Chartreusin analogues

Information

  • Patent Grant
  • 9522930
  • Patent Number
    9,522,930
  • Date Filed
    Tuesday, July 30, 2013
    11 years ago
  • Date Issued
    Tuesday, December 20, 2016
    7 years ago
Abstract
The present invention relates to novel Chartreusin analogues of formula (I), pharmaceutical compositions comprising the same and to their use for the treatment of cancer and other diseases.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a national stage application, filed under 35 U.S.C §371, of International Application No. PCT/EP2013/002257 filed on Jul. 30, 2013, which claims priority to European application no. 12005528.0, filed Jul. 30, 2012, the contents of which are incorporated herein by reference.


INCORPORATION-BY-REFERENCE OF SEQUENCE LISTING

The contents of the text file named “48361-002N01US.txt”, which was created on Jan. 28, 2015 and is 3.09 KB in size, are hereby incorporated by reference in their entireties.


The present invention relates to novel Chartreusin analogues, pharmaceutical compositions comprising the same and to their use for the treatment of cancer and other diseases.


One of the biggest medicinal challenges is the treatment of cancer, which has recently become the second leading cause of death among seniors (Jemal, A. et al. Global Cancer Statistics. CA: A Cancer Journal for Clinicians 61, 69-90 (2011)). Although much progress has been made in the development of monoclonal antibodies and small-molecule compounds that specifically target tumor cells, natural products from plant, fungi and bacteria still represent the prime source of antitumoral agents that help expanding the life expectancy of the patients (Grothaus, P. G., Cragg, G. M. & Newman, D. J. Plant Natural Products in Anticancer Drug Discovery. Current Organic Chemistry 14, 1781-1791 (2010)). The most effective chemotherapeutics either interfere with the tumor cell cycle and division or bind to DNA and cause apoptosis through various downstream processes.


This prominent mode of action is known for the bacterial metabolites chartreusin and elsamicin A. Common to both of these polyketide glycosides is the pentacyclic benzo-naphtho pyranone aglycone named chartarin.




embedded image


This rare chromophore is capable of intercalating into DNA, inhibiting RNA synthesis and causing radical-mediated single-strand scission of DNA. Moreover, chartreusin and elsamicin efficiently inhibit topoisomerase II, a prime target of chemotherapeutics used to treat human malignancies (Lorico, A. & Long, B. H. Biochemical-Characterization of Elsamicin and Other Coumarin-Related Antitumor Agents as Potent Inhibitors of Human Topoisomerase-Ii. Eur. J. Cancer 29A, 1985-1991 (1993)). Indeed, chartreusin proved to be highly effective against various cancer cell lines (such as murine P388, L1210 leukemia, and B16 melanoma cells). Additionally, recent in-silico docking studies suggested potential activity of chartreusin against glioblastoma multiforme, one of the most common and most malignant brain tumors (Kirubakaran, P. et al. In silico studies on marine actinomycetes as potential inhibitors for Glioblastoma multiforme. Bioinformation 6, 100-106 (2011)). Unfortunately, due to unfavorable pharmacokinetics and rapid biliary excretion, chartreusin has not yet found any clinical application (Tashiro, T. et al. Antitumor effects of IST-622, a novel synthetic derivative of chartreusin, against murine and human tumor lines following oral administration. Cancer Chemother. Pharmacol. 34, 287-292 (1994)). Likewise, elsamicin A has so far not gone beyond phase II, as it was not effective enough in vivo (Verweij, J. et al. Phase-II Studies of Elsamitrucin in Breast-Cancer, Colorectal-Cancer, Nonsmall Cell Lung-Cancer and Ovarian-Cancer. Annals of Oncology 5, 375-376 (1994)). A program focusing on the chemical modification of the hydroxyl moieties of chartreusin yielded a semi-synthetic derivative IST-622, which may be regarded as a prodrug with improved solubility. IST-622 has entered phase II of clinical trials in Japan for the treatment of patients with breast cancer (Asai, G. et al. Pharmacokinetic and pharmacodynamic study of IST-622, a novel synthetic derivative of chartreusin, by oral administration in a phase II study of patients with breast cancer. Cancer Chemother. Pharmacol. 49, 468-472 (2002)).


Accordingly, it has been the object of the present invention to provide new analogues of Chartreusin having improved properties.


The present invention provides compounds of formula (I)




embedded image


wherein


R1 is hydrogen or a mono-, di-, tri- or tetra saccharide or a derivative thereof or a 1,4′-bipiperidine-1′carboxylate group;


R2 is a hydrogen atom, or a 1,4′-bipiperidine-1′carboxylate group, or a group of formula —X—(CH2—CH2—O)n—R5 wherein X is a bond, a —C(═O)—, —C(═O)—O— or a —C(═O)—Y—O— group wherein Y is an alkylene group, n is an integer of from 2 to 100, and R5 is hydrogen or an alkyl group;


R3 is selected from a hydrogen atom, a halogen atom, a hydroxy group, a (C1-C8) alkoxy group, a (C2-C8) alkyl group, a (C2-C8) haloalkyl group, a (C2-C8) alkenyl group, or a (C2-C8) alkynyl group and R4 is hydrogen; or


R3 is hydrogen and R4 is selected from a hydrogen atom, a halogen atom, a hydroxy group, a (C1-C8) alkoxy group, a (C2-C8) alkyl group, a (C2-C8) haloalkyl group, a (C2-C8) alkenyl group, or a (C2-C8) alkynyl group;


or a pharmaceutically acceptable salt, solvate or hydrate or a pharmaceutically acceptable formulation thereof.


The expression alkyl refers to a saturated, straight-chain or branched hydrocarbon group that contains from 1 to 20 carbon atoms, preferably from 1 to 12 carbon atoms, especially from 1 to 6 (e.g. 1, 2, 3 or 4) carbon atoms, for example a methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, tert-butyl, n-pentyl, iso-pentyl, n-hexyl, 2,2-dimethylbutyl or n-octyl group.


The expression (C2-C8) alkyl refers to an alkyl group that contains from 2 to 8 (e.g. 2, 3 or 4) carbon atoms.


The expression alkoxy refers to an alkyl group as defined above which is bonded to an oxygen atom, i.e. to a group of formula alkyl-O—. for example a methyloxy (methoxy), ethyloxy (ethoxy), propyloxy, iso-propyloxy, n-butyloxy, iso-butyloxy, sec-butyloxy or tert-butyloxy group. The expression (C1-C8) alkoxy group refers to a group of formula (C1-C8) alkyl-O—.


The expression alkenyl refers to at least partially unsaturated, straight-chain or branched hydrocarbon groups that contain from 2 to 20 carbon atoms, preferably from 2 to 12 carbon atoms, especially from 2 to 6 (e.g. 2, 3 or 4) carbon atoms, for example an ethenyl(vinyl), propenyl(allyl), iso-propenyl, butenyl, isoprenyl or hex-2-enyl group. Preferably, alkenyl groups have one or two (especially preferably one) double bond(s).


The expression (C2-C8) alkenyl refers to an alkenyl group that contains from 2 to 8 (e.g. 2, 3 or 4) carbon atoms and preferably one or two (especially one) double bond(s).


The expression alkynyl refers to at least partially unsaturated, straight-chain or branched hydrocarbon groups that contain from 2 to 20 carbon atoms, preferably from 2 to 12 carbon atoms, especially from 2 to 6 (e.g. 2, 3 or 4) carbon atoms, for example an ethynyl(acetylenyl), propynyl, butynyl or propargyl group. Preferably, alkynyl groups have one or two (especially preferably one) triple bond(s).


The expression (C2-C8) alkynyl refers to an alkynyl group that contains from 2 to 8 (e.g. 2, 3 or 4) carbon atoms and preferably one or two (especially one) triple bond(s).


The term haloalkyl refers to an alkyl group in which one or more hydrogen atoms (e.g. 1, 2, 3, 4 or 5) have been replaced by a halogen atom (preferably F or Cl) such as, for example, a 2,2,2-trichloroethyl or a 2,2,2-trifluoroethyl group.


The expression (C2-C8) haloalkyl refers to a haloalkyl group that contains from 2 to 8 (e.g. 2, 3 or 4) carbon atoms.


The expression halogen atom refers to a fluorine, chlorine, bromine or iodine atom; preferably to a chlorine or bromine atom; especially preferably a bromine atom.


The expression mono-, di-, tri- or tetra saccharide refers to groups containing one, two, three or four saccharide moieties, preferably selected from glucoside, fucoside, digitaloside, elsaroside or elsamiside that are preferably bound to each other via a glycosidic bond. The term derivative thereof preferably relates to acetates, methyethers or acetals (preferably of benzaldehyde) thereof.


According to a preferred embodiment, the present invention provides compounds of formula (I) wherein


R1 is hydrogen or a mono-, di-, tri- or tetra saccharide or a derivative thereof;


R2 is a hydrogen atom, or a group of formula —X—(CH2—CH2—O)n—R5 wherein X is a bond, a —C(═O)—, —C(═O)—O— or a —C(═O)—Y—O— group wherein Y is an alkylene group, n is an integer of from 2 to 100, and R5 is hydrogen or an alkyl group;


R3 is a group selected from a halogen atom, a (C2-C8) alkyl group, a (C2-C8) haloalkyl group, or a (C2-C8) alkenyl group and R4 is hydrogen; or


R3 is hydrogen and R4 is a group selected from a halogen atom, a (C2-C8) alkyl group, a (C2-C8) haloalkyl group, or a (C2-C8) alkenyl group;


or a pharmaceutically acceptable salt, solvate or hydrate or a pharmaceutically acceptable formulation thereof.


Preferably, R1 is hydrogen.


Further preferably, R1 is a disaccharide or a derivative thereof.


Moreover preferably, R1 is a 1,4′-bipiperidine-1′carboxylate group:




embedded image


Especially preferably, R1 is selected from the following groups:




embedded image


Most preferably, R1 is fucose-digitalose or a 1,4′-bipiperidine-1′carboxylate group (especially most preferably, R1 is fucose-digitalose).


Preferably, R2 is a hydrogen atom.


Further preferably, R2 is a 1,4′-bipiperidine-1′carboxylate group.


Further preferably, R2 is a group of formula —X—(CH2—CH2—O)n—R5 wherein X is a bond, a —C(═O)—, —C(═O)—O— or a —C(═O)—Y—O— group wherein Y is an alkylene group, n is an integer of from 2 to 100, and R5 is hydrogen or an alkyl group.


Especially preferably, Y is a group of formula (CH2)m, wherein m is an integer from 1 to 20.


Moreover preferably, R3 is an ethyl or a vinyl group and R4 is a hydrogen atom.


Further preferably, R4 is an ethyl or a vinyl group and R3 is a hydrogen atom.


Further preferably, R5 is hydrogen, methyl or ethyl.


Especially preferably, the compounds of formula (I) are selected from the following compounds:




embedded image


Further preferred are compounds of formula (II):




embedded image


wherein


R3 is selected from a hydrogen atom, a halogen atom, a hydroxy group, a (C1-C8) alkoxy group, a (C1-C8) alkyl group, a (C1-C8) haloalkyl group, a (C2-C8) alkenyl group, or a (C2-C8) alkynyl group and R4 is hydrogen; or


R3 is hydrogen and R4 is selected from a hydrogen atom, a halogen atom, a hydroxy group, a (C1-C8) alkoxy group, a (C1-C8) alkyl group, a (C1-C8) haloalkyl group, a (C2-C8) alkenyl group, or a (C2-C8) alkynyl group;


or a pharmaceutically acceptable salt, solvate or hydrate or a pharmaceutically acceptable formulation thereof.


Further preferred are compounds of formula (II) wherein R3 and R4 are as defined above for compounds of formula (I).


The present invention further provides pharmaceutical compositions comprising one or more compounds of formula (I) or (II) as defined herein or a pharmaceutically acceptable salt, solvate or hydrate thereof, optionally in combination with a pharmaceutically acceptable carrier.


It is a further object of the present invention to provide a compound of formula (I) or (II) as defined herein or a pharmaceutical composition as defined herein for the preparation of a medicament for the treatment of cancer and/or one or more other diseases mentioned herein (e.g. psoriasis and bacterial infections).


The compounds of the present invention are useful in the treatment of different cancers, such as, for example, breast, colon, lung and prostate tumors, as well as osteosarcoma, acute myeloid leukaemia, sporadic endometrial cancer, melanoma, malignant melanoma, soft tissue Sarcoma, B-cell chronic lymphocytic leukaemia, gastric cancers, cervical cancer, hepatocellular carcinoma, pancreatic cancer; renal cancer/kidney cancer and colorectal cancer, bladder cancer, esophageal cancer as well as cancers of glioblastoma multiforme as Well as all other endoscopic accessible areas; and in the treatment of psoriasis; and in the treatment of bacterial infections (such as infections caused by mycobacteria).


Examples of pharmacologically acceptable salts of sufficiently basic compounds of formula (I) or (II) are salts of physiologically acceptable mineral acids like hydrochloric, hydrobromic, sulfuric and phosphoric acid; or salts of organic acids like methanesulfonic, p-toluenesulfonic, lactic, acetic, trifluoroacetic, citric, succinic, fumaric, maleic and salicylic acid. Further, a sufficiently acidic compound of formula (I) or (II) may form alkali or earth alkali metal salts, for example sodium, potassium, lithium, calcium or magnesium salts; ammonium salts; or organic base salts, for example methylamine, dimethylamine, trimethylamine, triethylamine, ethylenediamine, ethanolamine, choline hydroxide, meglumin, piperidine, morpholine, tris-(2-hydroxyethyl)amine, lysine or arginine salts; all of which are also further examples of salts of compounds of formula (I) or (II). Compounds of formula (I) or (II) may be solvated, especially hydrated. The hydratization/hydration may occur during the process of production or as a consequence of the hygroscopic nature of the initially water free compounds of formula (I) or (II). The solvates and/or hydrates may e.g. be present in solid or liquid form.


It should be appreciated that certain compounds of formula (I) or (II) may have tautomeric forms from which only one might be specifically mentioned or depicted in the following description, different geometrical isomers (which are usually denoted as cis/trans isomers or more generally as (E) and (Z) isomers) or different optical isomers e.g. as a result of one or more chiral carbon atoms (which are usually nomenclatured under the Cahn-Ingold-Prelog or R/S system). All these tautomeric forms, geometrical or optical isomers (as well as racemates and diastereomers) and polymorphous forms are included in the invention. Since the compounds of formula (I) or (II) may contain asymmetric C-atoms, they may be present either as achiral compounds, mixtures of diastereomers, mixtures of enantiomers or as optically pure compounds. The present invention comprises both all pure enantiomers and all pure diastereomers, and also the mixtures thereof in any mixing ratio.


The therapeutic use of compounds according to formula (I) or (II), their pharmacologically acceptable salts, solvates and hydrates, respectively, as well as formulations and pharmaceutical compositions also lie within the scope of the present invention.


The pharmaceutical compositions according to the present invention comprise at least one compound of formula (I) or (II) and, optionally, carrier substances and/or adjuvants.


As mentioned above, therapeutically useful agents that contain compounds of formula (I) or (II), their solvates, salts or formulations are also comprised in the scope of the present invention. In general, compounds of formula (I) or (II) will be administered by using the known and acceptable modes known in the art, either alone or in combination with any other therapeutic agent.


