The invention generally relates to the development of variant Zika virus (ZIKV) strains, variant Zika genomes (cDNA clones) and Zika RNA transcripts that contain specific substitution mutations, and methods for producing high yields of ZIKV using these variant cDNA clones, RNA transcripts and Zika strains. These variant cDNA clones, RNA transcripts and Zika strains can be used for the manufacture of purified inactivated vaccines (NV), which may be useful for treating ZIKV related diseases and providing immunoprotection against ZIKV.
Zika virus (ZIKV) has recently caused explosive outbreaks in the Americas and is unexpectedly associated with congenital microcephaly and other fetal abnormalities as well as Guillain Barr{tilde over (e)} syndrome (Schuler-Faccini et al., 2016). ZIKV was first isolated from a sentinel rhesus macaque in 1947 in the Zika Forest of Uganda (Dick et al., 1952). Human ZIKV infections have only sporadically been detected for decades. However, since 2007, ZIKV has rapidly spread across islands in the South Pacific and into the Americas, causing the outbreak on Yap Island in Micronesia, a subsequent outbreak in French Polynesia, and explosive, widespread epidemics in the Americas (Petersen et al., 2016). The World Health organization (http://www.who.int/emergencies/zika-virus/situation-report/6-october-2016/en/) has reported over 73 countries and territories with active ZIKV outbreaks/epidemics. Despite urgent medical needs, neither clinically approved vaccine nor antiviral is available for prevention and treatment.
ZIKV is a mosquito-borne member from the genus flavivirus within the family Flaviviridae. Besides ZIKV, many other flaviviruses are significant human pathogens, including the four serotypes of dengue (DENV-1 to -4), yellow fever (YFV), West Nile (WNV), Japanese encephalitis (JEV), and tick-borne encephalitis (TBEV) viruses. Flaviviruses have a positive-sense single-stranded RNA genome approximately 11,000 nucleotides in length. The genome contains a 5′ untranslated region (UTR), single open-reading frame (ORF), and 3′ UTR. The ORF encodes three structural (capsid [C], precursor membrane [prM], and envelope [E]) and seven non-structural (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) proteins. The structural proteins form virus particles and function in virus entry into cells. The nonstructural proteins participate in viral replication, virion assembly, and evasion of host innate immune responses (Lindenbach, 2013). Like other flaviviruses, ZIKV enters cells through the receptor-mediated endocytosis. After low pH-induced fusion with the endosome membrane, flaviviruses release and translate their genomic RNA in the endoplasmic reticulum (ER). Viral RNA replication occurs in the virus-induced replication complexes formed in the ER membrane. Progeny viruses form on the ER-derived membrane as immature virus particles, in which prM/E heterodimers form trimeric spikes with icosahedral symmetry. After removal of the pr from the prM by host furin protease during the transit through the Golgi network, the immature, non-infectious virions become mature infectious viruses. Finally, progeny virions are released through an exocytosis pathway (Lindenbach, 2013). Rapid progress has been made on ZIKV research in the past two years, including the high-resolution structures of virus (Kostyuchenko et al., 2016; Sirohi et al., 2016), reverse genetic systems (Atieh et al., 2016; Schwarz et al., 2016; Shan et al., 2016b; Tsetsarkin et al., 2016; Weger-Lucarelli et al., 2017; Xie et al., 2016), animal models (Lazear et al., 2016; Rossi et al., 2016), and vaccine development (Abbink et al., 2016; Dowd et al., 2016; Larocca et al., 2016).
Development of an effective and affordable ZIKV vaccine is a public health priority. Multiple strategies have been taken, including DNA- or viral vector-expressing subunit, chimeric, and live-attenuated vaccines (Dawes et al., 2016). Three frontrunner candidates, including two DNA vaccines expressing viral structural proteins prM and E (Dowd et al., 2016; Larocca et al., 2016) and one purified inactivated ZIKV vaccine (PIV) based on Puerto Rico strain PRVABC59 (Abbink et al., 2016), protect monkeys from ZIKV challenge. These frontrunners are currently in phase I clinical trials.
The present invention addresses the need for technologies that can increase the yield of virus production to improve accessibility of inactivated vaccines and reduce costs without compromising vaccine immunogenicity.
The invention in general relates to variant Zika virus (ZIKV) cDNA clones, RNA transcripts of these cDNA clones, and variant ZIKV strains which have been mutated to introduce at least one substitution mutation in at least one of the encoded ZIKV proteins, wherein said at least one substitution mutation comprises one or more of the following: NS1 K265E, prM H83R and NS3 S356F.
In some exemplary embodiments the cDNA clone, RNA transcript, or strain will comprise an NS1 K265E substitution mutation.
In some exemplary embodiments the encoded ZIKV proteins in the variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain will comprise one of the following combinations of substitution mutations: (a) NS1 K265E, prM H83R and NS3 S356F; (b) NS1 K265E and prM H83R; or (c) NS1 K265E and NS3 S356F.
In some exemplary embodiments the encoded ZIKV proteins in the variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain comprising any of the afore-mentioned substitutions may further comprise one or more other substitution mutations such as prM H83R, NS3 S356F, E R283W, E H219L, E L441L,E K443N, E T315I, E H401Y, E A501T, NS1 R103K and NS1 W98L.
In some embodiments the variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain comprising any of the afore-mentioned substitutions may comprise a variant of one of the following: a cDNA clone of a North or South American ZIKV strain, an RNA transcript of the cDNA clone of a North or South American ZIKV strain, or a North or South American ZIKV strain.
In some embodiments the variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain may comprise a variant of one of the following:
In some exemplary embodiments the variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain comprising any of the afore-mentioned substitutions will comprise a variant of PRVABC59 or FSS13025.
In some exemplary embodiments the variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain comprising any of the afore-mentioned substitutions may provide for increased yield of ZIKV production in cells as compared to the corresponding wildtype ZIKV cDNA clone, RNA transcript, or strain lacking these substitution mutations; and/or may provide for enhanced ZIKV assembly as compared to a corresponding wildtype ZIKV cDNA clone, RNA transcript, or strain lacking these substitution mutations, e.g., wherein the cells used to produce said variant ZIKV may be selected from any one of the following types of cells: (i) eukaryotic cells; (ii) mammalian cells; (iii) mouse or human cells; (iv) Vero cells, Huh7 cells, LLC-MK-2 cells, Hep-2 cells, LF 1043 (HEL) cells, MRC-5 cells, WI-38 cells, tMK cells, 293 T cells, QT 6 cells, QT 35 cells, or chicken embryo fibroblasts (CEF); and (v) Vero cells or Huh7 cells.
In some exemplary embodiments the variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain comprising any of the afore-mentioned substitutions will comprise an infectious cDNA clone, RNA transcript, or strain.
In some exemplary embodiments the variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain comprising any of the afore-mentioned substitutions will be further modified to include at least one additional mutation which results in a substitution, addition or deletion mutation in at least one Zika protein, preferably NS1, NS3 or prm, wherein said additional modification does not adversely impact the efficacy of the resultant cDNA clone, RNA transcript, or strain for use in vaccines.
In some exemplary embodiments the invention provides methods for producing ZIKV variants for use in vaccine manufacture, such methods in general comprising producing additional copies of any of the afore-mentioned variant Zika virus (ZIKV) cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain comprising any of the afore-mentioned substitutions in a suitable system thereby obtaining additional ZIKV variants suitable for use in the manufacture of ZIKV vaccines. In preferred exemplary embodiments the suitable system will comprise producing the ZIKV variants in suitable cells, e.g., cells selected from one of the following groups: (i) eukaryotic cells; (ii) mammalian cells; (iii) mouse or human cells; (iv) Vero cells, Huh7 cells, LLC-MK-2 cells, Hep-2 cells, LF 1043 (HEL) cells, MRC-5 cells, WI-38 cells, tMK cells, 293 T cells, QT 6 cells, QT 35 cells, or chicken embryo fibroblasts (CEF); and (v) Vero cells or Huh7 cells, optionally wherein the produced ZIKV variants are attenuated or inactivated.
