Cephalosporin C acylase

Abstract

A mutant CC acylase wherein at least one amino acid at the Ala.sup.49, Met.sup.164, Ser.sup.166, Met.sup.174, Glu.sup.358, Met.sup.465, Met.sup.506, or Met.sup.750 position of the amino acid sequence of the native CC acylase is replaced by a different amino acid, a DNA coding therefor, an expression vector containing the said DNA, a microorganism transformed with the said expression vector, the production of the CC acylase by culturing the said transformant, and use thereof for the production of a compound. The mutant CC acylase of the invention has desirable properties in terms of enzymatic potency, alteration of pH profile, efficiency of processing, and the like.

Description

The present application is a national stage application based on PCT/JP94/01799, filed Oct. 26, 1994.

The invention relates to a new cephalosporin C acylase (hereinafter referred to as "CC acylase"). More particularly, it relates to a new mutant CC acylase produced by protein engineering, a DNA coding therefor, an expression vector containing the said DNA, a microorganism transformed with the said expression vector, and the production of the CC acylase by culturing the said transformant.

The cephalosporin C acylase is a general term for an enzyme, which is, in common, capable of hydrolyzing cephalosporin C to 7-aminocephalosporanic acid (7-ACA).

Hitherto, there have been found three enzymes which should be classified as CC acylase, namely Cephalosporin C acylases SE83, N176 and V22, amino acid sequences of which are disclosed in Journal of Fermentation and Bioengineering Vol. 72, 232-243 (1991). In this literature, numbering of the amino acid sequence of CC acylase is begun at the methionine group of the N-terminal portion thereof. However, numbering of the amino acid sequence of CC acylase is begun at the threonine group adjacent to the methionine group of the N-terminal portion thereof in this Specification, because the N-terminal methionine of .alpha.-subunit of mature CC acylase obtained by expressing CC acylase gene in prokaryote is removed by an enzyme (e.g. aminopeptidase) to give a mature CC acylase having the threonine group as the N-terminal amino acid thereof. Production of native type CC acylase by recombinant DNA technology is also disclosed in the said literature and it has been found that the expressed CC acylase is intracellularly processed to give an active form composed of .alpha.-subunit and .beta.-subunit. However, efficiency of the processing is generally low in E. coli. From the results of extensive studies, the inventors of this invention have succeeded in producing mutant CC acylases which have more desirable properties which are characterized by higher enzymatic potency, alteration of pH profile, higher efficiency of processing and the like.

The new mutant CC acylase of this invention can be characterized by the following.

A mutant CC acylase wherein at least one amino acid at the Ala.sup.49, Met.sup.164, Ser.sup.166, Met.sup.174, Glu.sup.358, Met.sup.465, Met.sup.508 or Met.sup.750 position of the amino acid sequence of the native CC acylase is replaced by a different amino acid.

Preferred examples of the different amino acid to replace Met.sup.164 may include neutral amino acids such as glycine, alanine, leucine and the like.

Preferred examples of the different amino acid to replace Ser.sup.166, Met.sup.174, Met.sup.465, Met.sup.506 and/or Met.sup.750 may include neutral amino acids such as alanine and the like.

Preferred examples of the different amino acid to replace Glu.sup.358 may include neutral-amino acids (e.g. isoleucine, etc.), basic amino acids (e.g. lysine, etc.) and the like.

Most preferable example of the different amino acid to replace Ala.sup.49 is leucine.

The mutant CC acylase of this invention may also be a mutant CC acylase prepared by replacing at least one amino acid at another position of the amino acid sequence of native CC acylase with a different amino acid, for example, by replacing Met.sup.269 and/or Cys.sup.305 of the mutant CC acylase with (a) different amino acid(s).

A preferred example of the mutant CC acylase can be represented by the following formula in its precursor form before processing into .alpha.-subunit and .beta.-subunit thereof:

A1-48-X1-A50-163-X2-Gly-X3-A167-173-X4-A175-357-X5-A359-464-X6-A466-505-X7-A507-749-X8-A751-773 wherein A1-48 is the same amino acid sequence as that from Thr.sup.1 to Glu.sup.48 of native CC acylase, A50-163 is the same amino acid sequence as that from Asp.sup.50 to Leu.sup.163 of native CC acylase, A167-173 is the same amino acid sequence as that from Val.sup.167 to Arg.sup.173 of native CC acylase, A175-357 is the same amino acid sequence as that from Leu.sup.175 to Val.sup.357 of native CC acylase, A359-464 is the same amino acid sequence as that from Thr.sup.359 to Ala.sup.464 of native CC acylase, A466-505 is the same amino acid sequence as that from Pro.sup.466 to Ile.sup.505 of native CC acylase, A507-749 is the same amino acid sequence as that from Lys.sup.507 to Ala.sup.749 of native CC acylase, A751-773 is the same amino acid sequence as that from Val.sup.751 to Ala.sup.773 of native CC acylase, X1 is Ala or a different amino acid, X2, X4, X6, X7 and X8 are each Met or a different amino acid, X3 is Ser or a different amino acid and X5 is Glu or a different amino acid, providing that Met.sup.269 and/or Cys.sup.305 may be replaced by (a) different amino acid(s), and when X1 is Ala, X2, X4, X6, X7 and X8 are each Met, X3 is Ser and X5 is an amino acid other than Glu.

In this specification, a nomenclature for naming a specific mutant CC acylase is conveniently employed. According to this nomenclature, for example, a mutant CC acylase which is prepared by replacing the methionine residue at position 164 of the amino acid sequence of native CC acylase with leucine should be designated as a mutant CC acylase M164L, in which M is a one-letter abbreviation of the methionine (an amino acid) residue to be replaced, 164 is a position number of the amino acid sequence of native CC acylase and L is a one-letter abbreviation of leucine (the different amino acid) used for replacing the methionine (the former amino acid) residue. On the other hand, for example, mutant CC acylases. M164L and M164A are prepared by replacing the methionine residue at position 164 of the amino acid sequence of native CC acylase with leucine and alanine, respectively. A mutant CC acylase M164L/M174A/M269Y is prepared by replacing the methionine residue at position 164 of the amino acid sequence of native CC acylase with leucine, the methionine residue at position 174 of the amino acid sequence of native CC acylase with alanine and the methionine residue at position 269 of the amino acid sequence of native CC acylase with tyrosine.

The mutant CC acylase of this invention can be prepared by recombinant DNA technology, polypeptide synthesis and the like.

Namely, the new CC acylase can be prepared by culturing a host cell transformed with an expression vector comprising DNA encoding amino acid sequence of the new CC acylase in a nutrient medium and recovering the new CC acylase from the cultured broth.

Particulars of this process are explained in more detail as follows.

The host cell may include microorganisms �bacteria (e.g. Escherichia coli, Bacillus subtilis, etc.), yeast (e.g. Saccharomyces cerevisiae, etc.), animal cell lines and cultured plant cells!. Preferred examples of the microorganism may include bacteria, especially a strain belonging to the genus Escherichia (e.g. E. coli JM109 ATCC 53323, E. coli HB101 ATCC 33694, E. coli HB101-16 FERM BP-1872, E. coli 294 ATCC 31446, etc.), yeast, especially a strain belonging to the genus Saccharomyces �e.g. Saccharomyces cerevisiae AH22!, animal cell lines �e.g. mouse L929-cell, Chinese hamster ovary (CHO) cell, etc.! and the like.

When a becterium, especially E. coli is used as a host cell, the expression vector is usually composed of at least promoter-operator region, initiation codon, DNA encoding amino acid sequence of the new CC acylase, termination codon, terminator region and replicatable unit. When yeasts or animal cells are used as host cells, the expression vector is preferably composed of at least promoter, initiation codon, DNA encoding amino acid sequences of the signal peptide and the new CC acylase, and termination codon. It is possible that enhancer sequence, 5'- and 3'-noncoding region of the new CC acylase, splicing junctions, polyadenylation site and replicatable unit are also inserted into the expression vector.

The promoter-operator region comprises promoter, operator and Shine-Dalgarno (SD) sequence (e.g. AAGG, etc.). Preferable promoter-operator region may include conventionally employed promoter-operator region (e.g. PL-promoter and trp-promoter for E. coli) and promoter of the CC acylase N-176 chromosomal gene. The promoter for expression of the new CC acylase in yeast may include the promoter of the TRP1 gene, the ADHI or ADHII gene and acid phosphatase (pH05) gene for S. cerevisiae and the promoter for the expression of the new CC acylase in mammalian cells may include SV40 early or late-promoter, HTLV-LTR-promoter, mouse metallothionein I(MMT)-promoter, vaccinia-promoter and the like.

Preferable initiation codon may include methionine codon (ATG).

The signal peptide may include a signal peptide of conventionally employed other enzymes (signal peptide of the native t-PA, signal peptide of the native plasminogen) and the like.

The DNA encoding amino acid sequence of the new CC acylase can be prepared in a conventional manner such as a partial or whole DNA synthesis using DNA synthesizer and/or treatment of the complete DNA sequence coding for the native CC acylase inserted in a suitable vector (e.g. pCCN 176-2) obtainable from a transformant �e.g. E. coli JM109 (pCCN 176-2) FERM BP-3047! in a suitable manner such as a conventional mutation method �e.g. cassette mutation method (cf. Tokunaga, T. et al., Eur. J. Biochem. 153, 445-449 (1985)), PCR mutation method (cf. Higuchi, R. et al., Nucleic Acids Res. 16, 7351-7367 (1988)), Kunkel's method (cf. Kunkel, T. A. et al., Methods Enzymol. 154, 367 (1987)) and the like! in addition to treatment with a suitable enzyme (e.g. restriction enzyme, alkaline phosphatase, polynucleotide kinase, DNA ligase, DNA polymerase, etc.).

The termination codon(s) may include a conventionally employed termination codon (e.g. TAG, TGA, etc.).

The terminator region may include natural or synthetic terminator (e.g. synthetic fd phage terminator, etc.).

The replicatable unit is a DNA compound capable of replicating the whole DNA sequence belonging thereto in a host cell, and may include natural plasmid, artificially modified plasmid (e.g. DNA fragment prepared from natural plasmid) and synthetic plasmid. Preferable examples of the plasmid may include plasmid pBR322 and the artificially modified thereof (DNA fragment obtained from a suitable restriction enzyme treatment of pBR322) for E. coli, yeast 2.mu. plasmid and yeast chromosomal DNA for yeast, plasmid pRSVneo ATCC 37198, plasmid pSV2dhfr ATCC 37145, plasmid pdBPV-MMTneo ATCC 37224, and plasmid pSV2neo ATCC 37149 for mammalian cells.

The enhancer sequence may include the enhancer sequence (72 b.p.) of SV40.

The polyadenylation site may include the polyadenylation site of SV40.

The splicing junction may include the splicing junction of SV40.

The promoter, initiation codon, DNA encoding amino acid sequence of the new CC acylase, termination codon(s) and terminator region can consecutively and circularly be linked together with an adequate replicatable unit (plasmid), if desired, using (an) adequate DNA fragment(s) (e.g. linker, other restriction site, etc.) in a conventional manner (e.g. digestion with restriction enzyme, ligation using T4 DNA ligase) to give an expression vector.

A host cell can be transformed (transfected) with the expression vector. Transformation (transfection) can be carried out in a conventional manner �e.g. Kushner method for E. coli, calcium phosphate method for mammalian cells, microinjection, etc.! to give a transformant (transfectant).

For the production of the new CC acylase by the process of this invention, the thus obtained transformant comprising the expression vector is cultured in an aqueous nutrient medium.

The nutrient medium may contain carbon source(s) (e.g. glucose, glycerine, mannitol, fructose, lactose, etc.) and inorganic or organic nitrogen source(s) (e.g. ammonium sulfate, ammonium chloride, hydrolysate of casein, yeast extract, polypeptone, bactotrypton, beef extract, etc.). If desired, other nutritious sources �e.g. inorganic salts (e.g. sodium or potassium biphosphate, dipotassium hydrogen phosphate, magnesium chloride, magnesium sulfate, calcium chloride), vitamins (e.g. vitamin B1), antibiotics (e.g. ampicillin, kanamycin), etc.! may be added to the medium. For the culture of mammalian cells, Dulbecco's Modified Eagle's Minimum Essential Medium (DMEM) supplemented with fetal calf serum and an antibiotic is often used.

The culture of the transformant (including transfectant) is usually carried out at pH 5.5-8.5 (preferably pH 7-7.5) and 18.degree.-40.degree. C. (preferably 20.degree.-30.degree. C.) for 5-50 hours.

When the thus produced new CC acylase exists in the culture solution, culture filtrate (supernatant) is obtained by filtration or centrifugation of the cultured broth. From the culture filtrate, the new CC acylase can be purified in a conventional manner generally employed for the purification and isolation of natural or synthetic proteins (e.g. dialysis, gel filtration, affinity column chromatography using anti-CC acylase monoclonal antibody, column chromatography on a suitable adsorbent, high performance liquid chromatography, etc.). When the produced new CC acylase exists in periplasm and cytoplasm of the cultured transformant, the cells are collected by filtration and centrifugation, and the cell wall and/or cell membrane thereof are(is) destroyed by, for example, treatment with super sonic waves and/or lysozyme to give debris and/or lysate. The debris and/or lysate can be dissolved in a suitable aqueous solution (e.g. 8M aqueous urea, 6M aqueous quanidium salts). From the solution, the new CC acylase can be purified in a conventional manner as exemplified above.

This invention further provides a process for the preparation of a compound of the formula: ##STR1## wherein R.sup.1 is acetoxy its salt, or hydrogen, or its salt, which comprises contacting a compound of the formula: ##STR2## wherein R.sup.1 is as defined above and R.sup.2 is carboxylic acyl, or its salt,

with the cultured broth of a microorganism transformed with an expression vector comprising DNA encoding the new CC acylase of this invention or its processed material.