For oral administration such therapeutically useful agents can be administered by one of the following routes: oral, e.g. as tablets, dragees, coated tablets, pills, semisolids, soft or hard capsules, for example soft and hard gelatine capsules, aqueous or oily solutions, emulsions, suspensions or syrups, parenteral including intravenous, intramuscular and subcutaneous injection, e.g. as an injectable solution or suspension, rectal as suppositories, by inhalation or insufflation, e.g. as a powder formulation, as microcrystals or as a spray (e.g. liquid aerosol), transdermal, for example via an transdermal delivery system (TDS) such as a plaster containing the active ingredient or intranasal. For the production of such tablets, pills, semisolids, coated tablets, dragees and hard, e.g. gelatine, capsules the therapeutically useful product may be mixed with pharmaceutically inert, inorganic or organic excipients as are e.g. lactose, sucrose, glucose, gelatine, malt, silica gel, starch or derivatives thereof, talc, stearinic acid or their salts, dried skim milk, and the like. For the production of soft capsules one may use excipients as are e.g. vegetable, petroleum, animal or synthetic oils, wax, fat, polyols. For the production of liquid solutions, emulsions or suspensions or syrups one may use as excipients e.g. water, alcohols, aqueous saline, aqueous dextrose, polyols, glycerin, lipids, phospholipids, cyclodextrins, vegetable, petroleum, animal or synthetic oils. Especially preferred are lipids and more preferred are phospholipids (preferred of natural origin; especially preferred with a particle size between 300 to 350 nm) preferred in phosphate buffered saline (pH=7 to 8, preferred 7.4). For suppositories one may use excipients as are e.g. vegetable, petroleum, animal or synthetic oils, wax, fat and polyols. For aerosol formulations one may use compressed gases suitable for this purpose, as are e.g. oxygen, nitrogen and carbon dioxide. The pharmaceutically useful agents may also contain additives for conservation, stabilization, e.g. UV stabilizers, emulsifiers, sweetener, aromatizers, salts to change the osmotic pressure, buffers, coating additives and antioxidants.


In general, in the case of oral or parenteral administration to adult humans weighing approximately 80 kg, a daily dosage of about 1 mg to about 10,000 mg, preferably from about 5 mg to about 1,000 mg, should be appropriate, although the upper limit may be exceeded when indicated. The daily dosage can be administered as a single dose or in divided doses, or for parenteral administration, it may be given as continuous infusion or subcutaneous injection.


Compounds of formula (I) can e.g. be prepared by biosynthesis employing anthracyclin starter unit genes. The methyl substituent at C-1 represents the methyl group of the acetyl starter unit of the cha polyketide synthase (PKS) (Xu, Z., Jakobi, K., Welzel, K. & Hertweck, C. Biosynthesis of the antitumor agent chartreusin involves the oxidative rearrangement of an anthracyclic polyketide. Chem. Biol. 12, 579-588 (2005)). It has been found that it is possible to exchange the chartreusin methyl substituent for another substituent (e.g. an ethyl substituent) by swapping the anthracycline precursors.


Alternatively, compounds of formula (I) may be prepared synthetically using e.g. the reaction sequence shown in Scheme 1:




embedded image


Compounds 7, 8 and 9 can e.g. be prepared according to the following reaction sequence:




embedded image


Further, compounds of formula (I) may be prepared synthetically using e.g. the reaction sequence shown in Scheme 2:




embedded image


For the synthesis of chartarin variants a Hauser tandem annulation strategy can be employed, which has proven successful for the synthesis of the native aglycone (Mal, D., Patra, A. & Roy, H. Convergent and rapid assembly of benzonaphthopyranone cores of chartreusin, chrymutasins and hayumicins. Tetrahedron Lett. 45, 7895-7898 (2004)).


Alternatively, the following modified synthetic route can be used: Therein, the methoxy substituent was exchanged for the more readily cleavable methoxymethyl (MOM) ether and also the synthesis of the building blocks employed in the annulation reaction has been streamlined. Specifically, 3-hydroxy benzamide 3 was transformed into the corresponding MOM ether 4, and ortho-directed lithiation-formylation sequence yielded 5. The aldehyde was converted into phthalide 6 in the presence of trimethyl silylcyanide and KCN-18-crown-6, followed by treatment with acetic acid. 10-MOM-protected chartarin 11 was obtained by Hauser annulation of phthalide 6 with coumarin 8 (Mal, D., Patra, A. & Roy, H. Convergent and rapid assembly of benzonaphthopyranone cores of chartreusin, chrymutasins and hayumicins. Tetrahedron Lett. 45, 7895-7898 (2004); Harayama, T. et al. Convenient Synthesis of a Simple Coumarin from Salicylaldehyde and Wittig Reagent 0.2. Synthesis of Bromocoumarin and Methoxycarbonylcoumarin. Chem. Pharm. Bull. 42, 2170-2173 (1994)) (yield 66%). Finally, the MOM group was rapidly (<5 min) and nearly quantitatively removed using boron tribromide, and pure synthetic chartarin 1b was added to the ΔchaABC mutant (S. albus::pXU41/pXU343). HPLC-MS monitoring of the fermentation broth showed that the exogenously supplied aglycone was incorporated by the mutant and processed by glycosylation to restore chartreusin biosynthesis.


For the synthesis of the desmethyl analogue 13, coumarin 7 was synthesized and subjected to Hauser annulation with phthalide 6. After deprotection, the expected structure of 13 was verified by NMR- and MS techniques. Glycosylation was carried out as described above.


Further, a vinyl residue as a photoreactive group has been introduced into chartreusin. For this purpose, a bromo substituent has been introduced that could be replaced for another functional group at a later stage in the synthesis. Indeed it has been found that bromo-substituted coumarin 9 was a suitable reactant in the Hauser annulation, yielding the desired bromochartarin 14 after deprotection.


Stille-type reactions with PdII salts in the presence of lithium chloride gave acceptable results for the synthesis of the vinyl-substituted aglycone. Best results (20% yield) were obtained with the bridged Pd(dppp)Cl2 catalyst. Glycosylation was carried out as described above.


Further, compounds of formula (I) may be prepared synthetically using e.g. the reaction sequence shown in Scheme 3:




embedded image


Antimicrobial (MIC value [μM]), cytotoxic (CC50 [μM] for HeLa) and antiproliferative (GI50 [μM] for HUVEC, K-562, HT-29 and MEL-HO) activities of chartreusin and its derivatives. Test strain: Mycobacterium vaccae 10670.



















My-



HT-29
Mel-HO
















cobacterium

K-

w/o
420 nm,
w/o
420 nm,



vaccae
HUVEC
562
HeLa
light
3 × 8 h
light
3 × 8 h


















Norchartreusin
2.5
79.8
31.6
70.7






Chartreusin
1.2
6.24
1.56
12.6
7.96
7.65
1.56
2.34


Homochartreusin
9.6
7.18
2.14
23.10






Vinylchartreusin
4.8
32.8
3.06
24.7
7.05
0.61
0.11
0.08


Bromchartreusin
8.9
65.8
8.79
48.2






Ethinylchartreusin
19.2
>77
64.1
>77
33.2
26.9




Hydroxychartreusin
2.4
35.0
4.82
25.5






Methoxychartreusin
76
>76
>76
>76






(1→2)Abeochartreusin
4.87
5.78
2.03
14.2






(1→2)Abeohomochartreusin
19.1
26.6
11.6
58.1






(1→2)Abeovinylchartreusin
19.2
16.9
4.90
33.7
9.35
3.06
1.03
0.48


(1→2)Abeobromchartreusin
17.7
25.1
8.65
26.1






(1→2)Abeo-
19.2
7.84
3.23
13.4
8.61
1.69
2.00
1.38


ethinylchartreusin










Chartarin-1,10-bis-
>100
4.43
3.18
10.1






1,4'-bipiperidin-1'-










carboxylat










Bromchartarin-
>100
10.0
9.27
20.2






1,10-bis-1,4'-










bipiperidin-1'-










carboxylat










Norchartarin-1,10-
>100
52.3
52.2
>71






bis-1,4'-bi-










piperidin










1'-carboxylat










Vinylchartarin-
>100
>68
>68
>68






1,10-bis-1,4'-










bipiperidin-1'-










carboxylat









The GI50 values of both alkyl-substituted compounds (Chartreusin and Homochartreusin) against HUVEC were similarly low, but marked differences in the cytotoxic activities were found against HeLa cells. As can be seen from this data, the compound wherein R3 is an ethyl group therefore shows a higher selectivity.


It has been found that vinylchartreusin shows an extraordinary photoreactivity. Therefore, 1-vinylchartreusin is a strong in vivo drug to form covalent DNA adducts.


In standardized cytotoxic and antiproliferative assays the activity of vinylchartreusin was only slightly lower than chartreusin and homochartreusin using K562 and HeLa tumor cells, but about 4-fold less active than chartreusin using the HUVEC cell line. However, the situation changed substantially under photoinducing conditions. A GaN laser has been used for an induced DNA-adduct assay because a laser warrants high spectral purity combined with a high power density. Furthermore, the emission wavelength (405 nm) fits to the absorption maximum of chartreusin, which is a prerequisite to efficiently activating the molecule.


For the assay defined DNA fragments (1.5 kb) were treated with either chartreusin or 1-vinylchartreusin, and the effect of blue laser irradiation was compared to negative controls incubated in the dark or with daylight.


In the samples containing chartreusin or not irradiated 1-vinylchartreusin as well as negative controls the electrophoretic properties of the DNA fragment could be fully reserved. Irradiated DNA with 1-vinylchartreusin was affected in this manner that a clear band shift to a higher molecular mass is visible. Contrary to this, not irradiated 1-vinylchartreusin shows no shift.


In order to verify the extraordinary in vitro photo induced activity a human foreskin fibroblast cell line (Hs27) has been chosen to evaluate the antiproliferative activity against human cells. During this assay a control group without light has been tested under standard conditions. One group was irradiated with a very homogenous LED cluster under the same conditions. The GI50 value for 1-vinylchartreusin without light was 6.8 μg/mL whereas the value with light was more than 10 fold lower (0.5 μg/mL). Native chartreusin was not affected by treatment with light. This indicates the high potential of this new chartreusin-like structure motive as a drug for epithel cell carcinomas. Not only superficial areas like the skin in case of melanoma can be irradiated also endoscopic accessible areas like the bladder, colon, esophageal or laryngeal cancers are conceivable for a treatment.


In addition to the antitumor activity, the chartreusin derivatives also possess strong antibiotic properties including against methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococcus (VRE). 1-Vinyl- and 2-ethynyl-chartreusin are as active as the natural product and are even more potent than the reference antibiotic ciprofloxacin. A similar scenario becomes apparent in case of the VRE assay. Chartreusin, 1-vinyl chartreusin and the compound of formula (I) wherein R1, R2, and R4 are H and R3 is OH are highly active against this strain (MIC 9.59 to 9.76 μM).


Especially preferred are compounds of formula (I) wherein R3 and R4 are both hydrogen atoms for use in the treatment of bacterial infections.







EXAMPLES
Instrumentation

IR spectra were recorded on a Jasco FT/IR 4100 ATR spectrometer. All 1D (1H, 13C, DEPT) and 2D NMR (1H—1H COSY, 1H—13C HSQC, 1H—13C HMBC) have been recorded in deuterated solvents on a Bruker AVANCE II 300, a AVANCE III 500 or 600 MHz instrument equipped with a Bruker Cryo Platform. The chemical shifts are reported in ppm relative to the solvent residual peak (δ 1H (DMSO-D6)=2.50 ppm, δ 13C (DMSO-D6)=39.52 ppm, δ 1H (CDCl3)=7.24 ppm, δ 13C (CDCl3)=77.23 ppm, δ 1H (CD2Cl2)=5.32 ppm, δ 13C (CD2Cl2)=54.00 ppm, δ 1H (pyridine-D5)=7.22 ppm, δ 13C (pyridine-D5)=123.87 ppm, δ 1H (D3CCOCD3)=2.05 ppm, δ 13C (D3CCOCD3)=29.92 ppm). Following abbreviations are used for multiplicities of resonance signals: s=singlet, d=doublet, t=triplet, q=quartet, br broad. HPLC-MS was performed on a Hewlett Packard Series 1100 system, equipped with a DAD and an electro spray ionization (ESI)-quadrupole mass analyzer. HRESI-MS measurements were conducted either on a Thermo Exactive or a TSQ Quantum Ultra apparatus. Melting points of solid products were studied with a Büchi Melting Point B-540 device and are uncorrected. Gas-chromatographic analytics were executed on a Thermo Trace GC Ultra equipped with Combi PAL auto sampler and coupled with a FID and a Thermo Polaris Q electron impact (EI)-ion trap mass spectrometer. Preparative HPLC was performed on a Gilson 321 Pump with a UVNIS 156 detector system using a Phenomenex column Luna C18, 10 μm, Ø21 mm×250 mm at 21 mL/min and a gradient of water/acetonitrile. Flash chromatography was performed using a CombiFlash® RETRIEVE system by Teledyne Isco (Lincoln, Nebr.) with 120 g RediSep™ silica columns. Analytical HPLC was performed on a Shimadzu HPLC system consisting of an autosampler, high pressure pumps, column oven and PDA. HPLC conditions: C18 column (Grom Sil 100 ODS OAB, 3 μm, 250×4.6 mm) and gradient elution (MeCN/0.1% TFA (H2O) 1/99 in 30 min to MeCN/0.1% TFA (H2O) 100/0, MeCN 100% for 10 min), flow rate 1 mL/min. Preparative HPLC was performed on a Shimadzu LC-8a series HPLC system with UV detector.


General Methods


All reagents were obtained from commercial suppliers (Sigma Aldrich, Acros, TCI, etc.) and used without further purification unless otherwise explained. All solvents used were spectral grade or distilled prior to use. Reactions were carried out under inert gas (Ar) by using the Schlenk technique in dried solvents. Dry N,N′ dimethylformamide (DMF) and dichloromethane (DCM) was generated by distillation from calcium hydride suspension. Tetrahydrofurane was pre dried over potassium hydroxide and freshly distilled over lithium aluminum hydride (note: sodium/benzophenone drying was not sufficient enough which resulted in lower yields). Amines were dried over potassium hydroxide and distilled. Methanol, dichloromethane, chloroform and ethyl acetate were distilled prior to use. Open column chromatographic separations were executed on silica gel (Kieselgel 60, 15-40 μm, Merck KGaA). Reaction progresses were monitored by thin layer chromatography (TLC) (silica gel on aluminum sheets with fluorescent dye 254 nm, Merck KGaA), GC-MS or HPLC-MS.


Combinatorial Biosynthesis


Bacterial Strains, Culture Conditions and Molecular Manipulation:


Chartreusin producer Streptomyces chartreusis HKI-249 was obtained from the HKI strain collection. For chartreusin and derivatives production, mutant and complementary strains were cultivated in MS medium (mannitol soya flour medium)′ for 6 days at 30° C. with shaking. Exconjugants were selected with apramycin (50 μg/mL) and thiostrepton (8 μg/mL) in both solid and liquid medium. E. coli strains XL1 blue was served as host for routine subcloning. For intergenic conjugation, E. coli ET12567 containing the RP4 derivative pUZ8002 was used. E. coli strains grew in LB medium supplemented with ampicillin (100 μg/mL), spectinomycin (100 μg/mL) or apramycin (50 μg/mL) for preservation of plasmids. DNA isolation, plasmid preparation, restriction digests, gel electrophoresis, and ligation reactions were conducted according to standard methods[2]. All the genetic manipulation regarding Streptomyces were according to the protocols provided in the handbook Practical Streptomyces Genetics[1]. The E. coli-Streptomyces shuttle vector pOJ436[3], pKJ55[4] and pWHM4*[5] were used for expression experiments in Streptomyces. Restriction enzyme digested DNA fragments and PCR products were recovered from agarose gel by the GFX PCR DNA and Gel Band Purification Kit (Amersham).


