTTCAAAGTCATC13298TTTGGGAATGTCTCTGGCGTTGTTTCTGCTTGTGTCAATTTCACAGATTATGTGGCCCAT13358GTGACCCAACATACCCAGCAGCATCATCTGGTAATTGATCACATTCGGTTGCTGCATTTC13418CTGACACCATCTGCAATGAGGTGGGCTACAACCATTGCTTGTTTGTTCGCCATTCTCTTG13478GCAATATGAGATGTTCTCACAAATTGGGGCGTTTCTTGACTCCGCACTCTTGCTTC13534TGGTGGCTTTTTTTGCTGTGTACCGGCTTGTCCTGGTCCTTTGCCGATGGCAACGGCGAC13594AGCTCGACATACCAATACATATATAACTTGACGATATGCGAGCTGAATGGGACCGACTGG13654TTGTCCAGCCATTTTGGTTGGGCAGTCGAGACCTTTGTGCTTTACCCGGTTGCCACTCAT13714ATCCTCTCACTGGGTTTTCTCACAACAAGCCATTTTTTTGACGCGCTCGGTCTCGGCGCT13774GTATCCACTGCAGGATTTGTTGGCGGGCGGTACGTACTCTGCAGCGTCTACGGCGCTTGT13834GCTTTCGCAGCGTTCGTATGTTTTGTCATCCGTGCTGCTAAAAATTGCATGGCCTGCCGC13894TATGCCCGTACCCGGTTTACCAACTTCATTGTGGACGACCGGGGGAGAGTTCATCGATGG13954AAGTCTCCAATAGTGGTAGAAAAATTGGGCAAAGCCGAAGTCGATGGCAACCTCGTCACC14014ATCAAACATGTCGTCCTCGAAGGGGTTAAAGCTCAACCCTTGACGAGGACTTCGGCTGAG14074CAATGGGAGGCCTAGACGATTTTTGCAACGATCCTATCGCCGCACAAAAGCT14126CGTGCTAGCCTTTAGCATCACATACACACCTATAATGATATACGCCCTTAAGGTGTCACG14186CGGCCGACTCCTGGGGCTGTTGCACATCCTAATATTTCTGAACTGTTCCTTTACATTCGG14246ATACATGACATATGTGCATTTTCAATCCACCAACCGTGTCGCACTTACCCTGGGGGCTGT14306TGTCGCCCTTCTGTGGGGTGTTTACAGCTTCACAGAGTCATGGAAGTTTATCACTTCCAG14366ATGCAGATTGTGTTGCCTTGGCCGGCGATACATTCTGGCCCCTGCCCATCACGTAGAAAG14426TGCTGCAGGTCTCCATTCAATCTCAGCGTCTGGTAACCGAGCATACGCTGTGAGAAAGCC14486CGGACTAACATCAGTGAACGGCACTCTAGTACCAGGACTTCGGAGCCTCGTGCTGGGCGG14546CAAACGAGCTGTTAAACGAGGAGTGGTTAACCTCGTCAAGTATGGCCGGTAAAAACCAG14605AGCCAGAAGAAAAAGAAAAGTACAGCTCCGATGGGGAATGGCCAGCCAGTCAATCAACTG14665TGCCAGTTGCTGGGTGCAATGATAAAGTCCCAGCGCCAGCAACCTAGGGGAGGACAGGCY14725AAAAAGAAAAAGCCTGAGAAGCCACATTTTCCCCTGGCTGCTGAAGATGACATCCGGCAC14785CACCTCACCCAGACTGAACGCTCCCTCTGCTTGCAATCGATCCAGACGGCTTTCAATCAA14845GGCGCAGGAACTGCGTCRCTTTCATCCAGCGGGAAGGTCAGTTTTCAGGTTGAGTTTATG14905CTGCCGGTTGCTCATACAGTGCGCCTGATTCGCGTGACTTCTACATCCGCCAGTCAGGGT14965GCAAGTTAATTTGACAGTCAGGTGAATGGCCGCGATGGCGTGTGGCCTCTGAGTCA15021CCTATTCAATTAGGGCGATCACATGGGGGTCATACTTAATTCAGGCAGGAACCATGTGAC15081CGAAATTAAAAAAAAAAAAAAAAAAAA15108(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2396 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetSerGlyThrPheSerArgCysMetCysThrProAlaAlaArgVal151015PheTrpAsnAlaGlyGlnValPheCysThrArgCysLeuSerAlaArg202530SerLeuLeuSerProGluLeuGlnAspThrAspLeuGlyAlaValGly354045LeuPheTyrLysProArgAspLysLeuHisTrpLysValProIleGly505560IleProGlnValGluCysThrProSerGlyCysCysTrpLeuSerAla65707580ValPheProLeuAlaArgMetThrSerGlyAsnHisAsnPheLeuGln859095ArgLeuValLysValAlaAspValLeuTyrArgAspGlyCysLeuAla100105110ProArgHisLeuArgGluLeuGlnValTyrGluArgGlyCysAsnTrp115120125TyrProIleThrGlyProValProGlyMetGlyLeuPheAlaAsnSer130135140MetHisValSerAspGlnProPheProGlyAlaThrHisValLeuThr145150155160AsnSerProLeuProGlnGlnAlaCysArgGlnProPheCysProPhe165170175GluGluAlaHisSerSerValTyrArgTrpLysLysPheValValPhe180185190ThrAspSerSerLeuAsnGlyArgSerArgMetMetTrpThrProGlu195200205SerAspAspSerAlaAlaLeuGluValLeuProProGluLeuGluArg210215220GlnValGluIleLeuIleArgSerPheProAlaHisHisProValAsp225230235240LeuAlaAspTrpGluLeuThrGluSerProGluAsnGlyPheSerPhe245250255AsnThrSerHisSerCysGlyHisLeuValGlnAsnProAspValPhe260265270AspGlyLysCysTrpLeuSerCysPheLeuGlyGlnSerValGluVal275280285ArgCysHisGluGluHisLeuAlaAspAlaPheGlyTyrGlnThrLys290295300TrpGlyValHisGlyLysTyrLeuGlnArgArgLeuGlnValArgGly305310315320IleArgAlaValValAspProAspGlyProIleHisValGluAlaLeu325330335SerCysProGlnSerTrpIleArgHisLeuThrLeuAspAspAspVal340345350ThrProGlyPheValArgLeuThrSerLeuArgIleValProAsnThr355360365GluProThrThrSerArgIlePheArgPheGlyAlaHisLysTrpTyr370375380GlyAlaAlaGlyLysArgAlaArgAlaLysArgAlaAlaLysSerGlu385390395400LysAspSerAlaProThrProLysValAlaLeuProValProThrCys405410415GlyIleThrThrTyrSerProProThrAspGlySerCysGlyTrpHis420425430ValLeuAlaAlaIleMetAsnArgMetIleAsnGlyAspPheThrSer435440445ProLeuThrGlnTyrAsnArgProGluAspAspTrpAlaSerAspTyr450455460AspLeuValGlnAlaIleGlnCysLeuArgLeuProAlaThrValVal465470475480ArgAsnArgAlaCysProAsnAlaLysTyrLeuIleLysLeuAsnGly485490495ValHisTrpGluValGluValArgSerGlyMetAlaProArgSerLeu500505510SerArgGluCysValValGlyValCysSerGluGlyCysValAlaPro515520525ProTyrProAlaAspGlyLeuProLysArgAlaLeuGluAlaLeuAla530535540SerAlaTyrArgLeuProSerAspCysValSerSerGlyIleAlaAsp545550555560PheLeuAlaAsnProProProGlnGluPheTrpThrLeuAspLysMet565570575LeuThrSerProSerProGluArgSerGlyPheSerSerLeuTyrLys580585590LeuLeuLeuGluValValProGlnLysCysGlyAlaThrGluGlyAla595600605PheIleTyrAlaValGluArgMetLeuLysAspCysProSerSerLys610615620GlnAlaMetAlaLeuLeuAlaLysIleLysValProSerSerLysAla625630635640ProSerValSerLeuAspGluCysPheProThrAspValLeuAlaAsp645650655PheGluProAlaSerGlnGluArgProGlnSerSerGlyAlaAlaVal660665670ValLeuCysSerProAspAlaLysGluPheGluGluAlaAlaXaaGlu675680685GluValGlnGluSerGlyHisLysAlaValHisSerAlaLeuLeuAla690695700GluGlyProAsnAsnGluGlnValGlnValValAlaGlyGluGlnLeu705710715720LysLeuGlyGlyCysGlyLeuAlaValGlyAsnAlaHisGluGlyAla725730735LeuValSerAlaGlyLeuIleAsnLeuValGlyGlyAsnLeuSerPro740745750SerAspProMetLysGluAsnMetLeuAsnSerArgGluAspGluPro755760765LeuAspLeuSerGlnProAlaProAlaSerThrThrThrLeuValArg770775780GluGlnThrProAspAsnProGlySerAspAlaGlyAlaLeuProVal785790795800ThrValArgGluPheValProThrGlyProIleLeuCysHisValGlu805810815HisCysGlyThrGluSerGlyAspSerSerSerProLeuAspLeuSer820825830AspAlaGlnThrLeuAspGlnProLeuAsnLeuSerLeuAlaAlaTrp835840845ProValArgAlaThrAlaSerAspProGlyTrpValHisGlyArgArg850855860GluProValPheValLysProArgAsnAlaPheSerAspGlyAspSer865870875880AlaLeuGlnPheGlyGluLeuSerGluSerSerSerValIleGluPhe885890895AspArgThrLysAspAlaProValValAspAlaProValAspLeuThr900905910ThrSerAsnGluAlaLeuSerValValAspProPheGluPheAlaGlu915920925LeuLysArgProArgPheSerAlaGlnAlaLeuIleAspArgGlyGly930935940ProLeuAlaAspValHisAlaLysIleLysAsnArgValTyrGluGln945950955960CysLeuGlnAlaCysGluProGlySerArgAlaThrProAlaThrArg965970975GluTrpLeuAspLysMetTrpAspArgValAspMetLysThrTrpArg980985990CysThrSerGlnPheGlnAlaGlyArgIleLeuAlaSerLeuLysPhe99510001005LeuProAspMetIleGlnAspThrProProProValProArgLysAsn101010151020ArgAlaSerAspAsnAlaGlyLeuLysGlnLeuValAlaGlnTrpAsp1025103010351040ArgLysLeuSerValThrProProProLysProValGlyProValLeu104510501055AspGlnIleValProProProThrAspIleGlnGlnGluAspValThr106010651070ProSerAspGlyProProHisAlaProAspPheProSerArgValSer107510801085ThrGlyGlySerTrpLysGlyLeuMetLeuSerGlyThrArgLeuAla109010951100GlySerIleSerGlnArgLeuMetThrTrpValPheGluValPheSer1105111011151120HisLeuProAlaPheMetLeuThrLeuPheSerProArgGlySerMet112511301135AlaProGlyAspTrpLeuPheAlaGlyValValLeuLeuAlaLeuLeu114011451150LeuCysArgSerTyrProIleLeuGlyCysLeuProLeuLeuGlyVal115511601165PheSerGlySerLeuArgArgValArgLeuGlyValPheGlySerTrp117011751180MetAlaPheAlaValPheLeuPheSerThrProSerAsnProValGly1185119011951200SerSerCysAspHisAspSerProGluCysHisAlaGluLeuLeuAla120512101215LeuGluGlnArgGlnLeuTrpGluProValArgGlyLeuValValGly122012251230ProSerGlyLeuLeuCysValIleLeuGlyLysLeuLeuGlyGlySer123512401245ArgTyrLeuTrpHisValLeuLeuArgLeuCysMetLeuAlaAspLeu125012551260AlaLeuSerLeuValTyrValValSerGlnGlyArgCysHisLysCys1265127012751280TrpGlyLysCysIleArgThrAlaProAlaGluValAlaLeuAsnVal128512901295PheProPheSerArgAlaThrArgValSerLeuValSerLeuCysAsp130013051310ArgPheGlnThrProLysGlyValAspProValHisLeuAlaThrGly131513201325TrpArgGlyCysTrpArgGlyGluSerProIleHisGlnProHisGln133013351340LysProIleAlaTyrAlaAsnLeuAspGluLysLysMetSerAlaGln1345135013551360ThrValValAlaValProTyrAspProSerGlnAlaIleLysCysLeu136513701375LysValLeuGlnAlaGlyGlyAlaIleValAspGlnProThrProGlu138013851390ValValArgValSerGluIleProPheSerAlaProPhePheProLys139514001405ValProValAsnProAspCysArgValValValAspSerAspThrPhe141014151420ValAlaAlaValArgCysGlyTyrSerThrAlaGlnLeuXaaLeuGly1425143014351440ArgGlyAsnPheAlaLysLeuAsnGlnThrProProArgAsnSerIle144514501455SerThrLysThrThrGlyGlyAlaSerTyrThrLeuAlaValAlaGln146014651470ValSerAlaTrpThrLeuValHisPheIleLeuGlyLeuTrpPheThr147514801485SerProGlnValCysGlyArgGlyThrAlaAspProTrpCysSerAsn149014951500ProPheSerTyrProThrTyrGlyProGlyValValCysSerSerArg1505151015151520LeuCysValSerAlaAspGlyValThrLeuProLeuPheSerAlaVal152515301535AlaGlnLeuSerGlyArgGluValGlyIlePheIleLeuValLeuVal154015451550SerLeuThrAlaLeuAlaHisArgMetAlaLeuLysAlaAspMetLeu155515601565ValValPheSerAlaPheCysAlaTyrAlaTrpProMetSerSerTrp157015751580LeuIleCysPhePheProIleLeuLeuLysTrpValThrLeuHisPro1585159015951600LeuThrMetLeuTrpValHisSerPheLeuValPheCysLeuProAla160516101615AlaGlyIleLeuSerLeuGlyIleThrGlyLeuLeuTrpAlaIleGly162016251630ArgPheThrGlnValAlaGlyIleIleThrProTyrAspIleHisGln163516401645TyrThrSerGlyProArgGlyAlaAlaAlaValAlaThrAlaProGlu165016551660GlyThrTyrMetAlaAlaValArgArgAlaAlaLeuThrGlyArgThr1665167016751680LeuIlePheThrProSerAlaValGlySerLeuLeuGluGlyAlaPhe168516901695ArgThrHisLysProCysLeuAsnThrValAsnValValGlySerSer170017051710LeuGlySerGlyGlyValPheThrIleAspGlyArgArgThrValVal171517201725ThrAlaAlaHisValLeuAsnGlyAspThrAlaArgValThrGlyAsp173017351740SerTyrAsnArgMetHisThrPheLysThrAsnGlyAspTyrAlaTrp1745175017551760SerHisAlaAspAspTrpGlnGlyValAlaProValValLysValAla176517701775LysGlyTyrArgGlyArgAlaTyrTrpGlnThrSerThrGlyValGlu178017851790ProGlyIleIleGlyGluGlyPheAlaPheCysPheThrAsnCysGly179518001805AspSerGlySerProValIleSerGluSerGlyAspLeuIleGlyIle181018151820HisThrGlySerAsnLysLeuGlySerGlyLeuValThrThrProGlu1825183018351840GlyGluThrCysThrIleLysGluThrLysLeuSerAspLeuSerArg184518501855HisPheAlaGlyProSerValProLeuGlyAspIleLysLeuSerPro186018651870AlaIleIleProAspValThrSerIleProSerAspLeuAlaSerLeu187518801885LeuAlaSerValProValValGluGlyGlyLeuSerThrValGlnLeu189018951900LeuCysValPhePheLeuLeuTrpArgMetMetGlyHisAlaTrpThr1905191019151920ProIleValAlaValGlyPhePheLeuLeuAsnGluIleLeuProAla192519301935ValLeuValArgAlaValPheSerPheAlaLeuPheValLeuAlaTrp194019451950AlaThrProTrpSerAlaGlnValLeuMetIleArgLeuLeuThrAla195519601965SerLeuAsnArgAsnLysLeuSerLeuAlaPheTyrAlaLeuGlyGly197019751980ValValGlyLeuAlaAlaGluIleGlyThrPheAlaGlyArgLeuSer1985199019952000GluLeuSerGlnAlaLeuSerThrTyrCysPheLeuProArgValLeu200520102015AlaMetThrSerCysValProThrIleIleIleGlyGlyLeuHisThr202020252030LeuGlyValIleLeuTrpXaaPheLysTyrArgCysLeuHisAsnMet203520402045LeuValGlyAspGlySerPheSerSerAlaPhePheLeuArgTyrPhe205020552060AlaGluGlyAsnLeuArgLysGlyValSerGlnSerCysGlyMetAsn2065207020752080AsnGluSerLeuThrAlaAlaLeuAlaCysLysLeuSerGlnAlaAsp208520902095LeuAspPheLeuSerSerLeuThrAsnPheLysCysPheValSerAla210021052110SerAsnMetLysAsnAlaAlaGlyGlnTyrIleGluAlaAlaTyrAla211521202125LysAlaLeuArgGlnGluLeuAlaSerLeuValGlnIleAspLysMet213021352140LysGlyValLeuSerLysLeuGluAlaPheAlaGluThrAlaThrPro2145215021552160SerLeuAspIleGlyAspValIleValLeuLeuGlyGlnHisProHis216521702175GlySerIleLeuAspIleAsnValGlyThrGluArgLysThrValSer218021852190ValGlnGluThrArgSerLeuGlyGlySerLysPheSerValCysThr219522002205ValValSerAsnThrProValAspAlaXaaThrGlyIleProLeuGln221022152220ThrProThrProLeuPheGluAsnGlyProArgHisArgSerGluGlu2225223022352240AspAspLeuLysValGluArgMetLysLysHisCysValSerLeuGly224522502255PheHisAsnIleAsnGlyLysValTyrCysLysIleTrpAspLysSer226022652270ThrGlyAspThrPheTyrThrAspAspSerArgTyrThrGlnAspHis227522802285AlaPheGlnAspArgSerAlaAspTyrArgAspArgAspTyrGluGly229022952300ValGlnThrThrProGlnGlnGlyPheAspProLysSerGluThrPro2305231023152320ValGlyThrValValIleGlyGlyIleThrTyrAsnArgTyrLeuIle232523302335LysGlyLysGluValLeuValProLysProAspAsnCysLeuGluAla234023452350AlaLysLeuSerLeuGluGlnAlaLeuAlaGlyMetGlyGlnThrCys235523602365AspLeuThrAlaAlaGluValGluLysLeuLysArgIleIleSerGln237023752380LeuGlnGlyLeuThrThrGluGlnAlaLeuAsnCys238523902395(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1463 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:ThrGlyPheLysLeuLeuAlaAlaSerGlyLeuThrArgCysGlyArg151015GlyGlyLeuValValThrGluThrAlaValLysIleIleLysTyrHis202530SerArgThrPheThrLeuGlyProLeuAspLeuLysValThrSerGlu354045ValGluValLysLysSerThrGluGlnGlyHisAlaValValAlaAsn505560LeuCysSerGlyValIleLeuMetArgProHisProProSerLeuVal65707580AspValLeuLeuLysProGlyLeuAspThrIleProGlyIleGlnPro859095GlyHisGlyAlaGlyAsnMetGlyValAspGlySerIleTrpAspPhe100105110GluThrAlaProThrLysAlaGluLeuGluLeuSerLysGlnIleIle115120125GlnAlaCysGluValArgArgGlyAspAlaProAsnLeuGlnLeuPro130135140TyrLysLeuTyrProValArgGlyAspProGluArgHisLysGlyArg145150155160LeuIleAsnThrArgPheGlyAspLeuProTyrLysThrProGlnAsp165170175ThrLysSerAlaIleHisAlaAlaCysCysLeuHisProAsnGlyAla180185190ProValSerAspGlyLysSerThrLeuGlyThrThrLeuGlnHisGly195200205PheGluLeuTyrValProThrValProTyrSerValMetGluTyrLeu210215220AspSerArgProAspThrProPheMetCysThrLysHisGlyThrSer225230235240LysAlaAlaAlaGluAspLeuGlnLysTyrAspLeuSerThrGlnGly245250255PheValLeuProGlyValLeuArgLeuValArgArgPheIlePheGly260265270HisIleGlyLysAlaProProLeuPheLeuProSerThrTyrProAla275280285LysAsnSerMetAlaGlyIleAsnGlyGlnArgPheProThrLysAsp290295300ValGlnSerIleProGluIleAspGluMetCysAlaArgAlaValLys305310315320GluAsnTrpGlnThrValThrProCysThrLeuLysLysGlnTyrCys325330335SerLysProLysThrArgThrIleLeuGlyThrAsnAsnPheIleAla340345350LeuAlaHisArgSerAlaLeuSerGlyValThrGlnAlaPheMetLys355360365LysAlaTrpLysSerProIleAlaLeuGlyLysAsnLysPheLysGlu370375380LeuHisCysThrValAlaGlyArgCysLeuGluAlaAspLeuAlaSer385390395400CysAspArgSerThrProAlaIleValArgTrpPheValAlaAsnLeu405410415LeuTyrGluLeuAlaGlyCysGluGluTyrLeuProSerTyrValLeu420425430AsnCysCysHisAspLeuValAlaThrGlnAspGlyAlaPheThrLys435440445ArgGlyGlyLeuSerSerGlyAspProValThrSerValSerAsnThr450455460ValTyrSerLeuValIleTyrAlaGlnHisMetValLeuSerAlaLeu465470475480LysMetGlyHisGluIleGlyLeuLysPheLeuGluGluGlnLeuLys485490495PheGluAspLeuLeuGluIleGlnProMetLeuValTyrSerAspAsp500505510LeuValLeuTyrAlaGluArgProXaaPheProAsnTyrHisTrpTrp515520525ValGluHisLeuAspLeuMetLeuGlyPheArgThrAspProLysLys530535540ThrValIleThrAspLysProSerPheLeuGlyCysArgIleGluAla545550555560GlyArgGlnLeuValProAsnArgAspArgIleLeuAlaAlaLeuAla565570575TyrHisMetLysAlaGlnAsnAlaSerGluTyrTyrAlaSerAlaAla580585590