The carboxylic acyl for R.sup.2 may include aliphatic, aromatic or heterocyclic carboxylic acyl and suitable example thereof may be C.sub.1 -C.sub.6 alkanoyl which may have one or two suitable substituent(s) selected from the group of amino, hydroxy, carboxy, C.sub.1 -C.sub.6 alkanoylamino, benzamido, thienyl, and the like.

Suitable salt of the compounds (I) and (II) may be alkali metal salt (e.g. sodium salt, potassium salt, lithium salt).

If the CC acylase activity usually exists in transformed cells, the following preparations can be exemplified as a processed material of the cultured broth.

(1) Raw cells: separated from the cultured broth in a conventional manner such as filtration and centrifugation; (2) dried cells: obtained by drying said raw cells in a conventional manner such as lyophilization and vacuum drying; (3) cell-free extract: obtained by destroying said raw or dried cells in a conventional manner (e.g. autolysis of the cells using an organic solvent, grinding the cells with alumina, sea sand, etc. or treating the cells with super sonic waves); (4) enzyme solution: obtained by purification or partial purification of said cell-free extracts in a conventional manner (e.g. column chromatography); and (5) immobilized cells or enzyme: prepared by immobilizing said cells or enzyme in a conventional manner (e.g. a method using acrylamide, glass bead, ion exchange resin, etc.).

The reaction comprising a contact of the compound (II) with the enzyme can be conducted in an aqueous medium such as water or a buffer solution, that is, it can be usually conducted by dissolving or suspending the cultured broth or its processed material in an aqueous medium such as water or a buffer solution containing the compound (II).

Preferable pH of the reaction mixture, concentration of the compound (II), reaction time and reaction temperature may vary with properties of the cultured broth or its processed material to be used. Generally, the reaction is carried out at pH 6 to 10, preferably pH 7 to 9, at 5.degree. to 40.degree. C., preferably 5.degree. to 37.degree. C. for 0.5 to 50 hours.

The concentration of the compound (II) as a substrate in the reaction mixture may be preferably selected from the range of from 1 to 100 mg/ml.

The thus produced compound (I) can be purified and isolated from the reaction mixture in a conventional manner.

Specific activities of mutant acylases were determined according to the procedure mentioned below.

i) GL-7ACA acylase activity

To 500 .mu.l of GL-7ACA solution �10 mg/ml in 0.15M Tris.HCl (pH 7.5)! that was pre-incubated at 37.degree. C. for 10 min, 20 .mu.l of sample acylase was added and the mixture was incubated at 37.degree. C. for 5 min. The reaction was stopped by the addition of 550 .mu.l of 5% acetic acid. After centrifugation (10,000 rpm for 5 min at ambient temperature) of the resulting mixture, the supernatant was used for the assay of 7ACA formation.

HPLC conditions: column: TSKgel ODS-80 TMCTR 4.4 mm.times.100 mm (TOSOH); eluate: 100 mM citric acid, 5.0 mM sodium n-hexane-1-sulfonate in 14.3% (V/V) acetonitrile; flow rate: 1.0 ml/min; injection volume: 10 .mu.l; detector: 254 nm.

One unit was defined as the activity capable of synthesizing 1.0 .mu.mole of 7ACA from GL-7ACA per minute at 37.degree. C.

ii) CC acylase activity

To 500 .mu.l of CC solution �10 mg/ml sodium salt of cephalosporin C in 0.15M Tris.HCl (pH 8.7), pH was readjusted with 1N NaOH to pH 8.7! that was pre-incubated at 37.degree. C. for 10 min, 20 .mu.l of a sample acylase was added and the mixture was incubated at 37.degree. C. for 10 min. The reaction was stopped by the addition of 550 .mu.l of 5% acetic acid. After centrifugation (10,000 rpm for 5 min at ambient temperature) of the resulting mixture, the supernatant was used for the assay of 7ACA formation.

HPLC conditions: column: TSKgel ODS-80 TMCTR 4.4 mm.times.100 mm (TOSOH), eluate: 100 mM citric acid, 5.0 mM sodium n-hexane-1-sulfonate in 14.3% (V/V) acetonitrile; flow rate: 1.0 ml/min;

injection volume: 20 .mu.l; detector: 254 nm.

One unit was defined as the activity capable of synthesizing 1.0 .mu.mole of 7ACA from sodium salt of Cephalosporin C per minute at 37.degree. C.

Brief explanation of the accompanying drawings is as follows.

FIG. 1 shows DNA oligomers used in the working Examples of this Specification (SEQ ID NO:1-42).

FIG. 2 is a schematic presentation of the construction of pCC001A.

FIG. 3 is a schematic presentation of the construction of pCC002A.

FIG. 4 is a schematic presentation of the construction of pCK002.

FIG. 5 is a schematic presentation of the construction of pCC007A and pCCNt013.

FIG. 6 is a schematic presentation of the construction of pCC013A.

FIG. 7 is a schematic presentation of the construction of p.DELTA.N176 and pCK013.

FIG. 8 is a schematic presentation of the preparation of mp18p181 and mp18p183.

FIG. 9 is a schematic presentation of the preparation of mp18p181M164A, mp18p181M174A, pCKM174A and pCKM164A.

FIG. 10 is a schematic presentation of the preparation of pCKS166A.

FIG. 11 is a schematic presentation of the preparation of pCKM164L and pCKM164G.

FIG. 12 is a schematic presentation of the construction of mp19pfu62.

FIG. 13 is a schematic presentation of the preparation of RF DNAs (mp19pfu62M465A, mp19pfu62M506A and mp19pfu62M750A) and expression vectors (pCKM465A, pCKM506A and pCKM750A).

FIG. 14 is a schematic presentation of the preparation of p269I358K, p269I358S and p269I358L.

FIG. 15 is a schematic presentation of the preparation of pCCE358R and pGCE358T.

FIG. 16 is a schematic presentation of the preparation of p164L269Y, p164L269F and p164L269Y305S.

FIG. 17 is a schematic presentation of the preparation of p164L174A and p164A174A.

FIG. 18 is a schematic presentation of the preparation of p164A269Y, p164L174A269Y, p164L174A269F, p164A174A269Y305S.

FIG. 19 is a schematic presentation of the preparation of p164L174A269Y305S750A.

FIG. 20 is a schematic presentation of the preparation of pCKA49L.

FIG. 21 is a schematic presentation of the preparation of p49L164L174A269Y.

FIG. 22 shows the nucleotide and amino acid sequences of mutant CC acylase M164A (SEQ ID NO:43,44).

FIG. 23 shows the nucleotide and amino acid sequences of mutant CC acylase S166A (SEQ ID NO:45,46).

FIG. 24 shows the nucleotide and amino acid sequences of mutant CC acylase M269I/E358K (SEQ ID NO:47,48).

FIG. 25 shows the nucleotide and amino acid sequences of mutant CC acylase M164L/M174A/M269Y (SEQ ID NO:49,50).

FIG. 26 shows the nucleotide and amino acid sequences of mutant CC acylase A49L (SEQ ID NO:51,52).

In the following Examples, some plasmids, enzymes, such as restriction enzymes, T4 DNA ligases, and other materials were obtained from commercial sources and used according to the indication by suppliers. In particular, plasmid pCCN176-2 and plasmid pTQiPA.DELTA.trp used as starting materials in Examples have been deposited at an international depository, National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology in Japan, as transformant E. coli JM109 (pCCN176-2) FERM BP-3047 and transformant E. coli HB101-16 (pTQiPA.DELTA.trp) FERM BP-1870, respectively, and can be easily obtained based on U.S. Pat. No. 5,192,678 and European Patent Application Publication No. 302456. Other plasmid etc. can be easily prepared according to the description in the specification, from said pCCN176-2, pTQiPA.DELTA.trp and those commercially available. Operations employed for the cloning of DNA, transformation of host cells, cultivation of transformants, recovery of the new CC acylase from the cultured broth, and the like are well known in the art or can be adapted from literatures.

The following examples are given for the purpose of illustrating this invention, and the invention is not limited thereto.

EXAMPLE 1

(Synthesis of Oligodeoxyribonucleotide)

A DNA oligomer SO-M164A �as listed in FIG. 1(a)! was synthesized with 381A DNA synthesizer (Applied Biosystems Inc.). The DNA was liberated from CPG polymer support (CPG: controlled pore glass) with 28% aqueous ammonia followed by heating at 60.degree. C. for 9 hours to remove all protection groups (SEQ ID NO:2). The reaction mixture was evaporated in vacuo, and the residue was dissolved in 200 .mu.l of TE buffer �10 mM Tris.HCl (pH 7.4)-1 mM EDTA!. The resulting crude DNA solution was applied to reverse phase HPLC �column; COSMOSIL C18 4.6 mm.times.150 mm (Nacalai Tesque), eluate; A: 0.1M Triethylammonium acetate buffer (pH 7.2-7.4), B: acetonitrile, gradient; initial A(100%), final A(60%)+B(40%), linear gradient during 25 min, flow rate; 1.2 ml/min!. The eluate containing the objective DNA oligomer was collected and evaporated in vacuo. The purified DNA was dissolved in 200 .mu.l of TE buffer and stored at -20.degree. C. before use.

All other DNA oligomers listed in FIG. 1 were synthesized and purified in a manner similar to that described above.

EXAMPLE 2

(Preparation of Expression Vector for Native CC Acylase N176 Under the Control of trp Promoter)

(1) Construction of pCC002A, an ampicillin resistant expression vector for native CC acylase N176 (i) Construction of pCC001A

Plasmid pCCN176-3 �preparation method of this plasmid from plasmid pCCN176-2 (which is obtainable from a transformant Escherichia coli JM109 (pCCN176-2) FERM BP-3047 in a conventional manner) is disclosed in page 235 of JOURNAL OF FERMENTATION AND BIOENGINEERING Vol. 72, 1991! (1.0 .mu.g) was digested with EcoRI and HindIII, and the 2.9 kb fragment carrying the entire coding region of CC acylase N176 was isolated by agarose gel electrophoresis. On the other hand, PTQiPA.DELTA.trp (1.0 .mu.g), an expression vector for a mutant t-PA �which is obtainable from a transformant, Escherichia coli HB101-16 (pTQiPA.DELTA.trp) FERM BP-1870 in a conventional manner and a preparation method of which is disclosed in European Patent Application Publication No. 3024561! was digested with XmaI and XhoI, and a larger DNA (5113 bp) was isolated. Synthetic DNA oligomers CT-1 (5'-CCGGGTGTGTACACCAAGGTTACCAACTACCTAGACTGGATTCGTGACAACATGCGACCGTGA), CT-2 (5'-AGCTTCACGGTCGCATGTTGTCACGAATCCAGTCTAGGTAGTTGGTAACCTTGGTGTACACAC), TR-1 (5'-AGCTTGTCCTCGAGATCAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTTG) and TR-2 (5'-TCGACAAAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGATCTCGAGGACA) were phosphorylated with T4 polynucleotide kinase and ligated with T4 DNA ligase to give XmaI/SalI DNA fragment (114 bp) (SEQ ID NO:53-56). The resultant DNA fragment was ligated to the XmaI/XhoI DNA to give pTQiPAdtrp. The pTQiPAdtrp (1.0 .mu.g) was digested with EcoRI and HindIII. The resulting 4.3 kb DNA carrying trp promoter, a part of t-PA coding region (Cys92 to Trp113) and the duplicated sequence of fd phage central terminator were isolated. The 2.9 kb and 4.3 kb DNA fragments were mixed to ligate in the presence of T4 DNA ligase (300 units, Takara Shuzo) at 16.degree. C. for 5 hours. in 40 .mu.l of a ligation buffer consisting of 50 mM Tris.HCl 10 mM MgCl.sub.2, 10 mM dithiothreitol and 1 mM ATP. The ligation mixture was used to transform E. coli JM109. The desired plasmid, designated as pCC001A, was obtained from one of the transformants resistant to ampicillin and characterized by restriction mapping.

(ii) Construction of pCC002A

Plasmid pCC001A contains a portion of t-PA (Cys92 to Trp113) gene between trp promoter and the acylase gene. In order to remove this region, pCC001A (1.0 .mu.g) was digested with ClaI and MluI and the resulting 6.1 kb DNA fragment was isolated. On the other hand, pCCN176-3 (1 .mu.g) was digested with MluI and Sau3AI to isolate 189 bp DNA coding for Asp7 to Arg71 of the acylase. Synthetic DNA oligomers 002a and 002b (0.5 nmole, respectively, Table 1 below) were phosphorylated with T4 polynucleotide kinase (1.5 units, Takara Shuzo) in 10 .mu.l of a buffer (kination buffer; 50 mM Tris.HCl, 10 mM MgCl.sub.2, 10 mM DTT, 1.0 mM ATP) at 37.degree. C. for 1 hour and the reaction mixture was heated at 55.degree. C. for 20 min to inactivate the enzyme (SEQ ID NO:60,61). The resulting mixture was combined to ligate with the 189 bp Sau3AI/MluI DNA in the presence of T4 ligase at 15.degree. C. for 3 hours in 20 .mu.l of a ligation buffer. To the resultant ligation mixture, the 6.1 kb ClaI/MluI DNA fragment was added and the mixture was incubated at 4.degree. C. for 16 hours in the presence of additional T4 DNA ligase (300 units). The resultant ligation mixture was used to transform E. coli JM109. From one of the transformants, the desired plasmid pCC002A that is an expression vector for CC acylase N176 was isolated and characterized by restriction mapping.

