Cells expressing calcium channel .alpha.2 subunit-encoding DNA, optionally with a reporter gene for screening assays

Abstract

[DNAs] DNA molecules encoding mammalian calcium channel a.sub.1 and a.sub.2 subunits are provided. The [DNAs] DNA molecules are used to transform host cells which may also contain a reporter gene, the transcription of which is responsive to an ion or molecule capable of entering the cell through a calcium channel.

Description

A number of compounds useful in treating various diseases in animals, including humans, are thought to exert their beneficial effects by modulating functions of voltage-dependent calcium channels. Many of these compounds bind to calcium channels and block, or reduce the rate of, influx of Ca.sup.+2 into cells in response to depolarization of the inside and outside of the cells.

An understanding of the pharmacology of compounds that interact with calcium channels, and the ability to rationally design compounds that will interact with calcium channels to have desired therapeutic effects, have been hampered by a lack of understanding of the structure of channel subunits and the genes that code for them. Thus, it has not been possible to obtain the large amounts of highly purified channel subunits that are required to understand, at the molecular level, the nature of the subunits and their interactions with one another, with the cell membranes across which the channels allow Ca.sup.+2 ions to pass, with Ca.sup.+2 and other ions, and with low molecular weight compounds that affect channel function. For example, with the availability of large amounts of purified calcium channel subunits, functional channels could be prepared and used to screen the effects of compounds on channel function, thereby providing a basis for the design of therapeutic agents which affect the calcium channel, or various combinations of channel subunits could be crystallized and have their structures determined to high resolution employing X-ray or neutron diffraction techniques, providing yet another basis for rational design of therapeutic agents that affect channel function.

Certain diseases, such as Lambert-Eaton Syndrome, involve autoimmune interactions with calcium channels. The ready availability of calcium channel subunits would make possible immunoassays for the diagnosis of such diseases and an understanding of them at the molecular level that could lead to effective methods for treating them.

The lack of information on genes that code for calcium channel subunits has prevented the understanding of the molecular properties of the mature calcium channel subunits and their precursor proteins (i.e., the mature subunits with signal peptides appended to the amino-terminus) and the regulation of expression of calcium channel subunits. An understanding of these properties, and of how expression of calcium channel subunits genes is regulated, may provide the basis for designing therapeutic agents which have beneficial effects through affecting calcium channel function or concentration. Furthermore, the availability of sequences of genes coding for calcium channel subunits would make possible the diagnosis of defects, which might underlie a number of diseases, in genes coding for such subunits.

The availability of a DNA with the sequence of a segment, of at least about 12, and more preferably at least about 30, nucleotides of a cDNA encoding a subunits of a calcium channel from the cells of a tissue of an animal would make possible the isolation and cloning of cDNA's, and possibly genomic DNA's, coding for the corresponding subunits of different calcium channels from the same or different tissues and animals of the same or different species. The availability of the sequences of numerous full-length cDNA's coding for corresponding subunits of calcium channels from a variety of tissues and animal species would contribute to elucidating structure-function relationships in the subunits and this knowledge, in turn, would be useful in the design of therapeutic agents whose activities are exerted through binding to calcium channels.

Voltage-dependent calcium channels are thought to consist of two large subunits, of between about 130 and about 200 kilodaltons ("kD") in molecular weight, and a number (generally thought to be one or three) of different smaller subunits, of less than about 60 kD in molecular weight. At least one of the larger subunits and possibly some of the smaller are glycosylated. Some of the subunits are capable of being phosphorylated. There is confusion in the art concerning the naming of the various subunits of voltage-dependent calcium channels.

The two large subunits of voltage-dependent calcium channels are designated herein the "(alpha).sub.1 -subunit" and the "(alpha).sub.2 -subunit".

The (alpha).sub.1 -subunit is not detectably changed in molecular weight when treated with dithiothreitol ("DTT") or with enzymes which catalyze removal of N-linked sugar groups from glycosylated proteins. The (alpha).sub.1 -subunit has a molecular weight of about 150 to about 170 kD when analyzed by sodium dodecylsulfate ("SDS")-polyacrylamide gel electrophresis ("PAGE") after isolation from mammalian muscle tissue and has specific binding sites for various 1,4-dihydropyridines ("DHPs") and phenylalkylamines.

The (alpha).sub.2 -subunit is somewhat less well characterized than the (alpha).sub.1 -subunit. The molecular weight of the (alpha).sub.2 -subunit is at least about 130-150 kD, as determined by SDS-PAGE analysis in the presence of DTT after isolation from mammalian muscle tissue. However, in SDS-PAGE under non-reducing conditions (in the presence of N-ethylmaleimide), the (alpha).sub.2 -subunit migrates with a band of about 160-190 kD. It is not known in the art whether the smaller fragment (of about 30 kD), which appears to be released upon reduction, is the product of a gene different from the gene which encodes the 130-150 kD fragment (and, consequently, the two fragments are different subunits of the calcium channel) or whether both fragments are products of the same gene (and, consequently, the (alpha).sub.2 -subunit is about 160-190 kD and is split into (at least) two fragments upon reduction). There is evidence that the (alpha).sub.2 -subunit, whatever its size, and the corresponding fragment produced under reducing conditions, whether part of the (alpha).sub.2 -subunit or not, are glycosylated with at least N-linked sugars and do not have specified binding sites for 1,4-dihydropyridines and phenylalkylamines that are known to bind to the (alpha).sub.1 -subunit.

Reference herein to the precursor of an (alpha).sub.1 -subunit means the protein with the amino acid sequence corresponding to the sequence of the full-length mRNA which, upon translation, results, ultimately, in (alpha).sub.1 -subunit resident as part of a calcium channel in a cell membrane. The precursor protein is converted by various processing steps into the (alpha).sub.1 -subunit. The details of the processing between the precursor and the mature (alpha).sub.1 -subunit are not clear, but the processing possibly involves phosphorylation and also cleavage of the primary translation product to yield the mature (alpha).sub.1 -subunit of the calcium channel.

Similarly, reference herein to the precursor of an (alpha).sub.2 -subunit means the protein with the amino acid sequence corresponding to the sequence of the full-length mRNA which, upon translation, results, ultimately, in (alpha).sub.2 -subunit resident as part of a calcium channel in a cell membrane. The precursor protein is converted by various processing steps into the (alpha).sub.2 -subunit. As with the (alpha).sub.1 -subunit, the details of the processing between the precursor and the mature (alpha).sub.2 -subunit are not clear, but the processing presumably involves at least removal of a leader sequence (i.e., a signal peptide), glycosylation, and, possibly, cleavage to yield what are now thought to be other subunits of the calcium channel.

The cDNA and corresponding amino acid sequence of the (alpha).sub.1 -subunit precursor of a rabbit back skeletal muscle calcium channel has been reported. Tanabe et al., Nature 328, 313-318 (1987).

Calcium channel activity, measured electrophysiologically by voltage-clamp techniques, has been induced in Xenopus laevis oocytes when total mRNA isolated from mammalian brain and cardiac muscle is injected into the oocytes. Also, it has been reported that calcium channel-containing preparations, when reconstituted into lipid bilayers, confer voltage-dependent calcium channel activity on the bilayers.

However, there is no evidence that the (alpha).sub.1 -subunit alone or the (alpha).sub.2 -subunit alone provides a functional calcium channel in oocytes, lipid bilayers or any other situation. It has been recently reported by Hofmann, et al., Trends in Pharmacolog. Sci. 8, 393-398 (1987) that mRNA prepared using the cDNA of (alpha).sub.1 -subunit obtained by Tanabe, et al. was unable to induce calcium channel activity in Xenopus laevis oocytes.

BRIEF DESCRIPTION OF THE FIGURES

FIGS. 1a-1j set forth the nucleotide sequence of the cDNA encoding the (alpha).sub.1 -subunit of the rabbit skeletal calcium channel and the amino acid sequence encoded by the 5,619 nucleotide open reading frame, which encodes a sequence of 1,873 amino acids. The 3' non-coding sequence of the cDNA is 234 nucleotides in length, excluding the poly (dA) tract; and contains a consensus polyadenylation signal ATTAAA (nucleotides 5832-5837) 17 nucleotides upstream from the poly (dA) tract.

FIGS. 2a-2f set forth the 3,802 nucleotide and amino acid sequences of the rabbit skeletal calcium channel (alpha).sub.2 -subunit. The figures include the nucleotides of the cDNA that encodes the (alpha).sub.2 -subunit precursor, including the 308 nucleotides of the 5' untranslated sequence, the 3,318 nucleotide open reading frame and 176 nucleotides of 3' untranslated sequence. The signal peptide of the (alpha).sub.2 -subunit is shown as the first 26 negatively numbered amino acids.

FIG. 3 compares the sequences of the DNA encoding the human neuronal (alpha).sub.2 -subunit with that encoding the rabbit skeletal (alpha).sub.2 -subunit.

DETAILED DESCRIPTION OF THE INVENTION

In short, we have discovered a cDNA which codes for the (alpha).sub.1 -subunit of an animal calcium channel (see FIGS. 1a-1j and a cDNA which codes for the (alpha).sub.2 -subunit of an animal calcium channel (see FIGS. 2a-2f and Example 4).

Thus in one of its aspects, the invention is a DNA which comprises a cDNA which codes for the (alpha).sub.2 -subunit of an animal calcium channel, and the RNA, coding for such a subunit, made upon transcription of such a DNA according to the invention.

In another of its aspects, the invention is a substantially pure (alpha).sub.2 -subunit of an animal calcium channel.

By a "substantially pure" subunit or protein is meant a subunit or protein that is sufficiently free of other polypeptide contaminants to be considered homogeneous by SDS-PAGE or to be unambiguously sequenced.

In another of its aspects, the invention entails an eukaryotic cell with an heterologous calcium channel, said cell made by a process comprising administering to said cell a first composition, which consists essentially of a first RNA which is translatable in said cell into the precursor of the (alpha).sub.1 -subunit of a calcium channel of an animal of a first species, and a second composition which consists essentially of a second RNA which is translatable in said cell into the precursor of the (alpha).sub.2 -subunit of a calcium channel of an animal of a second species, said first and second species being the same or different, provided that at least one of said precursor of said (alpha).sub.1 -subunit and said precursor of said (alpha).sub.2 -subunit is foreign to said cell. Preferred cells for this purpose are Xenopus laevis oocytes.

In another of its aspects, the invention entails a method for assaying a compound for calcium channel agonist or antagonist activity which comprises electrophysiologically measuring the calcium channel activity of a cell described in the immediately preceeding paragraph when such cell is exposed to a solution of the compound being tested for such activity. For similar methods applied with Xenopus laevis oocytes and acetylcholine receptors, see e.g., Mishina et al. Nature 313, 364 (1985) and, with such oocytes and sodium channels, see Noda et al., Nature 322, 826-828 (1986).

In a further of its aspects, the invention is an eukaryotic cell containing a DNA which comprises a cDNA which can be expressed to make the (alpha).sub.2 -subunit of a calcium channel. Such a cell according to the invention can also contain a DNA which comprises a cDNA which can be expressed to make the (alpha).sub.1 -subunit of a calcium channel. Preferably, the (alpha).sub.2 -subunit or the (alpha).sub.1 -subunit made from such a cDNA in such a cell will be foreign to the cell, i.e., will have an amino acid sequence which differs from that of any calcium channel (alpha).sub.1 -subunit or (alpha).sub.2 -subunit which occurs in a cell of the same type which does not contain a DNA from which the (alpha).sub.1 -subunit or the (alpha).sub.2 -subunit encoded by such a cDNA is expressed. Preferred among such cells are those of mammalian origin, such as COS cells, NIH3T3 cells, mouse L cells or the like, or those of yeast such as S. cerevisiae or P. pastoris. Methods of making such cells of the invention, by transforming cells with suitable heterologous DNAs, to be maintained in the cell as episomes or (preferably) integrated into chromosomal DNA of the cell, and then culturing transformants or subculturing (or passaging, in the case of mammalian cells) from such a culture or a subculture thereof, are well known to those of ordinary skill.

Among such cells of the invention, the invention entails also an eukaryotic cell with an heterologous calcium channel, said calcium channel made by a process comprising expression of a first cDNA, which codes for the precursor of the (alpha).sub.1 -subunit of a calcium channel of an animal of a first species, and a second cDNA, which codes for the precursor of the (alpha).sub.2 -subunit of a calcium channel of a second species, said first and second species being the same or different. Usually at least one of said precursor of said (alpha).sub.1 -subunit and said precursor of said (alpha).sub.2 -subunit is foreign to said cell. Again, preferred among such cells are those of mammalian origin or those of yeast such as S. cerevisiae cells or P. pastoris. In a preferred embodiment, such a cell will also contain another heterologous gene, which comprises a transcriptional control element (e.g., a promoter or promoter/enhancer combination), which is active in said cell and the transcriptional activity of which responds to an ion or molecule capable of entering said cell through a functional calcium channel (e.g., Ca.sup.++, Ba.sup.++, Ca.sup.++ ionophores), linked operatively for expression to a structural gene for an indicator protein, such as chloramphenicol acetyltransferase, luciferase or .beta.-galactosidase.