In some exemplary embodiments the invention provides a variant ZIKV cDNA clone, RNA transcript of the cDNA clone, or variant ZIKV strain comprising a substitution mutation corresponding to A3282G in the ZIKV genome, wherein the A3282G substitution results in a K265E substitution in the NS1 protein expressed from the cDNA clone, RNA transcript or strain.
In some exemplary embodiments the invention provides immunogenic compositions comprising a variant ZIKV strain containing any of the afore-mentioned substitutions and at least one pharmaceutically acceptable carrier or excipient, optionally wherein the strain is attenuated or inactivated, and further optionally which is suitable for parenteral or enteral administration.
In some exemplary embodiments the invention provides methods for eliciting an immune response in a subject in need thereof by administering a composition comprising a prophylactically or therapeutically effective amount of a variant ZIKV strain containing any of the afore-mentioned substitutions, or an immunogenic composition containing same as above-described, wherein the ZIKV strain is attenuated or inactivated. In some exemplary embodiments the immune response elicited may include one or more of the following: (i) a CD8+ T cell response, an antibody response, and/or a cellular immune response against ZIKV; (ii) a neutralizing antibody titer equivalent to that of wildtype ZIKV infection; (iii) prevention of congenital ZIKV syndrome and/or microcephaly; and/or (iv) prevention of viremia in a subject after subsequent challenge with a wildtype ZIKV strain, optionally a human subject, further optionally a pregnant female.
The present invention in general relates to the construction and characterization of variant Zika strains having advantageous properties and the use and manufacture thereof, especially in making immunogenic compositions for use in providing immunity against Zika. However, before further describing the invention in detail the following definitions are provided.
An “adjuvant” refers to a substance that enhances an immune response, e.g., an antibody or cell-mediated immune response against a specific agent, e.g., an antigen, or an infectious agent.
An “attenuated” or “live-attenuated” virus strain refers to a mutated, modified and/or recombinant virus having reduced or no virulence or propensity to cause a disease or infection normally associated with the wildtype or unmodified, non-mutated virus.
Complementary DNA (“cDNA”) is DNA that is complementary to a given RNA which serves as a template for synthesis of the cDNA in a reaction that is catalyzed by reverse transcriptase. cDNA is synthesized from a single stranded RNA and may be artificially produced or naturally produced by retroviruses.
A viral “cDNA clone” is a double-stranded DNA copy of all or a portion of a viral genome, in this case the ZIKV RNA genome. A cDNA clone is generally carried in a plasmid vector. An “infectious cDNA clone” can be used for production of in vitro RNA transcripts with a polymerase such as the T7 RNA polymerase. An infectious cDNA clone (or the RNA transcript produced from the infectious cDNA clone) generates recombinant cDNA clone-derived virus when transfected into cells.
“Heterologous” means derived from a genetically distinct entity from the rest of the entity to which it is being compared. For example, a polynucleotide may be placed by genetic engineering techniques into a plasmid or vector derived from a different source, and is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence other than the native sequence is a heterologous promoter. The polynucleotides of the invention may comprise additional sequences, such as additional encoding sequences within the same transcription unit, controlling elements such as promoters, ribosome binding sites, 5′UTR, 3′UTR, transcription terminators, polyadenylation sites, additional transcription units under control of the same or a different promoter, sequences that permit cloning, expression, homologous recombination, and transformation of a host cell, and any such construct as may be desirable to provide embodiments of this invention.
In general, “identity” or “sequence identity” refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules (the reference sequence and a sequence with unknown % identity to the reference sequence) by aligning the sequences, introducing gaps if necessary to achieve the maximum percent identity, counting the exact number of matches between the two aligned sequences, dividing by the length of the reference sequence, and multiplying the result by 100. The determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, BLASTN, BLASTP, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods. Depending on the application, the “percent identity” can exist over a region of the sequence being compared, e.g., over the ORF of the variant ZIKV cDNA clone, RNA transcript, or strain, or, alternatively, exist over the full length of the two sequences to be compared. A skilled artisan would understand that for purposes of determining sequence identity when comparing a DNA to an RNA sequence, a thymidine nucleotide is equivalent to a uracil nucleotide.
An “immunogenic composition” herein refers to a composition containing an attenuated or inactivated ZIKV strain according to the invention which elicits an immune response in a susceptible host, e.g., an antibody, Thl or cellular (e.g., T cell-mediated) immune response.
An “isolated” biological component (such as an isolated virus, bacterium or nucleic acid) refers to a component that has been substantially separated or purified away from its environment or other biological components in the cell of the organism in which the component naturally occurs, for instance, other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant technology as well as chemical synthesis.
The term “nucleic acid” and “polynucleotide” refer to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof. The term also encompasses RNA/DNA hybrids. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thiolate, and nucleotide branches. The sequence of nucleotides may be further modified after polymerization, such as by conjugation, with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides or solid support. The polynucleotides can be obtained by chemical synthesis or derived from a microorganism. The term “gene” is used broadly to refer to any segment of polynucleotide associated with a biological function. Thus, genes include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs and/or the regulatory sequences required for their expression. For example, gene also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.
A “pharmaceutically acceptable carrier” or “excipient” refers to compounds or materials conventionally used in immunogenic or vaccine compositions during formulation and/or to permit storage.
“Prophylactically effective amount” of a ZIKV strain according to the invention refers to an amount sufficient to prevent or reduce the incidence of infection in a susceptible host.
The term “recombinant” as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which does not occur in nature or by virtue of its origin or manipulation is associated with or linked to another polynucleotide in an arrangement not found in nature. The term “recombinant” as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.
A “susceptible host” herein refers to a host or animal that may be infected by ZIKV. Such hosts include humans or animals, e.g., a human, nonhuman primate, ape, monkey, horse, cow, carabao, goat, duck, bat, or other suitable non-human host.
“Therapeutically effective amount” of a ZIKV strain according to the invention refers to an amount sufficient to treat ZIKV infection or a disease associated therewith in a susceptible host.
A “vaccine” composition herein refers to a composition containing a ZIKV strain according to the invention which elicits a therapeutic or prophylactic immune response against ZIKV.
The terms “variant” and “mutant” refer to biologically active derivatives of the reference molecule that retain or enhance the desired activity, such as the ability to increase ZIKV replication and production as discussed herein. In the present invention, a variant ZIKV cDNA clone or strain contains one or more naturally occurring or genetically engineered mutations that result in high-yield manufacture of ZIKV in cells, particularly monkey or human cell lines, such as Vero or Huh? cells.
The terms “variant” and “mutant” in reference to a polynucleotide (e.g. the variant ZIKV cDNA clone, RNA transcript, strain, or ORF) or polypeptide (e.g., one of the three structural (capsid [C], precursor membrane [prM], and envelope [E]) or seven non-structural (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) proteins of the ZIKAV) refers to a polynucleotide or polypeptide that differs from the corresponding wildtype polynucleotide sequence and structure by one or more nucleic acid additions, substitutions and/or deletions, or differs from the corresponding wildtype polypeptide sequence and structure by one or more amino acid additions, substitutions and/or deletions, so long as the modifications do not destroy the desired biological activity (e.g. the ability to replicate). In general, the sequences of such variants and mutants of the invention will have a high degree of sequence identity to the reference or corresponding wildtype sequence, e.g., a nucleic acid or amino acid sequence identity of at least 40, 50, 60, 70, 80 or 85%, more particularly at least 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99%, when the two sequences are aligned. For example, the nucleic acid sequence of the open reading frame (ORF) of a ZIKV cDNA clone, RNA transcript, or strain that is a variant of the PRVABC59 strain will generally have at least 40, 50, 60, 70, 80 or 85%, more particularly at least 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to the nucleic acid sequence of the ORF of PRVABC59.
Often, the “variant” or “mutant” polypeptide sequence will include the same number of amino acids as the wildtype polypeptide but will include particular substitutions, as explained herein.
It will be appreciated by those of ordinary skill in the art that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that encode a particular polypeptide of interest as described herein. Some of these polynucleotides bear minimal homology to the nucleotide sequence of any native gene. Nonetheless, “variant” or “mutant” polynucleotides that vary due to differences in codon usage are specifically contemplated by the present invention.