Inactivation of Minimal PKS Genes chaABC


The chaABC null mutant was constructed by using the λred system according to the manual of the manufacturers (Plant Bioscience Limited). To amplify the spectinomycin resistance gene (aadA) flanked by FRT sites (FLP recognition targets), two long primers were designed. chaABC-PTL: 5′-TCAATGGGCCGCACTTGTCGGCTCGAGAGGATTTCCATGATTCCGGGGATCCGTC GACC-3′, and chaABC-PTR: 5′-GGCCCCGGCCCGGCTGCCGGGCCCGGTCCCGCTTCGTCATGTAGGCTGGAGCTGC TTC-3′. The PCR product was introduced into E. coli BW25113/pIJ790 containing cosmid pSC5P21 with concomitant substitution of the chaABC gene by the spectinomycin cassette. The inserted cassette was removed through expression of the FLP-recombinase in E. coli DH5α_BT340, yielding an 81 bp “scar” in the preferred reading frame. The resulting plasmid, pXU41, was then introduced into S. albus by intergenic conjugation with the help of E. coli ET12567 containing the RP4 derivative pUZ8002. The exconjugant S. albus::pXU41 was selected by its apramycin resistance.


Complementation of chaABC Null Mutant with Both Cha and Akn Genes


A 3.4 kb-FspI-fragment containing chaABC and a 5.5 kb-NruI-fragment with addition of chaR1, respectively, downstream of a constitutive promoter were cloned into E. coli-Streptomyces shuttle vector pKJ01[4]. The resultant constructs pXU66 and pXU67 were respectively introduced into the minimal PKS null mutant S. albus::pXU41 via intergenic conjugation. For redirecting the biosynthesis of chartreusin, the 5 kb aklavinone synthase genes, aknBCDE2F, were applied to recombine with the retained Cha enzymes. The 5-gene-cassette was installed downstream of a constitutive promoter PermE* on the multi-copy freestanding E. coli-Streptomyces shuttle vector pWHM4*. The resultant plasmid pMMK1 carried an operon encode the minimal PKS, consisting of ketosynthase (AknB), chain length factor (AknC), and acyl carrier protein (AknD), followed by the propionate starter unit synthase, the KASIII homolog lacking the active cysteine residue (AknE2), and the acyltransferase homolog (AknF)[6]. This cassette was used to complement the cha PKS-null mutant S. albus::pXU41 in parallel with pXU67.


Supplementation of the Transcriptional Activator ChaR1


In order to get higher production of chartreusin and its derivatives, a transcriptional activator encoded by chaR1 was co-expressed with corresponding genes. The fragment containing chaR1 (1.2 kb) was extracted from the cha cluster by a double-digestion of PmlI and StuI. It was then subjected to the EcoRV site of pXU55, which harbours oriT-site for conjugation and a constitutive promoter upstream of the multicloning site. The achieved oriT-promoter-chaR1 cassette was further subcloned into the E. coli-Streptomyces shuttle vector pWHM4* derivative, namely pXU343, for co-expression experiments.

  • [1] T. Kieser, M. J. Bibb, M. J. Buttner, K. F. Chater, D. A. Hopwood, Practical Streptomyces Genetics, The John Innes Foundation, Norwich, U.K., 2000.
  • [2] J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning: a Laboratory Manual, 2nd ed., Cold Spring Harbor, N.Y., 1989.
  • [3] M. Bierman, R. Logan, K. O'Brien, E. T. Seno, R. N. Rao, B. E. Schoner, Gene 1992, 116, 43.
  • [4] K. Jakobi, C. Hertweck, J Am Chem Soc 2004, 126, 2298.
  • [5] J. Vara, M. Lewandowska-Skarbek, Y. G. Wang, S. Donadio, C. R. Hutchinson, J Bacteriol 1989, 171, 5872.
  • [6] K. Raty, J. Kantola, A. Hautala, J. Hakala, K. Ylihonko, P. Mantsala, Gene 2002, 293, 115.



FIG. 1 shows the supplementation of Cha minimal PKS-null mutant S. albus::pXU41 (chaABC cassette was replaced by an 81-bp scar) with freestanding chaR1ABC (pXU67) from original cha gene cluster and aknBCDE2F (pMMK1) out of aklavinone biosynthetic genes, respectively. Both constructs complemented the scarce of polyketide backbone of the mutant. The metabolite from each cassette was consequently tailored by Cha post-PKS enzymes to give rise to the authentic chartreusin and novel ethyl-chartreusin, respectively. chaR1ABC code for the Streptomyces antibiotic regulatory protein (SARP), ketosynthase (KS), chain length factor (CLF), and acyl carrier protein (ACP), respectively. aknBCDE2F encode the minimal PKS (KS-CLF-ACP), the ketosynthase III homolog (AknE2), and acyltransferase homolog (AknF), which is responsible for the propionate starter unit incorporation.


Culture Material and Fermentation


The strain was stored in 50% glycerol at −20° C. The strain was grown in a suitable Erlenmeyer flask with J Medium (tryptone, 30 g; sucrose, 100 g; yeast extract, 10.0 g; and MgCl2.6H2O, 10.0 g, in 1.0 L distilled water) for 24 hrs at 28° C. One volume of this culture was used to inoculate 20 volumes containing Medium 10 (yeast extract, 4.0 g; malt extract, 10.0 g; glucose, 4.0 g in 1.0 L distilled water). The cultures were shaken on a rotary shaker (180 rpm) at 28° C. for 1 day. Then the 0.08 volumes of substrate solution (1 mg/mL substrate in DMSO) were added and the cultures were shaken on a rotary shaker (180 rpm) at 28° C. for 1 day.


If the fermentation was carried out in a fermenter the culture was held at a pH range of 6.5-7.5. All media were treated with apramycin and thiostreptone to a final concentration of 50 μg/mL and 15 μg/mL respectively.


Extraction and Isolation


The fermentation liquid was extracted three times with each the double volume of ethyl acetate. The solvent was removed and the crude extract was suspected to sephadex LH20 chromatography using chloroform/methanol 1:1 and silica gel column with a gradient from 100% chloroform to chloroform/methanol 9:1. The product was then ˜90% pure (HPLC). At this stage the yellow solid was washed twice with DCM and dried to yield the pure product. The DCM solution was dried and suspected to preparative HPLC to yield the total fermentation amount.


Isolation of Homochartreusin:


The entire fermentation broth was extracted with ethyl acetate and the combined extracts were concentrated under reduced pressure. The crude extract was separated by flash chromatography on silica gel using CHCl3/MeOH mixtures of increasing polarity as eluents (CHCl3:MeOH 98:2, CHCl3:MeOH 95:5, CHCl3:MeOH 90:10, CHCl3:MeOH 80:20) and a flow rate of 30 mL·min−1. Metabolite-containing fractions were further purified by preparative HPLC (column: Nucleosil 100-5 250×20, gradient mode with MeCN/0.1% TFA (H2O): 1% MeCN to 83% MeCN in 30 min, then 83% MeCN for 10 min, flow rate 12 mL·min−1).


Gel Electrophoresis with a Specified DNA Fragment


DNA-Adduct formation was carried out using a pure specified DNA fragment with the following sequence:










ccaaggatccaccttggctcacacaaaatattaccaacgacttgctaccatcggccttcactatggaccggctttccagtgccttagcgg






gaatgtggagtgtggtaaaggcttcgcaactggagaaatcacctgggagcctaagagggtttccactggtgatgactccagcgccagt





gtgcttcatcctaccttcttggattcctccctccacccaatcttcgctgcagtggaaggtctcatgggccacagtattacggagtcctttatc





cctactttcatgcgctctttgaaaatttctggtcttcttaaccgtaaggagtacaaatgcgatggattcaaggccaacgttgctgtcgacagc





tggatgcacggaccccgtgttgccattagcaatattggtattgagtccaaggagggccagcttcttgcggatattgaaggtctagaactc





accagccttggaagcgatgctgatgaccagcagaagagaactcttttcttcggcatccagtggaagccggctttcgagttcctgactcct





gctcaagcccagaacctcagcgtccctgagattgttgacctctacgtccaccagaaccctaatttgcacttccttcactactctgactccca





tacctctaccttggacatcctgaaccatcttggtggctctaatggagagaggcgcaaattcggcaaaatgactgtggtgccagttggttca





gcggaggaggcaagcttctctccccttgttgaacgctggaatggccttgtttcgctcgaggtcactcttgatgagaagtttgatgtgataat





aatctcctcttcagctgaagctgcttccattgagaatctccatgagaacggccttgttatatcccatcctgcaaaggctcccactgccgaca





accttagacaattatgggccacttcggatgtggccgtcttgaagggcggtgatgaatcagtgttcactcctgagactcttaccattctcatg





ccatctaatccatctacagagactgaagctctcgccaaaagaattgaatcgaccacctcagcaaaggttactagaaaagacttcctgtct





ctcagaaatggcacacgaatggacgacaatgttatttctctctacgccctcgatgtaaacatcttctacgatgagccatccaaggctttga





acgaattcaaggcagtccagtccctcacaagcgatgcaaaccgcaacattgtttggcttagccagggtaccttcatggattgcccctgcc





cagagcaagctatgttcccaggccttgctcgctctgttcgtcatgaaactgaagacttgagaattgcaattcttgatataactaagtctgcta





aagctgatctctctgccgatctcattctccgcatcctcaacccaaccctccatgaagaagaaattgcgcttcgaaatggccaaatccatgt





ctcccgattgcacgcaaatgatgagttgaactctaagattgccggaggctacggatccttgg






8 μL of water, 2 μL of DNA (25.7 ng/μL) were either directly treated with 2 μL loading buffer or were treated additionally with 0.1 μL (1 mg/mL in DMSO) substrate. The solution was irradiated with a laser (405 nm, 20 mW) for 30 sec. and then treated with loading buffer. The DNA was loaded on 1% agarose gel with ethidium bromide operating at 120 V (FIG. 2).


Chemical Synthesis and Analytical Data
N,N-diethyl-3-(methoxymethoxy)benzamide (4)



embedded image


10 g (51.8 mmol, 1 eq.) N,N-diethyl-3-hydroxybenzamide (3) were placed in a round bottom flask and dissolved in 160 mL dichloromethane. Then 9.7 mL, (56.9 mmol, 1.1 eq.) Diisoproyl amine (DIPEA) and 4.13 mL (54.4 mmol, 1.05 eq.) methoxy methylchloride were added and the reaction flask was equipped with a drying tube filed with blue gel. The solution was stirred for 18 h at RT. Then additional 0.79 mL (10.36 mmol, 0.2 eq.) methoxy methylchloride were added and the solution was stirred for further 24 h at RT until no changes in GC/MS could be observed. The solvent was removed under reduced pressure and the resulting oil was distilled at 2 mbar. The fraction from 156-158° C. was collected to yield 8.15 g (35.9 mmol, 69%) of the desired product as a clear oil.


Rf silica gel 60; cyclohexane/ethyl acetate 2:1=0.25


bp. 156-158° C. at 2 mbar.



1H NMR (300 MHz; CDCl3): δ=7.30-7.25 [m, 1H, Ar—CH—CH—CH]; 7.04-7.01 [m, 2H, Ar—CH—COMOM-CH]; 6.98-3.95 [m, 1H, Ar—CH—CH—CCONEt2]; 5.15 [s, 2H; OCH2O]; 3.50 [br s, 2H, NCH′2]; 3.44 [s, 3H, OCH3]; 3.22 [br s, 2H, NCH2]; 1.21 [br s, 3H, NCH2CH′3]; 1.09 [br s, 3H, NCH2CH3] ppm.



13C NMR (75 MHz; CDCl3): δ=170.8 (CONEt2); 157.1 (Ar—COMOM); 138.5 (Ar-CCONEt2); 129.5 (Ar—CH—CH—CH—CCONEt2); 119.6 (Ar—CH—CH—CH—CCONEt2); 116.9 (Ar—CH—CH—CH—CCONEt2); 114.1 (Ar—COMOM-CH—CCONEt2); 94.4 (OCH2O); 55.9 (OCH3); 43.2 (NCH′2CH′3); 39.1 (NCH2CH3); 14.1 (NCH′2CH′3); 12.8 (NCH2CH3) ppm.


IR (ATR): {tilde over (v)} (Trel)=3494 (w), 3247 (w), 3065 (w), 2971 (m), 2934 (m), 2900 (m), 2849 (w), 2826 (w), 2789 (w), 2069 (w), 2000 (w), 1928 (w), 1627 (s), 1578 (s), 1489 (m), 1470 (s), 1456 (s), 1437 (s), 1424 (s), 1381 (m), 1364 (m), 1349 (m), 1315 (m), 1288 (s), 1237 (s), 1219 (m), 1206 (m), 1150 (s), 1099 (s), 1078 (s), 1014 (s), 1006 (s), 987 (s), 944 (m), 922 (s), 905 (m), 879 (m), 824 (m), 793 (s), 751 (s), 706 (m), 688 (m), 667 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=237 (30) [M]•+, 236 (49), 192 (100), 165 (62), 164 (39), 135 (15), 121 (8), 107 (9), 77 (10).


ESI-MS (ESI+): m/z=238 (100) [M+H], 260 (21) [M+Na]+, 475 (25) [2M+H]+, 497 (68) [2M+Na]+ amu.


HRMS (ESI+) 238.1438 for C11H8NO4 [M+H]+; 238.1439 found.


N,N-diethyl-2-formyl-3-(methoxymethoxy)benzamide (5)



embedded image


549 mg (2.31 mmol, 1 eq.) N,N-diethyl-3-(methoxymethoxy)benzamide (4) were placed in a Schlenk tube evacuated and flushed with argon 3 times. Then 3.7 mL freshly prepared dry THF and 384 μL, (2.55 mmol, 1.1 eq.) N,N,N′,N′-tetramethyl-ethane-1,2-diamine (TMEDA) were added and the clear, colorless solution was cooled to −78° C. in an ethanol/dry ice bath. After temperature equilibration (5 min) 1.1 eq. of tert-butyl lithium solution (1.7 mol/L in pentane) were added with a syringe pump with 1 mL/min. After 45 min 590 μL (7.64 mmol, 3.3 eq.) DMF were added as with a syringe pump at 0.7 mL/min. The yellow solution was allowed to warm to RT overnight. The solution was then quenched with water and extracted 3 times with diethyl ether. The solvent was removed in vacuo and the resulting suspension was suspected to column chromatography with cyclohexane/ethyl acetate 2:1 to yield 436 mg (1.65 mmol, 71%) of the desired product as a pale yellow oil.


Rf silica gel 60; cyclohexane/ethyl acetate 2:1=0.06



1H NMR (300 MHz; CDCl3): δ=10.47 [s, 1H, CHO]; 7.48 [m, 1H, Ar—CH-5]; 7.19 [d, 1H, 3JH-H=8.4 Hz, Ar—CH-4]; 6.85 [d, 1H, 3JH-H=7.4 Hz, Ar—CH-6]; 5.27 (s, 2H, OCH2O]; 3.54 [q, 2H, 3JH-H=7.1 Hz, NCH2CH3]; 3.04 [q, 2H, 3JH-H=7.1 Hz, NCH2′CH3′]; 1.28 [t, 3H, 3JH-H=7.1 Hz, NCH2CH3]; 0.98 [t, 3H, 3JH-H=7.1 Hz, NCH2′CH3′] ppm.