These cells of the invention, which have functional, foreign calcium channels (i.e., functional calcium channels wherein at least one of the (alpha).sub.1 -subunit and the (alpha).sub.2 -subunit is foreign to the cell) will be useful for, among other purposes, assaying a compound for calcium channel agonist or antagonist activity. First, such a cell can be employed to measure the affinity of such a compound for the functional calcium channel. Secondly, such a cell can be employed to measure electrophysiologically the calcium channel activity in the presence of the compound being tested as well as a ion or molecule, such as Ca.sup.++ or Ba.sup.++, which is known to be capable of entering the cell through the functional channel. For similar studies which have been carried out with the acetylcholine receptor, see Claudio et al. Science 238 1688-1694 (1987). These methods for assaying a compound for calcium channel agonist or antagonist activity are also part of the present invention.

Such cells according to the invention, in the preferred embodiment, wherein the cell also contains an heterologous gene with a transcriptional control element, which is active in the cell and responsive to an ion or molecule capable of entering the cell through a functional calcium channel and is linked operatively for expression to a structural gene for an indicator protein, can also be employed, in another method according to the invention for assaying a compound for calcium channel agonist or antagonist activity. This method comprises exposing a culture of such cells to a solution of a compound being tested for such activity, together with an ion or molecule, which is capable of entering the cells through a functional calcium channel and affecting the activity of the transcriptional control element controlling transcription of the gene for the indicator protein, and comparing the level of expression, in the cells of the culture, of the gene for the indicator protein with the level of such expression in the cells of another, control culture of such cells.

A "control culture," as clearly understood by the skilled, will be a culture that is, and is treated, substantially the same as the culture exposed to the compound being assayed except that the control culture is not exposed to the compound being assayed. Levels of expression of the genes for the indicator proteins are ascertained readily by the skilled by known methods, which involve measurements of the concentration of indicator protein via assays for detectable compounds produced in reactions catalyzed by the indicator protein.

As indicated above, indicator proteins are enzymes which are active in the cells of the invention and catalyze production of readily detectable compounds (e.g., chromogens, fluorescent compounds).

In a still further aspect, the invention is a method for diagnosing Lambert-Eaton Syndrome in a person by immunoassay which method comprises combining serum from the person with (alpha).sub.1 -subunit of a first animal species and (alpha).sub.2 -subunit of a second animal species (the same as or different from the first species) and ascertaining whether antibodies in the serum react with one or both of the subunits to a greater extent than antibodies in control serum (e.g., from a person or group of persons known to be free of the Syndrome). Any immunoassay procedure known in the art for detecting antibodies in serum against a given antigen can be employed in the method. Preferably, in the method, both of the (alpha) subunits are from a mammalian calcium channel, most preferably human.

The invention entails also a labeled (e.g., .sup.32 P or a biotinylated) RNA or single-stranded DNA of at least 12 (preferably at least 30) bases in length in a sequence which comprises a sequence of at least 12 (preferably at least 30) contiguous bases between bases -238 and 3495, inclusive, in FIGS. 2a-2f below, or such a labeled RNA or single-stranded DNA with a sequence taken from the cDNA, described in Example 4, which encodes an human neuronal (alpha).sub.2 -subunit. The use of such DNAs and RNAs as probes, to identify and isolate cDNAs coding calcium channel (alpha).sub.2 -subunits or to identify tissue in which (alpha).sub.2 -subunit mRNA is made, is clear to the skilled. In this regard, see, e.g., Example 4.

The primary strategy for cloning cDNAs encoding the (alpha).sub.1 and the (alpha).sub.2 polypeptide subunits of the DHP-sensitive calcium channels from rabbit skeletal muscle was to screen rabbit back skeletal muscle lambda gt11 cDNA expression libraries with antibody probes specific to each of the proteins. See generally Ausubel et al. Current Protocols in Molecular Biology, Wiley-interscience, New York (1987); Davis et al. Basic Methods in Molecular Biology, Elsevier Science Publishing Co., New York (1986). Monoclonal antibodies capable of immunoprecipitating the M.sub.r 155K-170K DHP receptor (alpha).sub.1 protein from rabbit skeletal muscle triads have been described previously by Leung, et al. J. Biol. Chem. 262, 7943-7946 (1987). Polyclonal antisera specific for the (alpha).sub.2 polypeptide subunit was prepared in guinea pigs using SDS polyacrylamide gel purified (alpha).sub.2 protein as described by Nakayama, et al. J. Biol. Chem. 262, 6572-6576 (1987). One of the (alpha).sub.1 -specific monoclonal antibodies, designated as IIF7 by Leung, et al. supra, and the (alpha).sub.2 -specific polyclonal antisera were used for screening of 1.0.times.10.sup.6 recombinant phages of an oligo-dT primed lambda gt11 cDNA library. Probes based on the Tanabe et al. (alpha).sub.1 -subunit cDNA sequence (Nature 328, 313-318 (1987)) could also be used to identify clones with fragments of the (alpha).sub.1 -subunit cDNA.

Once a positive clone was found using an antibody-screening method, the clone was used to screen further for overlapping clones. A sequential series of overlapping clones was thus generated. These clones were sequenced and fragments were subcloned into either pIBI 24/25 (IBI, New Haven, Conn.) or M13 mp18/19. In cloning the (alpha).sub.1 -subunit, the DNA sequence was compared to the primary sequence of the DHP receptor (alpha).sub.1 -subunit reported by Tanabe et al. Nucleotide differences resulting in amino acid differences were confirmed by sequencing in both directions.

As pertains to the (alpha).sub.1 -subunit, initially, two cDNA clones which reacted positively with the IIF7 monoclonal antibody were isolated and found to be related by cross-hybridization.

DNA sequencing of one of these clones revealed the presence of a cDNA insert of 453 base pairs (bp). Significantly, this insert coded for a 151 amino acid open reading frame with 28% homology to a region for the Electrophorus electroplax sodium channel sequence. The cDNA insert derived from this clone was used to rescreen the lambda gt11 cDNA library and a rabbit back skeletal muscle Okayama-Berg cDNA library (MacLennan, et al., Nature 316, 696-700 (1985)) to isolate overlapping cDNA clones. The cDNA clones were analyzed using the dideoxy chain-termination method of Sanger to determine the entire coding sequence of the (alpha).sub.1 subunit of the calcium channel and a restriction map was made for comparison and orientation of DNA sequences.

An oligo-dT-primed expression cDNA library was constructed in lambda gt11, using young adult rabbit back skeletal muscle poly (A+) RNA (kindly provided by J. Robbins, University of Cincinnati) isolated in guanidine isothiocyanate (see Gubler, et al. Gene 25, 263-269 (1983); Lapeyre, et al., Gene 37, 215-220 (1985); Huynh et. al, DNA Cloning: A Practical Approach, Vol. I 49-78 (IRL, Oxford, 1985)). Double-strand cDNA was synthesized and EcoRI adapters were added. After the addition of the adapters, the double-strand cDNA was size-selected on a Sepharose CL-4B or Bio-Gel A-50m column. Fragments>1500 bp were ligated into EcoRI digested, dephosphorylated lambda gt11. The library was packaged in vitro with Gigapack-plus, (Stratagene, San Diego, Calif.) and an efficiency of>95% recombinants was determined by plating in the presence of X-gal and IPTG. Two clones of a total 1.times.10.sup.6 recombinants were identified by screening the expression library with monoclonal Ab IIF7 reactive with the M.sub.r 170,000 (alpha).sub.1 subunit of the rabbit skeletal muscle calcium channel. Positive plaques were visualized by binding HRP-goat anti-mouse IgG followed by color development with 4-chloro-1-naphthol. Each clone contained a -500 bp insert and was related by cross-hybridization. One clone was DNA sequenced to identify an open reading frame (nts 2847-3300) and was used to identify a 6.5 Kb transcript by Northern analysis. The 453 bp insert noted above was used to rescreen the lambda gt11 library and 8 of 1.times.10.sup.6 clones were positive. One clone (1700 bp) extended the farthest 5' to nt 2237: its 522 bp PstI fragment, nts 2294-2816, was used to screen 1.times.10.sup.6 transformants of a rabbit back skeletal muscle cDNA library constructed according to the method of Okayama and Berg (see MacLennan, et. al., Nature 316, 696-700 (1985)). Three positive clones were isolated, of which the largest (5.0 Kb) extended 5' to nt -750. The Okayama-Berg cDNA library was rescreened with a 5' 250 bp (PstI)-EcoRI fragment (the PstI site is donated by the Okayama-Berg vector) (nts -750-1006). The longest clone isolated, of 5 positives, was 5.3 Kb, extending 5' to nt -450. To clone the 5' end of (alpha).sub.1, a random primed rabbit back skeletal muscle lambda gt11 cDNA library was synthesized as described above with the following modifications: (1) pd(N).sub.6 hexamers (Pharmacia, Inc. Piscathaway, N.J.) were used to random prime the first strand cDNA reaction, (2) Adapters containing NcoI, KpnI, and EcoRI sites:

5'-CCATGGTACCTTCGTTGACG-3' 3'-GGTACCATGGAAGCAACTGCTTAA-5' were ligated to the double-strand cDNA as described above, and (3) the double-strand cDNA was size-selected on a 1 ml Bio-Gel A50m column. Fragments>600 bp were ligated into lambda gt11. 1.times.10.sup.6 recombinants of this library were screened in duplicate with the 1,648 bp EcoRI/XhoI fragment corresponding to nt 1006-2653 and an oligonucleotide probe spanning the initiating methionine: 5'-GGGAAGCCATGGAGCCATCCTCACCCCAGG-3'. Forty clones were positive with both probes, of which one (1.55 Kb) extended 78 nts 5' of the start codon and -450 bp 3' of the EcoRI site.

FIGS. 1a-1j show the 5,975 nucleotide sequence of the cDNA encoding the (alpha).sub.1 -subunit. There is a 5,619 nucleotide sequence reading frame which encodes a sequence of 1,873 amino acids (FIGS. 1a-1j). The sequence context of the designated initiation codon is consistent with the proposed consensus sequence of Kozak, Nucleic Acids Res. 15, 8125-8132 (1987). The 3' non-coding sequence of the cDNA is 234 nucleotides in length, excluding the poly (dA) tract, and contains a consensus polyadenylation signal ATTAAA (nucleotides 5832-5837) 17 nucleotides upstream from the poly (dA) tract. This cDNA sequence is consistent with an -6,500 nucleotide DHP receptor (alpha).sub.1 mRNA. Furthermore, the DNA sequence is 99.4% identical to the cDNA sequence encoding the DHP receptor reported by Tanabe, et. al., supra. Nucleotide differences were identified at 33 positions, of which three, nucleotides 5423, 5444 and 5504 also result in amino acid changes.

As pertains to the (alpha).sub.2 -subunit, in an initial screen with the guinea pig (alpha).sub.2 -specific polyclonal antisera, three cDNA clones were isolated and shown to be related to each other but not any (alpha).sub.1 cDNA sequences by cross-hybridization. Two of these cDNA clones were used to rescreen the lambda gt11 cDNA library to isolate overlapping cDNA clones. The cDNA clones were analyzed to establish the coding DNA sequence of the (alpha).sub.2 subunit of the calcium channel and a restriction map was made. Approximately 7,850 nucleotides of (alpha).sub.2 cDNA was cloned, which is consistent with an -8,000 nucleotide (alpha).sub.2 mRNA.

An oligo-dT-primed expression cDNA library was constructed in lambda gt11, using young adult rabbit back skeletal muscle poly (A+) RNA as described for the (alpha) 1-subunit. Double-stranded cDNA fragments>1500 bp were ligated into lambda gt11 and a primary plating of 1.times.10.sup.6 recombinants was screened with guinea pig anti-160 Kd (alpha).sub.2 polyclonal anti-sera. Three positive plaques were visualized by binding HRP-Protein A, followed by color development with 4-chloro-1-naphthol. Two clones, (2.5 Kb and 3.6 Kb) overlapped to encode 4.75 Kb of an -8 Kb transcript identified by Northern analysis. (alpha).sub.2 cDNA clones extending in the 5' and 3' direction (oriented by DNA sequencing and identification of a long open reading frame) were isolated by rescreening the same lambda gt11 cDNA library with the (EcoRI)-HindIII fragment of one clone (nts 43-272, 5' proximal; EcoRI site from adapter) or the EcoRI-(EcoRI) fragment of a second clone (-1.0 Kb in the 3' untranslated region). A total of 14 clones were isolated, seven from each end, of which an overlapping pair of clones (one extending -2,750 nts 3' and the other extending 350 nts 5') encoded -7850 nts of the (alpha).sub.2 transcript; 308 nts of 5' untranslated sequence, 3318 nts of coding sequence, and -4224 nts of 3' untranslated sequence. Only 176 nts of 3' untranslated sequence was confirmed in both directions and is reported.

FIGS. 2a-2f represent the 3,802 nucleotides of the cDNA sequence encoding the (alpha).sub.2 -subunit and its precursor, including 308 nucleotides of 5' untranslated sequence, a 3,318 nucleotide open reading frame, and 176 nucleotides of 3' untranslated sequence.