The “variant” or “mutant” polypeptide sequence can include amino acid substitutions that are conservative in nature, i.e., those substitutions that take place within a family of amino acids that are related in their side chains. Specifically, amino acids are generally divided into four families: (1) acidic-aspartate and glutamate; (2) basic-lysine, arginine, histidine; (3) non-polar-alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar-glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. For example, it is reasonably predictable that an isolated replacement of leucine with isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid, will not have a major effect on the biological activity. Further one of skill in the art may readily determine regions of the molecule of interest that can tolerate change by reference to Hopp/Woods and Kyte-Doolittle plots, well known in the art.
“ZIKV infection” or “infection elicted by ZIKV” herein refers to the infection of a susceptible host with ZIKV and diseases associated therewith, including congenital ZIKV syndrome and Guillan-Barr{tilde over (e)} syndrome (GB S).
As has been mentioned above the present invention provides novel Zika variant strains for potential use in making Zika vaccines. In general the invention relates to the construction and characterization of a DNA copy of the Zika virus (ZIKV) genome (a cDNA clone) or a ZIKV strain encoding ZIKA proteins having specific mutations or combinations thereof, e.g., mutations in the NS1, NS3, prM and/or E proteins. These variant ZIKV cDNA clones, RNA transcripts of the cDNA clones, or variant ZIKV strains encoding the mutations, may possess increased ZIKV replication in cells, and thus can be used to produce higher yields of ZIKV, with shortened manufacture time, and minimized chance of contamination as compared to methods using existing ZIKV cDNA clones, RNA transcripts and strains that do not include these mutations. The ZIKV produced using the subject variant cDNA clones, RNA transcripts or strains may be used to produce ZIKV vaccines, in particular inactivated ZIKV vaccines, for treating diseases related to ZIKV or providing immunoprotection against infections elicited by ZIKV, including congenital ZIKV syndrome, microcephaly, and Guillan-Barr{tilde over (e)} syndrome (GBS). The vaccine may also prevent viremia in pregnant women and travelers to epidemic/endemic regions, avert congenital ZIKV syndrome and/or may also be useful to suppress epidemic transmission.
The variant ZIKV cDNA clones, RNA transcripts or strains of the invention contain one or more mutations in the ZIKV open reading frame (ORF). These mutations in particular may include the following amino acid substitutions: NS1 K265E, prM H83R, NS3 S356F, E R283W, E H219L, E L441L, E K443N, E T315I, E H401Y, E A501T, NS1 R103K, and NS1 W98L. In some preferred embodiments a variant ZIKV cDNA clone, RNA transcript thereof, or ZIKV strain according to the invention encodes ZIKV proteins comprising an NS1 K265E substitution; NS1 K265E, prM H83R and NS3 S356F substitutions; NS1 K265E and prM H83R substitutions; or NS1 K265E and NS3 S356F substitutions. It has been observed that the NS1 K265E mutation enhances the replication and viral yield of ZIKV in cells, but does not affect ZIKV virulence. In addition, both the prM H83R and the NS3 S356F mutations have been found to further increase viral yield, with the triple mutant (NS1 K265E, prM H83R and NS3 S356F) producing a peak viral titer.
The variant ZIKV cDNA clones, RNA transcripts and strains of the invention may comprise cDNA or RNA corresponding to the complete (full-length) or less than the complete ZIKV genomic RNA, such as one or several fragments of the ZIKV genome. In addition they may be derived from different Zika strains other than those embodied herein, e.g., using Zika strains which are known and available in the art, i.e., by introducing the afore-mentioned substitution mutations or corresponding mutations in the ORF of these or other Zika strains. Generally, the ZIKV cDNA clones, RNA transcripts and strains will comprise sequences encoding all or substantially all the proteins of a ZIKV or will comprise the entire open reading frame (ORF) of a ZIKV genome (modified to include any or all of the afore-mentioned substitution mutations). In some embodiments, the sequences will have at least 40, 50, 60, 70, 80 or 85%, more particularly at least 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99%, sequence identity to a wildtype sequence of ZIKV. In a preferred embodiment, a cDNA clone, RNA transcript or strain containing any combination of the afore-identified substitution mutations can be transfected into cells or used to infect cells to produce Zika virus containing any combination of the afore-identified substitution mutations. In certain embodiments the produced virus may be an infectious, attenuated, replication defective or inactivated virus containing any combination of the afore-identified substitution mutations.
The variant ZIKV cDNA clones, RNA transcripts and strains of the invention may be derived from any ZIKV and thus may be variants of any strain of ZIKV. For example, the source of the variant ZIKV cDNA clone or strain can be any one of the following strains: MR766-NIID, P6-740, ArD7117, IbH_30656, ArB1362, ARB13565, ARB7701, ARB15076, ArD_41519, ArD128000, ArD158084, ArD157995, FSM, FSS13025, PHL/2012/CPC-0740-Asian, H/PF/2013, PLCa1_ZV, Haiti/1225/2014, SV0127_14 Asian, Natal_RGN_Asian, Brazil_ZKV2015 Asian, ZikaSPH2015, BeH815744, BeH819015, BeH819966, BeH823339, BeH828305, SSABR1-Asian, FLR, 103344, 8375, PRVABC59, Z1106033, MRS_OPY_Martinique, VE_Ganxian_Asian, GD01_Asian, GDZ16001, ZJO3, Rio-U1 or Rio-S1 ZIKV strains (see Wang L, et al. Cell Host Microbe. 2016 May 11; 19(5):561-5). In certain embodiments, the strain is a North American strain or a South American strain. Preferred ZIKV strains used to produce Zika variant according to the invention are PRVABC59 or FSS13025.
In some embodiments, the variant ZIKV cDNA clone is contained in a plasmid, which optionally comprises a promoter and/or a ribozyme sequence. For example the promoter may comprise a viral promoter or a mammalian promoter. The promoter can be at the 5′ end of the cDNA clone, and is optionally a T7 promoter or a cytomegalovirus (CMV) promoter. The ribozyme sequence can be at the 3′ end of the cDNA clone, and is optionally a hepatitis delta virus ribozyme (HDVr) sequence. In some embodiments, the plasmid is an expression vector, optionally a mammalian expression vector.
The ZIKV cDNA clones and strains of the present invention, and plasmids or vectors encoding the same, may be further modified, engineered, optimized, or appended in order to provide or select for further increased yield and/or other various features. In particular, other mutations (e.g. missense, additions, substitutions, deletions, or combinations thereof) may be introduced into the cDNA clones or strains in any one or more of the genes encoding the C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, or NS5 proteins. For example, a missense mutation may be introduced which results in a cold-sensitive mutation or a heat-sensitive mutation. In some embodiments, major phosphorylation sites of viral protein(s) may be removed.
In addition to mutations within the genes of the ORF, the intergenic region of the cDNA clone or strain may be altered. In one embodiment, the length of the intergenic region is altered. In another embodiment, the intergenic regions may be shuffled from the 5′ to the 3′ end of the cDNA clone or genome. In other embodiments, the genome position of a gene or genes of the cDNA clone or strain can be changed.
The variant ZIKV cDNA clone, RNA transcript or strain of the present invention may further comprise a sequence encoding one or several heterologous genes or other non-gene sequences that are not derived from the ZIKV which was used as a source for the variant ZIKV cDNA clone or strain. Any heterologous gene of interest can be inserted into the nucleic acids of the present invention. In certain embodiments the heterologous genes encode peptides or proteins which are recognized as an antigen from an infectious agent by the immune system of a mammal. The heterologous gene may thus encode at least one antigen suitable for inducing an immune response against an infectious agent, at least one molecule interfering with the replication of an infectious agent or an antibody providing protection against an infectious agent. Alternatively or additionally, the heterologous gene may encode an immune modulator, a cytokine, an immunoenhancer or an anti-inflammatory compound. The cDNA clones and strains may also contain other mutations including, but not limited to, replacing a ZIKV gene with the analogous gene of a virus of a different species, of a different subgroup, or of a different variant.