AlaIleLeuMetAspSerCysAlaCysIleAspHisAspProGluTrp595600605TyrGluAspLeuIleCysGlyIleAlaArgCysAlaArgGlnAspGly610615620TyrSerPheProGlyProAlaPhePheMetSerMetTrpGluLysLeu625630635640ArgSerHisAsnGluGlyLysLysPheArgHisCysGlyIleCysAsp645650655AlaLysAlaAspTyrAlaSerAlaCysGlyLeuAspLeuCysLeuPhe660665670HisSerHisPheHisGlnHisCysXaaValThrLeuSerCysGlyHis675680685HisAlaGlySerLysGluCysSerGlnCysGlnSerProValGlyAla690695700GlyArgSerProLeuAspAlaValLeuLysGlnIleProTyrLysPro705710715720ProArgThrValIleMetLysValGlyAsnLysThrThrAlaLeuAsp725730735ProGlyArgTyrGlnSerArgArgGlyLeuValAlaValLysArgGly740745750IleAlaGlyAsnGluValAspLeuSerAspXaaAspTyrGlnValVal755760765ProLeuLeuProThrCysLysAspIleAsnMetValLysValAlaCys770775780AsnValLeuLeuSerLysPheIleValGlyProProGlySerGlyLys785790795800ThrThrTrpLeuLeuSerGlnValGlnAspAspAspValIleTyrXaa805810815ProThrHisGlnThrMetPheAspIleValSerAlaLeuLysValCys820825830ArgTyrSerIleProGlyAlaSerGlyLeuProPheProProProAla835840845ArgSerGlyProTrpValArgLeuIleAlaSerGlyHisValProGly850855860ArgValSerTyrLeuAspGluAlaGlyTyrCysAsnHisLeuAspIle865870875880LeuArgLeuLeuSerLysThrProLeuValCysLeuGlyAspLeuGln885890895GlnLeuHisProValGlyPheAspSerTyrCysTyrValPheAspGln900905910MetProGlnLysGlnLeuThrThrIleTyrArgPheGlyProAsnIle915920925CysAlaArgIleGlnProCysTyrArgGluLysLeuGluSerLysAla930935940ArgAsnThrArgValValPheThrThrArgProValAlaPheGlyGln945950955960ValLeuThrProTyrHisLysAspArgIleGlySerAlaIleThrIle965970975AspSerSerGlnGlyAlaThrPheAspIleValThrLeuHisLeuPro980985990SerProLysSerLeuAsnLysSerArgAlaLeuValAlaIleThrArg99510001005AlaArgHisGlyLeuPheIleTyrAspProHisAsnGlnLeuGlnGlu101010151020PhePheAsnLeuThrProGluArgThrAspCysAsnLeuValPheSer1025103010351040ArgGlyAspGluLeuValValLeuAsnAlaAspAsnAlaValThrThr104510501055ValAlaLysAlaLeuGluThrGlyProSerArgPheArgValSerAsp106010651070ProArgCysLysSerLeuLeuAlaAlaCysSerAlaSerLeuGluGly107510801085SerCysMetProLeuProGlnValAlaHisAsnLeuGlyPheTyrPhe109010951100SerProAspSerProThrPheAlaProLeuProLysGluLeuAlaPro1105111011151120HisTrpProValValThrHisGlnAsnAsnArgAlaTrpProAspArg112511301135LeuValAlaSerMetArgProIleAspAlaArgTyrSerLysProMet114011451150ValGlyAlaGlyTyrValValGlyProSerThrPheLeuGlyThrPro115511601165GlyValValSerTyrTyrLeuThrLeuTyrIleArgGlyGluProGln117011751180AlaLeuProGluThrLeuValSerThrGlyArgIleAlaThrAspCys1185119011951200ArgGluTyrLeuAspAlaAlaGluGluGluAlaAlaLysGluLeuPro120512101215HisAlaPheIleGlyAspValLysGlyThrThrValGlyGlyCysHis122012251230HisIleThrSerLysTyrLeuProArgSerLeuProLysAspSerVal123512401245AlaValValGlyValSerSerProGlyArgAlaAlaLysAlaValCys125012551260ThrLeuThrAspValTyrLeuProGluLeuArgProTyrLeuGlnPro1265127012751280GluThrAlaSerLysCysTrpLysLeuLysLeuAspPheArgAspVal128512901295ArgLeuMetValTrpLysGlyAlaThrAlaTyrPheGlnLeuGluGly130013051310LeuThrTrpSerAlaLeuProAspTyrAlaArgXaaIleGlnLeuPro131513201325LysAspAlaValValTyrIleAspProCysIleGlyProAlaThrAla133013351340AsnArgLysValValArgThrThrAspTrpArgAlaAspLeuAlaVal1345135013551360ThrProTyrAspTyrGlyAlaGlnAsnIleLeuThrThrAlaTrpPhe136513701375GluAspLeuGlyProGlnTrpLysIleLeuGlyLeuGlnProPheArg138013851390ArgAlaPheGlyPheGluAsnThrGluAspTrpAlaIleLeuAlaArg139514001405ArgMetAsnAspGlyLysAspTyrThrAspTyrAsnTrpAsnCysVal141014151420ArgGluArgProHisAlaIleTyrGlyArgAlaArgAspHisThrTyr1425143014351440HisPheAlaProGlyThrGluLeuGlnValGluLeuGlyLysProArg144514501455LeuProProGlyGlnValPro1460(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 249 