FIGS. 2a-2f also show the signal peptide of the (alpha).sub.2 -subunit, shown as the first 26 negatively numbered amino acids. An arrow identifies the cleavage site between the signal peptide and the mature (alpha).sub.2 -subunit. The N-terminal amino acid sequence previously determined is shown in bold sequence (Thr(+8), Trp(+12), and Asp(+14) were not previously determined.) The nucleotide sequence shown was determined from two clones which overlapped to span the coding sequence of the (alpha).sub.2 -subunit. Five nucleotide differences among individual clones were observed resulting in four amino acid changes. Differences occurred in the sequence at positions 169, 347, 348, 984, and a deletion of nts 1858-1860. The amino acids were finally determined to be as follows: Asn at residue 31, Lys at residue 90, and a deletion of Ser at residue 594. An in-frame upstream stop codon is underlined as well as the start and stop codons of an upstream short open reading frame. Three putative transmembrane regions are enclosed in boxes. Potential N-glycosylation and phosphorylation sites are indicated as described for FIGS. 1a-1j.

The open reading frame encodes a sequence of 1,106 amino acids (FIGS. 2a-2f). The previously determined NH.sub.2 -terminal amino acid sequence of the (alpha).sub.2 protein is encoded by nucleotides 79-129 in the same open reading frame (amino acid residues 1-17. FIGS. 2a-2f). The nucleotide sequence adjacent to the designated initiating codon agrees with the proposed consensus sequence. An in-frame termination codon is present upstream beginning at nucleotide -27. In addition, an out-of-frame potential initiation codon is located beginning at nucleotide -229 and is followed by a nonsense codon at nucleotides -179 to -181. The 5' untranslated sequence of the (alpha).sub.2 cDNA, 308 nucleotides cloned and sequenced thus far, is unusually long. This region is extremely G+C rich, approximately 80% G+C, which is similar to other relatively long 5' non-coding sequences which have been reported.

FIGS. 1a-1j show the 1,873 amino acid sequence deduced from the cDNA of the (alpha).sub.1 subunit of the rabbit skeletal muscle calcium channel. Based on the identification of a clone using the (alpha).sub.1 -specific IIF7 monoclonal antibody, we have determined that the protein sequence encoded by the 453 bp cDNA insert (amino acid residues 950--1,100) contains the epitope recognized by this monoclonal antibody. The complete sequence yields a calculated Mr of 212,143 for the (alpha).sub.1 protein, in contrast to the observed Mr 155K-170K, previously reported by others using SDS polyacrylamide gel electrophoresis. The amino acid sequence determined and reported here is 99.8% identical to that recently described by Tanabe et al., supra, showing three amino acid differences at residues 1,808 (Thr to Met), 1,815 (Ala to Val), and 1,835 (Ala to Glu). The calcium channel (alpha).sub.1 -subunit protein contains five potential N-glycosylation sites at Asn residues 79, 257, 797, 1,464, and 1,674 and seven potential cAMP-dependent phosphorylation sites at Ser residues 687, 1,502, 1,575, 1,757, 1,772, and 1,854, and Thr 1,552. Analogous to the (alpha)-subunit of the sodium channel, the (alpha).sub.1 -subunit of the skeletal muscle calcium channel contains four internal repeated sequence regions. An analysis of the hydropathy profile of the (alpha).sub.1 -protein sequence reveals that each repeat contains five hydrophobic segments and one segment with strong positive charge. Since the (alpha).sub.1 -protein sequence lacks an hydrophobic amino-terminal sequence characteristic of a signal peptide, it has been proposed that the segments of the four internally repeated regions represent twenty-four transmembrane segments and that the amino-and carboxy-termini extend intracellularly. That model is consistent with two of the potential glycosylation sites (Asn residues 79 and 257) being localized extracellularly and all of the potential phosphorylation cites being localized intracellularly. This generally agrees with previous biochemical studies suggesting that the (alpha).sub.1 -subunit (which has been identified as the putative 1,4-dihydropyridine receptor) is not glycosylated but is phosphorylated.

FIGS. 2a-2f show the 1,106 amino acid sequence deduced from the cDNA of the (alpha).sub.2 -subunit of the rabbit skeletal muscle calcium channel. The sequence yields a calculated M.sub.r of 125,018 for this protein, in contrast to the observed M.sub.r 165K-175K (under non-reducing conditions; M.sub.r 135K-150K under reducing conditions) determined previously by SDS polyacrylamide gel electrophoresis. The (alpha).sub.2 amino acid sequence deduced here from the cDNA confirms the sequence of 17 amino acids reported earlier as supposedly that of the amino terminal 17 amino acids of the (alpha).sub.2 -subunit. The (alpha).sub.2 -subunit precursor has a 26 amino acid (residues -1 to -26) signal peptide. While this proposed signal peptide is hydrophobic and of an appropriate length characteristic of signal sequences, it is somewhat unusual in that the peptide has Glu at position-1 and the Gln at position-12 defines a rather short central hydrophic region. The (alpha).sub.2 protein contains 18 potential N-glycosylation sites (Asn residues 68, 112, 160, 300, 324, 444, 451, 580, 589, 652, 671, 758, 801, 865, 872, 962, 975, and 1,005) and two potential cAMP-dependent phosphorylation sites at Thr 477 and Ser 822 (FIGS. 2a-2f).

An analysis of the (alpha).sub.2 protein sequence for regional hydropathy reveals that, in distinct contrast to similar analysis of the (alpha).sub.1 protein, this protein is substantially hydrophilic, although it does contain a number of hydrophobic regions. Further characterization of the hydrophobic regions of polarity index and hydrophobic moment analyses indicates that three segments may represent transmembrane domains of the (alpha).sub.2 protein. The topography of the (alpha).sub.2 protein is not, however, easily predicted from the deduced primary amino acid sequence. This problem is further compounded by the determination that the (alpha).sub.2 protein lacks significant homology with any protein in the Dayhoff protein sequence database or with other known ion channel and receptor proteins. If the proposed (alpha).sub.2 signal sequence is, in fact, cleaved between the Glu-residue at position -1 and the Glu residue at position, then the amino terminus of the mature protein would be extracellular. Furthermore, assuming that the three hydrophobic segments function as transmembrane domains, and that there are only three such domains, the carboxyl-terminus of the (alpha).sub.2 protein would be intracellular. Such a transmembrane topography would be consistent with 8 out of 18 potential N-glycosylation sites being localized extracellularly and the single potential phosphorylation site being localized intracellularly. Previous biochemical studies indicate that the (alpha).sub.2 -subunit of the skeletal muscle calcium channel is not phosphorylated but is extensively glycosylated.

Rabbit and human genomic DNAs were digested with various restriction enzymes and Southern blots of these DNAs were hybridized with radiolabeled cDNA clones specific for the (alpha).sub.1 -subunit or the (alpha).sub.2 -subunit. Under conditions of high stringency, very few hybridizing bands were observed in rabbit genomic DNA with either the (alpha).sub.1 - or (alpha).sub.2 -specific probes. This result is consistent with a low-copy number, perhaps only a single-copy, of each of the (alpha).sub.1 - and (alpha).sub.2 -subunit genes in the rabbit genome. Southern blot of the same DNA preparations were also probed under conditions of low stringency with the same (alpha).sub.1 - and (alpha).sub.2 -specific probes. While additional hybridizing bands were observed in rabbit genomic DNA under low stringency conditions with both the (alpha).sub.1 - and (alpha).sub.2 -specific probes, substantially greater hybridization was observed with the (alpha).sub.1 -specific cDNA probes. These results suggest that the (alpha).sub.1 - and (alpha).sub.2 -subunits of the skeletal muscle DHP-sensitive calcium channel may share significant homology with genes encoding other voltage-dependent DHP-sensitive calcium channels, voltage-dependent calcium channels which are not DHP-sensitive (e.g., T- and N-types), and possibly ligand-gated calcium channels (e.g., glutamate receptor). Interestingly, hybridization bands were observed in human genomic DNA with the (alpha).sub.1 -specific cDNA probes under both high and low stringency conditions, whereas significant hybridization of (alpha).sub.2 -specific cDNA probes were observed only under low stringency conditions. Thus, while there are human genes homologous to the rabbit (alpha).sub.1 - and (alpha).sub.2 -subunit genes, greater evolutionary sequence divergence may have occurred in the (alpha).sub.2 gene relative to the (alpha).sub.1 gene.

A further aspect of the invention provides for a diagnostic assay for Lambert Eaton Syndrome (LES). LES is an autoimmune disease characterized by an insufficient release of acetylcholine from motor nerve terminals which normally are responsive to nerve impulses. A recent publication (Kim and Neher, Science 239, 405-408 (1988)) demonstrates that IgG from LES patients block individual voltage-dependent calcium channels and thus prevent function. A diagnostic assay for LES based on immunological reactivity of LES IgG with calcium channel (alpha).sub.2 -subunit alone or in combination with (alpha).sub.1 -subunit is thus provided for. For example, such an assay may be based on immunoprecipitation of LES IgG by the calcium channels subunits of the invention.

EXAMPLE 1

Isolation of RNA for cDNA Library

On the day before RNA is isolated, prepare the following. As a precaution, all glassware should be baked and all stock solutions in the list immediately below should be sterilized by autoclaving.

200 ml of 0.1 NaOAc, pH 5.2, 1 mM EDTA 50 ml of 0.2M Na.sub.2 EDTA, pH 8.0. 50 ml of 1M Tris, pH 7.5 50 ml of 3.2 Tris, pH 7.2 50 ml of 0.01M Tris (pH 8.0), 1 mM EDTA 50 ml PK buffer (0.1M Tris, pH 7.2, 50 mM NaCl, 10 mM EDTA) 50 ml of 10% SDS, 4 1 of ultrapure H.sub.2 O On the morning of the RNA isolation, combine: 100 ml H.sub.2 O 100 g guanidine isothiocyanate (IBI) 10.6 ml 1M Tris, pH 7.5 10.6 ml 0.2M EDTA Stir, but do not heat above 65.degree. C. to dissolve guanidine isothiocyanate.

Dissect young adult rabbit back skeletal muscle on a clean glass plate and add about 10 g of muscle tissue (cut in -4 mm pieces) to 50 ml of the guanidine isothiocyanate solution in e.g., a 100 ml Wheaton bottle.

Homogenize using "tissuemizer" from Tekman (large blade) for 10-20 sec., or until small pieces are no longer visible.

Place in 60.degree. H.sub.2 O bath, add 30 ml of redistilled phenol which has been made 0.1% in 8-OH quinoline, 0.2% B-ME. Solution should be clear and homogenous after this addition.

Add 30 ml of a 1:1 solution of chloroform:acetate buffer.

Shake vigorously at 60.degree. for 10 minutes; the solutions should appear opaque; if not, add sufficient chloroform:acetate until it turns milky.

Cool on ice, spin to separate phases (7000.times.g, 10-20 minutes)

Take off and pass it vigorously through a 22 gauge needle.

Treat with phenol:chloroform (1:1) saturated with acetate buffer. Extract aqueous layer with 3.times. volume of chloroform. Add 2 vol of -20.degree. EtOH, and ppt for 1-2 hours, but no longer.

Collect precipitate; dry briefly (<5 minutes) under vacuum. Resuspend in 7 ml of PK buffer made 0.2% with respect to SDS. If precipitate develops, heat at 65.degree. until solution clears. Add 1.5 mg of proteinase K.

Incubate 20 minutes at 37.degree. (if you have dried for too long, RNA will be very difficult to get into solution and vigorous pipetting will be necessary throughout the incubation).

Extract reaction with 1:1 phenol:chloroform (made 0.1% in 8-OH quinoline, 0.2% B-ME, saturate with 100 mM Tris, pH 8.5 or PK buffer pH 7.7), 2.times. with chloroform, ppt by addition of 1/10 volume of 3.2M Tris, pH 7.5 and 2 vol. of EtOH. Poly A.sup.+ RNA may then be isolated from the RNA mixture by well-known hybridization methods utilizing matrix-immobilized oligo (dT).