13C NMR (75 MHz; CDCl3): δ=189.2 (CHO); 169.6 (CON); 159.9 (Ar—C-3); 139.2 (Ar—C-1); 135.4 (Ar—CH-5); 121.8 (Ar—C-2); 120.1 (Ar—CH-6); 115.0 (Ar—CH-4); 94.7 (OCH2O); 56.5 (OCH3); 42.4 (NCH2CH3); 38.6 (NCH2′CH3′); 13.5 (NCH2CH3); 12.0 (NCH2′CH3′) ppm.


ESI-MS (ESI+): m/z=266 (35) [M+H]+, 288 (100) [M+Na]+, 320 (36) [M+Na+MeOH]+, 531 (12) [2M+H]+553 (54) [2M+Na]+, 585 (14) [2M+Na+MeOH]+. (ESI+) with NH4OAc: m/z=266 (100) [M+H]+, 531 (60) [2M+H]+.


HRMS (ESI+) for C14H20NO4 [M+H]+ 266.1387. found. 266.1375.


7-(methoxymethoxy)-3-oxo-1,3-dihydroisobenzofuran-1-carbonitrile (6)



embedded image


418 mg (1.6 mmol, 1 eq.) N,N-diethyl-3-(methoxymethoxy)benzamide (5) were dissolved in 6.3 mL dichloro methane and treated with 1.6 mL (31.5 μmol, 0.02 eq.) of a 20 mmol/L potassium cyanide/18-crown-6 solution in THF and cooled to 0° C. Then 296 μL (2.4 mmol, 1.5 eq.) trimethylsilyl cyanide were added and the solution was stirred for 30 min at 0° C. The solvent was removed under reduced pressure and then 6.3 mL glacial acetic acid were added and the solution was stirred at RT over night. The clear solution was poured into 100 mL saturated sodium bicarbonate solution and extracted three times with each 100 mL ethyl acetate. The combined organics were washed with saturated sodium bicarbonate solution, brine solution and dried over sodium sulfate. After filtration the solvent was removed and the crude product was recrystallized from cyclohexane to yield 273 mg (1.2 mmol, 79%) 7-(methoxymethoxy)-3-oxo-1,3-dihydroisobenzofuran-1-carbonitrile (6) as a white crystalline powder.


Rf silicagel 60; chloroform/methanol 95:5=0.91


mp. 126.9° C.



1H NMR (300 MHz; D3CCOCD3): δ=7.75 [m, 1H, Ar—CH 5]; 7.61 [dd, 1H, 3JH-H=8.5 Hz, 4JH-H=0.5 Hz, Ar—CH 6]; 7.58 [dd, 1H, 3JH-H=7.5 Hz, 4JH-H=0.5 Hz, Ar—CH 4]; 6.58 [s, 1H, CHCN]; 5.52 [d, 1H, 2JH-H=6.9 Hz, OCH2O]; 5.45 [d, 1H, 2JH-H=6.9 Hz, OCH2O], 3.52 [s, 3H, OCH3] ppm.



13C NMR (75 MHz; D3CCOCD3): δ=168.4 (CO-3); 153.0 (Ar—C-4); 134.2 (Ar—CH-5); 131.5 (Ar—C-7a); 127.1 (Ar—C-3a); 120.9 (Ar—CH-6); 119.2 (Ar—CH-4); 114.9 (CN); 95.3 (OCH2O); 65.3 (CHCN); 56.8 (OCH3) ppm.


IR (ATR) {tilde over (v)} (Trel)=3093 (w), 3023 (w), 2973 (w), 2939 (w), 2852 (w), 2832 (w), 2529 (w), 2342 (w), 2191 (w), 2165 (w), 2068 (w), 2009 (w), 1957 (w), 1771 (s), 1737 (m), 1617 (m), 1486 (m), 1442 (m), 1404 (w), 1308 (m), 1281 (m), 1265 (s), 1255 (s), 1204 (m), 1173 (m), 1156 (s), 1088 (m), 1072 (m), 1055 (m), 1021 (m), 986 (s), 957 (s), 917 (s), 890 (s), 854 (m), 809 (m), 779 (m), 757 (s), 747 (s), 686 (m), 667 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=219 (9) [M]•+, 189 (23), 188 (24), 160 (13), 148 (27), 133 (21), 120 (91), 105 (16), 92 (60), 75 (91), 63 (100).


ESI-MS (ESI−): m/z=218 (100) [M−H] amu.


ESI-MS2 (ESI−): m/z=218 (15) [M−H]; 173 (100); 117 (12) amu.


HRMS (ESI−) for C11H8N4O [M−H]218.0459. found. 218.0419 amu.


General Procedure for Annulation:


1.0 eq. 7-(methoxymethoxy)-3-oxo-1,3-dihydroisobenzofuran-1-carbonitrile was weighed into a Schlenk flask, evacuated and flushed with argon 3 times. Then freshly prepared dry THF was added and the clear, colorless solution was cooled to −60° C. in an ethanol/dry ice bath. After equilibration (5 min) 3 eq. of lithium tert-butoxide solution (1 mol/L in THF) were added with a syringe pump with 12 mL/min. After 45 min the coumarin was added as solution in THF again with a syringe pump at 12 mL/min. After additional 1 h at −60° C. the deep yellow-orange solution was allowed to warm to RT over night. The solution was then treated with 10% (m/v) ammonium chloride solution and stirred vigorously for 30 min at RT. The THF was removed in vacuo and the resulting suspension was filtered. The filter cake was washed with water, acetone and pentane/ether 1:1 and then dried overnight in fine vacuum to yield the pure product as a yellow powder.


General Procedure for MOM-Deprotection:


The MOM protected phenol was weighed into a two necked round-bottom flask, evacuated and flushed 3 times with argon. The solid was dissolved in the minimal necessary amount of dry methylene chloride (about 1 mL per 1 mg of substrate) and treated with 5 eq. of a solution of boron tribromide in methylene chloride (1 mol/L). Immediately the yellow solution changed from yellow to red-orange. After 5 min a saturated sodium bicarbonate solution was added (25% (v/v) of total solvent volume) where the solution changed to yellow and a yellow precipitate occurs. The methylene chloride was removed in vacuo and the resulting suspension was filtered. The filter cake was washed with water, acetone and pentane/ether 1:1 and then dried overnight in fine vacuum to yield the pure phenol as yellow powder.


10-MOM-norchartarin (10)



embedded image


This compound was prepared as a yellow solid in (92)% yield by the reaction between (6) and (7) according to the general procedure for annulation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.91


mp. 234.5° C.



1H NMR (600 MHz; CD2Cl2): see Table 3.



13C NMR (150 MHz; CD2Cl2): see Table 4.


IR (ATR): {tilde over (v)} (% T)=3220 (w), 3096 (w), 3056 (w), 2981 (w), 2839 (w), 1733 (s), 1712 (s), 1611 (m), 1577 (w), 1550 (w), 1510 (m), 1496 (s), 1469 (m), 1442 (m), 1402 (m), 1378 (m), 1335 (m), 1281 (m), 1264 (m), 1240 (s), 1206 (s), 1153 (m), 1108 (s), 1081 (s), 1069 (s), 1017 (s), 986 (m), 941 (m), 930 (m), 905 (m), 875 (m), 819 (m), 778 (m), 761 (s), 743 (s), 707 (w), 685 (w), 668 (w), 659 (m) cm−1.


ESI-MS (ESI−): m/z=363 (100) [M−H].


HRMS (ESI−) for C20H11O7 [M−H]363.0510. found. 363.0513 amu.


10-MOM-1-bromochartarin (12)



embedded image


This compound was prepared as a yellow solid in (71)% yield by the reaction between (6) and (9) according to the general procedure for annulation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.93


mp. 290.4° C.



1H NMR (600 MHz; CD2Cl2): see Table 3.



13C NMR (150 MHz; CD2Cl2): see Table 4.


IR (ATR): {tilde over (v)} (% T)=3095 (w), 3008 (w), 2827 (w), 1739 (s), 1691 (s), 1633 (w), 1605 (m), 1588 (m), 1497 (m), 1463 (m), 1441 (m), 1395 (m), 1370 (s), 1342 (m), 1322 (m), 1310 (m), 1276 (m), 1252 (m), 1237 (s), 1211 (m), 1160 (s), 1140 (s), 1111 (m), 1091 (s), 1066 (s), 1010 (s), 924 (s), 873 (m), 836 (m), 816 (m), 788 (m), 774 (s), 720 (m), 702 (m), 685 (m), 677 (w), 660 (m) cm−1.


HRMS (ESI−) for C20H10O779Br [M−H]440.9615. found. 440.9620 amu.


10-MOM-chartarin (11)



embedded image


This compound was prepared as a yellow solid in (66)% yield by the reaction between (6) and (8) according to the general procedure for annulation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.91


mp. 273.1° C.



1H NMR (500 MHz; CD2Cl2): see Table 3.



13C NMR (125 MHz; CD2Cl2): see Table 4.


IR (ATR): {tilde over (v)} (% T)=3078 (w), 2928 (w), 1727 (s), 1635 (w), 1588 (m), 1474 (w), 1397 (m), 1345 (m), 1255 (s), 1209 (m), 1143 (s), 1103 (m), 1065 (s), 933 (s), 832 (m), 794 (m), 724 (m), 661 (m), 2970 (w), 2831 (w), 1683 (m), 1609 (m), 1502 (m), 1448 (m), 1371 (s), 1316 (m), 1236 (s), 1155 (s), 1124 (m), 1083 (m), 1017 (s), 875 (m), 813 (m), 775 (s), 687 (w) cm−1.


ESI-MS (ESI−): m/z=377 (100) [M−H].


HRMS (ESI−) for C21H13O7 [M−H] 377.0667. found. 377.0666 amu.


Chartarin (1 b)



embedded image


This compound was prepared as a yellow solid in (99)% yield by the reaction of (11) according to the general procedure for MOM-deprotection as described.


Rf silicagel 60; chloroform/methanol 95:5=0.91


mp. 306.5° C.



1H NMR (500 MHz; pyridine-D5): see Table 1.



13C NMR (125 MHz; pyridine-D5): see Table 2.


IR (ATR): {tilde over (v)} (% T)=3055 (w), 2929 (w), 1688 (s), 1607 (m), 1534 (w), 1457 (w), 1392 (m), 1331 (m), 1290 (m), 1236 (m), 1180 (m), 1117 (m), 1036 (m), 971 (w), 943 (w), 882 (w), 815 (m), 722 (m), 687 (m), 3213 (w), 2968 (w), 1740 (w), 1636 (m), 1582 (m), 1505 (m), 1421 (m), 1371 (s), 1316 (m), 1254 (m), 1219 (s), 1149 (m), 1072 (m), 985 (m), 961 (m), 890 (w), 841 (m), 776 (s), 712 (m), 662 (m) cm−1.


HRMS (ESI−) for C19H9O6 [M−H]333.0410. found. 333.0405 amu.


Norchartarin (13)



embedded image


This compound was prepared as a yellow solid in (93)% yield by the reaction of (10) according to the general procedure for MOM-deprotection as described.


Rf silicagel 60; chloroform/methanol 95:5=0.89


mp. 329.9° C.



1H NMR (600 MHz; pyridine-D5): see Table 1.



13C NMR (150 MHz; pyridine-D5): see Table 2.


IR (ATR): {tilde over (v)} (% T)=3206 (m), 1685 (s), 1617 (m), 1578 (m), 1507 (m), 1462 (w), 1368 (m), 1329 (m), 1264 (m), 1227 (m), 1144 (m), 1090 (s), 1022 (m), 977 (s), 913 (m), 879 (m), 811 (m), 747 (s), 678 (s), 1703 (m), 1634 (w), 1590 (w), 1534 (w), 1474 (m), 1421 (m), 1341 (m), 1288 (m), 1242 (m), 1202 (s), 1119 (s), 1061 (m), 997 (m), 929 (m), 903 (m), 827 (m), 773 (m), 711 (s) cm−1.


HRMS (ESI−) for C18H7O6 [M−H] 319.0248. found. 319.0255 amu.


1-Bromochartarin (14)



embedded image


This compound was prepared as a yellow solid in quatitative yield by the reaction of (12) according to the general procedure for MOM-deprotection as described.


Rf silicagel 60; chloroform/methanol 95:5=0.91


mp. 302.7° C.



1H NMR (500 MHz; pyridine-D5): see Table 1.



13C NMR (125 MHz; pyridine-D5): see Table 2.


IR (ATR): {tilde over (v)} (% T)=3243 (m), 3080 (w), 1689 (s), 1605 (s), 1562 (w), 1499 (m), 1423 (m), 1325 (m), 1288 (s), 1220 (s), 1136 (s), 1095 (s), 1002 (w), 966 (m), 895 (m), 846 (m), 816 (m), 773 (s), 682 (s), 3099 (w), 1717 (m), 1632 (w), 1584 (m), 1532 (m), 1456 (m), 1360 (s), 1306 (m), 1252 (m), 1204 (s), 1114 (s), 1072 (s), 982 (m), 928 (s), 881 (m), 826 (m), 791 (m), 700 (s), 660 (s) cm−1.


ESI-MS (ESI−): m/z=397 (100) [M−H].


HRMS (ESI−) for C18H6O679Br [M−H]396.9358. found. 396.9358 amu.


1-Vinylchartarin (15)



embedded image


107 mg (267 μmol, 1.0 eq.) 1-bromochartarin (14), 57 mg (1.34 mmol, 5 eq.) lithium chloride and 39 mg (66.83 mmol), dichloro(1,3-bis(diphenylphosphino) propane) palladium were placed in a Schlenk tube, evacuated and flushed with argon for three times. Under argon counter flow 40 mL dried DMF and 390 μL (1.34 mmol, 5 eq.) tri-n-butyl(vinyl)tin were added. The Schlenk tube was equipped with a cooling finger and stirred at 90° C. overnight. After cooling to RT 130 mg potassium fluoride were added and the slurry was stirred for 30 min. The solvent was removed and the resulting brownish solid was dissolved in dichloro methane and washed with water. The organic phase was flushed through Celite with 50% potassium fluoride. The Celite® was extracted with methanol. After evaporation 18.5 mg (53 μmol, 20%) 1-vinylchartarin (15) were yielded as a yellow solid. (Note: the yield is much higher, but the separation from tin organic residues limits the yield drastically)


Rf silicagel 60; chloroform/methanol 95:5=0.93



1H NMR (300 MHz; pyridine-D5): see Table 1.



13C NMR (75 MHz; pyridine-D5): see Table 2.


ESI-MS (ESI−): m/z=345 (100) [M−H].


HRMS (ESI−) for C20H9O6 [M−H] 345.0405. found. 345.0412.


Norchartreusin



embedded image


This compound was isolated as a yellow solid by fermentation of (13) according to the general procedure for fermentation and isolation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.07



1H NMR (600 MHz; pyridine-D5): see Table 5.



13C NMR (150 MHz; pyridine-D5): see Table 6.


ESI-MS (ESI−): see Table 7.


ESI-MS2 (ESI−): see Table 7.


HRMS (ESI−) for C31H29O14 [M−H] 625.1563. found. 625.1556 amu.