In certain embodiments, the variant ZIKV cDNA clone, RNA transcript or strain of the invention comprises additional mutations that result in an attenuated virus strain which is modified so that it has reduced or no virulence or propensity to cause any disease or infection normally associated with the wildtype or unmodified ZIKV. The cDNA clone or attenuated strain may in addition comprise deletions within the 3′UTR.
The enhanced replication phenotypes of a variant ZIKV cDNA clone or strain of the invention can be tested by any method known to the artisan. For example, cells can be transfected with a candidate variant ZIKV cDNA clone or RNA transcript thereof, or infected with the variant ZIKV strains. The replication rate of the ZIKV in cells can be determined by plotting the viral titer over the time post transfection or infection. The viral titer can be measured by any technique known to the skilled artisan. In certain embodiments, the yield of ZIKV production on cells can be measured using a one-step plaque-purification method. In certain embodiments, different cell lines can be used to evaluate the enhanced replication phenotype of the cDNA clone or strain. For example, the achievable virus titers may be different in different cell lines.
In a specific embodiment, the viral titre is determined by obtaining a sample from transfected or infected cells or an infected subject, preparing a serial dilution of the sample and infecting a monolayer of cells that are susceptible to infection with the virus at a dilution of the virus that allows for the emergence of single plaques. The plaques can then be counted and the viral titre expressed as plaque forming units per milliliter of sample. In another embodiment, the growth rate of a variant ZIKV strain of the invention in a subject can be estimated by the titer of antibodies against the virus in the subject. Without being bound by theory, the antibody titer in the subject reflects not only the viral titer in the subject but also the antigenicity. If the antigenicity of the virus is constant, the increase of the antibody titer in the subject can be used to determine the growth curve of the virus in the subject. In a preferred embodiment, the growth rate of the virus in animals or humans is tested by sampling biological fluids of a host at multiple time points post-infection and measuring viral titer.
The expression of ZIKV proteins from the variant ZIKV cDNA clone, RNA transcript thereof, or variant ZIKV strain in a cell culture system or in a subject can be determined by any technique known to the skilled artisan. In certain embodiments, expression is measured by quantifying the level of the transcript. The level of the transcript can be measured by Northern blot analysis or by RT-PCR using probes or primers, respectively that are specific for the transcript. The transcript can be distinguished from the genome of the virus because the virus is in the antisense orientation whereas the transcript is in the sense orientation. In certain embodiments, the expression of the gene is measured by quantifying the level of the protein product of the gene. The level of the protein can be measured by Western blot analysis using antibodies that are specific to the protein.
Additionally, the present invention provides methods of preparing a recombinant ZIKV, such as a viral RNA or a virion, using a variant ZIKV cDNA clone, RNA transcript of the cDNA, or strain of the invention by any method known to the artisan. For example, cells can be transfected with the cDNA clone or RNA transcript thereof, or infected with the strain, then grown in culture and monitored for viral protein expression, RNA synthesis, and virus production. Suitable host cells include any eukaryotic cells that support viral replication, for example monkey (e.g. Vero) or human (e.g. Huh7) cell lines as discussed herein. In some embodiments the cDNA can be expressed in a host cell and the ZIKV isolated from that host cell. Any of methods for isolating viruses from cell culture known in the art may be used. Alternatively, the nucleic acids of the present invention can be transcribed and/or translated using chemicals, biological reagents and/or cell extracts and the recombinant ZIKV subsequently isolated.
The recombinant virus produced from the variant ZIKV cDNA clone, RNA transcript of the cDNA, or strain of the invention can be attenuated, or can be inactivated by any known method, including with chemicals, heat or radiation. For example, common techniques known to one of skill in the art use formalin, beta-propiolactone, heat, and/or detergent for inactivation. An inactivated vaccine has a low residual infectivity following inactivation, e.g. <1 PFU/mL. The PFU's of a particular vaccine may be determined, for example, by using a plaque assay, an immunostaining assay, or other method known in the art for detecting viral infectivity. The virus can purified by any method known, including concentration by ultrafiltration followed by purification by zonal centrifugation or by chromatography, and may be purified before or after inactivation.
Inactivated vaccine types that can be used in the invention include whole-virus vaccines or subvirion (split) vaccines. The whole-virus vaccine contains intact, inactivated virus, while the subvirion vaccine contains purified virus disrupted with detergents that solubilize the lipid-containing viral envelope, followed by chemical inactivation of residual virus. Various assays, f or example sucrose gradients and neutralization assays, can be used to test the safety of a viral vaccine.
Inactivated or attenuated virus produced according to the invention can be used to confer prophylactic or therapeutic protection in susceptible hosts against ZIKV infection, e.g., to treat or prevent ZIKV infection and/or to prevent congenital ZIKV syndrome or GBS. The ZIKV vaccine produced according to the invention may be formulated using known techniques for formulating viral vaccines or immunogenic compositions of viral vaccines.
The immunogenic compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired.
For example, administration may be topical, parenteral, or enteral.
The pharmaceutical compositions of the invention are typically suitable for parenteral administration. As used herein, “parenteral administration” of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue, thus generally resulting in the direct administration into the blood stream, into muscle, or into an internal organ. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, subcutaneous, intraperitoneal, intramuscular, intrasternal, intravenous, intraarterial, intrathecal, intraventricular, intraurethral, intracranial, intrasynovial injection or infusions; and kidney dialytic infusion techniques.
Formulations of a pharmaceutical composition suitable for parenteral administration typically generally comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampoules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and the like. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition. Parenteral formulations also include aqueous solutions which may contain excipients such as salts, carbohydrates and buffering agents (preferably to a pH of from 3 to 9), but, for some applications, they may be more suitably formulated as a sterile non-aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water. Exemplary parenteral administration forms include solutions or suspensions in sterile aqueous solutions, for example, aqueous propylene glycol or dextrose solutions. Such dosage forms can be suitably buffered, if desired. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, or in a liposomal preparation. Formulations for parenteral administration may be formulated to be immediate and/or modified release. Modified release formulations include delayed-, sustained-, pulsed-, controlled-, targeted and programmed release.
The terms “oral”, “enteral”, “enterally”, “orally”, “non-parenteral”, “non-parenterally”, and the like, refer to administration of a compound or composition to an individual by a route or mode along the alimentary canal. Examples of “oral” routes of administration of a vaccine composition include, without limitation, swallowing liquid or solid forms of a vaccine composition from the mouth, administration of a vaccine composition through a nasojejunal or gastrostomy tube, intraduodenal administration of a vaccine composition, and rectal administration, e.g., using suppositories for the lower intestinal tract of the alimentary canal.
Preferably, the formulated virus-containing composition is suitable for intranasal, injection, topical or oral administration, for example as a dried stabilized powder for reconstitution in a suitable buffer prior to administration or in an aerosol composition. In a preferred embodiment, the composition is intranasally administered.
Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, semisolids, monophasic compositions, multiphasic compositions (e.g., oil-in-water, water-in-oil), foams microsponges, liposomes, nanoemulsions, aerosol foams, polymers, fullerenes, and powders (see, e.g., Reference 35, Taglietti et al. (2008) Skin Ther. Lett. 13:6-8). Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
Compositions and formulations for parenteral, intrathecal, or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carder compounds and other pharmaceutically acceptable carriers or excipients.
Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, aerosols, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
In one embodiment of the present invention the pharmaceutical compositions may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin, cationic glycerol derivatives, and polycationic molecules, such as polylysine, also enhance the cellular uptake of oligonucleotides.