TABLE 1______________________________________Synthetic DNA oligomers for casette mutation ofN-terminal of CC acylase N176(SEQ ID NO 57-63)restriction sequence of synthetic DNA oligomerssites of upper strand: 5' .fwdarw. 3' name/each end lower strand: 3' .fwdarw. 5' length______________________________________EcoRI/ AATTCGGATCCAAGCTTA 007a/18MluI GCCTAGGTTCGAATGCGC 007b/18 fMetThrMetAlaAlaAsnThrClaI/ CGATAAAATGACTATGGCGGCCAACACC 002a/28Sau3AI TATTTTACTGATACCGCCGGTTGTGGCTAG 002b/30C1aI/ fMetThrMetAlaAlaAsnThrBamHI CGATAAAATGACTATGGCAGCTAATACG 013a/28 TATTTTACTGATACCGTCGATTATGCCTAG 013b/30______________________________________ (2) Construction of pCK002, a kanamycin resistant expression vector for CC acylase N176

Plasmid pCC002A was digested with DraI (TOYOBO). The resultant mixture was treated with phenol to remove the enzyme and precipitated by EtOH. The recovered DNA was suspended in 20 .mu.l of a ligation buffer and mixed with phosphorylated EcoRI linker (2 .mu.g, Pharmacia), followed by incubation with T4 DNA ligase (300 units) at 4.degree. C. for 16 hours. The reaction mixture was extracted with phenol and precipitated by EtOH. The recovered DNA was digested with EcoRI and the resultant 5.6 kb DNA lacking ampicillin resistant gene was isolated by agarose gel electrophoresis. On the other hand, plasmid pA097 �which is obtainable from a transformant Escherichia coli JM109 (pA097) FERM BP-37721 (1 .mu.g) was digested with EcoRI, and the resulting 1.2 kb DNA of kanamycin resistance gene was isolated. The 1.2 kb EcoRI DNA was ligated to the 5.6 kb EcoRI DNA with T4 DNA ligase (300 units) in 50 .mu.l of a ligation buffer at 16.degree. C. for 2 hours. The ligation mixture was used to transform E. coli JM109 to obtain the desired plasmid pCK002 carrying kanamycin resistant gene for antibiotic marker.

EXAMPLE 3

(Construction of pCK013, a High Expression Vector for CC Acylase N176)

(1) Construction of pCC013A (i) Construction of pCC007A

Plasmid pCC001A was digested with EcoRI and MluI and the resulting 6.4 kb DNA fragment was isolated by agarose gel electrophoresis. The recovered DNA was ligated to synthetic DNA oligomers 007a and 007b (0.5 .mu.g, respectively, Table 1), each of which were phosphorylated prior to the ligation reaction, with T4 DNA ligase (300 units) at 16.degree. C. for 5 hours (SEQ ID NO:57,58). The resultant mixture was used to transform E. coli JM109 to obtain the desired plasmid pCC007A.

(ii) Construction of pCCNt013

Plasmid pCC007A (1.0 .mu.g) was digested with ClaI and BamHI and the resultant 6.1 kb DNA was isolated by 5% polyacrylamide gel electrophoresis. The DNA was ligated to synthetic oligomers 013a and 013b (0.5 .mu.g, respectively, each of which were phosphorylated, Table 1) with T4 DNA ligase (300 units) (SEQ ID NO:62,63). The ligation mixture was used to transform E. coli JM109 and the desired plasmid pCCNt013 was isolated from ampicillin resistant transformants.

(iii) Construction of pCC013A

Plasmid pCCNt013 was digested with BamHI and MluI and the resultant 6.1 kb DNA was isolated. On the other hand, pCC002A (1.0 .mu.g) was digested with MluI and Sau3AI to obtain 189 bp DNA fragment. The resultant DNA was ligated to the 6.1 kb BamHI/MluI DNA fragment with T4 DNA ligase (300 units) and the ligation mixture was used to transform E. coli JM109. From one of the transformants resistant to ampicillin, the desired plasmid pCC013A that has AT-rich NH.sub.2 terminal DNA sequence (coding for the same amino acid sequence as that of native CC acylase N176) was isolated.

(2) Construction of pCK013, a kanamycin resistant expression vector for native CC acylase N176 (i) Construction of p.DELTA.N176

Plasmid pCK002 (1.0 .mu.g) was digested with AatII (TOYOBO) and the resultant DNA was treated with T4 DNA ligase (150 units) for self-ligation. The ligation mixture was used to transform E. coli JM109 to obtain the desired plasmid p.DELTA.N176 carrying a unique AtaII restriction endonuclease site.

(ii) Construction of pCK013

Plasmid p.DELTA.N176 (1.0 .mu.g) was digested with AatII and the linearized DNA was treated with bacterial alkaline phosphatase (1 unit, Takara shuzo) in 100 mM Tris.HCl (pH 8.0) buffer 42.degree. C. for 1 hour. The dephosphorylated DNA was isolated and ligated to the 2.5 kb AatII DNA from pCC013A with T4 DNA ligase. The ligation mixture was used to transform E. coli JM109 to obtain the desired plasmid pCK013 carrying kanamaycin resistant gene for marker.

EXAMPLE 4

(Point Mutation of DNA Coding for CC Acylase N176 by Kunkel's Method)

(1) Subcloning of DNA coding for CC acylase N176 to M13 phage (i) Preparation of mp18p181

Plasmid pCC013A (An expression vector for native CC acylase N176 carrying ampicillin-resistant marker and construction of this plasmid is disclosed in European Patent Application Publication No. 558,241, p.8) was digested with HpaI and Smal. The 842 bp DNA coding for Met.sup.1 to Pro.sup.267 of CC acylase N176 was isolated. The DNA was ligated to 7250 bp M13mp18 digested with SmaI in the presence of T4 DNA ligase and the ligation mixture was used to transform E. coli JM109. From one of the plaques, the desired RF DNA mp18p181 in which the part of the acylase DNA had been inserted in the reverse direction with plus ori of M13, was isolated and characterized by restriction mapping. The phage solution from which RF DNA mp18p181 was prepared was stored at 4.degree. C. before use.

RF DNA mp18p183 was prepared from 1162 bp HpaI/Eco47III DNA coding for Met.sup.1 to Ala.sup.414 of CC acylase N176 from pCC013A and 7250 bp M13mp18 digested with HincII in a manner similar to that described above.

(ii) Preparation of single-stranded U-mp18p181-SS(cf. Kunkel, T. A. et al. Methods Enzyml. 154, 367)

A single colony of E. coli CJ236 (dut-, ung-, F')(Bio-Rad Lab.) was cultured in 2 ml of 2XTY broth containing chloramphenicol (30 .mu.g/ml) at 37.degree. C. for 16 hours. The cells (0.1 ml) were transferred to a fresh 2XTY broth (50 ml) containing 30 .mu.g/ml chloramphenicol and the cultivation was continued at 37.degree. C. When the absorbance at 600 nm reached 0.3, the phage solution (MOI<0.2) of mp18p181 was added to the culture. The cultivation was continued for additional 5 hours. After centrifugation at 17,000.times.g at 4.degree. C. for 15 min, the supernatant was centrifuged again. The resultant supernatant (30 ml) was treated with RNase (150 .mu.g/ml, Sigma) at ambient temperature for 30 min, followed by addition of 7.5 ml of PEG solution (3.5M NH.sub.4 OAc in 20% polyethyleneglycol 8,000). After centrifugation (17,000.times.g, 15 min, 4.degree. C.), the residue was suspended in 200 .mu.l of a buffer consisting of 300 mM NaCl, 100 mM Tris.HCl (pH 8.0) and 0.1 mM EDTA. The resultant solution was extracted with 200 .mu.l of phenol and 200 .mu.l of phenol/CHCl.sub.3 (1:1), successively, and washed twice with CHCl.sub.3 (200 .mu.l). To the solution, 7.5M NH.sub.4 OAc (100 .mu.l ) and ethanol (600 .mu.l) were added to precipitate phage DNA. The DNA was collected by centrifugation, washed with 700 .mu.l of ice-cooled 90% ethanol, and dried in vacuo. The purified single-stranded U-DNA (U-mp18p181-SS) was suspended in 20 .mu.l of TE buffer and stored at 4.degree. C. before use.

Other single-stranded U-DNAs for Kunkel's mutation method were prepared in a manner similar to that described above.

(2) Preparation of mp18p181M164A for mutant CC acylase M164A

An oligodeoxyribonucleotide SO-M164A (0.2 nmol) was incubated with T4 DNA kinase (10 units) in 15 .mu.l of buffer consisting of 1.3 mM ATP, 10 mM dithiothreitol (DTT), 50 mM Tris.HCl, 6.6 mM in 5% polyethyleneglycol (PEG) 6,000 at 37.degree. C. for 60 min (SEQ ID NO:2). The phosphorylated primer (1.5 .mu.l, 20 pmol) was mixed with SS-U-DNA of mp18p181 (1 .mu.l, 0.1 pmol) in 20 .mu.l of a buffer consisting of 10 mM Tris.HCl (pH 8.0), 6 mM and 40 mM NaCl. The mixture was heated at 75.degree. C. for 5 min, followed by cooling to room temperature over 40 min, and then the mixture was placed at 0.degree. C. To the mixture, T4 DNA polymerase (15 units), T4 DNA ligase (600 units), 100 mM dithiothreitol (DTT, 6 .mu.l), 10 mM ATP (2 .mu.l) and 5 mM dNTP (dATP, dCTP, dGTP and dTTP, 2 .mu.l ) were added. The resulting mixture was incubated at room temperature for 5 min and at 37.degree. C. for 1.5 h, successively. A portion of the reaction mixture (1.0 .mu.l ) was added to competent cells (100 .mu.l) of E. coli JM109 prepared according to Sigesada's method �Sigesada, K. (1983) SAIBO-KOUGAKU (Japanese) 2, 616-626!, and the cells were incubated on wet ice for 30 min. To the transformed cells, E. coli JM109 cultivated in L broth (A600=0.8, 200 .mu.l) was added, and the mixture of the cells was added to 3 ml of H Top agar (1% Bactotrypton, 0.8% NaCl, 0.8% agar) preheated at 55.degree. C. The mixture was spread over an H plate (1% Bactotryptone, 0.8% NaCl, 1.5% agar) and the plate was incubated at 37.degree. C. for 16 h. From plaques on the plate, the desired RF DNA (mp18p181M164A) was isolated and characterized by digestion with BamHI.

(3) Preparation of pCKM164A for mutant CC acylase M164A

mp18p181M164A was digested with MluI and BstBI, and the 582 bp DNA fragment was isolated by agarose gel electrophoresis. Also, pCK013 (an expression vector for native CC acylase N176 carrying kanamycin-resistant marker and construction of this plasmid is disclosed in European Patent Application Publication No. 558,241, p. 8) was digested with MluI and BstBI and a larger DNA fragment was isolated. The resultant DNA (0.03 pmol) was ligated to the 582 bp MluI/BstBI DNA (0.15 pmol) with T4 DNA ligase (300 units) in 10 .mu.l of a ligation buffer (66 mM Tris.HCl (pH 7.6), 6.6 mM, 10 mM .beta.-mercaptoethanol, 0.5 mM ATP) at ambient temperature for 5 hours. The ligation mixture was used to transform E. coli JM109. From one of the transformants resistant to kanamycin, the desired plasmid pCKM164A was isolated and characterized by restriction mapping. The transformant was named as E. coli JM109/pCKM164A, a glycerol stock of which was prepared in a conventional manner.

(4) Preparation of mp18p181M174A for mutant CC acylase M174A

mp18p181M174A was prepared from SS-U-DNA of mp18p181 and DNA oligomer SO-M174A in a manner similar to that described above.

(5) Preparation of expression vector, pCKM174A for mutant CC acylase M174A

An expression vector for mutant CC acylase M174A and a transformant thereof were prepared in a manner similar to that described above and designated as pCKM174A and E. coli JM109/pCKM174A, respectively. A glycerol stock of the transformant was prepared in a conventional manner.

(6) Preparation of expression vector, pCKS166A for mutant CC acylase S166A

mp18p183S166A for mutant CC acylase S166A was prepared from mp18p183 and DNA oligomer SO-S166A (5'-CATCCGCCAAAGCTTGAACCACACC GCACCCATAAG) in a manner similar to that described above. mp18p183S166A was digested with MluI and BstBI (SEQ ID NO:13). A smaller DNA fragment was isolated and ligated with a larger DNA fragment of pCK013 digested with MluI and BstBI to give pCKS166A. E. coli JM109 was transformed with pCKS166A to give a transformant E. coli JM109/pCKS166A, a glycerol stock of which was prepared in a conventional manner.

EXAMPLE 5

(Point Mutation of DNA Coding for CC Acylase N176 by PCR Method)

(1) Preparation of expression vector, pCKM164L for mutant CC acylase M164L

pCK013 (template DNA, 0.5 fmol), DNA oligomer SO-MluFor �primer #1, 125 pmol, FIG. 1(b)! and SO-M164L �primer #2, 125 pmol, FIG. 1(b)! were mixed with Taq DNA polymerase (Kurabo, 1 unit) in 100 .mu.l of a buffer consisting of 10 mM Tris.HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 2.5 mM and 0.2 mM dNTP (SEQ ID NO:15,25). The mixture was covered with mineral oil and PCR (Polymerase chain reaction) was carried out as follows. After an initial denaturation (96.degree. C. for 0.5 min), the reaction was performed for 30 cycles of amplification (97.degree. C. for 1.5 min, 50.degree. C. for 2.5 min and 72.degree. C. for 2.5 min), followed by final extension (72.degree. C. for 7 min). The resultant mixture was extracted with phenol, precipitated with ethanol and digested with BamHI and MluI. The 285 bp BamHI/MluI DNA was ligated to a larger DNA fragment of pCKM164A digested with BamHI and MluI. The ligation mixture was used to transform E. coli JM109. From one of the transformants resistant to kanamycin, the desired plasmid pCKM164L was isolated and characterized by restriction mapping. E. coli JM109 was transformed with pCKM164L to give a transformant E. coli JM109/pCKM164L, a glycerol stock of which was prepared in a conventional manner.