Chartreusin (1)



embedded image


This compound was isolated as a yellow solid by fermentation of (1b) according to the general procedure for fermentation and isolation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.53



1H NMR (600 MHz; pyridine-D5): see Table 5.



13C NMR (150 MHz; pyridine-D5): see Table 6.


ESI-MS (ESI−): see Table 7.


ESI-MS2 (ESI−): see Table 7.


HRMS (ESI−) for C32H31Ox4, [M−H] 639.1719. found. 639.1732 amu.


Homochartreusin



embedded image


Rf silicagel 60; chloroform/methanol 95:5=0.64



1H NMR (500 MHz; DMSO-D6): see Table 5.



13C NMR (125 MHz; DMSO-D6): see Table 6.


ESI-MS (ESI−): see Table 7.


ESI-MS (ESI+): m/z=677 [M+Na]+


ESI-MS2 (ESI−): see Table 7.


HRMS (ESI+): 677.1864 [M+Na]+ (calcd. for C33H34O14Na 677.1846).


1-Vinylchartreusin



embedded image


This compound was isolated as a yellow solid by fermentation of (15) according to the general procedure for fermentation and isolation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.53



1H NMR (500 MHz; pyridine-D5): see Table 5.



13C NMR (125 MHz; pyridine-D5): see Table 6.


ESI-MS (ESI−): see Table 7.


ESI-MS2 (ESI−): see Table 7.


HRMS (ESI−) for C33H31O14 [M−H]651.1719. found. 651.1723.


1-Bromochartreusin



embedded image


This compound was isolated as a yellow solid by fermentation of (14) according to the general procedure for fermentation and isolation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.36



1H NMR (600 MHz; pyridine-D5): see Table 5.



13C NMR (150 MHz; pyridine-D5): see Table 6.


ESI-MS (ESI−): see Table 7.


ESI-MS2 (ESI−): see Table 7.


HRMS (ESI−) for C31H28O1479Br [M−H]703.0668. found. 703.0685 amu.


Methyl 2-bromo-5-hydroxybenzoate (28)



embedded image


Methyl 3-hydroxybenzoate (40 g, 263 mmol, 1 eq.) was placed in a round bottom flask and dissolved in tetrachloromethane (600 mL). Then bromine (13.5 mL, 263 mmol, 1 eq.) was added and the solution was stirred for 5 h at 60° C. The resulting solution was concentrated and recrystallized from diisopropylether to yielding the title compound as white crystalline solid (24.74 g, 150 mmol, 57%).


Rf Silica gel 60; dichloromethane: 0.19.


mp. 96-98° C.



1H NMR (300 MHz; CDCl3): δ==7.46 [d; 1H; 3JH-H=8.7 Hz; CH-3]; 7.28 [d; 1H; 4JH-H=3.1 Hz; CH-6]; 6.83 dd; 1H; 3JH-H=8.7 Hz; 4JH-H=3.1 Hz; CH-4]; 5.77 [s; 1H; OH]; 3.91 [s; 3H; OCH3] ppm.



13C NMR (75 MHz; CDCl3): δ=166.9 (C═O); 154.9 (Ar—C-5); 135.3 (Ar—CH-3); 132.6 (Ar—C-1); 120.3 (Ar—CH-4); 118.3 (Ar—CH-6); 111.7 (Ar—C-2); 52.7 (OCH3) ppm.


EI-MS (EI+, 70 eV): m/z=230/232 (61), 199/201 (100), 171/173 (15), 143/145 (11), 110 (7), 63 (14).


HRMS (ESI+) for C8H7O3Na [M+Na]+: 252.9471. found. 252.9447.


Methyl 6-bromo-2-formyl-3-hydroxybenzoate (30a) and methyl 2-bromo-4-formyl-5-hydroxybenzoate (30b)



embedded image


Methyl 2-bromo-5-hydroxybenzoate (28) (5 g, 21.6 mM, 1 eq.) and hexamethylenetetraamine (4.55 g, 32.5 mM, 1.5 eq.) were placed in a 50 mL MLS® fused quartz microwave vial and treated with trifluoroacetic acid (32 mL). The following microwave parameters were set:





















Maximum



step
time/min
T/° C.
Power/W





















1
2
70
100



2
3
80
100



3
5
120
100



4
1
120
100










After cooling (15 min) the resulting brownish liquid was poured into water and neutralized with sodium bicarbonate. The aqueous phase was extracted trice with ethyl acetate. The crude extract was dried over sodium sulfate, concentrated and suspected to column chromatography with a gradient from chloroform to chloroform/methanol 98:2. The fractions containing the product mixture were recrystallized from hot cyclohexane to yield pure Methyl 6-bromo-2-formyl-3-hydroxybenzoate (29) (1.64 g, 6.33 mmol, 29.3%). A further separation of the mother liquor containing both isomers was carried out for analytical purposes with preparative HLPC using a phenomenex Luna C18 10 μm 250×21.2 mm at 21 mL/min with a gradient from 20 to 83% acetonitrile/water in 30 min.


Data for methyl 6-bromo-2-formyl-3-hydroxybenzoate (30a)


Rf Silica gel 60; chloroform/methanol 95/5: 0.91.


mp. 75.6° C.



1H NMR (300 MHz; CDCl3): δ=11.52 [s, 1H, OH], 9.82 [s, 1H, CHO], 7.63 [d, 1H, 3JH-H=9.0 Hz, CH-5], 6.94 [d, 1H, 3JH-H=9.0 Hz, CH-4], 3.99 [s, 3H, OCH3] ppm.



13C NMR (75 MHz; CDCl3): δ=194.0 (CHO), 165.9 (COOCH3), 161.3 (Ar—COH), 140.6 (Ar—CH-5), 138.6 (ArC—COOCH3), 121.2 (Ar—CH-4), 118.0 (Ar—CCHO), 108.9 (Ar—CBr), 53.3 (OCH3) ppm.


IR (ATR): {tilde over (v)} (Trel)=3075 (w), 2955 (w), 2925 (w), 2846 (w), 1712 (s), 1654 (s), 1441 (s), 1330 (s), 1306 (s), 1279 (s), 1257 (s), 1197 (m), 1173 (s), 1160 (s), 1118 (s), 1011 (s), 928 (s), 828 (s), 799 (s), 752 (s), 742 (s), 707 (s), 653 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=258/260 (48), 243/245 (36), 230/232 (65), 199/201 (100), 171/173 (20), 170/172 (20), 143/145 (15), 63 (44).


HRMS (ESI−) calc. for C9H679BrO4 [M+H]+: 256.9455. found. 256.9457.


Data for methyl 2-bromo-4-formyl-5-hydroxybenzoate (30b)


Rf Silica gel 60; chloroform/methanol 95/5: 0.91.


mp. 72.3° C.



1H NMR (300 MHz; CDCl3): δ=10.75 [s, 1H, OH], 9.85 [s, 1H CHO], 7.77 [s, 1H, CH-3], 7.27 [s, 1H, CH-6], 3.91 [s, 3H, OCH3] ppm.



13C NMR (75 MHz; CDCl3): δ=195.2 (CHO), 165.5 (COOCH3), 159.8 (Ar—COH), 139.5 (Ar—CCOOCH3), 138.0 (Ar—CH-3), 122.6 (Ar—CCHO), 120.4 (Ar—CH-6), 109.5 (Ar—CBr), 52.9 (COOCH3).


IR (ATR): {tilde over (v)} (Trel)=3197 (w), 2952 (w), 2879 (w), 1733 (s), 1666 (s), 1554 (m), 1473 (m), 1433 (m), 1297 (s), 1278 (s), 1213 (s), 1172 (s), 1115 (s), 1003 (s), 888 (s), 820 (s), 760 (s), 717 (s), 655 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=258/260 (94), 227/229 (100), 199/201 (19), 171/173 (8), 143/145 (19), 63 (29).


HRMS (ESI−) calc. for C9H679BrO4 [M+H]+: 256.9455. found. 256.9457.


Methyl 6-bromo-coumarin-5-carboxylate (9)



embedded image


Methyl 6-bromo-2-formyl-3-hydroxybenzoate (30b) (800 mg, 3.09 mmol, 1.0 eq.) and (Triphenylphosphoranylidene)ketene (1.03 g, 3.4 mmol, 1.1 eq.) were placed in a Schlenk tube, flushed with argon three times and dissolved in THF (32 mL) The mixture was heated while refluxing for 2 h, cooled to rt, and concentrated under reduced pressure. The resulting solid was suspected to column chromatography with a gradient from cyclohexane to cyclohexane/ethyl acetate 4:1 yielding the title compound as pale yellow solid (633 mg, 2.24 mmol, 72%).


Methyl 3-bromo-5-nitrobenzoate (51)



embedded image


methyl 3-nitrobenzoate (50) (85.4 g; 471 mmol, 1 eq.) were dissolved in concentrated sulfuric acid (500 mL). Then a solution of dibromoisocyanuric acid (67.6 g; 235 mmol, 0.5 eq.) in concentrated sulfuric acid (850 mL) was added. After stirring the clear solution for 2 hours the whole mixture were poured on 5 kg ice. The slurry was extracted 5 times with each 2 L of dichloromethane. The combined organic phases were dried over sodium sulfate. After evaporating of the solvent the crude product were recrystallize from methanol to yield the title compound (105.8 g 406 mmol, 86%) as large pale yellow crystals.


Rf silica gel 60; chloroform/methanol 95:5=0.87.


mp. 74.1° C.



1H NMR (300 MHz; CHCl3): δ=8.75 (dd, 1H, 4JH-H 1=2.0 Hz, 4JH-H 2=1.4 Hz, CH-6); 8.51 (dd, 1H, 4JH-H 1=4JH-H 2=2.0 Hz, Ar—CH-4); 8.45 (dd, 1H, 4JH-H 1=1.7 Hz, 4JH-H 2=1.5 Hz, Ar—CH-2); 3.96 (s, 3H, OCH3) ppm.



13C NMR (75 MHz; CHCl3): δ=163.7 (COOMe), 148.7 (Ar—C—NO2), 138.2 (Ar—CH-2), 133.2 (Ar—CCOOMe), 130.4 (Ar—CH-4), 123.1 (Ar—CH-6), 123.0 (Ar—C—Br), 53.1 (OCH3) ppm.


IR (ATR): {tilde over (v)} (Trel)=3096 (w), 3082 (m), 2955 (w), 2917 (w), 2870 (w), 2847 (w), 1725 (s), 1607 (w), 1527 (m), 1446 (m), 1434 (m), 1420 (m), 1345 (s), 1284 (s), 1243 (m), 1197 (m), 1146 (m), 1087 (m), 980 (m), 919 (m), 902 (s), 842 (m), 770 (m), 733 (s), 726 (s), 653 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=259/261 (65) [M]•+, 228/230 (100), 213/215 (8), 182/184 (22), 172/172 (6), 154/156 (6), 75 (31), 74 (30).


HRMS (ESI+) calc. for C8H6N79BrO4 [M+H]+: 258.9486. found 258.9480 amu.


Methyl 3-amino-5-bromobenzoate (52)



embedded image


Methyl 3-bromo-5-nitrobenzoate (51) (1.79 g, 6.86 mmol, 1 eq.) and iron (2.3 g, 41.2 mmol, 6 eq.) were suspended in methanol (40 mL) while refluxing hydrochloric acid (28 mL, 6 N) was added dropwise. After the addition the solution was further stirred under reflux for 45 min. After cooling the solution was diluted with water (150 mL) and neutralized with sodium bicarbonate. The greenish brown solution was extracted with chloroform four times. The combined organic phases were dried with sodium sulfate and concentrated, yielding the title compound as pale yellow solid (1.45 g, 6.3 mmol, 92%).


Rf silica gel 60; chloroform/methanol 95:5=0.56.


mp. 190.8° C.



1H NMR (300 MHz; CDCl3): δ=8.14 (s, 1H, NH2), 7.57 (dd, 1H, 4JH-H 1=4JH-H 2=1.6 Hz, Ar—CH-2), 7.54 (dd, 1H, 4JH-H 1=4JH-H 2=1.7 Hz, Ar—CH-6), 7.42 (dd, 1H, 4JH-H 1=4JH-H 2=1.7 Hz, Ar—CH-4), 3.84 (s, 3H, COOCH3) ppm.



13C NMR (75 MHz; CDCl3): δ=164.8 (Ar—COOMe), 143.0 (Ar—C—NH2), 132.4 (Ar—C-1), 125.0 (Ar—CH-4), 124.3 (Ar—CH-2), 122.1 (Ar—C—Br), 118.1 (Ar—CH-6), 52.6 (OCH3) ppm.


IR (ATR): {tilde over (v)} (Trel)=3067 (w), 2952 (w), 2839 (m), 2583 (w), 1730 (s), 1536 (m), 1439 (m), 1428 (m), 1290 (s), 1210 (s), 1113 (m), 976 (m), 914 (w), 881 (m), 830 (m), 766 (s), 731 (m), 662 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=229/231 (100) [M]•+, 198/200 (48), 170/172 (30), 171/173 (35), 143/154 (5), 90/92 (15), 63 (26).


HRMS (ESI−) calc. for C8H9N79BrO2 [M+H]+: 229.9811. found 229.9819 amu.


Methyl 3-bromo-5-hydroxybenzoate (53)



embedded image


A solution of concentrated sulfuric acid (30 mL) in water (200 mL) and methyl 3-amino-5-bromobenzoate (52) (17.08 g, 74 mmol, 1 eq.) were cooled with an ice bath to 0° C. Then a solution sodium nitrite (5.12 g, 74 mmol, 1 eq.) was added drop wise while the solution turned to yellow. After additional 30 min the solution were heated and refluxed for 30 min After cooling to rt the brownish solution were extracted four times with chloroform. The combined organic phases were dried over sodium sulfate and concentrated under reduced pressure. The crude product was flash purified using a silica gel pad with a gradient from chloroform to chloroform/methanol 95:5. The fraction with the desired product were collected, concentrated a suspected to recrystallization from petroleum ether/toluene to yield a yellow-brownish solid (7.57 g, 33 mmol, 44%). (Note: traces of colored side products cause the reddish brown color of the product, the purity (>95%) of the collected crystals was determined using NMR and GC-MS)


Rf silica gel 60; chloroform/methanol 95:5=0.44.


mp. 125° C.



1H NMR (300 MHz; CDCl3): δ=7.98 (s, 1H, Ar—OH), 7.65 (dd, 1H, 4JH-H 1=4JH-H 1=1.5 Hz, Ar—CH-2), 7.44 (dd, 1H, 4JH-H 1=2.3 Hz, 4JH-H 2=1.4 Hz, Ar—CH-6), 7.20 (dd, 1H, 4JH-H 1=4JH-H 2=2.1 Hz, Ar—CH-4), 3.87 (s, 3H, OCH3), ppm.



13C NMR (75 MHz; CDCl3): δ=166.0 (COOMe), 157.5 (Ar—C—OH), 132.5 (Ar—C-1), 124.1 (Ar—CH-2), 123.4 (Ar—CH-4), 122.6 (Ar—C—Br), 115.6 (Ar—CH-6), 52.5 (OCH3) ppm.


IR (ATR): {tilde over (v)} (Trel)=3411 (m), 3094 (w), 3062 (w), 2955 (w), 1703 (s), 1591 (s), 1480 (m), 1432 (s), 1308 (s), 1279 (s), 1244 (s), 1214 (s), 1114 (rn), 1001 (s), 915 (s), 874 (m), 835 (m), 762 (s), 731 (m), 667 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=230/232 (92) [M]•+, 199/201 (100), 171/173 (24), 143/145 (14), 63 (24).