The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
The compositions of the present invention may include excipients known in the art. Examples of excipients used for vaccine formulation such as adjuvants, stabilizers, preservatives, and trace products derived from vaccine manufacturing processes include but are not limited to: Aluminum Hydroxide, Amino Acids, Benzethonium Chloride, Formaldehyde or Formalin, Inorganic Salts and Sugars, Vitamins, Asparagine, Citric Acid, Lactose, Glycerin, Iron Ammonium Citrate, Magnesium Sulfate, Potassium Phosphate, Aluminum Phosphate, Ammonium Sulfate, Casamino Acid, Dimethyl-betacyclodextrin, 2-Phenoxyethanol, Bovine Extract, Polysorbate 80, Aluminum Potassium Sulfate, Gelatin, Sodium Phosphate, Thimerosal, Sucrose, Bovine Protein, Lactalbumin Hydrolysate, Formaldehyde or Formalin, Monkey Kidney Tissue, Neomycin, Polymyxin B, Yeast Protein, Aluminum Hydroxyphosphate Sulfate, Dextrose, Mineral Salts, Sodium Borate, Soy Peptone, MRC-5 Cellular Protein, Neomycin Sulfate, Phosphate Buffers, Polysorbate, Bovine Albumin or Serum, DNA, Potassium Aluminum Sulfate, Amorphous Aluminum Hydroxyphosphate Sulfate, Carbohydrates, L-histidine, Beta-Propiolactone, Calcium Chloride, Neomycin, Ovalbumin, Potassium Chloride, Potassium Phosphate, Sodium Phosphate, Sodium Taurodeoxychoalate, Egg Protein, Gentamicin, Hydrocortisone, Octoxynol-10, α-Tocopheryl Hydrogen Succinate, Sodium Deoxycholate, Sodium Phosphate, Beta-Propiolactone, Polyoxyethylene 910, Nonyl Phenol (Triton N-101, Octoxynol 9), Octoxinol-9 (Triton X-100), Chick Kidney Cells, Egg Protein, Gentamicin Sulfate, Monosodium Glutamate, Sucrose Phosphate Glutamate Buffer Calf Serum Protein, Streptomycin, Mouse Serum Protein, Chick Embryo Fibroblasts, Human Albumin, Sorbitol, Sodium Phosphate Dibasic, Sodium Bicarbonate, Sorbitol, Sucrose, Potassium Phosphate Monobasic, Potassium Chloride, Potassium Phosphate Dibasic, Phenol, Phenol Red (Phenol sulfonphthalein), Amphotericin B, Chicken Protein, Chlortetracycline, Ethylenediamine-Tetraacetic Acid Sodium (EDTA), Potassium Glutamate, Cell Culture Media, Sodium Citrate, Sodium Phosphate Monobasic Monohydrate, Sodium Hydroxide, Calcium Carbonate, D-glucose, Dextran, Ferric (III) Nitrate, L-cystine, L-tyrosine, Magnesium Sulfate, Sodium Hydrogenocarbonate, Sodium Pyruvate, Xanthan, Peptone, Disodium Phosphate, Monosodium Phosphate, Polydimethylsilozone, Hexadecyltrimethylammonium Bromide Ascorbic Acid, Casein, Galactose, Magnesium Stearate, Mannitol, Hydrolyzed Porcine Gelatin, Freund's emulsified oil adjuvants (complete and incomplete), Arlacel A, Mineral oil, Emulsified peanut oil adjuvant (adjuvant 65), Corynebacterium granulosum-derived P40 component, Lipopolysaccharide, Mycobacterium and its components, Cholera toxin, Liposomes, Immunostimulating complexes (ISCOMs), Squalene, and Sodium Chloride.
The vaccine or immunogenic composition may be used in the vaccination of a mammalian host, particularly a human, nonhuman primate, ape, monkey, horse, cow, carabao, goat, duck, bat, or other suitable non-human host. In some instances the subject may be immunocompromised or may have another condition, e.g., may be pregnant.
The following examples are offered to illustrate, but not to limit, the claimed invention.
Cell Culture and Antibodies.
BHK-21 and Vero cells were purchased from the American Type Culture Collection (ATCC, Bethesda, Md.), and maintained in a high-glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (HyClone Laboratories, South Logan, Utah) and 1% penicillin/streptomycin at 37° C. with 5% CO2. A. albopictus C6/36 cells were grown in RPMI1640 containing 10% FBS and 1% penicillin/streptomycin at 30° C. with 5% CO2. Huh7 cells were maintained in a high-glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin and 1% Non-Essential Amino Acids (NEAA) at 37° C. with 5% CO2. HEK293T cells were grown in high-glucose DMEM containing 10% FBS and 1% penicillin/streptomycin. All culture medium, NEAA and antibiotics were purchased from ThermoFisher Scientific (Waltham, Mass.).
The following antibodies were used: a mouse monoclonal antibody (mAb) 4G2 cross-reactive with flavivirus E protein (ATCC); goat anti-mouse IgG conjugated with Alexa Fluor®488 (Thermo Fisher Scientific, Waltham, Mass.); goat anti-mouse or anti-rabbit IgGs conjugated with horseradish peroxidase (IgG-HRP), protein A conjugated with HRP (A-HRP; Sigma, St. Louis, Mo.); rabbit or mouse control IgGs (ThermoFisher Scientific); rabbit IgG against ZIKV NS1, mouse IgG anti-ZIKV E, rabbit IgG anti-ZIKV prM (Alpha Diagnostic Intl. Inc., San Antonio, Tex.); mouse anti-HA (Abcam, Cambridge, United Kingdom); and rabbit anti-HA (Sigma).
Plasmid Construction.
The NS1 K265E mutation was introduced into the ZIKV infectious clone pFLZIKV containing the cDNA sequence of Cambodian strain (FSS13025) (Shan et al., 2016b) through an overlap PCR approach. Briefly, a cDNA fragment flanked between restriction sites AvrII (positions 1532-1537 in ZIKV genome) and SphI (positions 3856-3861 in ZIKV genome) was amplified by overlap PCR. The A3282G (NS1 K265E) mutation was introduced into the overlap primers during primer synthesis. The overlap PCR product containing the A3282G mutation was digested with AvrII and SphI restriction enzymes and cloned into the pFLZIKV.
Prior to construction of the infectious clone of ZIKV strain PRVABC59 (ZIKV-PRV), the parental viruses were propagated on Vero cells for two passages and subjected to whole-genome sequencing. Specifically, viral RNA was extracted using QIAamp Viral RNA Kits (Qiagen, Hilden, Germany). cDNA fragments covering the complete genome were synthesized from genomic RNA using the SuperScript® III One-Step RT-PCR System with Platinum® Taq DNA Polymerase (Invitrogen) according to the manufacturer's instructions. Similar strategy as previously reported for making ZIKV FSS13025 infectious clone (Shan et al., 2016b) was used to construct the infectious clone of ZIKV-PRV.
A mammalian expression vector, pXJ (Xie et al., 2013), driven by a cytomegalovirus (CMV) promoter was used to express the polyprotein E24-NS1-NS2A-HA of ZIKV strain FSS13025. The C-terminal 24 amino acids of the E protein were retained to ensure the correct targeting and processing of NS1 in the ER membrane. The gene cassette encoding E24-NS1-NS2A was amplified from pFLZIKV (Shan et al., 2016b) by PCR using primer pair P1 (5′-GATGCGGCCGCACCATGAATGGATCTATTTCCCTTATGTGCTTG-3′) and reverse primer P2 (5′-TAATCTGGAACATCGTATGGGTAGGATCCCCGCTTCCCACTCCTTGTGAGCA-3′). The human influenza hemagglutinin (HA) tag (GSYPYDVPDYA) sequence was in-frame fused to the C-terminus of NS2A through a second PCR using primer P1 and P3 (5′-GACCTCGAGCTAAGCGTAATCTGGAACATCGTATGGGTAGGATCC-3′). The purified PCR fragment was cloned into pXJ vector through restriction enzymes NotI and XhoI. All plasmids were validated by restriction enzyme digestion and DNA sequencing from GENEWIZ (South Plainfield, N.J.). Other primer sequences and the complete pFLZIKV-PRV sequence are available upon request.
RNA In Vitro Transcription, Electroporation and Immunofluorescence Assay.
Plasmid linearization, RNA in vitro transcription and Vero cell electroporation were performed according to previously described protocols (Shan et al., 2016b). After electroporation, cells were seeded in a T-175 flask for virus production or 8-well chamber slide for monitoring E protein expression by immunofluorescence assay (IFA). IFA was performed as described previously (Shan et al., 2016b). Antibody 4G2 and goat anti-mouse IgG conjugated with Alexa Fluor®488 were used as primary and secondary antibodies, respectively. Finally, the cells were mounted in a mounting medium with DAPI (4′,6-diamidino-2-phenylindole; Vector Laboratories, Inc., Burlingame, Calif.). Fluorescence images were acquired by a fluorescence microscope equipped with a video documentation system (Olympus, Shinjuku, Tokyo, Japan).