(2) Preparation of expression vector, pCKM164G for mutant CC acylase M164G

Mutation and amplification of the DNA fragment for mutant CC acylase M164G was performed using pCK013 (template DNA) and DNA oligomers SO-MluFor �primer #1, FIG. 1(b)! and SO-M164G �FIG. 1(b)! in a manner similar to that described above. The resultant 285 bp BamHI/MluI DNA was ligated to a larger DNA fragment of pCKM164A digested with MluI and BamHI to give pCKM164G (SEQ ID NO:15,21). E. coli JM109 was transformed with pCKM164G (SEQ ID NO:15,21) to give a transformant E. coli JM109/pCKM164G, a glycerol stock of which was prepared in a conventional manner.

(3) Expression vectors for other M164 mutant CC acylase

Expression vectors for M164X mutant acylases (X=C, D, E, F, H, I, K, N, P, Q, R, S, T, V, W or Y) and transformants thereof were prepared in a manner similar to that described above.

EXAMPLE 6

(Preparation of Expression Vectors for Other Mutant CC Acylases)

(1) Construction of mp19pfu62

M13mp19 (1.0 .mu.g) was digested with SmaI (5 units) and HindIII (5 units) and the resulting 7.2 kb DNA was isolated by agarose gel electrophoresis. On the other hand, pCK002 (construction of this plasmid is disclosed in European Patent Application Publication No. 558,241, p. 7) was digested with SmaI and HindIII and a 1.6 kb DNA was isolated. The resulting DNA was ligated to the 7.2 kb SmaI/HindIII DNA with T4 DNA ligase (300 units) in 20 .mu.l of a ligation buffer at 15.degree. C. for 2 h. The ligation mixture was used to transform E. coli JM109 to obtain the desired RF DNA mp19pfu62. The single-stranded U-DNA (SS-U-DNA) of mp19pfu62 was prepared in a manner similar to that described in Example 2 (1)(ii).

(2) Preparation of mp19pfu62M465A for mutant CC acylase M465A

mp19pfu62M465A was prepared from SS-U-DNA of mp19pfu62 and DNA oligomer SO-M465A �FIG. 1(a)! in a manner similar to that described above (SEQ ID NO:6).

(3) Preparation of mp19pfu62M506A for mutant CC acylase M506A

mp19pfu62M506A was prepared from SS-U-DNA of mp19pfu62 and DNA oligomer SO-M506A �FIG. 1(a)! in a manner similar to that described above (SEQ ID NO:8).

(4) Preparation of mp19pfu62M750A for mutant CC acylase M750A

mp19pfu62M750A was prepared from SS-U-DNA of mp19pfu62 and DNA oligomer SO-M750A �FIG. 1(a)! in a manner similar to that described above (SEQ ID NO:10).

(5) Preparation of expression vector, pCKM465A for mutant CC acylase M465A

mp19pfu62M465A was digested with PstI and NcoI, and a smaller DNA fragment (1271 bp) was isolated by agarose gel electrophoresis. Also, pCK013 was digested with PstI and NcoI. A larger DNA was isolated and ligated to the 1271 bp PstI/NcoI DNA with T4 DNA ligase in a buffer consisting of 50 mM Tris.HCl, 10 mM, 1.0 mM DTT and 5% PEG 6,000. The ligation mixture was used to transform E. coli DH10B. From one of the transformants resistant to kanamycin, the desired plasmid pCKM465A was isolated and characterized by restriction mapping. E. coli JM109 was transformed with pCKM465A to give a transformant E. coli JM109/pCKM465A, a glycerol stock of which was prepared in a conventional manner.

(6) Preparation of expression vector, pCKM506A for mutant CC acylase M506A

The pCKM506A was constructed from pCK013 and mp19pfu62M506A in a manner similar to that described above. E. coli JM109 was transformed with pCKM506A to give a transformant E. coli JM109/pCKM506A, a glycerol stock of which was prepared in a conventional manner.

(7) Preparation of expression vector, pCKM750A for mutant CC acylase M750A

The pCKM750A was constructed from pCK013 and mp19pfu62M750A in a manner similar to that described above. E. coli JM109 was transformed with pCKM750A to give a transformant E. coli JM109/pCKM750A, a glycerol stock of which was prepared in a conventional manner.

EXAMPLE 7

(Preparation of Expression Vectors for E358 Mutant CC Acylases)

(1) Preparation of expression vectors for M269I/E358 mutant CC acylases (i) Preparation of expression vector, p269I358K for mutant CC acylase M269I/E358K

A larger DNA fragment of pCK013 digested with HpaI and MluI (0.5 fmol), DNA oligomer SO-E358K �5'-TAACCGGGCCATGGCGCGTCTTGACTATAT CGAACT, 125 pmol, listed in FIG. 1(b)(ii)! and SO-BstFor �5'-ATCGCGTCTTCGAAATACCGGGCATC, 125 pmol, listed in FIG. 1(b)(ii)! were mixed with Taq DNA polymerase (TaKaRa, 1 unit) in 100 .mu.l of a buffer consisting of 10 mM Tris.HCl (pH 8.3), 50 mM KCl, 0.1% gelatin, 1.5 mM and 0.2 mM dNTP (SEQ ID NO:38,36). The mixture was covered with mineral oil and subjected to initial denaturation (96.degree. C. for 0.5 min), 25 cycles of amplification (97.degree. C. for 1.5 min, 50.degree. C. for 2.5 min and 72.degree. C. for 2.5 min.) and final extension (72.degree. C. for 7 min). The reaction mixture was extracted with phenol, precipitated with ethanol, and digested with NcoI and BstBI. The resultant DNA (290 bp) was ligated to a larger DNA fragment of pCK013 digested with NcoI and BstBI. The ligation mixture was used to transform E. coli DH10B (purchased from Gibco-BRL). From one of the transformants resistant to kanamycin, the desired plasmid p269I358K was isolated and characterized by restriction mapping. E. coli JM109 was transformed with p269I358K to give a transformant E. coli JM109/p269I358K, a glycerol stock of which was prepared in a conventional manner.

(ii) Preparation of expression vectors, p269I358S and p269I358L for mutant CC-acylases M269I/E358S and M269I/E358L, respectively

Expression vector for M269I/E358S (or M269I/E358L) was prepared from pCK013 and DNA oligomers SO-BstFor and SO-E358S �or SO-E358L, listed in FIG. 1(b)(ii)! in a manner similar to that described above (SEQ ID NO:41,37). E. coli JM109 was transformed with p269I358S (or p269I358L) to give a transformant E. coli JM109/p269I358S (or E. coli JM109/p269I358L), a glycerol stock of which was prepared in a conventional manner.

(2) Preparation of expression vectors for other E358 mutant CC acylases (i) Preparation of expression vector, pCCE358R for mutant CC acylase E358R

mp18p183E358R for mutant CC acylase E358R was prepared from mp18p183 and DNA oligomers SO-E358R �FIG. 1(b)(ii)! in a manner similar to that described in Example 2 (SEQ ID NO:40). A smaller DNA of mp18p183E358R digested with MluI and NcoI was ligated to a larger DNA of pCC013A digested with MluI and NcoI to give pCCE358R. E. coli JM109 was transformed with pCCE358R to give a transformant E. coli JM109/pCCE358R, a glycerol stock of which was prepared in a conventional manner.

(ii) Preparation of expression vector, mutant CC acylase pCCE358T for E358T

mp18p183E358T for mutant CC acylase E358T was prepared from mp18p183 and DNA oligomer SO-E358T �FIG. 1(b)(ii)! in a manner similar to that described in Example 2 (SEQ ID NO:42). A smaller DNA of mp18p183E358T digested with MluI and-NcoI was ligated to a larger DNA of pCC013A digested with MluI and NcoI to give pCCE358T. E. coli JM109 was transformed with pCCE358T to give a transformant E. coli JM109/pCCE358T, a glycerol stock of which was prepared in a conventional manner.

EXAMPLE 8

(Preparation of Multiple Mutant CC Acylases)

(1) Combination of M164L or M164A with another mutant CC acylase (i) Preparation of expression vector, p164L269Y for mutant CC acylase M164L/M269Y

pCKM164L was digested with MluI and BstBI and a smaller DNA (582 bp) was isolated. On the other hand, pCKM269Y (construction method of this plasmid is disclosed in European Patent Application Publication No. 558,241, p. 10) was digested with MluI and BstBI. The resultant DNA (ca 6.2 kb) was isolated and ligated to 582 bp MluI/BstBI DNA. The ligation mixture was used to transform E. coli DH10B. From one of the transformants resistant to kanamycin, the desired p164L269Y was isolated and characterized by restriction mapping. E. coli JM109 was transformed with p164L269Y to give a transformant E. coli JM109/p164L269Y, a glycerol stock of which was prepared in a conventional manner.

(ii) Preparation of expression vector, p164L269F for mutant CC acylase M164L/M269F

pCKM164L was digested with MluI and BstBI and a smaller DNA (582 bp) was isolated. On the other hand, pCKM269F (construction method of this plasmid is disclosed in European Patent Application Publication No. 558,241, p. 15-16) was digested with MluI and BstBI. A larger DNA fragment (ca 6.2 kb) was isolated and ligated to 582 bp MluI/BstBI DNA. The ligation mixture was used to transform E. coli DH10B. From one of the transformants resistant to kanamycin, the desired p164L269F was isolated and characterized by restriction mapping. E. coli JM109 was transformed with p164L269F to give a transformant E. coli JM109/p164L269F, a glycerol stock of which was prepared in a conventional manner.

(iii) Preparation of expression vector, p164L269Y305S for mutant CC acylase M164L/M269Y/C305S

p164L269Y305S was prepared from pCKM164L and p269Y305S (construction method of this plasmid is disclosed in European Patent Application Publication No. 558,241, p. 10) in a manner similar to that described above. E. coli JM109 was transformed with p164L269Y305S to give a transformant E. coli JM109/p164L269Y305S, a glycerol stock of which was prepared in a conventional manner.

(iv) Preparation of expression vector, p164L174A for mutant CC acylase M164L/M174A

HpaI/NcoI DNA (1122 bp) from pCKM164L (template DNA, 0.5 fmol), DNA oligomers SO-MluFor �primer #1, 125 pmol, FIG. 1(b)(i)! and SO-M174A2 (5'-GACCGGCAGCGCTAGCGCCCGCCAGAGCTTGA, primer #2, 125 pmol) were mixed with Taq DNA polymerase (TaKaRa, 1 unit) in 100 .mu.l of a buffer consisting of 10 mM Tris.HCl (pH 8.3), 50 mM KCl, 0.1% gelatin, 1.5 mM and 0.2 mM dNTP (SEQ ID NO:64). The mixture was covered with mineral oil and subjected to initial denaturation (96.degree. C. for 0.5 min), 25 cycles of amplification (97.degree. C. for 1.5 min, 50.degree. C. for 2.5 min and 72.degree. C. for 2.5 min) and final extension (72.degree. C. for 7 min). The resultant mixture was extracted with phenol, precipitated with ethanol, and digested with MluI and NheI. The resultant DNA was ligated to a larger DNA fragment of pCKM174A digested with MluI and NheI to give the desired plasmid p164L174A. E. coli JM109 was transformed with the p164L174A to give a transformant E. coli JM109/p164L174A, a glycerol stock of which was prepared in a conventional manner.

(v) Preparation of expression vector, p164A174A for mutant CC acylase M164A/M174A

p164A174A was prepared from pCKM164A (template DNA), SO-MluFor �primer #1, FIG. 1(b)(i)!, SO-M174A �primer #2, FIG. 1(a)! and pCKM174A (vector DNA) in a manner similar to that described above (SEQ ID NO:15,14). E. coli JM109 was transformed with p164A174A to give a transformant E. coli JM109/p164A174A, a glycerol stock of which was prepared in a conventional manner.

(vi) Preparation of expression vector, p164A269Y for mutant CC acylase M164A/M269Y

M164A was digested with MluI and BstBI and a small DNA (582 bp) was isolated. On the other hand, pCKM269Y was digested with MluI and BstBI. The resultant larger DNA fragment was ligated to the 582 bp MluI/BstBI DNA and the ligation mixture was used to transform E. coli DH10B. From one of the transformants resistant to kanamycin, the desired plasmid p164A269Y was isolated and characterized by restriction mapping. E. coli JM109 was transformed with p164A269Y to give a transformant E. coli JM109/p164A269Y, a glycerol stock of which was prepared in a conventional manner.

(vii) Preparation of expression vectors for mutant CC acylases, M164L/M174A/M269Y, M164L/M174A/M269F and M164A/M174A/M269Y/C305S

A smaller DNA of p164L174A digested with MluI and BstBI was ligated to a larger DNA fragment of pCKM269Y (or pCKM269F or p269Y305S) digested with MluI and BstBI to give the desired vector, p164L174A269Y (or p164L174A269F or p164A174A269Y305S). E. coli JM109 was transformed with the p164L174A269Y (or p164L174A269F or p164A174A269Y305S) to give a transformant E. coli JM109/p164L174A269Y (or E. coli JM109/p164L174A269F or E. coli JM109/p164A174A269Y305S), a glycerol stock of which was prepared in a conventional manner.

(viii) Preparation of expression vector, p164L174A269Y305S750A for mutant CC acylase, M164L/M174A/M269Y/C305S/M750A

pCKM750A was digested with PstI and NcoI. A smaller DNA was isolated and ligated to the larger DNA of p164L174A269Y305S digested with PstI and NcoI to give the desired plasmid. E. coli JM109 was transformed with p164L174A269Y305S750A to give a transformant E. coli JM109/p164L174A269Y305S750A, a glycerol stock of which was prepared in a conventional manner.

(2) Combination of A49L with other mutant acylases (i) Preparation of mp18p181A49L for mutant CC acylase A49L

mp18p181A49L was prepared from SS-U-DNA of mp18p181 and DNA oligomer SO-A49L in a manner similar to that described in Example 2 (SEQ ID NO:12).