HRMS (ESI−) calc. for C8H679BrO3 [M−H]: 228.9503. found 228.9498 amu.


Methyl 5-bromo-2-formyl-3-hydroxybenzoate (54) and Methyl 3-bromo-4-formyl-5-hydroxybenzoate (55)



embedded image


methyl 3-bromo-5-hydroxybenzoate (53) (5 g 21.6 mmol, 1.0 eq.) was placed in a round bottom flask followed by poly phosphoric acid (20 mL). The reactor were equipped with a KPG-stirrer and heated in an oil bath to 120° C. The sequential addition of urotopine (4.55 g, 32.5 mmol, 1.5 eq.) was started after the phenol were melted and completely dissolved into the acid. After 45 min the oil bath were removed and to the cooled mixture water was added. After neutralization with sodium bicarbonate the slurry was extracted trice with ethyl acetate. The crude extract was dried over sodium sulfate, concentrated and suspected to column chromatography with a gradient from cyclohexane to cyclohexane/ethyl acetate 4:1. The fractions containing the product mixture were recrystallized from hot cyclohexane to yield pure methyl 5-bromo-2-formyl-3-hydroxybenzoate (54) (2.02 g, 7.8 mmol, 36%). A further separation of the mother liquor containing both isomers in approximately 1:1 ratio were purified for analytical purposes with preparative HLPC using a phenomenex Synergy Hydro RP 80 250×21.2 mm at 21 mL/min with a gradient from 10 to 83% acetonitrile/20 mM phosphate buffer pH 7.5 in 30 min.


Data for methyl 5-bromo-2-formyl-3-hydroxybenzoate (54)


Rf silica gel 60; chloroform/methanol 95:5=0.78.


mp. 106.9° C.



1H NMR (300 MHz; CDCl3): δ=ppm. 12.28 (s, 1H, OH), 10.59 (s, 1H, CHO), 7.60 (d, 1H, 4JH-H=1.9 Hz, Ar—CH-6), 7.34 (d, 1H, 4JH-H=1.9 Hz, Ar—CH-4), 3.95 (s, 3H, OCH3) ppm.



13C NMR (75 MHz; CDCl3): δ=196.9 (CHO), 165.1 (Ar—COOMe), 163.5 (Ar—C—OH), 134.4 (Ar—CH-1), 130.5 (Ar—C—Br), 125.6 (Ar—CH-6), 125.4 (Ar—CH-4), 117.3 (Ar—C—CHO), 53.1 (COOCH3) ppm.


IR (ATR): {tilde over (v)} (Trel)=3091 (w), 3068 (w), 3023 (w), 2964 (w), 1713 (s), 1681 (w), 1637 (s), 1598 (m), 1558 (m), 1470 (m), 1447 (m), 1432 (m), 1416 (w), 1397 (m), 1335 (m), 1296 (s), 1251 (s), 1203 (s), 1172 (s), 1086 (s), 1019 (s), 927 (s), 882 (m), 868 (s), 859 (s), 792 (s), 768 (s), 718 (m), 668 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=258/260 (27) [M]•+, 243/245 (100), 225/227 (28), 199/201 (37), 171/173 (13), 143/145 (10), 63 (33).


HRMS (ESI+) calc. for C9H679BrO4 [M+H]+: 256.9455. found 256.9458 amu.


Data for methyl 3-bromo-4-formyl-5-hydroxybenzoate (55)


Rf silica gel 60; chloroform/methanol 95:5=0.78.


mp. 97.6° C.



1H NMR (300 MHz; CDCl3): δ=11.88 (s, 1H, OH), 10.36 (s, 1H, CHO), 7.76 (d, 1H, 4JH-H=1.5 Hz, Ar—CH-2), 7.55 (d, 1H, 4JH-H=1.5 Hz, Ar—CH-6), 3.92 (s, 3H, OCH3) ppm.



13C NMR (75 MHz; CDCl3): δ=197.7 (CHO), 164.4 (COOMe), 163.5 (Ar—C—OH), 137.8 (Ar—C—COOMe), 127.3 (Ar—C—Br), 124.8 (Ar—CH-2), 119.8 (Ar—C—CHO), 119.3 (Ar—CH-6), 52.9 (COO—CH3) ppm.


IR (ATR): {tilde over (v)} (Trel)=3091 (w), 2961 (w), 2907 (w), 2849 (w), 1730 (s), 1654 (s), 1556 (s), 1439 (m), 1413 (m), 1387 (s), 1336 (m), 1280 (s), 1247 (s), 1200 (s), 1165 (s), 1092 (s), 1000 (s), 928 (s), 899 (m), 885 (m), 841 (m), 803 (s), 767 (s), 735 (s), 713 (s), 676 (m), 665 (m), 654 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=258/260 (100) [M]•+, 257/259 (66), 227/229 (50), 199/201 (16), 143/145 (16), 63 (37).


HRMS (ESI+) calc. for C9H679BrO4 [M+H]+: 256.9455. found 256.9458 amu.


Methyl 7-bromo-coumarin-5-carboxylate (56)



embedded image


Salicylic aldehyde (54) (1.5 g, 5.79 mmol, 1 eq.) and (carbethoxymethylen)-triphenylphosphorane (2.22 g, 6.37 mmol, 1.1 eq.) were placed in a Schlenk tube and flushed with argon three times. Then N,N-diethylaniline (30 mL) was added and the solution were refluxed for 20 min. After cooling the solution was diluted with ethyl acetate and extracted twice with 2N hydrochloric acid. After concentration the crude product was suspected to column chromatography with a gradient from cyclohexane to cyclohexane/ethyl acetate 4:1. The title compound was isolated as pale yellow powder in 89% yield.


Rf silicagel 60; dichloromethane=0.67.


mp. 157.4-159.2° C.



1H NMR (300 MHz; CDCl3): see Table 8.



13C NMR (75 MHz; CDCl3): see Table 9.


IR (ATR): {tilde over (v)} (Trel)=3073 (m), 2958 (w), 2852 (w), 1716 (s), 1579 (s), 1460 (m), 1437 (m), 1398 (m), 1281 (s), 1240 (s), 1190 (s), 1106 (s), 1020 (s), 942 (s), 883 (s), 838 (s), 775 (s), 743 (s), 671 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=282/284 (100) [M]•+, 254/256 (87), 223/225 (65), 195/197 (27), 62 (46).


HRMS (ESI+) calc. for C11H779BrO4 [M+H]+: 282.9600. found 282.9603 amu.


Methyl 7-methyl-coumarin-5-carboxylate (57)



embedded image


To a solution of bromocoumarin (56) (308 mg, 1.09 mmol, 1 eq.) and [1,1′-bis(diphenylphosphino)ferrocene]dichloropalladium complex with dichloromethane (88.8 mg, 109 μmol, 0.1 eq.) in THF (15 mL) N,N-dimethylethanolamin (22 μL, 218 μmol, 0.2 eq.) and a dimethyl zinc solution in toluene (1.8 mL, 1.2 mol/L, 2.18 mmol, 2 eq.) was added. The yellow solution was stirred for 1 h. Then additional 1 N,N-dimethylethanolamin (0.2 eq.) and dimethyl zinc solution (2 eq.) were added and the mixture were heated to 60° C. After additional 1 h at 60° C. the solution were quenched with a saturated ammonium chloride solution followed by extraction with ethyl acetate for three times. The combined organic phases were dried over sodium sulfate and concentrated in vacuum. The crude product was purified using flash chromatography on silica gel with a gradient from cyclohexane to cyclohexane/ethyl acetate 7:1. The combined fractions yielded 222.4 mg (1.02 mmol, 94%) of the title compound as a pale yellow powder.


Rf silicagel 60; dichloromethane=0.59.


mp. 144.5-144.9° C.



1H NMR (300 MHz; CDCl3): see Table 8.



13C NMR (75 MHz; CDCl3): see Table 9.


IR (ATR): {tilde over (v)} (Trel)=3415 (m), 3099 (w), 2952 (w), 2854 (w), 1712 (s), 1607 (m), 1551 (m), 1441 (m), 1393 (m), 1304 (s), 1243 (s), 1200 (s), 1134 (m), 1103 (s), 1031 (s), 998 (s), 876 (s), 830 (s), 759 (m), 714 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=218 (100) [M]•+, 190 (80), 187 (31), 159 (83), 131 (48), 77 (27).


HRMS (ESI+) calc. for C12H11O4 [M+H]+: 219.0652. found 219.0650 amu.


Methyl 7-ethyl-coumarin-5-carboxylate (58)



embedded image


See procedure of methyl 7-methyl-coumarin-5-carboxylate (56). Diethyl zinc was used instead of dimethyl zinc.


Rf silicagel 60; dichloromethane=0.70.


mp. 119.1-119.7° C.



1H NMR (300 MHz; CDCl3): see Table 8.



13C NMR (75 MHz; CDCl3): see Table 9.


IR (ATR): {tilde over (v)} (Trel)=3415 (m), 3099 (w), 2952 (w), 2854 (w), 1712 (s), 1441 (m), 1393 (m), 1304 (s), 1243 (s), 1200 (s), 1134 (m), 1103 (s), 1031 (s), 998 (s), 876 (s), 830 (s), 794 (m), 777 (m), 759 (m), 714 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=232 (87) [M]•+, 217 (13), 204 (58), 201 (24), 189 (100), 173 (27), 161 (13), 145 (39), 133 (15), 115 (37), 102 (8), 91 (14), 77 (7), 63 (12).


HRMS (ESI+) calc. for C13H13O4 [M+H]+: 233.0808. found 233.0807 amu.


Methyl 7-(vinyl)-coumarin-5-carboxylate (59)



embedded image


Bromocoumarin (56) (50 mg, 177 μmol, 1 eq.), and tetrakis(triphenylphosphine)palladium(0) (10.2 mg, 8.8 μmol, 0.05 eq.) were placed in a Schlenk tube and flushed with argon three times. Then a degassed mixture of water and dioxane (1:1, v/v, 16 mL) was added followed by 45 μL (265 μmol, 1.5 eq.) vinylboronic acid pinacol ester. The mixture was stirred for 2.5 h at 95° C. After cooling water was added. The solution was extracted trice with ethyl acetate. The combined organic phases were dried over sodium sulfate concentrated and suspected to column chromatography with a gradient from pentane to cyclohexane to cyclohexane/ethyl acetate 9:1. To yield of the title compound as white crystalline solid (29.7 mg, 127 μmol, 72%).


Rf silicagel 60; chloroform/methanol 95:5=0.9.



1H NMR (300 MHz; CDCl3): see Table 8.



13C NMR (75 MHz; CDCl3): see Table 9.


EI-MS (EI+, 70 eV): m/z=230 (86) [M]•+, 202 (70), 199 (23), 171 (92), 159 (23), 143 (42), 131 (27), 115 (100), 89 (33), 63 (26).


HRMS (ESI+) calc. for C13H10O4Na [M+Na]+: 253.0471. found 253.0568 amu.


Methyl 7-((trimethylsilyl)ethynyl)-coumarin-5-carboxylate (60)



embedded image


Bromocoumarin (56) (203 mg, 717 μmol, 1 eq.), copper(I)iodide (13.7 mg, 72 μmol, 0.1 eq.) and tetrakis(triphenylphosphine)palladium(0) (83 mg, 72 μmol, 0.1 eq.) were placed in a Schlenk tube and flushed with argon three times. Then of a degassed mixture of dithylamine and THF (16 mL, 1:1, v/v) was added followed by trimethylsilylacetylene (204 μL, 1.43 mmol, 2 eq.). The mixture was stirred overnight while refluxing. 2- and 4 hours after starting the reaction further 2 eq. of trimethylsilylacetylene were added. After cooling mixture were quenched with 1 N hydrochloric acid. The solution was extracted trice with diethyl ether. The combined organic phases were dried over sodium sulfate concentrated and suspected to column chromatography with a gradient from pentane to cyclohexane to cyclohexane/ethyl acetate 9:1. To yield the title compound as white crystalline solid (179 mg, 596 μmol, 83%).


Rf silicagel 60; chloroform/methanol 95:5=0.5.


mp. 116.5-117.3° C.



1H NMR (300 MHz; CDCl3): see Table 8.



13C NMR (75 MHz; CDCl3): see Table 9.


IR (ATR): {tilde over (v)} (Trel)=3072 (w), 2957 (w), 2899 (w), 1739 (s), 1599 (m), 1329 (m), 1306 (m), 1241 (m), 1200 (m), 1138 (m), 1110 (m), 1029 (m), 997 (m), 847 (s), 759 (m), 703 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=300 (33) [M]•+, 285 (100), 197 (14), 155 (5).


HRMS (ESI+) calc. for C16H17O4Si [M+H]+: 301.0891. found 301.0889 amu.


10-MOM-(1→2)-abeo-bromochartarin (61)



embedded image


This compound was prepared as a yellow solid in 92% yield by the reaction between (22) and (56) according to the general procedure for annulation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.95.


mp. 228° C.→brown.



1H NMR (600 MHz; CD2Cl2): see Table 10.



13C NMR (150 MHz; CD2Cl2): see Table 11.


IR (ATR) {tilde over (v)} (% T)=3182 (w), 3081 (w), 2923 (w), 2851 (w), 1739 (s), 1709 (s), 1604 (m), 1582 (m), 1500 (m), 1455 (m), 1374 (m), 1317 (s), 1284 (s), 1210 (s), 1100 (s), 1071 (s), 1008 (s), 919 (s), 876 (m), 771 (s), 714 (s), 659 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=444/442 (39) [M]•+, 414/412 (100), 398/400 (37), 397/399 (43), 369/371 (47), 348 (48), 334 (41).


HRMS (ESI−) calc. for C20H1079BrO7 [M−H]: 440.9615. found 440.9613 amu.


10-MOM-(1→2)-abeo-chartarin (62)



embedded image


This compound was prepared as a yellow solid in 84% yield by the reaction between (22) and (57) according to the general procedure for annulation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.95.


mp. 246.2° C.



1H NMR (600 MHz; CD2Cl2): see Table 10.



13C NMR (150 MHz; CD2Cl2): see Table 11.


IR (ATR): {tilde over (v)} (% T)=3229 (w), 2979 (w), 2843 (w), 1723 (s), 1621 (m), 1502 (s), 1449 (m), 1399 (s), 1371 (s), 1334 (m), 1279 (m), 1210 (s), 1153 (s), 1092 (s), 1078 (s), 1011 (s), 922 (s), 869 (m), 767 (s), 737 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=378 (6) [M]•+, 348 (11), 334 (21), 320 (100), 292 (25), 236 (27).


HRMS (ESI−) calc. for C21H13O7 [M−H]: 377.0667. found 377.0664 amu.


10-MOM-(1→2)-abeo-homochartarin (63)



embedded image


This compound was prepared as a yellow solid in 60% yield by the reaction between (22) and (58) according to the general procedure for annulation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.95.


mp. 213.6-214.5° C.



1H NMR (600 MHz; CD2Cl2): see Table 10.



13C NMR (150 MHz; CD2Cl2): see Table 11.


IR (ATR): {tilde over (v)} (% T)=3229 (w), 3056 (w), 2969 (w), 2837 (w), 1706 (s), 1610 (m), 1507 (s), 1436 (s), 1372 (m), 1277 (m), 1209 (s), 1151 (s), 1090 (s), 1013 (s), 919 (s), 876 (m), 766 (s), 737 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=392 (8) [M]•+, 362 (14), 334 (100), 320 (89), 306 (27).