Virus Replication Kinetics and Plaque Assay.
C6/36 cells (1.2×106 cells/well), BHK-21 cells (8×105 cells/well), Vero cells (8×105 cells/well) or Huh? cells (8×105 cells/well) were seeded into a 6-well plate one day prior to infection. At 16-20 h post-seeding, cells were infected with WT or mutant ZIKV at an MOI 0.01. Infection was performed in triplicate at 30° C. (C6/36 cells) or 37° C. (BHK-21, Vero and Huh? cells). After 1 h incubation, virus inoculum were removed and cells were washed extensively by PBS to eliminate unabsorbed viruses. Afterwards, 3 ml fresh medium was added to each well. From day 1 to 6 post-infection, supernatants were collected daily and clarified by centrifugation at 500 g for 5 min prior to storage at −80° C. Virus in the culture fluids were determined by standard cytopathogenic effect-based plaque assay on Vero cells (Shan et al., 2016b). Plaques formed on Vero monolayers were stained by crystal violet after 4 days of infection.
Replicon Transient Transfection Assay.
This assay was performed as described previously (Xie et al., 2016). WT or NS1 K265E (10 μg) ZIKV FSS13025 replicon RNAs were electroporated into Vero cells. At given time points, cells were washed twice with PBS and lysed in 100 μl 1× Renilla luciferase lysis buffer (Promega, Madison, Wis.). Luciferase signals were immediately measured by Cytation 5 (Biotek, Winooski, Vt.) according to the manufacturer's instructions.
Plaque purification. Vero cells (8×105 per well) were seeded into a 6-well plate. At 18-24 hour post-seeding, 200 μl serial dilutions of ZIKV (102 to 105 PFU/ml) were inoculated onto the monolayer for infection at 37° C. for 1 hour. Afterwards, virus inoculants were replaced with 3 ml of the first overlay (DMEM supplemented with 3.7 g/L NaHCO3, 2% FBS [v/v], 1% penicillin/streptomycin [v/v] and 1% Lonza SeaPlaque™ agarose [w/v]). Plates were incubated at 37° C. with 5% CO2. After four days of incubation, 3 ml of the second overlay (first overlay supplemented with 1/50 0.33% neutral red solution [Sigma]) was added to the top of the first layer. Plates were incubated at 37° C. with 5% CO2 for another two days. Sequentially, individual plaques were harvested and transferred into a 24-well plate pre-seeded with 2×105 Vero cells. After 2-3 days of incubation, cytopathic effects occurred in 24-well plates. Immediately, supernatants were harvested, clarified by centrifugation at 500 g for 5 min and stored at −80° C. The titers and plaque morphologies of all isolates were determined by plaque assay (Shan et al., 2016b). The cDNA sequence of the viral genomes from three large and three small plaque isolates were determined by Sanger sequencing.
Quantitative Reverse Transcription PCR (qRT-PCR).
Viral RNAs in culture fluids were extracted using QIAamp viral RNA minikit (Qiagen), and intracellular total RNAs were isolated using an RNeasy minikit (Qiagen). Extracted RNAs were eluted in 50 μl RNase-free water. One specific probe (5′-FAM/AGCCTACCT/ZEN/TGACAAGCAATCAGACACTCAA/3IABkFQ-3′) and a primer set (ZIKV_1193F: 5′-CCGCTGCCCAACACAAG-3′; ZIKV_1269R: 5′-CCACTAACGTTCTTTTGCAGACAT-3′) were used to determine the ZIKV RNA copies. The probe contains a 5′-FAM reporter dye, 3′ IBFQ quencher, and internal ZEN quencher. qRT-PCR assays were performed on the LightCycler® 480 System (Roche) following the manufacturer's protocol by using 15 μl reactions of the QuantiTect Probe RT-PCR Kit (QIAGEN) and 1.50 RNA templates. In vitro transcribed full-length ZIKV RNAs were used as RNA standard for RT-PCR quantification. The mRNA level of the housekeeping gene glyceraldehyde-3-phophate dehydrogenase (GAPDH) was measured using an iScript one-Step RT-PCR kit with SYBR green (Bio-Rad) and a primer pair M_GAPDH-F (5′-AGGTCGGTGTGAACGGATTTG-3′) and M_GAPDH-R (5′-TGTAGACCATGTAGTTGAGGTCA-3′).
Quantification of Extra- and Intracellular Infectious Virions.
At selected time points, about 1 ml of culture fluids were harvested and centrifuged at 500 g for 5 min to remove cell debris prior to storage at −80° C. Infected cells were washed three times with cold PBS to remove unbound virions. As indicated in
Co-Immunoprecipitation (Co-IP).
Co-IPs were performed according to a previous described protocol (Zou et al., 2014) with some modifications. For infection samples, 3×106 Vero cells in 6-cm dishes were infected with recombinant WT or NS1 K265E ZIKV strain FSS13025 at MOI 1.0. At 32 h p.t., cells were washed three times with PBS and lysed in 1 ml Pierce™ IP lysis buffer at 4° C. for 30 min. For transfection samples, 3×106 HEK293T cells in 6-cm dishes were transfected with 5 μg of plasmids encoding WT or NS1 K265E mutated polyprotein E24-NS1-NS2A-HA using X-tremeGENE 9 DNA transfection reagent (Roche) according to the manufacturer's instructions. At 42 h p.t., cells were washed twice with cold PBS an lysed in 1 ml immunoprecipitation (IP) buffer (20 mM Tris, pH 7.5, 100 mM NaCl, 0.5% DDM, and EDTA-free protease inhibitor cocktail [Roche]) with rotation at 4° C. for 1 h. All cell lysates were clarified by centrifugation at 15,000 rpm at 4° C. for 30 min and subjected to co-IP using protein G-conjugated magnetic beads according to the manufacturer's instructions (Millipore). Briefly, immune complexes were formed at 4° C. overnight by mixing 400 μl of cell lysate with 2 μg corresponding antibodies (rabbit anti-NS1, mouse anti-HA, rabbit control IgGs or mouse control IgGs) in a 500 μl reaction system containing 300 mM sodium chloride. Subsequently, the complexes were precipitated with protein G-conjugated magnetic beads at 4° C. for 1 h with rotation, followed by washing extensively with phosphate-buffered saline (PBS) containing 0.1% Tween 20 (Sigma). Finally, proteins were eluted with 4× lithium dodecyl sulfate (LDS) sample buffer (ThermoFisher Scientific) supplemented with 100 mM DTT, heated at 70° C. for 10 min, and analyzed by Western blotting described as below.
SDS-PAGE and Western blotting. Proteins were resolved in 12% SDS-PAGE gels and transferred onto a polyvinylidene difluoride (PVDF) membrane by using a Trans-Blot Turbo transfer system (Bio-Rad Laboratories, Hercules, Calif.). The blots were blocked in TBST buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 0.1% Tween 20) supplemented with 5% skim milk for 1 h, followed by probing with primary antibodies (1:2,000 dilution) for 1 h at room temperature. After two washes with TBST buffer, the blots were incubated with a goat anti-mouse or goat anti-rabbit IgG conjugated to HRP (1:20,000 dilution) in TBST buffer with 5% milk for 1 h, followed by three washes with TBST buffer. The antibody-protein complexes were detected using Amersham ECL Prime Western blotting detection reagent (GE Healthcare, Chicago, Ill.).
Mouse Experiments.
A129 mice (interferon type I receptor-knockout) were used to examine the virulence of recombinant WT or NS1 K265E ZIKV FSS13025. Experiments were performed according to a previously described protocol with some modifications (Shan et al., 2016b). In brief, 6-week-old A129 mice were infected with 104 PFU via the intraperitoneal route. Eight mice were used for each group. Calcium and magnesium-free DPBS (ThermoFisher Scientific) was used to dilute the virus stocks to the desired concentration. DPBS injection was used as mock-infection. On day 1 to 4 post-infection, four mice from each cohort were bled via the retro-orbital sinus (RO) after being anesthetized. Serum was clarified by centrifugation at 6000 g for 5 min and immediately stored at −80° C. prior to plaque assay for viremia. All animal work was completed in compliance with the UTMB policy as approved by the Institutional Animal Care and Use Committee (IACUC).