(ii) Preparation of expression vector, pCKA49L for mutant CC acylase A49L

mp18p181A49L was digested with ClaI and MluI and a 218 bp DNA was isolated. On the other hand, pCC013A was digested with ClaI and MluI. The resultant larger DNA was isolated and ligated to the 218 bp ClaI/MluI DNA. The ligation mixture was used to transform E. coli JM109. From one of the transformants resistant to ampicillin, an expression vector for mutant CC acylase A49L, designated as pCCA49L, was isolated and characterized by restriction mapping. A 250 bp HpaI/MluI DNA fragment from pCCA49L was ligated to a larger DNA fragment of pCK013 digested with HpaI and MluI to give pCKA49L.

(iii) Comparison of expression of native CC acylase and mutant CC acylase A49L

Glycerol stock solution (1 ml) of E. coli JM109/pCKA49L (or JM109/pCK013) which had been prepared by transforming E. coli JM109 with the plasmid pCKA49L (or pCK013) in a conventional manner was transferred to 100 ml of L broth containing 50 .mu.g/ml kanamycin, and the mixture was cultured at 30.degree. C. for 8 hours. The cultured broth (3.75 ml) was added to 25 ml of N-3 broth (ingredients: 5% soybean sauce, 1% glycerol, 1.25% K.sub.2 HPO.sub.4, 0.38% KH.sub.2 PO.sub.4, 50 .mu.g/ml thiamine.HCl, 2 mM MgSO.sub.4.7H.sub.2 O.sub.4 0.2 mM CaCl.sub.2.2H.sub.2 O, 0.05 mM FeSo.sub.4.7H.sub.2 O) containing 25 .mu.g/ml kanamycin, and the mixture was cultured at 22.5.degree. C. for 16 hours. At 16 h, 3-indoleacrylic acid (IAA) was added to the cultured broth to a final concentration of 20 .mu.g/ml and the cultivation was continued for additional 56 hours. Cells were harvested by centrifugation at 14,000 rpm for 15 min at 4.degree. C., suspended in 40 ml of TE buffer (pH 8.0) and lysed by sonication. The lysate was centrifuged at 14,000 rpm for 20 min at 4.degree. C. to obtain the supernatant (designated as "soup" fraction). The residues were resuspended in 40 ml of a buffer containing 100 mM Tris.HCl (pH 8.0), 1 mM EDTA and 8M urea and lysed by sonication. After centrifugation to remove insoluble materials, the supernatant was collected (designated as "ppt" fraction). The "soup" and "ppt" fractions of mutant CC acylase A49L and native CC acylase N176 were analyzed by 15% SDS-PAGE. The cellular insoluble precursor protein was greatly decreased by mutation from a native CC acylase to a mutant CC acylase A49L. The results corresponded to the amounts of mature acylases (native CC acylase or mutant CC acylase A49L) in "soup" assayed by reversed phase HPLC (in the following Table).

______________________________________A49L (units/ml broth) native (units/ml broth)______________________________________72.6 35.6______________________________________ (iv) Preparation of expression vector, p49L164L174A269Y for mutant CC acylase, A49L/M164L/M174A/M269Y

The 772 bp MluI/NcoI DNA from p164L174A269Y was ligated to a larger DNA of pCKA49L digested with MluI and NcoI to give the desired plasmid p49L164L174A269Y. E. coli JM109 was transformed with p49L164L174A269Y to give a transformant E. coli JM109/p49L164L174A269Y, a glycerol stock of which was prepared in a conventional manner.

EXAMPLE 9

(Expression and Purification of Mutant CC Acylases)

(1) Expression of mutant CC acylase M164A

A glycerol stock of E. coli JM109/pCKM164A (0.5 ml) was added to 50 ml of L broth containing 50 .mu.g/ml kanamycin and the mixture was cultivated at 30.degree. C. for 8 h. The cultivated broth (3.75 ml) was transferred to 25 ml of N-3 broth (5.0% soybean source (Osaka Shokuhinn Kagaku), 0.608% Na.sub.2 HPO.sub.4, 0.7% KH.sub.2 PO.sub.4, 0.7% K.sub.2 HPO.sub.4, 0.12% (NH.sub.4).sub.2 SO.sub.4, 0.02% NH.sub.4 Cl, 0.0011% FeSO.sub.4.7H.sub.2 O, 0.0011% CaCl.sub.2.2H.sub.2 O, 0.000276% MnSO.sub.4.nH.sub.2 O, 0.000276% AlCl.sub.3.6 H.sub.2 O, 0.00011% CoCl.sub.2.6H.sub.2 O, 0.0000552% ZnSO.sub.4.7H.sub.2 O, 0.0000552% NaMoO.sub.4.2H.sub.2 O, 0.0000276% CuSO.sub.4.7H.sub.2 O, 0.0000138% H.sub.3 BO.sub.4, 50 .mu.g/ml vitamin B1, 0.048% MgSO.sub.4) containing 1.0% glycerol and 12.5 .mu.g/ml kanamycin. The mixture was incubated at 20.degree.-22.degree. C. for 88 h with addition of .beta.-indoleacrylic acid (final concentration 20 .mu.g/ml) at 16 h and glycerol (final concentration 1.0%) at 16 and 24 h after the start of cultivation. Cells were harvested by centrifugation (8,000 rpm at 4.degree. C. for 10 min), suspended in 10 ml of TE buffer (10 mM Tris.HCl (pH 8.0), 1.0 mM EDTA) and lysed by sonication. After centrifugation (15,000 rpm at 4.degree. C. for 20 min), the supernatant (crude lysate) was stored at 4.degree. C. until use.

(2) Purification of M164A

The crude lysate (1.0 ml) was filtrated using a 0.45 .mu.m column guard (Millipore) and applied to a TSK-gelTM DEAE-5PW (TOSOH, 4.6.times.50 mm) high performance liquid chromatography column. Elution was performed with a concave gradient from 80% of A buffer �25 mM Tris.HCl (pH 8.0)!+20% of B buffer �0.5M NaCl-25 mM Tris.HCl (pH 8.0)! to 50% of A buffer+50% of B buffer over 30 min at a flow rate of 1.0 ml/min. Absorbance at 230 nm was used to monitor the eluate. The last main peak eluted with approximately 0.16M NaCl was collected to obtain a pure preparation of mutant CC acylase M164A.

(3) Expression of other mutant CC acylases

Cultivation of E. coli JM109 carrying another expression vector (such as pCKM164L, pCKM164G, pCKM174A, pCKM465A, pCKM506A, pCKM750A, p164L/269Y, p164L/269Y/305S, p164L/174A/269Y/305S, p269I/358K, p269I/358S, p164L/269F, p164L/174A/269F, pCKS166A, p164L/174A/269Y/305S/750A, p164A/269Y, pCK49L and p49L/164L/174A) and preparation of the crude lysate was performed in a manner similar to that described above.

(4) Purification of other mutant CC acylases

Other mutant CC acylases (such as M164L, M164G, M174A, M465A, M506A, M750A, M164L/M269Y, M164L/M269Y/C305S, M164L/M174A/M269Y/S305S, M269I/E358K, M269I/E358S, M164L/M269F, M164L/M174A/M269F, S166A, M164L/M174A/M269Y/C305S/M750A, M164A/269Y, and A49L/M164L/M174A) were purified from each of crude lysates in a manner similar to that described above.

(5) Identification of mutant CC acylases

Purified mutant CC acylases such as M164A, M164L, M164G, M174A, M465A, M506A, M750A, M164L/M269Y, M164L/M269Y/C305S, M164L/M174A/M269Y/S305S, M269I/E358K, M269I/E358S, M164L/M269F, M164L/M174A/M269F, S166A, M164L/M174A/M269Y/C305S/M750A, M164A/269Y, and A49L/M164L/M174A were characterized by 12.5% SDS-PAGE analysis and reversed phase HPLC. From the SDS-PAGE analysis in the presence of .beta.-mercaptoethanol, each purified acylase was confirmed to consist of two independent subunits, 25.4 kDa and 58.4 kDa peptides corresponding to .alpha. and .beta. subunits, respectively, whose molecular weights were calculated from their mobility on gel electrophoresis. In HPLC analysis, each purified acylase was dissociated to 2 independent peptides, .alpha. and .beta. subunits, which were eluted at approximately 8.7 and 5.8 min, respectively �HPLC conditions, column: 5C4-AR-300, 4.6.times.50 mm; eluate: linear gradient from 35% to 70% aqueous acetonitrile containing 0.05% trifluoroacetic acid over 10 min; detection: 214 nm!. The both subunits of each mutant acylase were isolated by the reversed phase HPLC system and determined to be identical to the sequence of native acylase by amino terminal sequence analysis with 473A protein sequencer (Applied Biosystems).

EXAMPLE 10

(DNA Sequence Analysis)

DNA sequence of vectors for mutant acylases such as M164A, M164L, M164G, M174A, M465A, M506A, M750A, M164L/M269Y, M164L/M269Y/C305S, M164L/M174A/M269Y/S305S, M269/E358K, M269I/E358S, M164L/M269F, M164L/M174A/M269F, S166A, M164L/M174A/M269Y/C305S/M750A, M164A/269Y, and A49L/M164L/M174A was determined by 373A DNA sequencer (Applied Biosystems) and confirmed to be identical to that as expected.

EXAMPLE 11

(CC Acylase Activity)

The CC acylase activity at pH 8.7 of each of the mutant acylases as listed in Table 2 was determined in the same manner as described above. The results are shown in Table

TABLE 2______________________________________Relative activity of CC acylase:mutant acylase CC acylase activity______________________________________native (N176) 100*M164L 122M174A 123M465A 136M506A 140M750A 142M164L/M269Y 161M164L/M269Y/C305S 141M164L/M174A/M269Y/C305S 155M269I/E358K 153M269I/E358S 184M164L/M269F 193M164L/M174A/M269F 184S166A 186M164L/M174A/M269Y 245M164L/M174A/M269Y/C305S/M750A 192M164A/M269Y 172A49L/M164L/M174A/M269Y 226______________________________________ (*: calculated as native = 100%)

EXAMPLE 12

(GL-7ACA Acylase Activity)

The GL-7ACA acylase activity at pH 7.5 of each of the mutant acylases as listed in Table 3 was determined in the same manner as described above. The results are shown in Table 3.