HRMS (ESI−) calc. for C22H15O7 [M−H]: 391.0823. found 391.0827 amu.


10-MOM-(1→2)-abeo-((trimethylsilyl)ethynyl)-chartarin (65)



embedded image


This compound was prepared as a yellow solid in 84% yield by the reaction between (22) and (60) according to the general procedure for annulation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.95.


mp. 212-214° C.



1H NMR (600 MHz; CD2Cl2): see Table 10.



13C NMR (150 MHz; CD2Cl2): see Table 11.


IR (ATR): {tilde over (v)} (% T)=3241 (w), 2953 (w), 2839 (w), 2160 (w), 1709 (s), 1608 (m), 1507 (s), 1427 (s), 1372 (m), 1317 (m), 1241 (m), 1209 (m), 1145 (m), 1095 (s), 1011 (s), 889 (m), 847 (s), 765 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=460 (10) [M]•+, 430 (14), 348 (72), 334 (31), 333 (31), 305 (24), 305 (23), 176 (100).


HRMS (ESI−) calc. for C25H19O7Si [M−H]: 459.0906. found 459.0910 amu.


(1→2)-Abeo-bromochartarin (66)



embedded image


This compound was prepared as a yellow solid in 86% yield by the reaction of (61) according to the general procedure for MOM-deprotection as described.


Rf silicagel 60; chloroform/methanol 95:5=0.89.


mp. 350° C.→dark brown.



1H NMR (600 MHz; CD2Cl2): see Table 12.



13C NMR (150 MHz; CD2Cl2): see Table 13.


IR (ATR): {tilde over (v)} (% T)=3264 (m), 3080 (w), 1703 (s), 1606 (m), 1580 (m), 1507 (m), 1427 (m), 1413 (m), 1368 (s), 1322 (m), 1271 (m), 1220 (s), 1134 (m), 1094 (m), 976 (m), 914 (m), 881 (m), 846 (w), 765 (s), 712 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=398/400 (100) [M]•+, 370/372 (20), 314/316 (19), 207 (17), 179 (18), 150/152 (18).


HRMS (ESI−) calc. for C18H679BrO6 [M−H]: 396.9353. found 396.9365 amu.


(1→2)-Abeo-chartarin (67)



embedded image


This compound was prepared as a yellow solid in 86% yield by the reaction of (62) according to the general procedure for MOM-deprotection as described.


Rf silicagel 60; chloroform/methanol 95:5=0.95.


mp. 330° C.→brown; 339° C.→dark brown; 346-367° C.→melting.



1H NMR (600 MHz; CD2Cl2): see Table 12.



13C NMR (150 MHz; CD2Cl2): see Table 13.


IR (ATR): {tilde over (v)} (% T)=3246 (w), 3066 (w), 2915 (w), 1691 (s), 1626 (m), 1519 (m), 1453 (m), 1413 (m), 1371 (s), 1335 (s), 1276 (s), 1227 (s), 1121 (m), 1056 (m), 1029 (m), 980 (m), 945 (m), 884 (m), 768 (s), 714 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=334 (100) [M]•+, 306 (20), 278 (9), 250 (16), 165 (13).


HRMS (ESI−) calc. for C19H9O6 [M−H]: 333.0412. found 333.0405 amu.


(1→2)-Abeo-homochartarin (68)



embedded image


This compound was prepared as a yellow solid in 96% yield by the reaction of (63) according to the general procedure for MOM-deprotection as described.


Rf silicagel 60; chloroform/methanol 95:5=0.95.


mp. 306° C.



1H NMR (600 MHz; CD2Cl2): see Table 12.



13C NMR (150 MHz; CD2Cl2): see Table 13.


IR (ATR): {tilde over (v)} (% T)=3238 (m), 2968 (w), 2933 (w), 2879 (w), 1692 (s), 1618 (m), 1522 (m), 1453 (m), 1415 (m), 1373 (s), 1330 (s), 1283 (s), 1225 (s), 1135 (s), 1063 (m), 979 (m), 925 (m), 885 (m), 766 (s), 719 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=348 (100) [M]•+, 333 (38), 320 (8), 305 (17), 249 (11), 221 (6), 165 (7).


HRMS (ESI−) calc. for C20H11O7 [M−H]: 347.0561. found 347.0571 amu.


(1→2)-Abeo-ethynylchartarin (69)



embedded image


To a solution of (65) (131 mg, 283 μmol, 1 eq.) in dichloromethane (150 mL) a solution of caesium carbonate in methanol (30 mL, 10 mg/mL, 851 μmol, 3 eq.) was added. After 2 hours hydrochloric acid (100 mL, 1 N) was added. The organic phase was separated and the aqueous phase was further extracted twice with dichloro methane (100 mL) each. The combined organic phases were dried over sodium sulfate. TLC with chloroform indicates a spot at Rf=0.42 whereas the educt shows a Rf value of 0.58. Also LC-MS analysis indicates the absence of the TMS-group ([M−H]=387.0501 calc. for C22H11O7 [M−H]: 387.0501 amu). The compound was used without further purification for cleavage of the MOM-group according to the general procedure for MOM-deprotection as described. The title compound was prepared as a yellow solid in 91% yield over both steps.


Rf silicagel 60; chloroform/methanol 95:5=0.91.


mp. 240° C.→orange; 277° C.→brown; 0.397° C.→black.



1H NMR (600 MHz; CD2Cl2): see Table 12.



13C NMR (150 MHz; CD2Cl2): see Table 13.


IR (ATR): {tilde over (v)} (% T)=3513 (w), 3270 (m), 3089 (w), 2962 (w), 1749 (s), 1698 (s), 1617 (m), 1579 (m), 1514 (s), 1453 (m), 1411 (m), 1353 (s), 1317 (s), 1251 (s), 1200 (s), 1133 (s), 1095 (s), 1048 (s), 975 (m), 931 (m), 896 (m), 815 (m), 770 (s), 716 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=344 (100) [M]•+, 316 (17), 288 (7), 260 (19), 232 (9), 204 (5), 176 (11).


HRMS (ESI−) for C20H7O6 [M−H]: 343.0248. found. 343.0240 amu.


(1→2)-Abeo-chartreusin (70)



embedded image


This compound was isolated as a yellow solid by fermentation of (67) according to the general procedure for fermentation and isolation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.74.



1H NMR (600 MHz; pyridine-D5): see Table 14a.



13C NMR (150 MHz; pyridine-D5): see Table 15a.


ESI-MS (ESI−): see Table 16.


ESI-MS2 (ESI−): see Table 16.


HRMS (ESI−) calc. for C32H31O14 [M−H]: 639.1719. found 639.1737 amu.


(1→2)-Abeo-homochartreusin (71)



embedded image


This compound was isolated as a yellow solid by fermentation of (68) according to the general procedure for fermentation and isolation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.75.



1H NMR (600 MHz; pyridine-D5): see Table 14a.



13C NMR (150 MHz; pyridine-D5): see Table 15a.


ESI-MS (ESI−): see Table 16.


ESI-MS2 (ESI−): see Table 16.


HRMS (ESI−) calc. for C33H33O14 [M−H]: 653.1876 found 653.1890 amu.


(1→2)-Abeo-bromochartreusin (72)



embedded image


This compound was isolated as a yellow solid by fermentation of (66) according to the general procedure for fermentation and isolation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.70.



1H NMR (600 MHz; pyridine-D5): see Table 14b.



13C NMR (150 MHz; pyridine-D5): see Table 15b.


ESI-MS (ESI−): see Table 16.


ESI-MS2 (ESI−): see Table 16.


HRMS (ESI−) calc. for C31H2879BrO14 [M−H]: 703.0668. found 703.0691 amu.


(1→2)-Abeo-ethynylchartreusin (73)



embedded image


This compound was isolated as a yellow solid by fermentation of (69) according to the general procedure for fermentation and isolation as described.


Rf silicagel 60; chloroform/methanol 95:5=0.66.



1H NMR (600 MHz; pyridine-D5): see Table 14b.



13C NMR (150 MHz; pyridine-D5): see Table 15b.


ESI-MS (ESI−): see Table 16.


ESI-MS2 (ESI−): see Table 16.


HRMS (ESI−) calc. for C33H29O14 [M−H]:649.1963. found 649.1561 amu.


(1→2)-Abeo-vinylchartreusin (74)



embedded image


(1→2)-abeo-alkynylchartreusin (73) (4 mg, 6.15 μmol) was dissolved in 25 mL methanol. The solution was degassed in a temperature controlled ultrasonic bath at 20° C. while argon was bubbled through the solution. After 10 min of degassing a suspension of Lindlar catalyst (2 mg, Aldrich) and quinolone (17.2 μL) in methanol (600 μL) was added. Then hydrogen was passed through the suspension while temperature controlled sonication. After 2 h the suspension was passed through a 0.2 μm PTFE filter membrane. HPLC-MS analysis showed total alkinine conversion. Beside to the vinyl product the corresponding ethyl derivative (71) could be detected. The ratio was determined as 8.2:1 (HPLC, λmax=410 nm, vinyl/ethyl). The final purification was carried out using preparative HPLC yielding 2.3 mg (57%) of the desired vinyl derivative.


Rf silica gel 60; chloroform/methanol 95:5=0.64.



1H NMR (600 MHz; pyridine-D5): see Table 14b.



13C NMR (150 MHz; pyridine-D5): see Table 15b.


ESI-MS (ESI−): see Table 16.


ESI-MS2 (ESI−): see Table 16.


HRMS (ESI−) calc. for C33H31O14 [M−H]: 651.1719. found. 651.1722 amu.


Methyl 2-formyl-3,6-dihydroxybenzoate (31)



embedded image


Methyl 2-bromo-5-hydroxybenzoate (29) (500 mg, 3.29 mM, 1 eq.) and hexamethylenetetraamine (9.21 mg, 65.7 mM, 2 eq.) were placed in a 6 mL Biotage® microwave vial and treated with trifluoroacetic acid (5 mL) and sealed. The slurry was heated for 15 min in an aluminum block at 110° C. After cooling the resulting yellow liquid was poured into water and neutralized with sodium bicarbonate. The aqueous phase was extracted trice with ethyl acetate. The crude extract was dried over sodium sulfate, concentrated and subjected to column chromatography with a gradient from cyclohexane to cyclohexane/ethyl acetate 7:1. The fractions containing the product yield pure methyl 2-formyl-3,6-dihydroxybenzoate (72) (286 mg, 1.59 mmol, 48%).


Rf Silica gel 60; chloroform/methanol 95:5=0.63.


mp. 102.9-103.6° C.



1H NMR (300 MHz; CDCl3): δ=12.09 (s, 1H, OH-6), 10.56 (s, 1H, OH-3), 10.43 (s, 1H, CHO), 7.15 (d, 1H, 3JH-H=9.3 Hz, CH-5), 7.08 (d, 1H, 3JH-H=9.3 Hz, CH-4), 3.97 (s, 3H, OCH3) ppm.



13C NMR (75 MHz; CDCl3): δ=196.8 (CHO), 169.9 (COOMe), 157.7 (C-3-OH), 156.0 (C-6-OH), 128.2 (CH-5), 126.6 (CH-4), 116.2 (C-2), 109.8 (C−1), 53.1 (OCH3) ppm.


IR (ATR): {tilde over (v)} (Trel)=3083 (w), 3029 (w), 2958 (w), 2923 (w), 2852 (w), 1666 (m), 1637 (s), 1587 (m), 1443 (s), 1400 (m), 1329 (s), 1280 (s), 1194 (s), 1163 (s), 1132 (s), 1025 (m), 931 (s), 844 (s), 802 (s), 748 (s), 709 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=196 (78), 181 (17), 164 (73), 150 (17), 136 (100), 119 (16), 108 (97), 79 (11).


HRMS (ESI+) calc. for C9H7O5 [M+H]+=195.0299. found: 195.0295.


Methyl 6-hydroxy-coumarin-5-carboxylate (33)



embedded image


Methyl 2-formyl-3,6-dihydroxybenzoate (29) (100 mg, 510 μmol, 1.0 eq.) and carboxymethylphosphorane (195 mg, 561 μmol, 1.1 eq.) were placed in a Schlenk tube, flushed with argon three times and dissolved in N,N-dimethylaniline (1.6 mL) The mixture was heated while refluxing at a cooling finger for 20 min, cooled to rt, dissolved in ethyl acetate and extracted twice with 2 N hydrochloric acid, sodium bicarbonate solution and dried over sodium sulfate. The resulting solid was subjected to column chromatography with a gradient from cyclohexane to cyclohexane/ethyl acetate 7:1 yielding the title compound as pale yellow solid (93 mg, 422 μmol, 83%).


Rf Silica gel 60, chloroform/methanol 95:5=0.94


mp. 159.3-160.6° C.



1H NMR (300 MHz; CDCl3): δ=see Table 17a.



13C NMR (75 MHz; CDCl3): δ=see Table 18.


IR (ATR): {tilde over (v)} (Trel)==3117 (w), 3074 (m), 2950 (m), 2922 (m), 2852 (w), 1811 (w), 1715 (s), 1662 (s), 1563 (m), 1440 (s), 1330 (s), 1184 (s), 1123 (s), 1031 (s), 963 (m), 938 (m), 898 (s), 831 (s), 760 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=220 (43), 188 (100), 160 (55), 132 (33), 76 (15).


HRMS calc. for (ESI−) for C9H7O5 [M−H]: 195.0299. found: 195.0295.


Methyl 6-(methoxymethoxy)-coumarin-5-carboxylate (34)



embedded image


Methyl 6-hydroxy-coumarin-5-carboxylate (33) (200 mg, 0.91 mmol, 1 eq.) and Hünigs base (300 μL, 1.8 mmol, 2 eq.) were dissolved in 5 mL dichloromethane. The mixture was treated with methoxymethyl chloride (114 μL, 1.8 mmol, 2 eq.) and stirred for 2 h. The solution was treated with water (50 mL) and extracted with ethyl acetate (50 mL). The organic phase was extracted with a sodium hydroxide solution (1 mol·L−1) dried with sodium sulfate and concentrated to yield the title product as pale yellow solid (230 mg, 0.87 mmol, 96%).


Rf Silica gel 60; dichloromethane: 0.18.


mp. 126.8-127.2° C.



1H NMR (300 MHz; CDCl3): δ=see Table 17a.



13C NMR (75 MHz; CDCl3): δ=see Table 18.


IR (ATR): {tilde over (v)} (Trel)=3435 (w), 3096 (w), 3053 (w), 3000 (w), 2952 (w), 2916 (w), 2832 (w), 1718 (s), 1603 (m), 1567 (m), 1469 (m), 1422 (m), 1282 (m), 1251 (m), 1210 (s), 1154 (s), 1113 (m), 1091 (m), 1038 (s), 1002 (s), 921 (m), 891 (s), 839 (m), 820 (s), 765 (m), 694 (m), 650 (m), 604 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=264 (57), 234 (96), 203 (32), 188 (100), 175 (34), 160 (75), 132 (66), 76 (55).


HRMS calc. for (ESI+) for C11H9O5 [M+H]+: 221.0444. found: 221.0446.