Infection of Mosquitoes with ZIKV.
Aedes aegypti colony mosquitoes derived from Galveston, Tex., were fed for 30 min on blood meals. The blood meals consist of 1% (weight/vol) sucrose, 20% (vol/vol) FBS, 5 mM ATP, 33% (vol/vol) PBS-washed human blood cells (UTMB Blood Bank), and 33% (vol/vol) DMEM medium. The 1 ml-blood meals were combined with 1 ml virus offered in Hemotek 2-ml heated reservoirs (Discovery Workshops) covered with a mouse skin. Virus titer in the blood meals ranged from 6.0 to 6.5 log 10 PFU/ml. Infectious blood meals were loaded on cartons containing A. aegypti. Engorged mosquitoes were incubated at 28° C., 80% relative humidity on a 12:12 h light:dark cycle with ad libitum access to 10% sucrose for 14 days, then frozen at −20° C. overnight. To assess infection, whole bodies of individual mosquitoes were individually homogenized (Retsch MM300 homogenizer, Retsch Inc., Newton, Pa.) in DMEM with 20% FBS and 250 μg/ml amphotericin B. The samples were then centrifuged for 10 min at 5,000 rpm. Afterwards, 50 μl of supernatants were inoculated into 96-well plates containing Vero cells at 37° C. and 5% CO2 for 3 days. Cells were fixed with a mixture of ice-cold acetone and methanol (1:1) solution and immunostained as described previously (Shan et al., 2016b). The infection rate was calculated using the number of virus-positive mosquito bodies divided by the total number of engorged and incubated mosquitoes.
Identification of NS1 K265E Mutation.
To identify cell-adaptive mutation(s) that can increase the yields of ZIKV production on Vero cells, we used a one-step plaque-purification approach to isolate virus clones with increased replication competency using Cambodian strain FSS13025. This ZIKV strain was isolated in 2010 from the blood of a three-year old patient from Cambodia (Heang et al., 2012), and had been cultured thrice on Vero cells. This parental isolate generated heterogeneous plaque sizes on Vero cells (
Characterization of Recombinant NS1 K265E ZIKV FSS13025.
Since mutations other than NS1 K265E were also recovered from S1-3 viruses, we engineered the NS1 K265E mutation into the ZIKV strain FSS13025 to verify its role in increased plaque morphology. Both WT and NS1 K265E mutant genomic RNAs were electroporated into Vero cells. An increasing number of the transfected cells expressed viral E protein from 24 to 72 h post-transfection (p.t.); interestingly, the K265E mutant RNA produced more E-positive cells than the WT at 48 and 72 h p.t. (
To examine the effect of NS1 K265E on viral infectivity, we determined the RNA copy/plaque-forming unit (PFU) ratio for both WT and NS1 K265E viruses. The extracellular viral RNA copies represented total virus (including both infectious and non-infectious) released into the culture fluids, while the PFU numbers indicated the amounts of infectious virions. Both the WT and mutant (collected at 72 h p.t.) showed similar RNA copy/PFU ratios (
Comparison of viral replication of WT or NS1 mutant ZIKV FSS13025 in cell culture. We compared the replication kinetics of WT and NS1 K265E viruses in mosquito (C6/36), hamster (BHK-21), monkey (Vero), and human (Huh7) cell lines. Interestingly, the mutant and WT viruses showed comparable replication kinetics on C6/36 and BHK-21 cells (
NS1 K265E mutation enhances the replication of ZIKV strain PRVABC59 in Vero cells. To examine whether the effects of NS1 K265E on viral replication is ZIKV strain-dependent, we engineered this mutation into a new infectious cDNA clone of ZIKV Puerto Rico strain PRVABC59 (GenBank number KU501215) isolated in 2015 (Lanciotti et al., 2016). We chose PRVABC59 because this strain was previously used to produce an inactivated vaccine [with monkey efficacy (Abbink et al., 2016)] that is currently in phase I clinical trials (https://clinicaltrials.gov). As depicted in
The RNA transcribed from pFLZIKV-PRV was infectious, as evidenced by increasing E-positive cells upon transfection into Vero cells (
NS1 K265E mutation enhances virus assembly, but retards virus entry. To understand which step(s) of the viral infection cycle were affected by NS1 K265E mutation, we engineered the mutation into a luciferase reporter ZIKV replicon (Xie et al., 2016). After transfection of Vero cells with equal amounts of replicon RNAs, the WT and mutant produced comparable amounts of luciferase activity 2-46 h p.t. (
Next, we used recombinant Cambodian FSS13025 virus to examine the effect of the NS1 K265E mutation on a single infection cycle.
Surprisingly, at 1 h p.i., the intracellular level of mutant viral RNA of was about half of the WT virus (
Mutation K265E increases NS1/NS2A interaction. The structure of ZIKV NS1 consists of an N-terminal β-roll, an epitope-rich wing domain, and a C-terminal β-ladder (Brown et al., 2016). Residue K265 is located at the C-terminal β-ladder, and is spatially clustered with two other positively charged residues (R294 and R347) on the surface of the NS1 molecule (
Since NS2A is known to modulate flavivirus assembly (Kummerer and Rice, 2002; Leung et al., 2008; Xie et al., 2013), we tested whether K265E changed the NS1/NS2A interaction. Due to the lack of availability of specific antibodies against ZIKV NS2A, we performed the co-immunoprecipitation experiment using a plasmid co-expressing NS1 and HA-tagged NS2A proteins. As shown in
NS1 K265E mutation does not affect ZIKV virulence in the A129 mouse model. We evaluated the in vivo virulence of WT and mutant NS1 K265E ZIKVs in the A129 mice by monitoring the viremia and weight loss (Shan et al., 2016b). Equal amounts (1×104 PFU) of each virus were inoculated into mice via the intraperitoneal (i.p.) route. Unexpectedly, the WT and mutant viruses produced statistically indistinguishable levels of viremia (
NS1 K265E mutation decreases viral infection of Ae. aegypti mosquitoes. To understand whether the NS1 K265E mutation affects viral fitness in mosquitoes, we determined the oral susceptibility of A. aegypti using artificial human bloodmeals containing approximately 106 PFU/ml of the K265E mutant or WT virus (Shan et al., 2016b). On day 14 post-feeding, engorged mosquitos were analyzed for the presence of virus in the bodies to estimate infection rates. As summarized in Table 1, NS1 K265E virus showed a significantly lower infection rate than the WT virus in mosquitoes, demonstrating that the mutation reduced virus fitness for infection of A. aegypti mosquitoes.
aAfter blood meal, viral titers for both parental and recombinant viruses were measured by plaque assay to ensure the accuracy of virus amounts in the blood meal.
bInfection rate = (number of infected mosquitos/number of engorged mosquitos) × 100%.
PrM H83R and NS3 S356F mutations further increase viral yield on Vero cells. Although the above results demonstrated that NS1 K265E enhanced viral yield, we asked whether other cell adaptive mutations could further increase virus production on Vero cells. To address this question, we engineered two additional cell-adaptive mutations (prM H83R and NS3 S356F) in the context of NS1 K265E pFLZIKV-PRV. PrM H83R mutation was identified from passaging of ZIKV FSS13025 on Vero cells (our unpublished data). NS3 S356F mutation was recently reported to increase ZIKV replication in cell culture (Tsetsarkin et al., 2016). In vitro transcribed genomic RNAs (prM H83R+NS1 K265E; NS1 K265E+NS3 S356F, and prM H83R+NS1 K265E+NS3 S356F) were electroporated into Vero cells. At 72 h p.t., about 4-, 3-, and 6-fold more viruses were produced from the prM H83R+NS1 K265E, NS1 K265E+NS3 S356F, and prM H83R+NS1 K265E+NS3 S356F RNA-transfected cells than the NS1 K265E RNA-transfected cells, respectively (
Virus Thermostability Assay.