EXAMPLE 2

cDNA Cloning Procedure

1. First Strand Synthesis

a. The following reagents and compositions are combined together and incubated on ice for 5 minutes:

______________________________________ Final concen-Reagent Volume tration______________________________________-5 .mu.g poly A + RNA, plus water to 10.5 .mu.l5X reverse transcriptase buffer 10 .mu.l 1X0.5M DTT 1 .mu.l 10 mMRNasin (24 U/.mu.l) 2 .mu.l -IU/.mu.l5X dNTPs 10 .mu.l 1Xoligo dT (250 .mu.g/ml) 5 .mu.l 25 .mu.g/ml______________________________________

b. Next, the following three reagents are added to (a) and the mixture is incubated at 37.degree. C. for 60 minutes:

______________________________________actinomycin D (600 .mu.g/ml) 4 .mu.l -50 .mu.g/ml.sup.32 P-gammadCTP (3200 Ci/mmol) 2.5 .mu.l --MMLV-reverse transcriptase 5 .mu.l 200 U/.mu.g RNA(BRL-200 U/.mu.l) 50 .mu.l (total a + b)______________________________________

c. The following reagents are added to (b) and the mixture is incubated at 37.degree. C. for 30 minutes:

______________________________________RNasin (24 U/.mu.l) 1 .mu.lMMLV-reverse transcriptase 3 .mu.l(BRL-200 U/.mu.l)______________________________________

d. Take aliquots for analysis:

1 .mu.l at time 0 for TCA 1 .mu.l at 90 minutes for TCA 0.5 .mu.l at 90 minutes for gel

e. The reaction is stopped after 30 minutes by adding 2 .mu.l of 0.5M EDTA and performing one phenol/chloroform extraction, followed by one chloroform extraction. Then 10 .mu.l of 10M NH.sub.4 OAc plus two volumes of ethanol are added to precipitate the first strand.

f. To analyze the synthesis, 0.5 .mu.l of the reaction are run on a 1.5% agarose mini-gel, the gel is photographed, dried, and placed under film (generally an overnight exposure with an intensifying screen is adequate).

g. Calculate the mass of cDNA from the percent incorporation of label above background. 1 .mu.g ss cDNA=1.4% incorporation.

2. Second Strand Synthesis

a. The cDNA-RNA is spun down by centrifugation in a benchtop microfuge for 15 minutes. The pellet is washed in 95% ethanol and dried.

b. The following mixture is assembled and incubated at 12.degree. C. for 60 minutes.

______________________________________ Final Concen- Volume tration______________________________________cDNA RNA, plus water to 68 .mu.l5X 2nd strand buffer 20 .mu.l 1X10 mM B-NAD 1.5 .mu.l 0.15 mM4 mM dNTPs 5 .mu.l 200 .mu.M/mlDNA polymerase I (10 U/.mu.l) 2.5 .mu.l 250 U/mlE. coli DNA ligase (2 U/.mu.l) 2 .mu.l 40 U/mlRNase H (2.3 U/.mu.l) 1 .mu.l 23 U/ml 100 .mu.l______________________________________

c. To this mix is added the following, and incubation continues at 22.degree. C. for 60 minutes:

______________________________________DNA polymerase I (10 U/.mu.l) 1.5 .mu.lE. coli DNA ligase (2 U/.mu.l) 1.5 .mu.l______________________________________

d. The reaction is stopped after 60 minutes by adding 4 .mu.l of 0.5M EDTA and performing one phenol/chloroform extraction and one chloroform extraction.

e. The aqueous phase is run over a G-50 column in a short Pasteur pipet and 100 .mu.l fractions are collected. The 500 .mu.ls containing the cDNA is collected and pooled, and butanol extracted down to a volume of -50 .mu.l. The cDNA is precipitated by adding 10 .mu.l of 10M NH.sub.4 OAc plus two volumes of ethanol.

3. T4 Polymerase Reaction

a. The cDNA is spun down in a microfuge for 15 minutes. A 95% ethanol wash is performed and the cDNA pellet is dried. The dry pellet is counted in a scintillation counter. Assume 100% efficiency of the 2nd strand reaction, and calculate mass of double-stranded cDNA from the first strand calculation.

b. To the cDNA is added the following, and the mixture is incubated at 37.degree. C. for 20 minutes.

______________________________________cDNA +10X T4 buffer 5 .mu.lH.sub.2 O 40.75 .mu.l4mM dNTPs 1.25 .mu.l0.1 mM DTT 2.5 .mu.lT4 polymerase (10 U/.mu.l) 0.5 .mu.l 50 .mu.l______________________________________

c. Aliquots are taken:

0.5 .mu.l for gel at time 0 0.5 .mu.l for gel at 20 minutes

d. The reaction is stopped after 20 minutes by adding 2 .mu.l of 0.5M EDTA, followed by a phenol/chloroform extraction and a chloroform extraction.

e. The aqueous phase is run over a G-50 column in a short Pasteur pipet and 100 .mu.l fractions are collected. The 500 .mu.ls containing the cDNA is collected and pooled, and butanol extracted down to a volume of -50 .mu.l. The cDNA is precipitated by adding 10 .mu.l of 10M NH.sub.4 OAc plus two volumes of ethanol.

f. The 0.5 .mu.l samples taken at time 0 and 20 minutes are run on a 1.5% agarose mini-gel, which is subsequently photographed, dried, and placed under film.

4. Addition of EcoRI Adapters (for insertion into lambda gt11)

a. Oligos are synthesized having the following sequences:

20 mer: 5'-CCATGGTACCTTCGTTGACG-3' 24 mer: 3'-GGTACCATGGAAGCAACTGCTTAA-5'

b. The 20 mer is phosphorylated by combining the following reagents and incubated at 37.degree. C. for 15 minutes.:

______________________________________225 pmoles 20 mer +water 6.8 .mu.l10X kinase buffer 1.2 .mu.l.sup.32 P-gammaATP (7000 Ci/mmole) 1.0 .mu.lkinase (2 U/.mu.l) 1.0 .mu.l 10 .mu.l______________________________________

c. The following two reagents are added to above mixture and it is incubated at 37.degree. C. for 30 minutes:

______________________________________10 mM ATP 1 .mu.lkinase (2 U/ml) 1 .mu.l 12 .mu.l (total b + c)______________________________________

d. The enzyme is then inactivated by boiling for 10 minutes.

e. The 24 mer is hybridized to the phosphorylated 20 mer by addition of 225 pmoles of the 24 mer (plus water to bring volume to 15 .mu.l), and incubation at 65.degree. C. for 5 minutes. The reaction is then allowed to slow cool to room temperature.

The adapters are now present at a concentration of 15 pmoles/.mu.l, and are ready for cDNA-vector ligation.

f. Combine the following:

______________________________________cDNA +hybridized adapters (15 pmol/.mu.l) 50-fold molar excess over cDNAwater 16 .mu.l10X ligase buffer 2 .mu.lligase (10 U/.mu.l) 2 .mu.l 20 .mu.l______________________________________ 5. Phosphorylation of cDNA

a. The ligase is inactivated by heating the mixture to 72.degree. C. for 15 minutes.

b. The following reagents are added to the cDNA ligation reaction and it is heated at 37.degree. C. for 30 minutes:

______________________________________cDNA ligation reaction 20 .mu.lwater 24 .mu.l10X kinase buffer 3 .mu.l10 mM ATP 1 .mu.lkinase (2 U/.mu.l) 2 .mu.l 50 .mu.l______________________________________

c. The reaction is stopped by the addition of 2 .mu.l 0.5M EDTA, followed by one phenol/chloroform extraction and one chloroform extraction.

6. Purification and Size-Selection of cDNA

a. The cDNA is run over a BIO-GEL A-50 column that has been washed with .gtoreq.5 ml of TE buffer. The column has 0.8 ml bed resin in a 0.2 cm (inner diameter).times.30 cm siliconized glass tube with a glass wool plug in a yellow pipet tip at the bottom.

b. The cDNA is dried down in a speed vac to -20 .mu.l. 2.5 .mu.l of gel loading dye is added and the cDNA is run over the column. The counts begin coming off after running 200-250 .mu.l TE buffer through the column. 5 minute fractions (-30 .mu.l) are collected and counted in a scintillation counter. Free adapters may begin to elute off 350-400 .mu.l after the cDNA starts to elute.

c. 0.5 .mu.l of several of the collected fractions are run on a 1.5% agarose minigel. The gel is photographed, dried down, and placed under film.

7. Ligation of cDNA to lambda gt11 vector

a. The fractions containing cDNA are pooled, butanol extracted down to 20-30 .mu.l, and 5 .mu.l of 10M NH.sub.4 OAc plus two volumes of ethanol is added to precipitate the cDNA. It is spun in a microfuge for 15 minutes, and then subjected to a 95% ethanol wash and dry.

b. The pellet is counted, and the mass of cDNA is calculated relative to the mass after the second strand synthesis.

c. The cDNA is resuspended in TE (-0.10 pmol/.mu.l).

d. The ligation reaction contains the following, which is incubated at 14.degree.-16.degree. C. overnight:

______________________________________lambda gt11 (1 g/.mu.l) 1 .mu.lcDNA insert (2-4 fold molar excess of cDNA over vector)water to 3 .mu.l5X ligase buffer 1 .mu.lligase (10 U/.mu.l) 1 .mu.l 5 .mu.l______________________________________ 8. Packaging

The vector is packaged using the Gigapack in vitro packaging kit supplied by Strategene, and following the instructions contained therein.

______________________________________REAGENTS5x RT buffer250 mM Tris, pH 7.4 250 .mu.l of 1M375 mM KCl 375 .mu.l of 1M15 mM MgCl.sub.2 75 .mu.l of 0.2MH.sub.2 O 300 .mu.l 1000 .mu.l5X dNTPs5 mM dATP 14.1 .mu.l3 mM dCTP 9.1 .mu.l5 mM dGTP 13.6 .mu.l5 mM dTTP 13.3 .mu.l 50 .mu.l5X 2nd Strand Buffer100 mM Tris, pH 7.5 100 .mu.l of 1M500 mM KCl 500 .mu.l of 1M50 mM (NH.sub.4).sub.2 SO.sub.4 50 .mu.l of 1M25 mM MgCl.sub.2 125 .mu.l of 0.2M250 .mu.g/ml BSA 5 .mu.l of 50 mg/mlwater 220 .mu.l 1000 .mu.l10X T4 buffer670 mM Tris, pH 8.0 670 .mu.l of 1M167 mM (NH.sub.4).sub.2 SO.sub.4 167 .mu.l of 1M67 mM MgCl.sub.2 67 .mu.l of 1MH.sub.2 O 96 .mu.l 1000 .mu.l______________________________________

EXAMPLE 3

Screening cDNA Library with Antibody

Plate lambda gt11 library on Y1090 in LB agar and 50 .mu.g/ml ampicillin. Grow overnight in 15 ml of LB, 0.2% maltose and 50 .mu.g/ml ampicillin. Pellet the cells and resuspend in 3 ml of 10 mM MgSO.sub.4. Plate four plates at 250,000 plaques/plate using 25 .mu.l of phage (10,000/.mu.l) and 300 .mu.l of said 3 ml solution of cells in 10 ml soft agar containing 50 .mu.g/ml ampicillin.

Grow at 42.degree. C. for 2.5 hours and overlay IPTG-treated filters which were soaked in 10 mM IPTG (Boehringer Mannheim Biochemicals, Indianapolis, Ind.). Dry filters until just moist, lay them in the plates and incubate overnight at 37.degree. C.

Orient the plates and spot 0.5 .mu.l of purified DHP receptor on one plate as a positive control. Wash the filters for 10 min at room temperature TBS (50 mM TRIS, 150 mM NaCl, pH 8.0). Wash filters in TBS, 20% FCS (filtered) for 30 min at room temp.

Incubate the filters for 2 hours in TBS, 20% FCS, anti-DHS-receptor antibody (monoclonal or polyclonal). Wash for 10 min in TBS. Transfer filters to new plates and wash for 1 min in TBS, 0.1% NP40. Wash for 10 min in TBS and transfer to new plates.

Incubate for at least 1 hour with TBS, 20% FCS containing an appropriate second antibody (e.g. HRP-Protein A; or HRP-goat anti-mouse IgG).

Wash filters as described above for the first antibody.

Develop the positive clones using about 40 ml/plate of 4-chloro-1-naphthol reagent which is made by dissolving 60 mg of said developer in 20 ml of ice cold MeOH and mixing 4-chloro-1-naphthol (Aldrich Chemical Company, Milwaukee, Wis.) into 100 ml of TBS containing 60 .mu.l of 30% H.sub.2 O.sub.2.

EXAMPLE 4

An Human Neuronal Calcium Channel (Alpha).sub.2 -Subunit-Encoding cDNA

Because of the indications, mentioned supra, that human calcium channel (alpha).sub.2 -subunit genes had diverged somewhat from rabbit calcium channel (alpha).sub.2 -subunit genes, human (alpha).sub.2 -subunit-encoding fragments were isolated to use as probes to screen human brain cDNA libraries under high stringency conditions.