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetGlnTrpGlyHisCysGlyValLysSerAlaSerCysSerTrpThr151015ProSerLeuSerSerLeuLeuValTrpLeuIleLeuXaaPheSerLeu202530ProTyrCysLeuGlySerProSerGlnAspGlyTyrTrpSerPhePhe354045SerGluTrpPheAlaProArgPheSerValArgAlaLeuProPheThr505560LeuProAsnTyrArgArgSerTyrGluGlyLeuLeuProAsnCysArg65707580ProAspValProGlnPheAlaValLysHisProLeuXaaMetPheTrp859095HisMetArgValSerHisLeuIleAspGluXaaValSerArgArgIle100105110TyrGlnThrMetGluHisSerGlyGlnAlaAlaTrpLysGlnValVal115120125GlyGluAlaThrLeuThrLysLeuSerGlyLeuAspIleValThrHis130135140PheGlnHisLeuAlaAlaValGluAlaAspSerCysArgPheLeuSer145150155160SerArgLeuValMetLeuLysAsnLeuAlaValGlyAsnValSerLeu165170175GlnTyrAsnThrThrLeuAspArgValGluLeuIlePheProThrPro180185190GlyThrArgProLysLeuThrAspPheArgGlnTrpLeuIleSerVal195200205HisAlaSerIlePheSerSerValAlaSerSerValThrLeuPheIle210215220ValLeuTrpLeuArgIleProAlaLeuArgTyrValPheGlyPheHis225230235240TrpProThrAlaThrHisHisSerSer245(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 265 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:MetAlaHisGlnCysAlaArgPheHisPhePheLeuCysGlyPheIle151015CysTyrLeuValHisSerAlaLeuAlaSerAsnSerSerSerThrLeu202530CysPheTrpPheProLeuAlaHisGlyAsnThrSerPheGluLeuThr354045IleAsnTyrThrIleCysMetProCysSerThrSerGlnAlaAlaArg505560GlnArgLeuGluProGlyArgAsnMetTrpCysLysIleGlyHisAsp65707580ArgCysGluGluArgAspHisAspGluLeuLeuMetSerIleProSer859095GlyTyrAspAsnLeuLysLeuGluGlyTyrTyrAlaTrpLeuAlaPhe100105110LeuSerPheSerTyrAlaAlaGlnPheHisProGluLeuPheGlyIle115120125GlyAsnValSerArgValPheValAspLysArgHisGlnPheIleCys130135140AlaGluHisAspGlyHisAsnSerThrValSerThrGlyHisAsnIle145150155160SerAlaLeuTyrAlaAlaTyrTyrHisHisGlnIleAspGlyGlyAsn165170175TrpPheHisLeuGluTrpLeuArgProLeuPheSerSerTrpLeuVal180185190LeuAsnIleSerTrpPheLeuArgArgSerProValSerProValSer195200205ArgArgIleTyrGlnIleLeuArgProThrArgProArgLeuProVal210215220SerTrpSerPheArgThrSerIleValSerAspLeuThrGlySerGln225230235240GlnArgLysArgLysPheProSerGluSerArgProAsnValValLys245250255ProSerValLeuProSerThrSerArg260265(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 183 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetAlaAlaAlaThrLeuPhePheLeuAlaGlyAlaGlnHisIleMet151015ValSerGluAlaPheAlaCysLysProCysPheSerThrHisLeuSer202530AspIleGluThrAsnThrThrAlaAlaAlaGlyPheMetValLeuGln354045AspIleAsnCysPheArgProHisGlyValSerAlaAlaGlnGluLys505560IleSerPheGlyLysSerSerGlnCysArgGluAlaValGlyThrPro65707580GlnTyrIleThrIleThrAlaAsnValThrAspGluSerTyrLeuTyr859095AsnAlaAspLeuLeuMetLeuSerAlaCysLeuPheTyrAlaSerGlu100105110MetSerGluLysGlyPheLysValIlePheGlyAsnValSerGlyVal115120125ValSerAlaCysValAsnPheThrAspTyrValAlaHisValThrGln130135140HisThrGlnGlnHisHisLeuValIleAspHisIleArgLeuLeuHis145150155160PheLeuThrProSerAlaMetArgTrpAlaThrThrIleAlaCysLeu165170175PheAlaIleLeuLeuAlaIle180(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 201 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:MetArgCysSerHisLysLeuGlyArgPheLeuThrProHisSerCys151015PheTrpTrpLeuPheLeuLeuCysThrGlyLeuSerTrpSerPheAla202530AspGlyAsnGlyAspSerSerThrTyrGlnTyrIleTyrAsnLeuThr354045IleCysGluLeuAsnGlyThrAspTrpLeuSerSerHisPheGlyTrp505560AlaValGluThrPheValLeuTyrProValAlaThrHisIleLeuSer65707580LeuGlyPheLeuThrThrSerHisPhePheAspAlaLeuGlyLeuGly859095AlaValSerThrAlaGlyPheValGlyGlyArgTyrValLeuCysSer100105110ValTyrGlyAlaCysAlaPheAlaAlaPheValCysPheValIleArg115120125AlaAlaLysAsnCysMetAlaCysArgTyrAlaArgThrArgPheThr130135140AsnPheIleValAspAspArgGlyArgValHisArgTrpLysSerPro145150155160IleValValGluLysLeuGlyLysAlaGluValAspGlyAsnLeuVal165170175ThrIleLysHisValValLeuGluGlyValLysAlaGlnProLeuThr180185190ArgThrSerAlaGluGlnTrpGluAla195200(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 