Equal amounts (2×105 PFU/ml) of recombinant WT and NS1 K265E mutant ZIKV strain FSS13025, and DENV-2 New Guinea strain (as positive control) in DMEM medium containing 2% FBS were pre-incubated at 37° C. or 40° C. for 30 min or 60 min, respectively. After the treatment, virus titers in each sample were determined by plaque assay. For determining the initial input amount of viruses, untreated samples were immediately titrated for plaque assay. The relative infectivity was calculated by normalizing the virus titers of treatment groups to those of untreated groups. Experiments were performed three times in triplicate. See
Purified inactivated vaccine (PIV) is one of the frontrunners in the rapidly evolving ZIKV vaccine pipeline. A PIV using ZIKV strain PRVABC59 completely protects rhesus macaques from ZIKV challenge (Abbink et al., 2016), and is currently undergoing a phase I clinical trial (https://clinicaltrials.gov). Licensed PIVs have been developed for TBEV and JEV (Shan et al., 2016a). Technologies that can increase the yield of virus production with shortened manufacture time will greatly reduce the cost and increase the vaccine accessibility. Here, we report a ZIKV with triple mutations (prM H83R+NS1 K265E+NS3 S356F) that greatly increased viral replication in Vero cells. Our findings will be useful for PIV manufacture because Vero cells are approved for vaccine production (Griffiths, 1987).
The NS1 K265E mutation was initially identified from plaque purification using the parental ZIKV strain FSS13025. This mutation was consistently recovered from viruses recovered from large plaques, but not from small plaques (
Mechanistically, we provided five lines of evidence that NS1 K265E modulates the steps of viral entry and assembly during an infection cycle. (i) NS1 K265E did not affect virus attachment to the cell surface (
Flavivirus entry and assembly are tightly controlled by the spatial and temporal interplays between host and viral factors. How does the NS1 K265E mutation affect both ZIKV entry and assembly? The flavivirus NS1 is a multifunctional protein involved in viral replication (Lindenbach and Rice, 1997, 1999; Youn et al., 2012), virion assembly (Scaturro et al., 2015), and evasion of host immune response (Avirutnan et al., 2011; Chung et al., 2006). The crystal structure of ZIKV NS1 shows an elongated hydrophobic surface for membrane association and a polar surface that varies substantially among different flaviviruses (Brown et al., 2016). Amino acid K265, together with two nearby positively charged residues (R294 and R347), could contribute to the positive surface of the β-ladder domain of NS1 (
The flavivirus E protein interacts with multiple cell surface receptors and attachment factors to facilitate virus entry. Many cell surface factors are reported to mediate flavivirus entry, including heat shock proteins, phosphatidylserine receptors [TIM (Tyro3, Ax1, and Mer) and TAM (T cell, immunoglobulin, and mucin)], claudin-1, heparan sulfate, dendritic cell-specific intracellular adhesion molecular-3 grabbing nonintegrin (DC-SIGN), mannose receptor, and C-type lectin domain family 5 member A (Perera-Lecoin et al., 2014). ZIKV selectively binds to TAM, but not TIM phosphatidylserine transmembrane receptor (Hamel et al., 2015). The ER membrane contains phosphatidylserine lipids in the luminal leaflet (Leventis and Grinstein, 2010), and NS1 is proposed to assist in virion morphogenesis via its lipid-remodeling activity, membrane association capability, and interactions with viral non-structural and structural proteins (Scaturro et al., 2015). It is thus tempting to speculate that mutation K265E alters NS1's ability to recruit specific lipids during virion budding. The altered lipid components in virion bilayer could consequently modulate the kinetics of viral entry.
In contrast to the enhanced viral replication on Vero cells, NS1 K265E did not significantly change the virulence of ZIKV in the A129 mice (
In mosquito hosts, NS1 K265E virus replicated to the WT level on C6/36 cells, but significantly reduced its ability to infect A. aegypti (Table 1). The reduced vector infectivity of NS1 K265E ZIKV could explain its rarity in clinical isolates. Only 3 out of 169 ZIKV full-length sequences in the GenBank exhibit the NS1 K265E mutation. Since Vero cells are routinely used to isolate ZIKV, it remains to be determined whether the NS1 265E sequence from the 3 clinical isolates (GenBank number ANN83272, AOX49265, and AMS00611) resulted from adaptation to Vero cells during virus isolation.
Our study has provided a new platform to reproducibly generate high yields of ZIKV for PIV manufacture. Specifically, the infectious ZIKV cDNA clone of PRVABC59 containing the triple mutations (prM H83R+NS1 K265E+NS3 S356F) could be used to launch ZIKV production on Vero cells. The mechanism of how prM H83R and NS3 S356F mutations increase viral replication remains to be understood. In addition, further studies are needed to investigate the effect of prM H83R and NS3 S356F mutations on ZIKV virulence and vector infection. Nevertheless, compared with the traditional method of virus amplification from seed viruses, the cDNA clone-launched PIV manufacture platform has the advantages of higher yields, shortened manufacture time, higher reproducibility (viruses directly produced from in vitro synthesized RNA), and a reduced risk of contamination (due to the elimination of isolation and multiple rounds of passaging of seed viruses in cell culture). Since ZIKV strain PRVABC59 was used for the current PIV clinical trial, our mutant cDNA plasmid could be readily used for this vaccine manufacture.
In summary, this invention provides an infectious cDNA clone-launched platform to maximize the yield of ZIKV. A single NS1 protein substitution (K265E) was identified to increase ZIKV replication on Vero cells (a cell line approved for vaccine production) for both Cambodian FSS13025 and Puerto Rico PRVABC59 strains. The NS1 mutation did not affect viral RNA synthesis, but significantly increased virion assembly, probably through an increased interaction between NS1 and NS2A (a known regulator of flavivirus assembly). The NS1 mutant virus retained wildtype virulence in the A129 mouse model, but decreased its competence to infect Aedes aegypti mosquitoes. To further increase virus yield, we constructed an infectious cDNA clone of the clinical trial PIV strain PRVABC59 containing three viral replication-enhancing mutations (NS1 K265E, prM H83R, and NS3 S356F) that could generate a viral titer of >108 PFU/ml on Vero cells, and produced >25-fold more ZIKV than the wildtype parent on Vero cells. Taken together, the results demonstrate that the infectious cDNA clone containing these triple mutations represents an attractive platform to reproducibly generate high yields of ZIKV, which could be readily used for manufacture of PIV for a vaccine clinical trial. This cDNA clone-launched manufacture platform has the advantages of higher virus yield, shortened manufacture time, and minimized chance of contamination. The enhancement of virus production by the cell-adaptive triple mutations and the reported reverse genetic system could be used to manufacture the ZIKV strain PRVABC59-derived purified inactivated vaccine (PIV) that showed efficacy in monkeys and is currently in phase I clinical trial. High-yield manufacture of this PIV is essential for its development and vaccine access.
One skilled in the art will readily appreciate that the present invention is adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The prior examples along with the methods, procedures, treatments, molecules, and specific compounds described herein are presently representative of preferred embodiments, are examples, and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.
In the following listing of claims, all sequence numbers are given with reference to the amino acid sequences of the ZIKV proteins encoded by ZIKV strain FSS13025 (GenBank Accession No. KU955593.1) but are applicable to all homologous sequences, as would be appreciated by one of skill in the art. This includes, for example, ZIKV strain PRVABC59.
The contents of the following references and all other references which are cited in this application are incorporated by reference in their entirety.
In the preceding procedures, various steps have been described. It will, however, be evident that various modifications and changes may be made thereto, and additional procedures may be implemented, without departing from the broader scope of the exemplary procedures as set forth in the claims that follow.
This application claims priority to U.S. Provisional Application No. 62/459,367 filed on Feb. 15, 2017, the contents of which are incorporated by reference in their entirety herein.
The invention was funded by NIH grant R01AI087856, Pan American Health Organization grant SCON2016-01353, and NIH grant A1120942.
Number | Date | Country | |
---|---|---|---|
62459367 | Feb 2017 | US |