Thus, an EcoRI-digested human genomic Southern blot was probed under both low and high stringency conditions with a fragment of rabbit (alpha).sub.2 -subunit-encoding cDNA (the fragment from nucleotide 43 to nucleotide 272 indicated in FIGS. 2a-2f). Under low stringency conditions, two genomic fragments were identified, of 3.0 kbp and 3.5 kbp in size. Under high stringency conditions, only the 3.5 kbp fragment maintained a stable hybrid. These two fragments were cloned into lambda-gt11. The 3.5 kbp fragment includes a small PstI-XbaI fragment, of about 300 bp, which includes an 82 bp exon with 96.4% homology to nucleotides 102 to 183 of the sequence in FIGS. 2a-2f. This exon is preceded by the dinucleotide AG (splice donor) and followed by the dinucleotide GT (splice acceptor), as understood in the art. The 3.0 kbp fragment includes an XbaI-BglII fragment, of about 585 bp, which includes 104 bp of an exon (which includes the BglII site at its downstream end) which, in the 104 bp, has 93.3% homology to nucleotides 184 to 287 of the sequence in FIGS. 2a-2f. Both the 300 bp, PstI-XbaI fragment and the 585 bp, XbaI-BglII fragments were used to probe duplicate lifts of a human basal ganglia cDNA library in lambda-gt11 (the library having been obtained from the American Type Culture Collection, Rockville, Md., USA, and containing about 10.sup.6 independent recombinants with an average insert size of 800-1000 bp). Three positive clones were identified which hybridized to both probes under high stringency conditions, one with an insert size of about 1150 bp, another with an insert size of about 790 bp, and the third with an insert size of about 670 bp. The 1150 bp insert in the one clone extended into the coding region from about nucleotide 200 in the coding region and was found to have a sequence more than 90% homologous to that of the corresponding segment of the cDNA whose sequence is presented in FIGS. 2a-2f. Using the lambda genome with the 1150 bp insert as probe, an human brain stem cDNA library (also purchased from the American Type Culture Collection, and having about 4.times.10.sup.6 independent recombinants with an average insert size of 800-1000 bp) was probed under high stringency conditions. In this probing, four positive clones were identified, with inserts of about 950 bp, 1120 bp, 3000 bp and 2500 bp. Most of the 1120 bp insert overlapped the 1150 bp insert of the DNA used as probe but extended somewhat upstream from the upstream end of the 1150 bp insert. The 2500 bp insert extended downstream from about 650 bp from the 5'-end of the 1120 bp insert. The DNA with the 2500 bp insert was used to again probe the brain stem library, and a clone with a 2750 bp insert was found. The 2750 bp insert was found by restriction analysis and sequencing to extend in the 3'-direction beyond the translational stop signal of a reading frame that was found to begin in the 1120 bp insert described above. The 2750 bp insert and 1120 bp insert have a PvuII site in common and have been ligated using the PvuII site to provide a cDNA that encodes a human neuronal calcium channel (alpha).sub.2 -subunit. The 5'-1560 bp of this cDNA have been sequenced and, as illustrated in FIGS. 3a-3d, found to be 91.2% homologous with the corresponding 1575 bp segment indicated in FIGS. 2a-2f.

The human (alpha).sub.2 -subunit-encoding cDNA will be subcloned into the mammalian expression vector pSV2DHFR, which is available in the art, for expression in mammalian tissue culture cells.

We obtained the human neuroblastoma cell line IMR32 from the American Type Culture Collection (accession no. CCL127). A northern blot analysis was carried out on poly A.sup.+ RNA from this cell line using the full-length human (alpha).sub.2 -subunit-encoding cDNA. Under low stringency washing, a single 8.2 kb fragment was found. The rabbit skeletal muscle (alpha).sub.2 -encoding messenger RNA also had a size similar to 8.2 kb. While the invention has been described herein with some specificity, the ordinarily skilled in the art will recognize numerous variations and modifications, in what is described, that are within the spirit of the invention. Such variations and modifications are within the scope of the invention as described in the claims herein.