173 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:MetGlyGlyLeuAspAspPheCysAsnAspProIleAlaAlaGlnLys151015LeuValLeuAlaPheSerIleThrTyrThrProIleMetIleTyrAla202530LeuLysValSerArgGlyArgLeuLeuGlyLeuLeuHisIleLeuIle354045PheLeuAsnCysSerPheThrPheGlyTyrMetThrTyrValHisPhe505560GlnSerThrAsnArgValAlaLeuThrLeuGlyAlaValValAlaLeu65707580LeuTrpGlyValTyrSerPheThrGluSerTrpLysPheIleThrSer859095ArgCysArgLeuCysCysLeuGlyArgArgTyrIleLeuAlaProAla100105110HisHisValGluSerAlaAlaGlyLeuHisSerIleSerAlaSerGly115120125AsnArgAlaTyrAlaValArgLysProGlyLeuThrSerValAsnGly130135140ThrLeuValProGlyLeuArgSerLeuValLeuGlyGlyLysArgAla145150155160ValLysArgGlyValValAsnLeuValLysTyrGlyArg165170(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 128 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:MetAlaGlyLysAsnGlnSerGlnLysLysLysLysSerThrAlaPro151015MetGlyAsnGlyGlnProValAsnGlnLeuCysGlnLeuLeuGlyAla202530MetIleLysSerGlnArgGlnGlnProArgGlyGlyGlnXaaLysLys354045LysLysProGluLysProHisPheProLeuAlaAlaGluAspAspIle505560ArgHisHisLeuThrGlnThrGluArgSerLeuCysLeuGlnSerIle65707580GlnThrAlaPheAsnGlnGlyAlaGlyThrAlaXaaLeuSerSerSer859095GlyLysValSerPheGlnValGluPheMetLeuProValAlaHisThr100105110ValArgLeuIleArgValThrSerThrSerAlaSerGlnGlyAlaSer115120125__________________________________________________________________________

Number	Date	Country	Kind
91201398	Jun 1991	EPX
92200781	Mar 1992	EPX

Number	Name	Date	Kind
5476778	Chladek et al.	Dec 1995
5510258	Sanderson et al.	Apr 1996

Number	Date	Country
0592584	Aug 1992	EPX
0587780B1	Mar 1994	EPX
0610250B1	Dec 1995	EPX
2282811	Apr 1995	GBX
9303760	Mar 1993	WOX
WO9606619	Mar 1996	WOX

Causative agent of the mystery swine disease, vaccine compositions and diagnostic kits

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (2)

PCT Information

US Referenced Citations (2)

Foreign Referenced Citations (6)

Non-Patent Literature Citations (55)

Entry
Terpstra et al "Experimental reproduction of porcine epidemic abortion . . . " The Veterinary Quarterly, vol. 13, No. 3, Jul. 1991, pp. 131-136.
"Pathological, ultrastructural, and immunohistochemical changes caused by . . . " The Veterinary Quarterly, vol. 13, No. 3, Jul. 1991, pp. 137-143.
Wensvoort et al "Blue ear" disease, The Veterinary Record, vol. 128, No. 128, Jun. 15, 1991, column, 1, letter, p. 574.
Wensvoort et al "Mystery swine disease in the Netherlands: the isolation of Lelystad virus", The Veterinary Quarterly, vol. 13, No. 3, Jul. 1991, pp. 121-130.
Saif LJ. Veterinary Microbiology 37:285-297, 1993.
Scott FW. Adv. Exp. Med. Biol 218:569-576, 1987.
Martin et al, Can J Comp Med 49(1):1-9, 1985.
Beale AJ, "Vaccines and antiviral drugs", Topley & Wilson's Principles of bacteriology, virology and immunity, vol. 4, Ch. 86, pp. 147-161.
Brinton MA, "Lactate Dehydrogenase-Elevating, Equine Arteritis and Lelystad Viruses", Encyclopedia of Virology, vol. 2, pp. 763-771.
Christianson et al., "Porcine reproductive and respiratory syndrome: A review", Swine Health and Production, vol. 2, No. 2, pp. 10-28, Mar. and Apr., 1994.