TABLE 3______________________________________Relative activity of GL-7ACA acylase:mutant acylase GL-7ACA acylase activity______________________________________native (N176) 100*M164A 167M164G 162______________________________________ (*: calculated as native = 100%) __________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 64(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 9 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GlyLeuLeuAlaGlySerValTrpPhe15(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 29 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:GGGCCTGCTTGCGGGATCCGTGTGGTTCA29(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 8 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:LeuTrpArgAlaLeuAlaLeuPro15(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 26 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:GCTCTGGCGGGCGCTAGCGCTGCCGG26(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 8 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:HisGluAlaAlaProArgValIle15(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 26 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:GCACGAGGCGGCGCCACGCGTGATCG26(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 9 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:GluArgIleAlaLysArgLeuValAla15(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 28 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:GAGCGCATCGCGAAGCGCTTGGTCGCCA28(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 8 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:AspCysAlaAlaValProMetLeu15(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 26 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:CGACTGTGCGGCGGTACCGATGCTCT26(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 9 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:AlaSerGlyGluLeuAspAlaTyrArg15(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:GCCTCGGGCGAGCTCGATGCCTATCGG27(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:CATCCGCCAAAGCTTGAACCACACCGCACCCATAAG36(2) INFORMATION FOR SEQ ID NO:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:MetGluLeuThrArgArgLysAlaLeuGlyArg1510(2) INFORMATION FOR SEQ ID NO:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 32 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:ATGGAGCTGACGCGTCGCAAAGCGCTGGGACG32(2) INFORMATION FOR SEQ ID NO:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 12 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:ValMetArgArgLeuGlyLeuLeuCysGlySerVal1510(2) INFORMATION FOR SEQ ID NO:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:CGGTGATGCGTCGACTCGGCCTGCTTTGCGGATCCGTG38(2) INFORMATION FOR SEQ ID NO:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:CACGGATCCATCAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:CACGGATCCTTCAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:20:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:CACGGATCCGAAAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:CACGGATCCGCCAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:22:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:CACGGATCCATGAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:CACGGATCCGATAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:CACGGATCCCTTAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:25:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:CACGGATCCCAGAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:26:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:CACGGATCCGTTAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:27:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:CACGGATCCCGGAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:28:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:CACGGATCCCTGAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:29:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:CACGGATCCACGAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:30:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:CACGGATCCCGAAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:31:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:CACGGATCCCGTAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:32:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:CACGGATCCCACAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:33:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:CACGGATCCCCAAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:34:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:CACGGATCCCACAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:35:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 8 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:ArgValPheGluIleProGlyIle15(2) INFORMATION FOR SEQ ID NO:36:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:CACGGATCCATAAAGCAGGCCGAGTCGACGCATCACCG38(2) INFORMATION FOR SEQ ID NO:37:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:PheAspIleValLysThrArgHisGlyProVal1510(2) INFORMATION FOR SEQ ID NO:38:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:TCAAGCTATATCAGTTCTGCGCGGTACCGGGCCAAT36(2) INFORMATION FOR SEQ ID NO:39:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:TAACCGGGCCATGGCGCGTCAGGACTATATCGAACT36(2) INFORMATION FOR SEQ ID NO:40:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:TAACCGGGCCATGGCGCGTGCGGACTATATCGAACT36(2) INFORMATION FOR SEQ ID NO:41:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:TAACCGGGCCATGGCGCGTCGAGACTATATCGAACT36(2) INFORMATION FOR SEQ ID NO:42:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:TAACCGGGCCATGGCGCGTGGTGACTATATCGAACT36(2) INFORMATION FOR SEQ ID NO:43:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2325 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..2325(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 4..2322(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:ATGACTATGGCAGCTAATACGGATCGCGCGGTCTTGCAGGCGGCGCTG48MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015CCGCCGCTTTCCGGCAGCCTCCCCATTCCCGGATTGAGCGCGTCGGTC96ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530CGCGTCCGGCGCGATGCCTGGGGCATCCCGCATATCAAGGCCTCGGGC144ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GAGGCCGATGCCTATCGGGCGCTGGGCTTCGTCCATTCGCAGGACCGT192GluAlaAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560CTTTTCCAGATGGAGCTGACGCGTCGCAAGGCGCTGGGACGCGCGGCC240LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GAATGGCTGGGCGCCGAGGCCGCCGAGGCCGATATCCTCGTGCGCCGG288GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095CTCGGAATGGAAAAAGTCTGCCGGCGCGACTTCGAGGCCTTGGGCGTC336LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GAGGCGAAGGACATGCTGCGGGCTTATGTCGCCGGCGTGAACGCATTC384GluAlaLysAspMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125CTGGCTTCCGGTGCTCCCCTGCCTGTCGAATACGGATTGCTCGGAGCA432LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GAGCCGGAGCCCTGGGAGCCTTGGCACAGCATCGCGGTGATGCGCCGG480GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155CTGGGCCTGCTTGCGGGATCCGTGTGGTTCAAGCTCTGGCGGATGCTG528LeuGlyLeuLeuAlaGlySerValTrpPheLysLeuTrpArgMetLeu160165170175GCGCTGCCGGTGGTCGGAGCCGCGAATGCGCTGAAGCTGCGCTATGAC576AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190GATGGCGGCCGGGATTTGCTCTGCATCCCGCCGGGCGCCGAAGCCGAT624AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205CGGCTCGAGGCGGATCTCGCGACCCTGCGGCCCGCGGTCGATGCGCTG672ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220CTGAAGGCGATGGGCGGCGATGCCTCCGATGCTGCCGGCGGCGGCAGC720LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AACAACTGGGCGGTCGCTCCGGGCCGCACGGCGACCGGCAGGCCGATC768AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255CTCGCGGGCGATCCGCATCGCGTCTTCGAAATCCCGGGCATGTATGCG816LeuAlaGlyAspProHisArgValPheGluIleProGlyMetTyrAla260265270CAGCATCATCTGGCCTGCGACCGGTTCGACATGATCGGCCTGACCGTG864GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285CCGGGCGTGCCGGGCTTCCCGCACTTCGCGCATAACGGCAAGGTCGCC912ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TATTGCGTCACCCATGCCTTCATGGACATCCACGATCTCTATCTCGAG960TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315CAGTTCGCGGGGGAGGGCCGCACTGCGCGGTTCGGCAACGATTTCGAG1008GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335CCCGTCGCCTGGAGCCGGGACCGTATCGCGGTCCGGGGTGGCGCCGAT1056ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350CGCGAGTTCGATATCGTCGAGACGCGCCATGGCCCGGTTATCGCGGGC1104ArgGluPheAspIleValGluThrArgHisGlyProValIleAlaGly355360365GATCCGCGCGATGGCGCAGCGCTCACGCTGCGTTCGGTCCAGTTCGCC1152AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GAGACCGATCTGTCCTTCGACTGCCTGACGCGGATGCCGGGCGCATCG1200GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ACCGTGGCCCAGCTCTACGACGCGACGCGCGGCTGGGGCCTGATCGAC1248ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415CATAACCTCGTCGCCGGGGATGTCGCGGGCTCGATCGGCCATCTGGTC1296HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430CGCGCCCGCGTTCCGTCCCGTCCGCGCGAAAACGGCTGGCTGCCGGTG1344ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445CCGGGCTGGTCCGGCGAGCATGAATGGCGGGGCTGGATTCCGCACGAG1392ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460GCGATGCCGCGCGTGATCGATCCGCCGGGCGGCATCATCGTCACGGCG1440AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AATAATCGCGTCGTGGCCGATGACCATCCCGATTATCTCTGCACCGAT1488AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495TGCCATCCGCCCTACCGCGCCGAGCGCATCATGAAGCGCCTGGTCGCC1536CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AATCCGGCTTTCGCCGTCGACGATGCCGCCGCGATCCATGCCGATACG1584AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525CTGTCGCCCCATGTCGGGTTGCTGCGCCGGAGGCTCGAGGCGCTTGGA1632LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540GCCCGCGACGACTCCGCGGCCGAAGGGCTGAGGCAGATGCTCGTCGCC1680AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TGGGACGGCCGCATGGATGCGGCTTCGGAGGTCGCGTCTGCCTACAAT1728TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575GCGTTCCGCAGGGCGCTGACGCGGCTGGTGACGGACCGCAGCGGGCTG1776AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GAGCAGGCGATATCGCATCCCTTCGCGGCTGTCGCGCCGGGCGTCTCA1824GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605CCGCAAGGCCAGGTCTGGTGGGCCGTGCCGACCCTGCTGCGCGACGAC1872ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620GATGCCGGAATGCTGAAGGGCTGGAGCTGGGACCAGGCCTTGTCTGAG1920AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635GCCCTCTCGGTCGCGTCGCAGAACCTGACCGGGCGAAGCTGGGGCGAA1968AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GAGCATCGGCCGCGCTTCACGCATCCGCTTGCCACGCAATTCCCGGCC2016GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TGGGCGGGGCTGCTGAATCCGGCTTCCCGTCCGATCGGTGGCGATGGC2064TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685GATACCGTGCTGGCGAACGGGCTCGTCCCGTCAGCCGGGCCGCAGGCG2112AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ACCTATGGTGCCCTGTCGCGCTACGTCTTCGATGTCGGCAATTGGGAC2160ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AATAGCCGCTGGGTCGTCTTCCACGGCGCCTCCGGGCATCCGGCCAGC2208AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735GCCCATTATGCCGATCAGAATGCGCCCTGGAGCGACTGTGCGATGGTG2256AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750CCGATGCTCTATAGCTGGGACAGGATCGCGGCAGAGGCCGTGACGTCG2304ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765CAGGAACTCGTCCCGGCCTGA2325GlnGluLeuValProAla*770(2) INFORMATION FOR SEQ ID NO:44:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 774 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GluAlaAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GluAlaLysAspMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155LeuGlyLeuLeuAlaGlySerValTrpPheLysLeuTrpArgMetLeu160165170175AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255LeuAlaGlyAspProHisArgValPheGluIleProGlyMetTyrAla260265270GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350ArgGluPheAspIleValGluThrArgHisGlyProValIleAlaGly355360365AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765GlnGluLeuValProAla770(2) INFORMATION FOR SEQ ID NO:45:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2325 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..2325(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 4..2322(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:ATGACTATGGCAGCTAATACGGATCGCGCGGTCTTGCAGGCGGCGCTG48MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015CCGCCGCTTTCCGGCAGCCTCCCCATTCCCGGATTGAGCGCGTCGGTC96ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530CGCGTCCGGCGCGATGCCTGGGGCATCCCGCATATCAAGGCCTCGGGC144ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GAGGCCGATGCCTATCGGGCGCTGGGCTTCGTCCATTCGCAGGACCGT192GluAlaAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560CTTTTCCAGATGGAGCTGACGCGTCGCAAGGCGCTGGGACGCGCGGCC240LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GAATGGCTGGGCGCCGAGGCCGCCGAGGCCGATATCCTCGTGCGCCGG288GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095CTCGGAATGGAAAAAGTCTGCCGGCGCGACTTCGAGGCCTTGGGCGTC336LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GAGGCGAAGGACATGCTGCGGGCTTATGTCGCCGGCGTGAACGCATTC384GluAlaLysAspMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125CTGGCTTCCGGTGCTCCCCTGCCTGTCGAATACGGATTGCTCGGAGCA432LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GAGCCGGAGCCCTGGGAGCCTTGGCACAGCATCGCGGTGATGCGCCGG480GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155CTGGGCCTGCTTATGGGTGCGGTGTGGTTCAAGCTTTGGCGGATGCTG528LeuGlyLeuLeuMetGlyAlaValTrpPheLysLeuTrpArgMetLeu160165170175GCGCTGCCGGTGGTCGGAGCCGCGAATGCGCTGAAGCTGCGCTATGAC576AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190GATGGCGGCCGGGATTTGCTCTGCATCCCGCCGGGCGCCGAAGCCGAT624AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205CGGCTCGAGGCGGATCTCGCGACCCTGCGGCCCGCGGTCGATGCGCTG672ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220CTGAAGGCGATGGGCGGCGATGCCTCCGATGCTGCCGGCGGCGGCAGC720LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AACAACTGGGCGGTCGCTCCGGGCCGCACGGCGACCGGCAGGCCGATC768AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255CTCGCGGGCGATCCGCATCGCGTCTTCGAAATCCCGGGCATGTATGCG816LeuAlaGlyAspProHisArgValPheGluIleProGlyMetTyrAla260265270CAGCATCATCTGGCCTGCGACCGGTTCGACATGATCGGCCTGACCGTG864GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285CCGGGCGTGCCGGGCTTCCCGCACTTCGCGCATAACGGCAAGGTCGCC912ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TATTGCGTCACCCATGCCTTCATGGACATCCACGATCTCTATCTGGAG960TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315CAGTTCGCGGGGGAGGGCCGCACTGCGCGGTTCGGCAACGATTTCGAG1008GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335CCCGTCGCCTGGAGCCGGGACCGTATCGCGGTCCGGGGTGGCGCCGAT1056ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350CGCGAGTTCGATATCGTCGAGACGCGCCATGGCCCGGTTATCGCGGGC1104ArgGluPheAspIleValGluThrArgHisGlyProValIleAlaGly355360365GATCCGCGCGATGGCGCAGCGCTCACGCTGCGTTCGGTCCAGTTCGCC1152AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GAGACCGATCTGTCCTTCGACTGCCTGACGCGGATGCCGGGCGCATCG1200GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ACCGTGGCCCAGCTCTACGACGCGACGCGCGGCTGGGGCCTGATCGAC1248ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415CATAACCTCGTCGCCGGGGATGTCGCGGGCTCGATCGGCCATCTGGTC1296HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430CGCGCCCGCGTTCCGTCCCGTCCGCGCGAAAACGGCTGGCTGCCGGTG1344ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445CCGGGCTGGTCCGGCGAGCATGAATGGCGGGGCTGGATTCCGCACGAG1392ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460GCGATGCCGCGCGTGATCGATCCGCCGGGCGGCATCATCGTCACGGCG1440AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AATAATCGCGTCGTGGCCGATGACCATCCCGATTATCTCTGCACCGAT1488AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495TGCCATCCGCCCTACCGCGCCGAGCGCATCATGAAGCGCCTGGTCGCC1536CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AATCCGGCTTTCGCCGTCGACGATGCCGCCGCGATCCATGCCGATACG1584AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525CTGTCGCCCCATGTCGGGTTGCTGCGCCGGAGGCTCGAGGCGCTTGGA1632LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540GCCCGCGACGACTCCGCGGCCGAAGGGCTGAGGCAGATGCTCGTCGCC1680AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TGGGACGGCCGCATGGATGCGGCTTCGGAGGTCGCGTCTGCCTACAAT1728TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575GCGTTCCGCAGGGCGCTGACGCGGCTGGTGACGGACCGCAGCGGGCTG1776AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GAGCAGGCGATATCGCATCCCTTCGCGGCTGTCGCGCCGGGCGTCTCA1824GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605CCGCAAGGCCAGGTCTGGTGGGCCGTGCCGACCCTGCTGCGCGACGAC1872ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620GATGCCGGAATGCTGAAGGGCTGGAGCTGGGACCAGGCCTTGTCTGAG1920AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635GCCCTCTCGGTCGCGTCGCAGAACCTGACCGGGCGAAGCTGGGGCGAA1968AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GAGCATCGGCCGCGCTTCACGCATCCGCTTGCCACGCAATTCCCGGCC2016GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TGGGCGGGGCTGCTGAATCCGGCTTCCCGTCCGATCGGTGGCGATGGC2064TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685GATACCGTGCTGGCGAACGGGCTCGTCCCGTCAGCCGGGCCGCAGGCG2112AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ACCTATGGTGCCCTGTCGCGCTACGTCTTCGATGTCGGCAATTGGGAC2160ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AATAGCCGCTGGGTCGTCTTCCACGGCGCCTCCGGGCATCCGGCCAGC2208AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735GCCCATTATGCCGATCAGAATGCGCCCTGGAGCGACTGTGCGATGGTG2256AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750CCGATGCTCTATAGCTGGGACAGGATCGCGGCAGAGGCCGTGACGTCG2304ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765CAGGAACTCGTCCCGGCCTGA2325GlnGluLeuValProAla*770(2) INFORMATION FOR SEQ ID NO:46:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 774 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GluAlaAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GluAlaLysAspMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155LeuGlyLeuLeuMetGlyAlaValTrpPheLysLeuTrpArgMetLeu160165170175AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255LeuAlaGlyAspProHisArgValPheGluIleProGlyMetTyrAla260265270GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350ArgGluPheAspIleValGluThrArgHisGlyProValIleAlaGly355360365AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765GlnGluLeuValProAla770(2) INFORMATION FOR SEQ ID NO:47:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2325 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..2325(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 