Various features of the invention are also described in the following claims.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 3(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 5975 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: Coding Sequence(B) LOCATION: 79...5700(D) OTHER INFORMATION:(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GCGGGGAACACTGGGGACGCAGGGAAGAGAGGGCCGCGGGGTGGGGGAGCAGCAGGAAGC60GCCGTGGCCAGGGAAGCCATGGAGCCATCCTCACCCCAGGATGAGGGCCTG111MetGluProSerSerProGlnAspGluGlyLeu1510AGGAAGAAACAGCCCAAGAAGCCCCTGCCCGAGGTCCTGCCCAGGCCG159ArgLysLysGlnProLysLysProLeuProGluValLeuProArgPro152025CCGCGGGCTCTGTTCTGCCTGACCCTGCAGAACCCGCTGAGGAAGGCG207ProArgAlaLeuPheCysLeuThrLeuGlnAsnProLeuArgLysAla303540TGCATCAGCATCGTGGAATGGAAACCCTTCGAGACCATCATCCTGCTC255CysIleSerIleValGluTrpLysProPheGluThrIleIleLeuLeu455055ACCATCTTTGCCAACTGTGTGGCCCTGGCCGTGTACCTGCCCATGCCC303ThrIlePheAlaAsnCysValAlaLeuAlaValTyrLeuProMetPro60657075GAGGATGACAACAACTCCCTGAACCTGGGCCTGGAGAAGCTGGAGTAC351GluAspAspAsnAsnSerLeuAsnLeuGlyLeuGluLysLeuGluTyr808590TTCTTCCTCACCGTCTTCTCCATCGAAGCCGCCATGAAGATCATCGCC399PhePheLeuThrValPheSerIleGluAlaAlaMetLysIleIleAla95100105TACGGCTTCCTGTTCCACCAGGACGCCTACCTGCGCAGCGGCTGGAAC447TyrGlyPheLeuPheHisGlnAspAlaTyrLeuArgSerGlyTrpAsn110115120GTGCTGGACTTCATCATCGTCTTCCTGGGGGTCTTCACGGCGATTCTG495ValLeuAspPheIleIleValPheLeuGlyValPheThrAlaIleLeu125130135GAACAGGTCAACGTCATCCAGAGCAACACGGCCCCGATGAGCAGCAAA543GluGlnValAsnValIleGlnSerAsnThrAlaProMetSerSerLys140145150155GGAGCCGGCCTGGACGTCAAGGCCCTGAGGGCCTTCCGTGTGCTCAGA591GlyAlaGlyLeuAspValLysAlaLeuArgAlaPheArgValLeuArg160165170CCCCTCCGGCTGGTGTCGGGGGTGCCTAGTTTGCAGGTGGTCCTCAAC639ProLeuArgLeuValSerGlyValProSerLeuGlnValValLeuAsn175180185TCCATCTTCAAGGCCATGCTCCCCCTGTTCCACATCGCCCTGCTCGTC687SerIlePheLysAlaMetLeuProLeuPheHisIleAlaLeuLeuVal190195200CTCTTCATGGTCATCATCTACGCCATCATCGGGCTGGAGCTCTTCAAG735LeuPheMetValIleIleTyrAlaIleIleGlyLeuGluLeuPheLys205210215GGCAAGATGCACAAGACCTGCTACTACATCGGGACAGACATCGTGGCC783GlyLysMetHisLysThrCysTyrTyrIleGlyThrAspIleValAla220225230235ACAGTGGAGAATGAGAAGCCCTCGCCCTGCGCTAGGACGGGCTCGGGG831ThrValGluAsnGluLysProSerProCysAlaArgThrGlySerGly240245250CGCCCCTGCACCATCAACGGCAGCGAGTGCCGGGGCGGCTGGCCGGGG879ArgProCysThrIleAsnGlySerGluCysArgGlyGlyTrpProGly255260265CCCAACCACGGCATCACGCACTTCGACAACTTCGGCTTCTCCATGCTC927ProAsnHisGlyIleThrHisPheAspAsnPheGlyPheSerMetLeu270275280ACCGTGTACCAGTGCATCACCATGGAGGGCTGGACAGATGTCCTCTAC975ThrValTyrGlnCysIleThrMetGluGlyTrpThrAspValLeuTyr285290295TGGGTCAACGATGCCATCGGGAACGAGTGGCCCTGGATCTACTTTGTC1023TrpValAsnAspAlaIleGlyAsnGluTrpProTrpIleTyrPheVal300305310315ACTCTCATCCTGCTGGGGTCCTTCTTCATCCTCAACCTGGTGCTGGGC1071ThrLeuIleLeuLeuGlySerPhePheIleLeuAsnLeuValLeuGly320325330GTCCTGAGTGGGGAATTCACCAAGGAGCGGGAGAAGGCCAAGTCCAGG1119ValLeuSerGlyGluPheThrLysGluArgGluLysAlaLysSerArg335340345GGAACCTTCCAGAAGCTGCGGGAGAAGCAGCAGCTGGAGGAGGACCTT1167GlyThrPheGlnLysLeuArgGluLysGlnGlnLeuGluGluAspLeu350355360CGGGGCTACATGAGCTGGATCACGCAGGGCGAGGTCATGGACGTGGAG1215ArgGlyTyrMetSerTrpIleThrGlnGlyGluValMetAspValGlu365370375GACCTGAGAGAAGGAAAGCTGTCCTTGGAAGAGGGAGGCTCCGACACG1263AspLeuArgGluGlyLysLeuSerLeuGluGluGlyGlySerAspThr380385390395GAAAGCCTGTACGAAATCGAGGGCTTGAACAAAATCATCCAGTTCATC1311GluSerLeuTyrGluIleGluGlyLeuAsnLysIleIleGlnPheIle400405410CGACACTGGAGGCAGTGGAACCGTGTCTTTCGCTGGAAGTGCCATGAC1359ArgHisTrpArgGlnTrpAsnArgValPheArgTrpLysCysHisAsp415420425CTGGTGAAGTCGAGAGTCTTCTACTGGCTGGTCATCCTGATCGTGGCC1407LeuValLysSerArgValPheTyrTrpLeuValIleLeuIleValAla430435440CTCAACACCCTGTCCATCGCCTCGGAGCACCACAACCAGCCGCTCTGG1455LeuAsnThrLeuSerIleAlaSerGluHisHisAsnGlnProLeuTrp445450455CTGACCCACTTGCAAGACATCGCCAATCGAGTGCTGCTGTCACTCTTC1503LeuThrHisLeuGlnAspIleAlaAsnArgValLeuLeuSerLeuPhe460465470475ACCATCGAGATGCTGCTGAAGATGTACGGGCTGGGCCTGCGCCAGTAC1551ThrIleGluMetLeuLeuLysMetTyrGlyLeuGlyLeuArgGlnTyr480485490TTCATGTCCATCTTCAACCGCTTCGACTGCTTCGTGGTGTGCAGCGGC1599PheMetSerIlePheAsnArgPheAspCysPheValValCysSerGly495500505ATCCTGGAGCTGCTGCTGGTGGAGTCGGGCGCCATGACGCCGCTGGGC1647IleLeuGluLeuLeuLeuValGluSerGlyAlaMetThrProLeuGly510515520ATCTCCGTGTTGCGCTGCATCCGCCTCCTGAGGCTCTTCAAGATCACC1695IleSerValLeuArgCysIleArgLeuLeuArgLeuPheLysIleThr525530535AAGTACTGGACGTCGCTCAGCAACCTGGTGGCCTCCCTGCTCAACTCC1743LysTyrTrpThrSerLeuSerAsnLeuValAlaSerLeuLeuAsnSer540545550555ATCCGCTCCATCGCCTCGCTGCTGCTGCTGCTCTTCCTCTTCATCATC1791IleArgSerIleAlaSerLeuLeuLeuLeuLeuPheLeuPheIleIle560565570ATCTTCGCCCTGCTGGGCATGCAGCTCTTCGGGGGGCGGTACGACTTC1839IlePheAlaLeuLeuGlyMetGlnLeuPheGlyGlyArgTyrAspPhe575580585GAGGACACGGAAGTGCGACGCAGCAACTTCGACAACTTCCCCCAGGCC1887GluAspThrGluValArgArgSerAsnPheAspAsnPheProGlnAla590595600CTCATCAGCGTCTTCCAGGTGCTGACGGGTGAGGACTGGAACTCCGTG1935LeuIleSerValPheGlnValLeuThrGlyGluAspTrpAsnSerVal605610615ATGTACAACGGGATCATGGCCTACGGAGGCCCGTCCTACCCGGGCGTT1983MetTyrAsnGlyIleMetAlaTyrGlyGlyProSerTyrProGlyVal620625630635CTCGTGTGCATCTATTTCATCATCCTTTTTGTCTGCGGCAACTATATC2031LeuValCysIleTyrPheIleIleLeuPheValCysGlyAsnTyrIle640645650CTGCTGAATGTCTTCCTGGCCATCGCCGTGGACAACCTGGCCGAGGCC2079LeuLeuAsnValPheLeuAlaIleAlaValAspAsnLeuAlaGluAla655660665GAGAGCCTGACTTCCGCGCAAAAGGCCAAGGCCGAGGAGAGGAAACGT2127GluSerLeuThrSerAlaGlnLysAlaLysAlaGluGluArgLysArg670675680AGGAAGATGTCCAGGGGTCTCCCTGACAAGACGGAGGAGGAGAAGTCT2175ArgLysMetSerArgGlyLeuProAspLysThrGluGluGluLysSer685690695GTGATGGCCAAGAAGCTGGAGCAGAAGCCCAAGGGGGAGGGCATCCCC2223ValMetAlaLysLysLeuGluGlnLysProLysGlyGluGlyIlePro700705710715ACCACTGCCAAGCTCAAGGTCGATGAGTTCGAATCTAACGTCAACGAG2271ThrThrAlaLysLeuLysValAspGluPheGluSerAsnValAsnGlu720725730GTGAAGGACCCCTACCCTTCAGCTGACTTCCCAGGGGATGATGAGGAG2319ValLysAspProTyrProSerAlaAspPheProGlyAspAspGluGlu735740745GACGAGCCTGAGATCCCAGTGAGCCCCCGACCGCGCCCGCTGGCCGAG2367AspGluProGluIleProValSerProArgProArgProLeuAlaGlu750755760CTGCAGCTCAAAGAGAAGGCAGTGCCCATCCCGGAAGCCAGCTCCTTC2415LeuGlnLeuLysGluLysAlaValProIleProGluAlaSerSerPhe765770775TTCATCTTCAGTCCCACCAATAAGGTCCGTGTCCTGTGTCACCGCATC2463PheIlePheSerProThrAsnLysValArgValLeuCysHisArgIle780785790795GTCAACGCCACCTGGTTCACCAACTTCATCCTGCTCTTCATCCTGCTC2511ValAsnAlaThrTrpPheThrAsnPheIleLeuLeuPheIleLeuLeu800805810AGCAGTGCTGCGCTGGCCGCCGAGGACCCCATCCGGGCGGAGTCCGTG2559SerSerAlaAlaLeuAlaAlaGluAspProIleArgAlaGluSerVal815820825AGGAATCAGATCCTTGGATATTTTGATATTGCCTTCACCTCTGTCTTC2607ArgAsnGlnIleLeuGlyTyrPheAspIleAlaPheThrSerValPhe830835840ACTGTGGAGATTGTCCTCAAGATGACAACCTACGGCGCCTTCCTGCAC2655ThrValGluIleValLeuLysMetThrThrTyrGlyAlaPheLeuHis845850855AAGGGCTCCTTCTGCCGCAACTACTTCAACATCCTGGACCTGCTGGTG2703LysGlySerPheCysArgAsnTyrPheAsnIleLeuAspLeuLeuVal860865870875GTGGCCGTGTCTCTCATCTCCATGGGTCTCGAGTCCAGCACCATCTCC2751ValAlaValSerLeuIleSerMetGlyLeuGluSerSerThrIleSer880885890GTGGTAAAGATCCTGAGAGTGCTAAGGGTGCTCCGGCCCCTGCGAGCC2799ValValLysIleLeuArgValLeuArgValLeuArgProLeuArgAla895900905ATCAACAGAGCCAAAGGGTTGAAGCACGTGGTCCAGTGCGTGTTCGTG2847IleAsnArgAlaLysGlyLeuLysHisValValGlnCysValPheVal910915920GCCATCCGCACCATCGGGAACATCGTCCTGGTCACCACGCTCCTGCAG2895AlaIleArgThrIleGlyAsnIleValLeuValThrThrLeuLeuGln925930935TTCATGTTCGCCTGCATCGGTGTCCAGCTCTTCAAGGGCAAGTTCTTC2943PheMetPheAlaCysIleGlyValGlnLeuPheLysGlyLysPhePhe940945950955AGCTGCAATGACCTATCCAAGATGACAGAAGAGGAGTGCAGGGGCTAC2991SerCysAsnAspLeuSerLysMetThrGluGluGluCysArgGlyTyr960965970TACTATGTGTACAAGGACGGGGACCCCACGCAGATGGAGCTGCGCCCC3039TyrTyrValTyrLysAspGlyAspProThrGlnMetGluLeuArgPro975980985CGCCAGTGGATACACAATGACTTCCACTTTGACAACGTGCTGTCGGCC3087ArgGlnTrpIleHisAsnAspPheHisPheAspAsnValLeuSerAla9909951000ATGATGTCGCTCTTCACGGTGTCCACCTTCGAGGGATGGCCCCAGCTG3135MetMetSerLeuPheThrValSerThrPheGluGlyTrpProGlnLeu100510101015CTGTACAGGGCCATAGACTCCAACGAGGAGGACATGGGCCCCGTTTAC3183LeuTyrArgAlaIleAspSerAsnGluGluAspMetGlyProValTyr1020102510301035AACAACCGAGTGGAGATGGCCATCTTCTTCATCATCTACATCATCCTC3231AsnAsnArgValGluMetAlaIlePhePheIleIleTyrIleIleLeu104010451050ATTGCCTTCTTCATGATGAACATCTTTGTGGGCTTTGTCATCGTCACC3279IleAlaPhePheMetMetAsnIlePheValGlyPheValIleValThr105510601065TTCCAGGAGCAGGGGGAGACGGAGTACAAGAACTGCGAGCTGGACAAG3327PheGlnGluGlnGlyGluThrGluTyrLysAsnCysGluLeuAspLys107010751080AACCAGCGCCAGTGTGTGCAGTATGCCCTGAAGGCCCGCCCACTTCGG3375AsnGlnArgGlnCysValGlnTyrAlaLeuLysAlaArgProLeuArg108510901095TGCTACATCCCCAAGAACCCATACCAGTACCAGGTGTGGTACGTCGTC3423CysTyrIleProLysAsnProTyrGlnTyrGlnValTrpTyrValVal1100110511101115ACCTCCTCCTACTTTGAATACCTGATGTTCGCCCTCATCATGCTCAAC3471ThrSerSerTyrPheGluTyrLeuMetPheAlaLeuIleMetLeuAsn112011251130ACCATCTGCCTGGGCATGCAGCACTACCACCAGTCGGAGGAGATGAAC3519ThrIleCysLeuGlyMetGlnHisTyrHisGlnSerGluGluMetAsn113511401145CACATCTCAGACATCCTCAATGTGGCCTTCACCATCATCTTCACGCTG3567HisIleSerAspIleLeuAsnValAlaPheThrIleIlePheThrLeu115011551160GAGATGATTCTCAAGCTCTTGGCGTTCAAGGCCAGGGGCTATTTCGGA3615GluMetIleLeuLysLeuLeuAlaPheLysAlaArgGlyTyrPheGly116511701175GACCCCTGGAATGTGTTCGACTTCCTGATCGTCATCGGCAGCATCATT3663AspProTrpAsnValPheAspPheLeuIleValIleGlySerIleIle1180118511901195GACGTCATCCTCAGCGAGATCGACACTTTCCTGGCCTCCAGCGGGGGA3711AspValIleLeuSerGluIleAspThrPheLeuAlaSerSerGlyGly120012051210CTGTATTGCCTGGGTGGCGGCTGCGGGAACGTTGACCCAGACGAGAGC3759LeuTyrCysLeuGlyGlyGlyCysGlyAsnValAspProAspGluSer121512201225GCCCGCATCTCCAGTGCCTTCTTCCGCCTGTTCCGGGTTATGAGGCTG3807AlaArgIleSerSerAlaPhePheArgLeuPheArgValMetArgLeu123012351240ATCAAGCTGCTGAGTCGGGCCGAGGGCGTGCGCACGCTGCTGTGGACG3855IleLysLeuLeuSerArgAlaGluGlyValArgThrLeuLeuTrpThr124512501255TTCATCAAGTCCTTCCAGGCCCTGCCCTACGTGGCCCTGCTCATCGTC3903PheIleLysSerPheGlnAlaLeuProTyrValAlaLeuLeuIleVal1260126512701275ATGCTGTTCTTCATCTACGCCGTCATCGGCATGCAGATGTTTGGAAAG3951MetLeuPhePheIleTyrAlaValIleGlyMetGlnMetPheGlyLys128012851290ATCGCCCTGGTGGACGGGACCCAGATCAACCGCAACAACAACTTCCAG3999IleAlaLeuValAspGlyThrGlnIleAsnArgAsnAsnAsnPheGln129513001305ACCTTCCCGCAGGCCGTGCTGCTGCTCTTCAGGTGTGCGACAGGGGAG4047ThrPheProGlnAlaValLeuLeuLeuPheArgCysAlaThrGlyGlu131013151320GCGTGGCAAGAGATCCTGCTGGCCTGCAGCTACGGGAAGTTGTGCGAC4095AlaTrpGlnGluIleLeuLeuAlaCysSerTyrGlyLysLeuCysAsp132513301335CCAGAGTCAGACTACGCCCCGGGCGAGGAGTACACGTGTGGCACCAAC4143ProGluSerAspTyrAlaProGlyGluGluTyrThrCysGlyThrAsn1340134513501355TTCGCCTACTACTACTTCATCAGCTTCTACATGCTCTGCGCCTTCCTG4191PheAlaTyrTyrTyrPheIleSerPheTyrMetLeuCysAlaPheLeu136013651370ATCATCAACCTCTTCGTGGCTGTCATCATGGACAACTTTGACTACCTG4239IleIleAsnLeuPheValAlaValIleMetAspAsnPheAspTyrLeu137513801385ACACGCGACTGGTCCATCCTGGGCCCTCACCACCTGGACGAGTTCAAG4287ThrArgAspTrpSerIleLeuGlyProHisHisLeuAspGluPheLys139013951400GCCATCTGGGCAGAGTATGACCCAGAGGCCAAGGGGCGAATCAAGCAC4335AlaIleTrpAlaGluTyrAspProGluAlaLysGlyArgIleLysHis140514101415CTGGACGTGGTGACCCTGCTGAGAAGGATCCAGCCCCCTCTGGGCTTC4383LeuAspValValThrLeuLeuArgArgIleGlnProProLeuGlyPhe1420142514301435GGGAAGTTCTGTCCACACCGGGTGGCCTGTAAGCGCCTGGTGGGCATG4431GlyLysPheCysProHisArgValAlaCysLysArgLeuValGlyMet144014451450AACATGCCCCTGAACAGTGACGGCACGGTCACCTTCAATGCCACGCTC4479AsnMetProLeuAsnSerAspGlyThrValThrPheAsnAlaThrLeu145514601465TTTGCCCTGGTGCGCACGGCCCTCAAGATCAAGACAGAAGGTAACTTC4527PheAlaLeuValArgThrAlaLeuLysIleLysThrGluGlyAsnPhe147014751480GAGCAGGCCAACGAGGAGCTGAGGGCCATCATCAAGAAGATCTGGAAG4575GluGlnAlaAsnGluGluLeuArgAlaIleIleLysLysIleTrpLys148514901495AGAACCAGCATGAAGCTACTGGACCAGGTCATCCCTCCCATAGGAGAT4623ArgThrSerMetLysLeuLeuAspGlnValIleProProIleGlyAsp1500150515101515GACGAGGTGACCGTGGGGAAGTTCTACGCCACATTCCTCATCCAGGAG4671AspGluValThrValGlyLysPheTyrAlaThrPheLeuIleGlnGlu152015251530CACTTCCGGAAGTTCATGAAGCGCCAGGAGGAATATTATGGGTATCGG4719HisPheArgLysPheMetLysArgGlnGluGluTyrTyrGlyTyrArg153515401545CCCAAGAAGGACACCGTGCAGATCCAGGCTGGGCTGCGGACCATAGAG4767ProLysLysAspThrValGlnIleGlnAlaGlyLeuArgThrIleGlu155015551560GAGGAGGCGGCCCCTGAGATCCGCCGCACCATCTCAGGAGACCTGACC4815GluGluAlaAlaProGluIleArgArgThrIleSerGlyAspLeuThr156515701575GCCGAGGAGGAGCTGGAGAGAGCCATGGTGGAGGCTGCGATGGAGGAG4863AlaGluGluGluLeuGluArgAlaMetValGluAlaAlaMetGluGlu1580158515901595AGGATCTTCCGGAGGACCGGAGGCCTGTTTGGCCAGGTGGACACCTTC4911ArgIlePheArgArgThrGlyGlyLeuPheGlyGlnValAspThrPhe160016051610CTGGAAAGGACCAACTCCCTACCCCCGGTGATGGCCAACCAAAGACCG4959LeuGluArgThrAsnSerLeuProProValMetAlaAsnGlnArgPro161516201625CTCCAGTTTGCTGAGATAGAAATGGAAGAGCTTGAGTCGCCTGTCTTC5007LeuGlnPheAlaGluIleGluMetGluGluLeuGluSerProValPhe163016351640TTGGAGGACTTCCCTCAAGACGCAAGAACCAACCCTCTCGCTCGTGCC5055LeuGluAspPheProGlnAspAlaArgThrAsnProLeuAlaArgAla164516501655AATACCAACAACGCCAATGCCAATGTTGCCTATGGCAACAGCAACCAT5103AsnThrAsnAsnAlaAsnAlaAsnValAlaTyrGlyAsnSerAsnHis1660166516701675AGCAACAACCAGATGTTTTCCAGCGTCCACTGTGAAAGGGAGTTCCCG5151SerAsnAsnGlnMetPheSerSerValHisCysGluArgGluPhePro168016851690GGAGAGGCGGAGACACCGGCTGCCGGACGAGGAGCCCTCAGCCACTCC5199GlyGluAlaGluThrProAlaAlaGlyArgGlyAlaLeuSerHisSer169517001705CACAGGGCCCTGGGACCTCACAGCAAGCCCTGTGCTGGAAAACTGAAT5247HisArgAlaLeuGlyProHisSerLysProCysAlaGlyLysLeuAsn171017151720GGGCAGCTGGTCCAGCCGGGAATGCCCATCAACCAGGCACCTCCTGCC5295GlyGlnLeuValGlnProGlyMetProIleAsnGlnAlaProProAla172517301735CCCTGCCAGCAGCCTAGCACAGATCCCCCAGAGCGCGGGCAGAGGAGG5343ProCysGlnGlnProSerThrAspProProGluArgGlyGlnArgArg1740174517501755ACCTCCCTGACAGGGTCTCTGCAAGACGAAGCACCCCAGAGGAGGAGC5391ThrSerLeuThrGlySerLeuGlnAspGluAlaProGlnArgArgSer176017651770TCCGAGGGGAGCACCCCCAGGCGCCCGGCTCCTGCTACAGCTCTGCTG5439SerGluGlySerThrProArgArgProAlaProAlaThrAlaLeuLeu177517801785ATCCAAGAGGCTCTGGTTCGAGGGGGCCTGGACACCTTGGCAGCTGAT5487IleGlnGluAlaLeuValArgGlyGlyLeuAspThrLeuAlaAlaAsp179017951800GCTGGCTTCGTCATGGCAACAAGCCAGGCCCTGGTAGACGCCTGTCAG5535AlaGlyPheValMetAlaThrSerGlnAlaLeuValAspAlaCysGln180518101815ATGGAACCGGAGGAAGTAGAGGTCGCAGCCACAGAGCTACTGAAAGAG5583MetGluProGluGluValGluValAlaAlaThrGluLeuLeuLysGlu1820182518301835CGAGAGTCCGTCCAGGGCATGGCCAGTGTCCCGGGAAGCCTGAGCCGC5631ArgGluSerValGlnGlyMetAlaSerValProGlySerLeuSerArg184018451850AGGTCCTCCCTGGGCAGCCTTGACCAGGTCCAGGGCTCCCAGGAAACC5679ArgSerSerLeuGlySerLeuAspGlnValGlnGlySerGlnGluThr185518601865CTTATTCCTCCCAGGCCGTGATGGCTGTGCAGTGTCCACATGACCAAGGCGAGGGG5735LeuIleProProArgPro*1870GACAGTGCGTGCAGAAGCTCAGCCCTGCATGGCAGCCTCCCTCTGTCTCAGCCCTCCTGC5795TGAGCTGGGGCGGTCTGGAACCGACCAGGAAGCCAGGAGCCTCCCCTGGCCAGCAAGAGG5855CATGATTCTAAAGCATCCAGAAAGGCCTGGTCAGTGCCACTCCCCAGCAGGACATTAAAG5915TCTCTAGGTCTGTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA5975(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3802 