Den Boon et al., "Equine Arteritis Virus Is Not a Togavirus but Belongs to the Coronaviruslike Superfamily", Journal of Virology, vol. 65, No. 6, pp. 2910-2920, 1991.
Dykhuizen et al., "Determining the Economic Impact of the 'New' Pig Disease", Porcine Reproductive and Respiratory Syndrome, A Report on the Seminar Held in Brussels on 4-5 Nov. 1991 and Organized by the European Commission, pp. 53-60.
Fenner et al., "Viral Genetics and Evolution", Veterinary Virology, Ch. 5, pp. 89-95.
Fenner et al., "Immunization against Viral Diseases", Veterinary Virology, Ch. 14, pp. 265-271.
Meredith MJ, "Porcine Reproductive and Respiratory Syndrome (PRRS)", Pig Disease Information Center, 1st North American Edition, Universtiy of Cambridge, pp. 1-57, Aug. 1994.
Polson et al., "An evalutation of the financial impact of Porcine Reproductive and Respiratory Syndrome (PRRS) in nursery pigs", Proceedings of the 13th International Pig Veterinary Society Congress, p. 31, Jun. 1994.
Polson DD, "Answers to Your Questions on PRRS", NOBL Laboratories, 18 pages.
Polson DD, "RespPRRS A PRRS Vaccine Review", NOBL Laboratories, 22 pages.
Snijder et al., "The carboxyl-terminal part of the putative Berne virus polymerase is expressed by ribosomal frameshifting and contains sequence motifs which indicate that toro-and coronaviruses are evolutionarily related", Nucleic Acids Research, vol. 18, No. 15, pp. 4535-4542, 1990.
Timony PJ, "Equine Viral Arteritis", Manual of Standards for Diagnostic Tests and Vaccines, pp. 493-499, 1992.
"Revision of the taxonomy of the Coronavirus, Torovirus and Arterivirus genera", Arch Virol, vol. 135, pp. 227-239, Virology Division News, 1994.
Wenswoort et al., "Antigenic comparison of Lelystad virus and swine infertility and respiratory syndrome (SIRS) virus", J. Vet Diagn Invest, vol. 4, pp. 134-138, 1992.
Wenswoort et al., "The Porcine Reproductive and Respiratory Syndrome; Characteristics and diagnosis of the causative virus", Veterinary Biotechnology Newsletter, vol. 3, pp. 113-120, 1993.
Murphy et al "Immunization Against Virus" in Virology 2nd ed, vol. 1, Fields et al eds. Raven Press, N.Y. 1990 pp. 469-502.
Notice of Opposition by Akzo Nobel against European Patent No. 0 587 780, Nov. 28, 1995, EP.
Notice of Opposition by Cyandmid Iberica against European Patent No. 0 587 780, Nov. 28, 1995, EP.
Abstracts of Papers Presented at the 71st Annual Meeting of the Conference of Research Workers in Animal Disease, No.'s 1-6, Nov. 5,6, 1990, 2 pages.
"Advances in Veterinary Virology 2", Veterinary Microbiology, 33(1992), pp. 185-193.
Boursnell et al., "Completion of the Sequence of the Genome of the Coronavirus Avian Infectious Bronchitis Virus", Journal of General Virology 68, 1986, pp. 57-77.
Christianson et al., "Experimental reproduction of swine infertility and respitatory syndrome in pregnant sows", Am J Vet Res., vol. 53, No. 4, Apr. 1992, pp. 485-488.
Collins et al., "Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs", J Vet Diagn Invest, 4:117-126 (1992).
Den Boon et al., "Equine Arteritis Virus Is Not a Togavirus but Belongs to the Cononaviruslike Superfamily", Journal of Virology, vol. 65, No. 6, Jun. 1991, pp. 2910-2920.
de Vries et al., "All subgenomic mRNAs of equine arteritis virus contain a common leader sequence", Nucleic Acids Research, vol. 18, No. 11, 1990, pp. 3241-3247.
"Diseases Of Swine", Sixth Edition, Iowa State University Press, 1986, pp. 244-315.
Duran et al., "Recombinant Baculovirus Vaccines Against Porcine Reproductive And Respiratory Syndrome (PRRS)", Abstract PRRS, Aug. 9th to 10th, 1995, Copenhagen, Denmark, 2 pages.
Godeny et al., "Map Location of Lactate Dehydrogenase-Elevating Virus (LDV) Capsid Protein (Vp1) Gene", Virology 177, (1990), pp. 768-771 (1990).
Godeny et al., "The 3' Terminus of Lactate Dehydrogenase-Elevating Virus Genome RNA Does Not Contain Togavirus or Flavivirus Conserved Sequences", Virology 172, pp. 647-650.
Joo et al., "Encephalomyocarditis Virus As A Potential Cause For Mystery Swine Disease", Livestock Conservation Institute, Denver, Co, pp. 62-66, Oct. 6, 1990.
Kuo et al., "A Nested Set of Eight RNAs Is Formed in Macrophages Infected with Lactate Dehydrogenase-Elevating Virus", Journal of Virology, vol. 65, No. 9, Sep. 1991, pp. 5118-5123.
Keffaber, K., "Reproductive Failure of Unknown Etiology", AASP Newsletter, vol. 1, No. 2, Sept.-Oct. 1989, pp. 1,4-5, 8-10.