4..2322(xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:ATGACTATGGCAGCTAATACGGATCGCGCGGTCTTGCAGGCGGCGCTG48MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015CCGCCGCTTTCCGGCAGCCTCCCCATTCCCGGATTGAGCGCGTCGGTC96ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530CGCGTCCGGCGCGATGCCTGGGGCATCCCGCATATCAAGGCCTCGGGC144ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GAGGCCGATGCCTATCGGGCGCTGGGCTTCGTCCATTCGCAGGACCGT192GluAlaAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560CTTTTCCAGATGGAGCTGACGCGTCGCAAGGCGCTGGGACGCGCGGCC240LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GAATGGCTGGGCGCCGAGGCCGCCGAGGCCGATATCCTCGTGCGCCGG288GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095CTCGGAATGGAAAAAGTCTGCCGGCGCGACTTCGAGGCCTTGGGCGTC336LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GAGGCGAAGGACATGCTGCGGGCTTATGTCGCCGGCGTGAACGCATTC384GluAlaLysAspMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125CTGGCTTCCGGTGCTCCCCTGCCTGTCGAATACGGATTGCTCGGAGCA432LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GAGCCGGAGCCCTGGGAGCCTTGGCACAGCATCGCGGTGATGCGCCGG480GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155CTGGGCCTGCTTATGGGTTCGGTGTGGTTCAAGCTCTGGCGGATGCTG528LeuGlyLeuLeuMetGlySerValTrpPheLysLeuTrpArgMetLeu160165170175GCGCTGCCGGTGGTCGGAGCCGCGAATGCGCTGAAGCTGCGCTATGAC576AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190GATGGCGGCCGGGATTTGCTCTGCATCCCGCCGGGCGCCGAAGCCGAT624AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205CGGCTCGAGGCGGATCTCGCGACCCTGCGGCCCGCGGTCGATGCGCTG672ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220CTGAAGGCGATGGGCGGCGATGCCTCCGATGCTGCCGGCGGCGGCAGC720LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AACAACTGGGCGGTCGCTCCGGGCCGCACGGCGACCGGCAGGCCGATC768AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255CTCGCGGGCGATCCGCATCGCGTCTTCGAAATACCGGGCATCTATGCG816LeuAlaGlyAspProHisArgValPheGluIleProGlyIleTyrAla260265270CAGCATCATCTGGCCTGCGACCGGTTCGACATGATCGGCCTGACCGTG864GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285CCGGGCGTGCCGGGCTTCCCGCACTTCGCGCATAACGGCAAGGTCGCC912ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TATTGCGTCACCCATGCCTTCATGGACATCCACGATCTCTATCTCGAG960TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315CAGTTCGCGGGGGAGGGCCGCACTGCGCGGTTCGGCAACGATTTCGAG1008GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335CCCGTCGCCTGGAGCCGGGACCGTATCGCGGTCCGGGGTGGCGCCGAT1056ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350CGCGAGTTCGATATAGTCAAGACGCGCCATGGCCCGGTTATCGCGGGC1104ArgGluPheAspIleValLysThrArgHisGlyProValIleAlaGly355360365GATCCGCGCGATGGCGCAGCGCTCACGCTGCGTTCGGTCCAGTTCGCC1152AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GAGACCGATCTGTCCTTCGACTGCCTGACGCGGATGCCGGGCGCATCG1200GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ACCGTGGCCCAGCTCTACGACGCGACGCGCGGCTGGGGCCTGATCGAC1248ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415CATAACCTCGTCGCCGGGGATGTCGCGGGCTCGATCGGCCATCTGGTC1296HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430CGCGCCCGCGTTCCGTCCCGTCCGCGCGAAAACGGCTGGCTGCCGGTG1344ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445CCGGGCTGGTCCGGCGAGCATGAATGGCGGGGCTGGATTCCGCACGAG1392ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460GCGATGCCGCGCGTGATCGATCCGCCGGGCGGCATCATCGTCACGGCG1440AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AATAATCGCGTCGTGGCCGATGACCATCCCGATTATCTCTGCACCGAT1488AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495TGCCATCCGCCCTACCGCGCCGAGCGCATCATGAAGCGCCTGGTCGCC1536CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AATCCGGCTTTCGCCGTCGACGATGCCGCCGCGATCCATGCCGATACG1584AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525CTGTCGCCCCATGTCGGGTTGCTGCGCCGGAGGCTCGAGGCGCTTGGA1632LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540GCCCGCGACGACTCCGCGGCCGAAGGGCTGAGGCAGATGCTCGTCGCC1680AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TGGGACGGCCGCATGGATGCGGCTTCGGAGGTCGCGTCTGCCTACAAT1728TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575GCGTTCCGCAGGGCGCTGACGCGGCTGGTGACGGACCGCAGCGGGCTG1776AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GAGCAGGCGATATCGCATCCCTTCGCGGCTGTCGCGCCGGGCGTCTCA1824GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605CCGCAAGGCCAGGTCTGGTGGGCCGTGCCGACCCTGCTGCGCGACGAC1872ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620GATGCCGGAATGCTGAAGGGCTGGAGCTGGGACCAGGCCTTGTCTGAG1920AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635GCCCTCTCGGTCGCGTCGCAGAACCTGACCGGGCGAAGCTGGGGCGAA1968AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GAGCATCGGCCGCGCTTCACGCATCCGCTTGCCACGCAATTCCCGGCC2016GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TGGGCGGGGCTGCTGAATCCGGCTTCCCGTCCGATCGGTGGCGATGGC2064TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685GATACCGTGCTGGCGAACGGGCTCGTCCCGTCAGCCGGGCCGCAGGCG2112AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ACCTATGGTGCCCTGTCGCGCTACGTCTTCGATGTCGGCAATTGGGAC2160ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AATAGCCGCTGGGTCGTCTTCCACGGCGCCTCCGGGCATCCGGCCAGC2208AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735GCCCATTATGCCGATCAGAATGCGCCCTGGAGCGACTGTGCGATGGTG2256AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750CCGATGCTCTATAGCTGGGACAGGATCGCGGCAGAGGCCGTGACGTCG2304ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765CAGGAACTCGTCCCGGCCTGA2325GlnGluLeuValProAla*770(2) INFORMATION FOR SEQ ID NO:48:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 774 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GluAlaAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GluAlaLysAspMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155LeuGlyLeuLeuMetGlySerValTrpPheLysLeuTrpArgMetLeu160165170175AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255LeuAlaGlyAspProHisArgValPheGluIleProGlyIleTyrAla260265270GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350ArgGluPheAspIleValLysThrArgHisGlyProValIleAlaGly355360365AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765GlnGluLeuValProAla770(2) INFORMATION FOR SEQ ID NO:49:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2325 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..2325(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 4..2322(xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:ATGACTATGGCAGCTAATACGGATCGCGCGGTCTTGCAGGCGGCGCTG48MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015CCGCCGCTTTCCGGCAGCCTCCCCATTCCCGGATTGAGCGCGTCGGTC96ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530CGCGTCCGGCGCGATGCCTGGGGCATCCCGCATATCAAGGCCTCGGGC144ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GAGGCCGATGCCTATCGGGCGCTGGGCTTCGTCCATTCGCAGGACCGT192GluAlaAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560CTTTTCCAGATGGAGCTGACGCGTCGCAAGGCGCTGGGACGCGCGGCC240LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GAATGGCTGGGCGCCGAGGCCGCCGAGGCCGATATCCTCGTGCGCCGG288GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095CTCGGAATGGAAAAAGTCTGCCGGCGCGACTTCGAGGCCTTGGGCGTC336LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GAGGCGAAGGACATGCTGCGGGCTTATGTCGCCGGCGTGAACGCATTC384GluAlaLysAspMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125CTGGCTTCCGGTGCTCCCCTGCCTGTCGAATACGGATTGCTCGGAGCA432LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GAGCCGGAGCCCTGGGAGCCTTGGCACAGCATCGCGGTGATGCGTCGA480GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155CTCGGCCTGCTTCTGGGATCCGTGTGGTTCAAGCTCTGGCGGGCGCTA528LeuGlyLeuLeuLeuGlySerValTrpPheLysLeuTrpArgAlaLeu160165170175GCGCTGCCGGTGGTCGGAGCCGCGAATGCGCTGAAGCTGCGCTATGAC576AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190GATGGCGGCCGGGATTTGCTCTGCATCCCGCCGGGCGCCGAAGCCGAT624AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205CGGCTCGAGGCGGATCTCGCGACCCTGCGGCCCGCGGTCGATGCGCTG672ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220CTGAAGGCGATGGGCGGCGATGCCTCCGATGCTGCCGGCGGCGGCAGC720LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AACAACTGGGCGGTCGCTCCGGGCCGCACGGCGACCGGCAGGCCGATC768AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255CTCGCGGGCGATCCGCATCGCGTCTTCGAAATCCCTGGCTATTATGCG816LeuAlaGlyAspProHisArgValPheGluIleProGlyTyrTyrAla260265270CAGCATCATCTGGCCTGCGACCGGTTCGACATGATCGGCCTGACCGTG864GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285CCGGGCGTGCCGGGCTTCCCGCACTTCGCGCATAACGGCAAGGTCGCC912ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TATTGCGTCACCCATGCCTTCATGGACATCCACGATCTCTATCTCGAG960TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315CAGTTCGCGGGGGAGGGCCGCACTGCGCGGTTCGGCAACGATTTCGAG1008GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335CCCGTCGCCTGGAGCCGGGACCGTATCGCGGTCCGGGGTGGCGCCGAT1056ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350CGCGAGTTCGATATCGTCGAGACGCGCCATGGCCCGGTTATCGCGGGC1104ArgGluPheAspIleValGluThrArgHisGlyProValIleAlaGly355360365GATCCGCGCGATGGCGCAGCGCTCACGCTGCGTTCGGTCCAGTTCGCC1152AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GAGACCGATCTGTCCTTCGACTGCCTGACGCGGATGCCGGGCGCATCG1200GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ACCGTGGCCCAGCTCTACGACGCGACGCGCGGCTGGGGCCTGATCGAC1248ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415CATAACCTCGTCGCCGGGGATGTCGCGGGCTCGATCGGCCATCTGGTC1296HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430CGCGCCCGCGTTCCGTCCCGTCCGCGCGAAAACGGCTGGCTGCCGGTG1344ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445CCGGGCTGGTCCGGCGAGCATGAATGGCGGGGCTGGATTCCGCACGAG1392ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460GCGATGCCGCGCGTGATCGATCCGCCGGGCGGCATCATCGTCACGGCG1440AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AATAATCGCGTCGTGGCCGATGACCATCCCGATTATCTCTGCACCGAT1488AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495TGCCATCCGCCCTACCGCGCCGAGCGCATCATGAAGCGCCTGGTCGCC1536CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AATCCGGCTTTCGCCGTCGACGATGCCGCCGCGATCCATGCCGATACG1584AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525CTGTCGCCCCATGTCGGGTTGCTGCGCCGGAGGCTCGAGGCGCTTGGA1632LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540GCCCGCGACGACTCCGCGGCCGAAGGGCTGAGGCAGATGCTCGTCGCC1680AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TGGGACGGCCGCATGGATGCGGCTTCGGAGGTCGCGTCTGCCTACAAT1728TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575GCGTTCCGCAGGGCGCTGACGCGGCTGGTGACGGACCGCAGCGGGCTG1776AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GAGCAGGCGATATCGCATCCCTTCGCGGCTGTCGCGCCGGGCGTCTCA1824GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605CCGCAAGGCCAGGTCTGGTGGGCCGTGCCGACCCTGCTGCGCGACGAC1872ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620GATGCCGGAATGCTGAAGGGCTGGAGCTGGGACCAGGCCTTGTCTGAG1920AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635GCCCTCTCGGTCGCGTCGCAGAACCTGACCGGGCGAAGCTGGGGCGAA1968AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GAGCATCGGCCGCGCTTCACGCATCCGCTTGCCACGCAATTCCCGGCC2016GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TGGGCGGGGCTGCTGAATCCGGCTTCCCGTCCGATCGGTGGCGATGGC2064TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685GATACCGTGCTGGCGAACGGGCTCGTCCCGTCAGCCGGGCCGCAGGCG2112AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ACCTATGGTGCCCTGTCGCGCTACGTCTTCGATGTCGGCAATTGGGAC2160ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AATAGCCGCTGGGTCGTCTTCCACGGCGCCTCCGGGCATCCGGCCAGC2208AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735GCCCATTATGCCGATCAGAATGCGCCCTGGAGCGACTGTGCGATGGTG2256AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750CCGATGCTCTATAGCTGGGACAGGATCGCGGCAGAGGCCGTGACGTCG2304ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765CAGGAACTCGTCCCGGCCTGA2325GlnGluLeuValProAla*770(2) INFORMATION FOR SEQ ID NO:50:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 774 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GluAlaAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GluAlaLysAspMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155LeuGlyLeuLeuLeuGlySerValTrpPheLysLeuTrpArgAlaLeu160165170175AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255LeuAlaGlyAspProHisArgValPheGluIleProGlyTyrTyrAla260265270GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350ArgGluPheAspIleValGluThrArgHisGlyProValIleAlaGly355360365AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765GlnGluLeuValProAla770(2) INFORMATION FOR SEQ ID NO:51:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2325 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..2325(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 4..2322(xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:ATGACTATGGCAGCTAATACGGATCGCGCGGTCTTGCAGGCGGCGCTG48MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015CCGCCGCTTTCCGGCAGCCTCCCCATTCCCGGATTGAGCGCGTCGGTC96ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530CGCGTCCGGCGCGATGCCTGGGGCATCCCGCATATCAAGGCCTCGGGC144ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GAGCTCGATGCCTATCGGGCGCTGGGCTTCGTCCATTCGCAGGACCGT192GluLeuAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560CTTTTCCAGATGGAGCTGACGCGTCGCAAGGCGCTGGGACGCGCGGCC240LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GAATGGCTGGGCGCCGAGGCCGCCGAGGCCGATATCCTCGTGCGCCGG288GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095CTCGGAATGGAAAAAGTCTGCCGGCGCGACTTCGAGGCCTTGGGCGTC336LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GAGGCGAAGGAGATGCTGCGGGCTTATGTCGCCGGCGTGAACGCATTC384GluAlaLysGluMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125CTGGCTTCCGGTGCTCCCCTGCCTGTCGAATACGGATTGCTCGGAGCA432LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GAGCCGGAGCCCTGGGAGCCTTGGCACAGCATCGCGGTGATGCGCCGG480GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155CTGGGCCTGCTTATGGGTTCGGTGTGGTTCAAGCTCTGGCGGATGCTG528LeuGlyLeuLeuMetGlySerValTrpPheLysLeuTrpArgMetLeu160165170175GCGCTGCCGGTGGTCGGAGCCGCGAATGCGCTGAAGCTGCGCTATGAC576AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190GATGGCGGCCGGGATTTGCTCTGCATCCCGCCGGGCGCCGAAGCCGAT624AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205CGGCTCGAGGCGGATCTCGCGACCCTGCGGCCCGCGGTCGATGCGCTG672ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220CTGAAGGCGATGGGCGGCGATGCCTCCGATGCTGCCGGCGGCGGCAGC720LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AACAACTGGGCGGTCGCTCCGGGCCGCACGGCGACCGGCAGGCCGATC768AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255CTCGCGGGCGATCCGCATCGCGTCTTCGAAATCCCGGGCATGTATGCG816LeuAlaGlyAspProHisArgValPheGluIleProGlyMetTyrAla260265270CAGCATCATCTGGCCTGCGACCGGTTCGACATGATCGGCCTGACCGTG864GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285CCGGGCGTGCCGGGCTTCCCGCACTTCGCGCATAACGGCAAGGTCGCC912ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TATTGCGTCACCCATGCCTTCATGGACATCCACGATCTCTATCTCGAG960TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315CAGTTCGCGGGGGAGGGCCGCACTGCGCGGTTCGGCAACGATTTCGAG1008GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335CCCGTCGCCTGGAGCCGGGACCGTATCGCGGTCCGGGGTGGCGCCGAT1056ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350CGCGAGTTCGATATCGTCGAGACGCGCCATGGCCCGGTTATCGCGGGC1104ArgGluPheAspIleValGluThrArgHisGlyProValIleAlaGly355360365GATCCGCGCGATGGCGCAGCGCTCACGCTGCGTTCGGTCCAGTTCGCC1152AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GAGACCGATCTGTCCTTCGACTGCCTGACGCGGATGCCGGGCGCATCG1200GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ACCGTGGCCCAGCTCTACGACGCGACGCGCGGCTGGGGCCTGATCGAC1248ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415CATAACCTCGTCGCCGGGGATGTCGCGGGCTCGATCGGCCATCTGGTC1296HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430CGCGCCCGCGTTCCGTCCCGTCCGCGCGAAAACGGCTGGCTGCCGGTG1344ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445CCGGGCTGGTCCGGCGAGCATGAATGGCGGGGCTGGATTCCGCACGAG1392ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460GCGATGCCGCGCGTGATCGATCCGCCGGGCGGCATCATCGTCACGGCG1440AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AATAATCGCGTCGTGGCCGATGACCATCCCGATTATCTCTGCACCGAT1488AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495TGCCATCCGCCCTACCGCGCCGAGCGCATCATGAAGCGCCTGGTCGCC1536CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AATCCGGCTTTCGCCGTCGACGATGCCGCCGCGATCCATGCCGATACG1584AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525CTGTCGCCCCATGTCGGGTTGCTGCGCCGGAGGCTCGAGGCGCTTGGA1632LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540GCCCGCGACGACTCCGCGGCCGAAGGGCTGAGGCAGATGCTCGTCGCC1680AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TGGGACGGCCGCATGGATGCGGCTTCGGAGGTCGCGTCTGCCTACAAT1728TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575GCGTTCCGCAGGGCGCTGACGCGGCTGGTGACGGACCGCAGCGGGCTG1776AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GAGCAGGCGATATCGCATCCCTTCGCGGCTGTCGCGCCGGGCGTCTCA1824GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605CCGCAAGGCCAGGTCTGGTGGGCCGTGCCGACCCTGCTGCGCGACGAC1872ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620GATGCCGGAATGCTGAAGGGCTGGAGCTGGGACCAGGCCTTGTCTGAG1920AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635GCCCTCTCGGTCGCGTCGCAGAACCTGACCGGGCGAAGCTGGGGCGAA1968AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GAGCATCGGCCGCGCTTCACGCATCCGCTTGCCACGCAATTCCCGGCC2016GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TGGGCGGGGCTGCTGAATCCGGCTTCCCGTCCGATCGGTGGCGATGGC2064TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685GATACCGTGCTGGCGAACGGGCTCGTCCCGTCAGCCGGGCCGCAGGCG2112AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ACCTATGGTGCCCTGTCGCGCTACGTCTTCGATGTCGGCAATTGGGAC2160ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AATAGCCGCTGGGTCGTCTTCCACGGCGCCTCCGGGCATCCGGCCAGC2208AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735GCCCATTATGCCGATCAGAATGCGCCCTGGAGCGACTGTGCGATGGTG2256AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750CCGATGCTCTATAGCTGGGACAGGATCGCGGCAGAGGCCGTGACGTCG2304ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765CAGGAACTCGTCCCGGCCTGA2325GlnGluLeuValProAla*770(2) INFORMATION FOR SEQ ID NO:52:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 774 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:MetThrMetAlaAlaAsnThrAspArgAlaValLeuGlnAlaAlaLeu1151015ProProLeuSerGlySerLeuProIleProGlyLeuSerAlaSerVal202530ArgValArgArgAspAlaTrpGlyIleProHisIleLysAlaSerGly354045GluLeuAspAlaTyrArgAlaLeuGlyPheValHisSerGlnAspArg505560LeuPheGlnMetGluLeuThrArgArgLysAlaLeuGlyArgAlaAla657075GluTrpLeuGlyAlaGluAlaAlaGluAlaAspIleLeuValArgArg80859095LeuGlyMetGluLysValCysArgArgAspPheGluAlaLeuGlyVal100105110GluAlaLysGluMetLeuArgAlaTyrValAlaGlyValAsnAlaPhe115120125LeuAlaSerGlyAlaProLeuProValGluTyrGlyLeuLeuGlyAla130135140GluProGluProTrpGluProTrpHisSerIleAlaValMetArgArg145150155LeuGlyLeuLeuMetGlySerValTrpPheLysLeuTrpArgMetLeu160165170175AlaLeuProValValGlyAlaAlaAsnAlaLeuLysLeuArgTyrAsp180185190AspGlyGlyArgAspLeuLeuCysIleProProGlyAlaGluAlaAsp195200205ArgLeuGluAlaAspLeuAlaThrLeuArgProAlaValAspAlaLeu210215220LeuLysAlaMetGlyGlyAspAlaSerAspAlaAlaGlyGlyGlySer225230235AsnAsnTrpAlaValAlaProGlyArgThrAlaThrGlyArgProIle240245250255LeuAlaGlyAspProHisArgValPheGluIleProGlyMetTyrAla260265270GlnHisHisLeuAlaCysAspArgPheAspMetIleGlyLeuThrVal275280285ProGlyValProGlyPheProHisPheAlaHisAsnGlyLysValAla290295300TyrCysValThrHisAlaPheMetAspIleHisAspLeuTyrLeuGlu305310315GlnPheAlaGlyGluGlyArgThrAlaArgPheGlyAsnAspPheGlu320325330335ProValAlaTrpSerArgAspArgIleAlaValArgGlyGlyAlaAsp340345350ArgGluPheAspIleValGluThrArgHisGlyProValIleAlaGly355360365AspProArgAspGlyAlaAlaLeuThrLeuArgSerValGlnPheAla370375380GluThrAspLeuSerPheAspCysLeuThrArgMetProGlyAlaSer385390395ThrValAlaGlnLeuTyrAspAlaThrArgGlyTrpGlyLeuIleAsp400405410415HisAsnLeuValAlaGlyAspValAlaGlySerIleGlyHisLeuVal420425430ArgAlaArgValProSerArgProArgGluAsnGlyTrpLeuProVal435440445ProGlyTrpSerGlyGluHisGluTrpArgGlyTrpIleProHisGlu450455460AlaMetProArgValIleAspProProGlyGlyIleIleValThrAla465470475AsnAsnArgValValAlaAspAspHisProAspTyrLeuCysThrAsp480485490495CysHisProProTyrArgAlaGluArgIleMetLysArgLeuValAla500505510AsnProAlaPheAlaValAspAspAlaAlaAlaIleHisAlaAspThr515520525LeuSerProHisValGlyLeuLeuArgArgArgLeuGluAlaLeuGly530535540AlaArgAspAspSerAlaAlaGluGlyLeuArgGlnMetLeuValAla545550555TrpAspGlyArgMetAspAlaAlaSerGluValAlaSerAlaTyrAsn560565570575AlaPheArgArgAlaLeuThrArgLeuValThrAspArgSerGlyLeu580585590GluGlnAlaIleSerHisProPheAlaAlaValAlaProGlyValSer595600605ProGlnGlyGlnValTrpTrpAlaValProThrLeuLeuArgAspAsp610615620AspAlaGlyMetLeuLysGlyTrpSerTrpAspGlnAlaLeuSerGlu625630635AlaLeuSerValAlaSerGlnAsnLeuThrGlyArgSerTrpGlyGlu640645650655GluHisArgProArgPheThrHisProLeuAlaThrGlnPheProAla660665670TrpAlaGlyLeuLeuAsnProAlaSerArgProIleGlyGlyAspGly675680685AspThrValLeuAlaAsnGlyLeuValProSerAlaGlyProGlnAla690695700ThrTyrGlyAlaLeuSerArgTyrValPheAspValGlyAsnTrpAsp705710715AsnSerArgTrpValValPheHisGlyAlaSerGlyHisProAlaSer720725730735AlaHisTyrAlaAspGlnAsnAlaProTrpSerAspCysAlaMetVal740745750ProMetLeuTyrSerTrpAspArgIleAlaAlaGluAlaValThrSer755760765GlnGluLeuValProAla770(2) INFORMATION FOR SEQ ID NO:53:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 63 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:CCGGGTGTGTACACCAAGGTTACCAACTACCTAGACTGGATTCGTGACAACATGCGACCG60TGA63(2) INFORMATION FOR SEQ ID NO:54:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 63 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:AGCTTCACGGTCGCATGTTGTCACGAATCCAGTCTAGGTAGTTGGTAACCTTGGTGTACA60CAC63(2) INFORMATION FOR SEQ ID NO:55:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 51 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:AGCTTGTCCTCGAGATCAAATAAAGGCTCCTTTTGGAGCCTTTTTTTTTTG51(2) INFORMATION FOR SEQ ID NO:56:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 51 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:TCGACAAAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGATCTCGAGGACA51(2) INFORMATION FOR SEQ ID NO:57:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:AATTCGGATCCAAGCTTA18(2) INFORMATION FOR SEQ ID NO:58:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:CGCGTAAGCTTGGATCCG18(2) INFORMATION FOR SEQ ID NO:59:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:XaaThrMetAlaAlaAsnThr15(2) INFORMATION FOR SEQ ID NO:60:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 28 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:CGATAAAATGACTATGGCGGCCAACACC28(2) INFORMATION FOR SEQ ID NO:61:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:GATCGGTGTTGGCCGCCATAGTCATTTTAT30(2) INFORMATION FOR SEQ ID NO:62:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 28 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:CGATAAAATGACTATGGCAGCTAATACG28(2) INFORMATION FOR SEQ ID NO:63:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:GATCCGTATTAGCTGCCATAGTCATTTTAT30(2) INFORMATION FOR SEQ ID NO:64:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 32 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:GACCGGCAGCGCTAGCGCCCGCCAGAGCTTGA32__________________________________________________________________________