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: Coding Sequence(B) LOCATION: 309...3630(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 387...3626(D) OTHER INFORMATION:(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:AGAAGGGAGGGCGAGCGTGGTGTGTGCGCGCTCGGGCGCCGGCGGCACCGCCGAGGTCTG60TTGGCAAAAGTCGCCCTTGATGGCGGCGGAGGCGAGGCAGCCGCGGCGCCGAACAGCCGA120CGCGCGCTAGCGGGGTCCGCCCGCCCCTTTCCCAGAGCCCAGCGCCGCCGTTCGCCGCCG180CCGCCGCCCGCCCGCGCGCCGTTCGCCGCCGCCGCCGCCCGCGGGTGGCAGCGCCGCTCG240GTCCCCGGCCCCGGGGCCGGCTGGGGGGCGGTCGGGGCGTGTGAGGGGCTTGCTCCCAGC300TCGCGAAGATGGCTGCGGGCCGCCCGCTGGCCTGGACGCTGACACTTTGG350MetAlaAlaGlyArgProLeuAlaTrpThrLeuThrLeuTrp26-25- 20-15CAGGCGTGGCTGATCCTGATCGGGCCCTCGTCGGAGGAGCCGTTCCCT398GlnAlaTrpLeuIleLeuIleGlyProSerSerGluGluProPhePro10-5-11TCAGCCGTCACTATCAAGTCATGGGTGGATAAGATGCAAGAAGACCTG446SerAlaValThrIleLysSerTrpValAspLysMetGlnGluAspLeu5101520GTCACACTGGCAAAAACAGCAAGTGGAGTCAATCAGCTTGTTGATATT494ValThrLeuAlaLysThrAlaSerGlyValAsnGlnLeuValAspIle253035TATGAGAAATATCAAGATTTGTATACTGTGGAACCAAATAATGCACGT542TyrGluLysTyrGlnAspLeuTyrThrValGluProAsnAsnAlaArg404550CAGCTGGTGGAAATTGCAGCCAGAGACATTGAGAAGCTTCTCAGCAAC590GlnLeuValGluIleAlaAlaArgAspIleGluLysLeuLeuSerAsn556065AGATCTAAAGCCCTGGTGCGCCTGGCTTTGGAAGCAGAGAAAGTTCAA638ArgSerLysAlaLeuValArgLeuAlaLeuGluAlaGluLysValGln707580GCAGCCCACCAATGGAGGGAAGATTTTGCAAGCAATGAAGTTGTCTAC686AlaAlaHisGlnTrpArgGluAspPheAlaSerAsnGluValValTyr859095100TATAACGCGAAGGATGATCTTGATCCTGAAAAAAATGACAGTGAACCA734TyrAsnAlaLysAspAspLeuAspProGluLysAsnAspSerGluPro105110115GGCAGCCAGAGGATCAAACCTGTTTTCATTGACGATGCTAACTTTAGA782GlySerGlnArgIleLysProValPheIleAspAspAlaAsnPheArg120125130AGACAAGTATCCTATCAGCACGCAGCTGTCCATATCCCCACTGACATC830ArgGlnValSerTyrGlnHisAlaAlaValHisIleProThrAspIle135140145TATGAAGGATCGACAATCGTGTTAAACGAACTCAACTGGACAAGTGCC878TyrGluGlySerThrIleValLeuAsnGluLeuAsnTrpThrSerAla150155160TTAGATGACGTTTTCAAAAAAAATCGAGAGGAAGACCCTTCACTGTTG926LeuAspAspValPheLysLysAsnArgGluGluAspProSerLeuLeu165170175180TGGCAGGTGTTTGGCAGTGCCACTGGCCTGGCCCGGTATTACCCAGCT974TrpGlnValPheGlySerAlaThrGlyLeuAlaArgTyrTyrProAla185190195TCTCCATGGGTTGATAATAGCCGAACCCCAAACAAGATTGATCTTTAT1022SerProTrpValAspAsnSerArgThrProAsnLysIleAspLeuTyr200205210GATGTACGCAGAAGACCATGGTACATCCAAGGTGCTGCATCCCCTAAA1070AspValArgArgArgProTrpTyrIleGlnGlyAlaAlaSerProLys215220225GATATGCTTATTCTGGTGGATGTGAGTGGAAGCGTTAGTGGACTGACA1118AspMetLeuIleLeuValAspValSerGlySerValSerGlyLeuThr230235240CTCAAACTCATCCGGACATCCGTCTCCGAAATGTTGGAAACCCTCTCA1166LeuLysLeuIleArgThrSerValSerGluMetLeuGluThrLeuSer245250255260GATGATGATTTTGTGAACGTGGCTTCATTTAACAGCAATGCTCAGGAT1214AspAspAspPheValAsnValAlaSerPheAsnSerAsnAlaGlnAsp265270275GTAAGCTGCTTTCAGCACCTTGTCCAAGCAAATGTAAGAAATAAGAAA1262ValSerCysPheGlnHisLeuValGlnAlaAsnValArgAsnLysLys280285290GTGTTGAAAGATGCAGTGAATAATATCACAGCAAAAGGAATCACAGAT1310ValLeuLysAspAlaValAsnAsnIleThrAlaLysGlyIleThrAsp295300305TATAAGAAGGGCTTTAGTTTTGCTTTTGAGCAGCTGCTTAATTATAAT1358TyrLysLysGlyPheSerPheAlaPheGluGlnLeuLeuAsnTyrAsn310315320GTATCCAGAGCCAACTGCAATAAGATTATCATGTTGTTCACGGACGGA1406ValSerArgAlaAsnCysAsnLysIleIleMetLeuPheThrAspGly325330335340GGAGAAGAGAGAGCCCAGGAGATATTTGCCAAATACAATAAAGACAAG1454GlyGluGluArgAlaGlnGluIlePheAlaLysTyrAsnLysAspLys345350355AAAGTACGTGTATTCACATTCTCAGTTGGCCAACATAATTACGACAGA1502LysValArgValPheThrPheSerValGlyGlnHisAsnTyrAspArg360365370GGACCTATTCAGTGGATGGCTTGCGAAAATAAAGGTTATTATTATGAA1550GlyProIleGlnTrpMetAlaCysGluAsnLysGlyTyrTyrTyrGlu375380385ATTCCATCCATTGGAGCCATAAGAATTAATACTCAGGAATACCTAGAT1598IleProSerIleGlyAlaIleArgIleAsnThrGlnGluTyrLeuAsp390395400GTTCTGGGAAGACCGATGGTTTTAGCAGGAGACAAAGCTAAGCAAGTC1646ValLeuGlyArgProMetValLeuAlaGlyAspLysAlaLysGlnVal405410415420CAATGGACAAATGTGTACCTGGATGCACTGGAACTGGGACTTGTCATT1694GlnTrpThrAsnValTyrLeuAspAlaLeuGluLeuGlyLeuValIle425430435ACTGGAACTCTTCCGGTCTTCAACATAACTGGCCAATTTGAAAATAAG1742ThrGlyThrLeuProValPheAsnIleThrGlyGlnPheGluAsnLys440445450ACAAACTTAAAGAACCAGCTGATTCTTGGAGTGATGGGAGTTGATGTG1790ThrAsnLeuLysAsnGlnLeuIleLeuGlyValMetGlyValAspVal455460465TCTTTGGAAGATATTAAAAGACTGACACCACGTTTTACACTCTGCCCC1838SerLeuGluAspIleLysArgLeuThrProArgPheThrLeuCysPro470475480AATGGCTACTATTTTGCAATTGATCCTAATGGTTATGTGTTATTACAT1886AsnGlyTyrTyrPheAlaIleAspProAsnGlyTyrValLeuLeuHis485490495500CCAAATCTTCAGCCAAAGCCTATTGGTGTAGGTATACCAACAATTAAT1934ProAsnLeuGlnProLysProIleGlyValGlyIleProThrIleAsn505510515TTGAGAAAAAGGAGACCCAATGTTCAGAACCCCAAATCTCAGGAGCCA1982LeuArgLysArgArgProAsnValGlnAsnProLysSerGlnGluPro520525530GTGACATTGGATTTCCTCGATGCAGAGTTGGAGAATGACATTAAAGTG2030ValThrLeuAspPheLeuAspAlaGluLeuGluAsnAspIleLysVal535540545GAGATTCGAAATAAAATGATCGATGGAGAAAGTGGAGAAAAAACATTC2078GluIleArgAsnLysMetIleAspGlyGluSerGlyGluLysThrPhe550555560AGAACTCTGGTTAAATCTCAAGATGAGAGATATATTGACAAAGGAAAC2126ArgThrLeuValLysSerGlnAspGluArgTyrIleAspLysGlyAsn565570575580AGGACATACACGTGGACTCCTGTCAACGGCACAGATTATAGCAGTTTG2174ArgThrTyrThrTrpThrProValAsnGlyThrAspTyrSerSerLeu585590595GCCTTGGTATTACCAACCTACAGTTTTTACTATATAAAAGCCAAAATA2222AlaLeuValLeuProThrTyrSerPheTyrTyrIleLysAlaLysIle600605610GAAGAGACAATAACTCAGGCCAGATATTCAGAAACACTGAAACCGGAT2270GluGluThrIleThrGlnAlaArgTyrSerGluThrLeuLysProAsp615620625AATTTTGAAGAATCTGGCTACACATTCCTAGCACCAAGAGATTACTGC2318AsnPheGluGluSerGlyTyrThrPheLeuAlaProArgAspTyrCys630635640AGTGACCTTAAACCTTCAGATAATAACACTGAATTTCTTTTAAATTTC2366SerAspLeuLysProSerAspAsnAsnThrGluPheLeuLeuAsnPhe645650655660AATGAGTTTATTGATAGAAAAACTCCAAACAACCCATCCTGTAATACA2414AsnGluPheIleAspArgLysThrProAsnAsnProSerCysAsnThr665670675GACTTGATTAATAGAGTCTTGCTGGATGCAGGCTTTACAAATGAACTT2462AspLeuIleAsnArgValLeuLeuAspAlaGlyPheThrAsnGluLeu680685690GTTCAAAATTACTGGAGTAAGCAGAAGAATATCAAGGGAGTGAAAGCA2510ValGlnAsnTyrTrpSerLysGlnLysAsnIleLysGlyValLysAla695700705CGGTTTGTTGTGACTGATGGTGGGATTACCAGAGTTTATCCCAAAGAG2558ArgPheValValThrAspGlyGlyIleThrArgValTyrProLysGlu710715720GCTGGAGAAAATTGGCAGGAAAACCCAGAGACATATGAAGACAGCTTC2606AlaGlyGluAsnTrpGlnGluAsnProGluThrTyrGluAspSerPhe725730735740TATAAAAGGAGCCTCGATAATGATAACTACGTTTTCACTGCTCCCTAC2654TyrLysArgSerLeuAspAsnAspAsnTyrValPheThrAlaProTyr745750755TTTAACAAAAGTGGACCTGGGGCCTATGAGTCAGGCATTATGGTAAGC2702PheAsnLysSerGlyProGlyAlaTyrGluSerGlyIleMetValSer760765770AAAGCTGTAGAAATATATATCCAAGGAAAACTTCTTAAACCTGCAGTT2750LysAlaValGluIleTyrIleGlnGlyLysLeuLeuLysProAlaVal775780785GTTGGAATTAAAATTGATGTAAATTCTTGGATAGAGAATTTCACCAAA2798ValGlyIleLysIleAspValAsnSerTrpIleGluAsnPheThrLys790795800ACTTCAATCAGGGATCCGTGTGCTGGTCCAGTTTGTGACTGCAAACGA2846ThrSerIleArgAspProCysAlaGlyProValCysAspCysLysArg805810815820AACAGTGATGTAATGGATTGTGTGATTCTAGATGACGGTGGGTTTCTT2894AsnSerAspValMetAspCysValIleLeuAspAspGlyGlyPheLeu825830835TTGATGGCCAACCATGATGATTATACCAATCAGATTGGAAGATTCTTT2942LeuMetAlaAsnHisAspAspTyrThrAsnGlnIleGlyArgPhePhe840845850GGAGAGATTGATCCAAGCTTGATGAGACACCTGGTCAATATATCAGTT2990GlyGluIleAspProSerLeuMetArgHisLeuValAsnIleSerVal855860865TATGCCTTTAACAAATCTTATGATTATCAGTCGGTGTGTGAACCTGGT3038TyrAlaPheAsnLysSerTyrAspTyrGlnSerValCysGluProGly870875880GCTGCGCCAAAGCAGGGAGCAGGGCACCGCTCGGCTTATGTGCCATCA3086AlaAlaProLysGlnGlyAlaGlyHisArgSerAlaTyrValProSer885890895900ATAGCAGACATACTGCAGATTGGATGGTGGGCCACTGCTGCTGCCTGG3134IleAlaAspIleLeuGlnIleGlyTrpTrpAlaThrAlaAlaAlaTrp905910915TCTATTCTTCAGCAGTTTCTGTTGAGTTTGACTTTTCCACGGCTCCTT3182SerIleLeuGlnGlnPheLeuLeuSerLeuThrPheProArgLeuLeu920925930GAGGCAGCTGATATGGAGGATGACGACTTCACTGCCTCCATGTCAAAG3230GluAlaAlaAspMetGluAspAspAspPheThrAlaSerMetSerLys935940945CAGAGCTGCATCACTGAGCAAACCCAGTATTTCTTCGATAATGACAGC3278GlnSerCysIleThrGluGlnThrGlnTyrPhePheAspAsnAspSer950955960AAATCGTTCAGTGGGGTATTAGACTGTGGGAATTGTTCCAGAATCTTT3326LysSerPheSerGlyValLeuAspCysGlyAsnCysSerArgIlePhe965970975980CATGTAGAAAAGCTCATGAACACCAATTTAATATTCATAATGGTAGAG3374HisValGluLysLeuMetAsnThrAsnLeuIlePheIleMetValGlu985990995AGCAAGGGGACATGTCCCTGTGACACACGGCTGCTCATACAAGCAGAG3422SerLysGlyThrCysProCysAspThrArgLeuLeuIleGlnAlaGlu100010051010CAAACTTCTGATGGACCAGATCCTTGTGATATGGTTAAGCAACCCAGA3470GlnThrSerAspGlyProAspProCysAspMetValLysGlnProArg101510201025TATCGAAAAGGGCCAGATGTCTGCTTTGACAACAATGTCCTGGAGGAT3518TyrArgLysGlyProAspValCysPheAspAsnAsnValLeuGluAsp103010351040TATACTGACTGCGGTGGGGTCTCTGGATTAAATCCTTCCCTGTGGTCC3566TyrThrAspCysGlyGlyValSerGlyLeuAsnProSerLeuTrpSer1045105010551060ATCATCGGGATACAGTTTGTACTGCTTTGGCTGGTTTCTGGCAGCAGA3614IleIleGlyIleGlnPheValLeuLeuTrpLeuValSerGlySerArg106510701075CACTGCCTGTTATGACCTTCTAAAACCAAATCTCCATAATTAAACTCCAGACCCTG3670HisCysLeuLeu*1080CCACAACATGATCCCTCCGTTATGTTAAAGTAGGGTCAACTGTTAAATCAGAACATTAGC3730TGGGCCTCTGCCATGGCAGAGCCCTAAGGCGCAGACTCATCAGGCACCCACTGGCTGCAT3790GTCAGGGTGTCC3802(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1560 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: unknown(ii) MOLECULE TYPE: Genomic DNA(ix) FEATURE:(A) NAME/KEY: Coding Sequence(B) LOCATION: 35...1558(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GGGCGGGGGAGGGGGATTGATCTTCGATCGCAAGATGGCTGCTGGCTGCCTGCTG55MetAlaAlaGlyCysLeuLeu15GCCTTGACTCTGACACTTTTCCAATCTTTGCTCATCGGCCCCTCGTCG103AlaLeuThrLeuThrLeuPheGlnSerLeuLeuIleGlyProSerSer101520GAGGAGCCGTTCCCTTCGGCCGTCACTATCAAATCATGGGTGGATAAG151GluGluProPheProSerAlaValThrIleLysSerTrpValAspLys253035ATGCAAGAAGACCTTGTCACACTGGCAAAAACAGCAAGTGGAGTCAAT199MetGlnGluAspLeuValThrLeuAlaLysThrAlaSerGlyValAsn40455055CAGCTTGTTGATATTTATGAGAAATATCAAGATTTGTATACTGTGGAA247GlnLeuValAspIleTyrGluLysTyrGlnAspLeuTyrThrValGlu606570CCAAATAATGCACGCCAGCTGGTAGAAATTGCAGCCAGGGATATTGAG295ProAsnAsnAlaArgGlnLeuValGluIleAlaAlaArgAspIleGlu758085AAACTTCTGAGCAACAGATCTAAAGCCCTGGTGAGCCTGGCATTGGAA343LysLeuLeuSerAsnArgSerLysAlaLeuValSerLeuAlaLeuGlu9095100GCGGAGAAAGTTCAAGCAGCTCACCAGTGGAGAGAAGATTTTGCAAGC391AlaGluLysValGlnAlaAlaHisGlnTrpArgGluAspPheAlaSer105110115AATGAAGTTGTCTACTACAATGCAAAGGATGATCTCGATCCTGAGAAA439AsnGluValValTyrTyrAsnAlaLysAspAspLeuAspProGluLys120125130135AATGACAGTGAGCCAGGCAGCCAGAGGATAAAACCTGTTTTCATTGAA487AsnAspSerGluProGlySerGlnArgIleLysProValPheIleGlu140145150GATGCTAATTTTGGACGACAAATATCTTATCAGCACGCAGCAGTCCAT535AspAlaAsnPheGlyArgGlnIleSerTyrGlnHisAlaAlaValHis155160165ATTCCTACTGACATCTATGAGGGCTCAACAATTGTGTTAAATGAACTC583IleProThrAspIleTyrGluGlySerThrIleValLeuAsnGluLeu170175180AACTGGACAAGTGCCTTAGATGAAGTTTTCAAAAAGAATCGCGAGGAA631AsnTrpThrSerAlaLeuAspGluValPheLysLysAsnArgGluGlu185190195GACCCTTCATTATTGTGGCAGGTTTTTGGCAGTGCCACTGGCCTAGCT679AspProSerLeuLeuTrpGlnValPheGlySerAlaThrGlyLeuAla200205210215CGATATTATCCAGCTTCACCATGGGTTGATAATGGTAGAACTCCAAAT727ArgTyrTyrProAlaSerProTrpValAspAsnGlyArgThrProAsn220225230ATGATTGACCTTTATGATGTACGCAGAAGACCATGGTACATCCAAGGA775MetIleAspLeuTyrAspValArgArgArgProTrpTyrIleGlnGly235240245GCTGCATCTCCTAAAGACATGCTTATTCTGGTGGATGTGAGTGGAAGT823AlaAlaSerProLysAspMetLeuIleLeuValAspValSerGlySer250255260GTTAGTGGATTGACACTTAAACTGATCCGAACATCTGTCTCCGAAATG871ValSerGlyLeuThrLeuLysLeuIleArgThrSerValSerGluMet265270275TTAGAAACCCTCTCAGATGATGATTTCGTGAATGTAGCTTCATTTAAC919LeuGluThrLeuSerAspAspAspPheValAsnValAlaSerPheAsn280285290295AGCAATGCTCAGGATGTAAGCTGTTTTCAGCACCTTGTCCAAGCAAAT967SerAsnAlaGlnAspValSerCysPheGlnHisLeuValGlnAlaAsn300305310GTAAGAAATAAAAAAGTGTTGAAAGACGCGGTGAATAATATCACAGCC1015ValArgAsnLysLysValLeuLysAspAlaValAsnAsnIleThrAla315320325AAAGGAATTACAGATTATAAGAAGGGCTTTAGTTTTGCTTTTGAACAG1063LysGlyIleThrAspTyrLysLysGlyPheSerPheAlaPheGluGln330335340CTGCTTAATTATAATGTTTCCAGAGCAAACTGCAATAAGATTATTATG1111LeuLeuAsnTyrAsnValSerArgAlaAsnCysAsnLysIleIleMet345350355CTATTCACGGATGGAGAAGAGAGAGCCCAGGAGATATTTAACAAATAC1159LeuPheThrAspGlyGluGluArgAlaGlnGluIlePheAsnLysTyr360365370375AATAAAGATAAAAAACTACCTGTATTCACCTTCTCAGTTGGTCAACAC1207AsnLysAspLysLysLeuProValPheThrPheSerValGlyGlnHis380385390AATTATGACAGAGGACCTATTCAGTGGATGGCCTGTGAAAACAAAGGT1255AsnTyrAspArgGlyProIleGlnTrpMetAlaCysGluAsnLysGly395400405TATTATTATGAAATTCCTTCCATTGGTGCAATAAGAATCAATACTCAG1303TyrTyrTyrGluIleProSerIleGlyAlaIleArgIleAsnThrGln410415420GAATATTTGGATGTTTTGGGAAGACCAATGGTTTTAGCAGGAGACAAA1351GluTyrLeuAspValLeuGlyArgProMetValLeuAlaGlyAspLys425430435GCTAAGCAAGTCCAATGGACAAATGTGTACCTGGATGCATTGGAACTG1399AlaLysGlnValGlnTrpThrAsnValTyrLeuAspAlaLeuGluLeu440445450455GGACTTGTCATTACTGGAACTCTTCCGGTCTTCAACATAACCGGCCAA1447GlyLeuValIleThrGlyThrLeuProValPheAsnIleThrGlyGln460465470TTTGAAAATAAGACAAACTTAAAGAACCAGCTGATTCTTGGTGTGATG1495PheGluAsnLysThrAsnLeuLysAsnGlnLeuIleLeuGlyValMet475480485GGAGTAGATGTGTCTTTGGAAGATATTAAAAGACTGACACCACGTTTT1543GlyValAspValSerLeuGluAspIleLysArgLeuThrProArgPhe490495500ACACTGTGCCCCAATGG1560ThrLeuCysProAsn505__________________________________________________________________________

Claims

1. A eukaryotic cell comprising a heterologous calcium channel, wherein the calcium channel is produced by a process comprising expressing in the cell cDNA that encodes the .alpha..sub.1 subunit of a calcium channel of an animal of a first species, and cDNA that encodes the .alpha..sub.2 subunit of an animal of a second species, wherein:

the first and second species are the same or different; and

the cDNA that encodes the .alpha..sub.2 subunit comprises a sequence of nucleotides that encodes the .alpha..sub.2 subunit of a naturally occurring mammalian calcium channel, wherein the sequence of nucleotides hybridizes under conditions of high stringency with DNA that includes all or a portion of the nucleotide sequence set forth in FIGS. 2a to 2f (SEQ ID NO: 2), wherein the portion includes at least nucleotides 43-272 as set forth in FIGS. 2a to 2f.

2. The eukaryotic cell of claim 1, further comprising a heterologous reporter gene, wherein the heterologous reporter gene comprises a transcriptional control element which is active in the cell and the transcriptional activity of which responds to an ion or molecule capable of entering the cell through a functional calcium channel, linked operatively for expression to a structural gene for an indicator protein.

3. The cell of claim 2, wherein the DNA encoding the .alpha..sub.1 subunit encodes a protein having the amino acid sequence set forth in SEQ ID NO: 1 or a protein having an amino acid sequence which is identical to that set forth in SEQ ID NO: 1 except for the presence of a Thr in place of the Met at residue 1,108, an Ala in place of the Val at residue 1,185, and an Ala in place of the Glu at residue 1,835.

4. The cell of claim 2, wherein the indicator protein is selected from the group consisting of chloramphenicol acetyltransferase, luciferase, and .beta.-galactosidase.

5. The cell of claim 3, wherein the indicator protein is selected from the group consisting of chloramphenicol acetyltransferase, luciferase, and .beta.-galatosidase.