Claims

1. A mutant CC acylase wherein at least one amino acid at the Ala.sup.49, Met.sup.164, Ser.sup.166, Met.sup.174, Glu.sup.358, Met.sup.465, Met.sup.506, or Met.sup.750 position of the amino acid sequence of the native CC acylase is replaced by a different amino acid.

2. A mutant Cephalosporin C acylase of claim 1, which is represented by the following formula in its precursor form before processing into .alpha.-subunit and .beta.-subunit thereof:

A1-48-X1-A50-163-X2-Gly-X3-A167-173-X4-A175-357-X5-A359-464-X6-A466-505-X7-A507-749-X8-A751-773

wherein A1-48 is the same amino acid sequence as that from Thr.sup.1 to Glu.sup.48 of native CC acylase,

A50-163 is the same amino acid sequence as that from Asp.sup.50 to Leu.sup.163 of native CC acylase,

A167-173 is the same amino acid sequence as that from Val.sup.167 to Arg.sup.173 of native CC acylase,

A175-357 is the same amino acid sequence as that from Leu.sup.175 to Val.sup.357 of native CC acylase,

A359-464 is the same amino acid sequence as that from Thr.sup.359 to Ala.sup.464 of native CC acylase,

A466-505 is the same amino acid sequence as that from Pro.sup.466 to Ile.sup.505 of native CC acylase,

A507-749 is the same amino acid sequence as that from Lys.sup.507 to Ala.sup.749 of native CC acylase,

A751-773 is the same amino acid sequence as that from Val.sup.751 to Ala.sup.773 of native CC acylase,

X1 is Ala or a different amino acid,

X2, X4, X6, X7 and X8 are each Met or a different amino acid,

X3 is Ser or a different amino acid and

X5 is Glu or a different amino acid,

providing that Met.sup.269 and/or Cys.sup.305 may be replaced by (a) different amino acid(s) in the above formula, and when X1 is Ala, X2, X4, X6, X7 and X8 are each Met, X3 is Ser and X5 is an amino acid other than Glu.

3. A mutant Cephalosporin C acylase of claim 2, in which X1 is leucine, X3 is alanine, and Met.sup.269 is replaced by tyrosine.

4. An isolated DNA which encodes the Cephalosporin C acylase of claim 1.

5. An expression vector which comprises the DNA of claim 4.

6. A host cell transformed by the expression vector of claim 5.

7. A process for producing a mutant Cephalosporin C acylase, which comprises culturing a host cell transformed by an expression vector which comprises DNA which encodes the Cephalosporin C acylase of claim 1 in an aqueous nutrient medium and recovering the mutant Cephalosporin C acylase from the cultured broth.

8. A process for preparing a compound of the formula (I): ##STR3## wherein R.sup.1 is acetoxy, hydroxy, or hydrogen, or its salt,

which comprises contacting a compound of the formula (II): ##STR4## wherein R.sup.1 is the same as defined above and

R.sup.2 is carboxylic acyl, or its salt

with the cultured broth of the transformant of claim 6 or its processed material.