Methyl 6-(methoxy)-coumarin-5-carboxylate (35)



embedded image


Methyl 6-hydroxy-coumarin-5-carboxylate (33) (264 mg, 1.20 mmol, 1 eq.) and potassium carbonate (330 mg, 2.4 mmol, 2 eq.) were suspended in 6 mL DMF and cooled to 0° C. in an ice bath. The mixture was treated with methyl iodide and stirred for 2 h while warming up to rt. The solution was treated with water (50 mL) and extracted tree times with ethyl acetate (50 mL each). The organic phase was dried over sodium sulfate and concentrated to yield the title product as pale yellow solid. (274 mg, 1.17 mmol, 98%).


Rf Silica gel 60, dichloromethane: 0.15.


mp. 161.3-161.6° C.



1H NMR (300 MHz; CDCl3): δ=see Table 17a.



13C NMR (75 MHz; CDCl3): δ=see Table 18.


IR (ATR): {tilde over (v)} (Trel)=3097 (w), 3013 (w), 2952 (w), 2917 (w), 2844 (w), 1703 (s), 1569 (m), 1464 (m), 1380 (m), 1283 (s), 1244 (s), 1188 (s), 1118 (s), 1073 (s), 1020 (s), 948 (m), 915 (m), 884 (m), 820 (s), 689 (m), 623 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=234 (100), 203 (74), 175 (71), 160 (22), 147 (14), 132 (15), 119 (14), 117 (13), 103 (7), 91 (14), 89 (15), 77 (17), 76 (17), 63 (15).


HRMS (ESI+) calc. for C12H11O5 [M+H]+: 235.0601. found 235.0597.


Methyl 6-(trifluoromethylsulfonyloxy)-coumarin-5-carboxylate (36)



embedded image


Methyl 6-hydroxy-coumarin-5-carboxylate (33) (1 g, 4.54 mmol, 1 eq.) was placed in a Schlenk tube and flushed with argon three times. Then dichloromethane (60 mL), Hünigs base (2.7 mL, 16.3 mmol, 3.6 eq.) and trifluoromethanesulfonic anhydride (0.92 mL, 5.4 mmol, 1.2 eq.) were added. The solution was stirred for 2 h at rt. Then additional trifluoromethanesulfonic anhydride (0.2 mL, 1.5 mmol, 0.3 eq.) was added. The solution was stirred for further 1 h. The solution was extracted with saturated ammonium chloride solution and dried over sodium sulfate. The crude product was filtered through a silica gel pad and recrystallized from methanol/water, yielding the title compound as pale yellow crystals (1.24 g, 3.5 mmol, 78%).


Rf Silica gel 60; dichloromethane: 0.41.


mp. 93.7-94.4° C.



1H NMR (300 MHz; CDCl3): δ=see Table 17a.



13C NMR (75 MHz; CDCl3): δ=see Table 18.


IR (ATR): {tilde over (v)} (Trel)=3435 (w), 3096 (w), 3000 (w), 2916 (w), 2832 (w), 2073 (w), 1718 (s), 1630 (w), 1567 (m), 1469 (m), 1454 (m), 1376 (w), 1326 (m), 1282 (m), 1210 (s), 1091 (m), 1038 (s), 938 (m), 839 (m), 820 (s), 784 (m), 765 (m), 743 (m), 694 (m), 650 (m), 626 (m), 604 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=352 (42), 321 (18), 219 (100), 191 (23), 188 (26), 175 (39), 160 (51), 132 (27), 119 (18), 91 (24).


HRMS calc. for (ESI+) for C12H8O7F3S [M+H]+: 352.9937. found: 352.9940.


Methyl 6-((trimethylsilyl)ethynyl)-coumarin-5-carboxylate (37)



embedded image


Methyl 6-(trifluoromethylsulfonyloxy)-coumarin-5-carboxylate (29) (500 mg, 1.42 mmol, 1 eq.), copper(I)iodide (27 mg, 142 μmol 0.1 eq.) and tetrakis(triphenylphosphine)-palladium(0) (164 mg, 142 μmol, 0.1 eq.) were placed into a Schlenk tube and flushed with argon 3 times. Then 40 mL of a degassed mixture of diethylamine and THF (1:1, v/v) was added followed by trimethylsilylacetylene (401 μL, 2.84 mmol, 2 eq.). The mixture was stirred overnight while refluxing. Two and four hours after starting the reaction further trimethylsilylacetylene (2 eq.) was added. After cooling the mixture was quenched with 1 mol·L−1 hydrochloric acid. The solution was extracted trice with diethyl ether. The combined organic phases were dried over sodium sulfate concentrated and subjected to column chromatography with a gradient from pentane to cyclohexane/ethyl acetate 9:1. The title compound was isolated as a pale yellow solid. (269.7 mg 89.8 μmol, 63%)


Rf Silica gel 60; dichloromethane: 0.25.


mp. 122.4-123.7° C.



1H NMR (300 MHz; CDCl3): δ=see Table 17a.



13C NMR (75 MHz; CDCl3): δ=see Table 18.


IR (ATR): {tilde over (v)} (Trel)=2953 (m), 2921 (m), 2851 (w), 2154 (w), 1714 (s), 1568 (m), 1463 (m), 1445 (m), 1325 (m), 1287 (m), 1248 (s), 1183 (m), 1108 (m), 1030 (m), 978 (m), 927 (m), 843 (s), 759 (s), 710 (m), 648 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=300 (23), 285 (26), 255 (100), 227 (22).


HRMS (ESI+) calc. for C16H17O4Si [M+H]+: 301.0902. found: 301.0892 amu.


10-MOM-Methoxymethylchartarin (39)



embedded image


This compound was prepared in analogy to general protocol using 22 and 34. (yellow solid, 59% yield) This compound was used without further purification or analysis.


EI-MS (EI+, 70 eV): m/z=424 (71), 394 (52), 380 (30), 364 (20), 350 (100), 348 (74), 335 (53), 321 (27), 307 (47).


HRMS (ESI−) calc. for C22H15O9 [M−H]: 423.0722. found: 423.0732.


10-MOM-Methoxychartarin (40)



embedded image


This compound was prepared in analogy to general protocol using 22 and 35. (yellow solid, 70% yield) This compound was used without further purification or analysis.


HRMS (ESI−) calc. for C21H13O8 [M−H]: 393.0616. found: 393.0627.


10-MOM-TMS-Ethynylchartarin (41)



embedded image


This compound was prepared in analogy to general protocol using 22 and 37. (yellow solid, 70% yield)


mp. 223.7-224.9° C.



1H NMR (300 MHz; CDCl3): δ=see Table 20.



13C NMR (75 MHz; CDCl3): δ=see Table 4.


IR (ATR): {tilde over (v)} (Trel)=2957 (w), 1742 (m), 1695 (m), 1594 (w), 1497 (m), 1369 (m), 1234 (s), 1146 (s), 1067 (m), 1004 (s), 924 (m), 841 (s), 766 (s), 674 (m) cm−1.


EI-MS (EI+, 70 eV): m/z=460 (50), 445 (42), 430 (47), 415 (43), 400 (37), 372 (30), 356 (100).


HRMS (ESI−) calc. for C25H19O7Si [M−H]: 459.0895. found: 495.0915 amu.


1-Hydroxychartarin (43)



embedded image


This compound was prepared in analogy to general protocol using 39. (yellow solid, quant. yield) This compound was used without further purification or analysis.


ESI-MS (ESI+): m/z=336 (100), 308 (12), 280 (15), 252 (15), 224 (8), 196 (6), 168 (9), 139 (9).


HRMS (ESI−) calc. for C18H7O7 [M−H]: 335.0186. found 335.0200.


1-Methoxychartarin (44)



embedded image


This compound was prepared in analogy to general protocol using 40. (yellow solid) This compound was used without further purification or analysis.


HRMS (ESI−) calc. for C19H9O7 [M−H]: 349.0354. found: 349.0360.


Ethynylchartarin (45)



embedded image


This compound was prepared in analogy to 69 using 41. (yellow solid, 98% yield)


mp. >410° C.



1H NMR (300 MHz; CDCl3): 5=see Table 19.



13C NMR (75 MHz; CDCl3): 5=see Table 2.


IR (ATR): {tilde over (v)} (Trel)=3460 (w), 3249 (m), 1755 (m), 1698 (s), 1584 (m), 1496 (m), 1366 (s), 1293 (m), 1232 (s), 1096 (s), 1051 (s), 946 (m), 840 (m), 771 (s), 731 (m), 672 (s) cm−1.


EI-MS (EI+, 70 eV): m/z=344 (100), 316 (26), 288 (10), 260 (20), 232 (13), 204 (8), 176 (16), 150 (9).


HRMS (ESI−) calc. for C20H7O6 [M−H]: 343.0248. found: 343.0251 amu.


Hydroxychartreusin (47)



embedded image


This compound was isolated as a yellow solid by fermentation of 43 according to the general procedure for fermentation and isolation as described.


Rf Silica gel 60; chloroform/methanol 95:5=0.2.



1H NMR (600 MHz; pyridine-D5): see Table 21.



13C NMR (150 MHz; pyridine-D5): see Table 22.


ESI-MS (ESI−): see Table 7.


ESI-MS2 (ESI−): see Table 7.


HRMS (ESI−) for C31H29O15 [M−H] 641.1512. found: 641.1542.


Methoxychartreusin (48)



embedded image


This compound was isolated as a yellow solid by fermentation of 44 according to the general procedure for fermentation and isolation as described.


Rf Silica gel 60; chloroform/methanol 95:5=0.2.



1H NMR (600 MHz; pyridine-D5): see Table 21.



13C NMR (150 MHz; pyridine-D5): see Table 22.


ESI-MS (ESI−): see Table 7.


ESI-MS2 (ESI−): see Table 7.


HRMS (ESI−) for C32H31O15 [M−H] 655.1668. found: 655.1691.


Ethynylchartreusin (49)



embedded image


This compound was isolated as a yellow solid by fermentation of 45 according to the general procedure for fermentation and isolation as described.


Rf Silica gel 60; chloroform/methanol 95:5=0.07.



1H NMR (600 MHz; pyridine-D5): see Table 21.



13C NMR (150 MHz; pyridine-D5): see Table 22.


ESI-MS (ESI−): see Table 7.


ESI-MS2 (ESI−): see Table 7.


HRMS (ESI−) for C33H29O14 [M−H] 649.1552. found: 649.1574.


Chartarin-1,10 bis-1,4′-bipiperidine-1′-carboxylate



embedded image


Chartarin (1.0 eq.) 1,4′-bipiperidine-1′-carbonyl chloride (4.0 eq.), N,N-dimethylpyridin-4-amine was placed in a Schlenk tube and flushed with argon 3 times. Then pyridin was added and the solution was stirred for 2 days at 60° C. After cooling the solvent was removed and the resulting brownish solid was dissolved in Methanol/THF. The solution was suspected to preparative HPLC using a Phenomenex Kinetix XB-C18 column with a gradient from 10 to 83% acetonitrile in water with 0.1% formic acid.


HRMS (ESI+) calc. for C43H47O8N4 [M+H]+: 723.3402. found. 723.3395 amu.


Bromchartarin-1,10 bis-1,4′-bipiperidine-1′-carboxylate



embedded image


Preparation see Chartarin-1,10 bis-1,4′-bipiperidine-1′-carboxylate


HRMS (ESI+) ber. für C40H4479BrO8N4 [M+H]+: 787, 2337, gef. 787, 2333.


Norchartarin-1,10 bis-1,4′-bipiperidine-1′-carboxylate and vinylchartarin-1,10 bis-1,4′-bipiperidine-1′-carboxylate



embedded image


1-Bromochartarin (1.0 eq.), lithium chloride (5 eq.) and dichloro(1,3-bis(diphenylphosphino) propane) palladium (0.1 eq.) were placed in a Schlenk tube, evacuated and flushed with argon for three times. Under argon counter flow dried DMF and tri-n-butyl(vinyl)tin (5 eq.) were added. The Schlenk tube was equipped with a cooling finger and stirred at 90° C. for 3 h. After cooling the solvent was removed and the resulting brownish solid was dissolved in Methanol/THF. The solution was suspected to preparative HPLC using a Phenomenex Kinetix XB-C18 column with a gradient from 10 to 83% acetonitrile in water with 0.1% formic acid. Both compounds were isolated in a ratio 1:4 as H:vinyl.


HRMS (ESI+) calc. for C40H45O8N4 [M+H]+: 709.3232. found. 709.3228 amu.


HRMS (ESI+) calc. for C42H47O8N4 [M+H]+: 735.3388. found. 735.3385 amu.


Determination of Growth Inhibition and Cytotoxicity of HUVEC, K-562 and HeLa


Compounds were assayed against human umbilical vein endothelial cells HUVEC (ATCC CRL-1730) and human chronic myeloid leukemia cells K-562 (DSM ACC 10) for their antiproliferative effects (GI50) and against human cervix carcinoma cells HeLa (DSM ACC 57) for their cytotoxic effects (CC50) as previously described (Scherlach, K., Partida-Martinez, L. P., Dahse, H. M. & Hertweck, C. Antimitotic rhizoxin derivatives from a cultured bacterial endosymbiont of the rice pathogenic fungus Rhizopus microsporus. Journal of the American Chemical Society 128, 11529-11536 (2006)).


Determination of Growth Inhibition of Hs27 in the Presence or Absence of Light


The Hs27 foreskin fibroblast cells (ATCC, CRL-1634) were grown in RPMI 1640 (CAMBREX 12-167F) supplemented with 500 μl/l gentamicin sulfate (Cambrex 17-518Z), 10% heat inactivated fetal bovine serum (PAA A15-104), at 37° C. in plastic flasks (NUNC) in a humidified atmosphere containing 5% CO2.


The adherent cells of Hs27 were harvested at the logarithmic growth phase after soft trypsinization using 0.25% trypsin in PBS containing 0.02% EDTA (Biochrom KG L2163).


Hs27 cells were seeded with 1×104 cells per 0.1 mL per well of the 96-well microplates (NUNC 167008). Then, the plates were prepared with dilutions of the compounds.


The influence of the different dilutions of compounds in the absence or presence of light (distance to the cells: 4 cm) were assayed for 72 hours at 37° C. in a humidified atmosphere containing 5% CO2. After incubation time, the effect of compounds in the absence or presence of light were analyzed in compare to negative control.


For this, the adherent Hs27 cells were fixed by glutaraldehyde (MERCK 1.04239.0250) and stained with a 0.05% solution of methylene blue (SERVA 29198) for 15 min. After gentle washing, the stain was eluted by 0.2 mL of 0.33 N HCl in the wells. The optical densities were measured at 660 nm in a microplate reader (Tecan “Sunrise”, Austria). Under the experimental conditions, the signals from the methylene blue are proportional to the number of viable cells.


Determination of Growth Inhibition of HT-29 and MEL-HO in the Presence or Absence of Light


The human HT-29 colon adenocarcinoma cells (ACC 299) and the human MEL-HO (ACC 62) melanoma cells were grown as previously described (Ueberschaar, N.; Dahse, H.-M.; Bretschneider, T.; Hertweck, C. Angew. Chem. Int. Ed. 2013, 52, 6185-6189).


Whereas the antiproliferative effect of chartreusin, (1→2)abeo vinylchartreusin, (1→2)abeo-ethynylchartreusin, and vinylchartreusin against colon adenocarcinoma cell line HT-29 is rather low in the absence of light (7.0-9.4 μM), incubation in the presence of the blue LED substantially increased the activity of (1→2) abeo vinylchartreusin (GI50 3.1 μM vs. 9.4 μM) and vinylchartreusin (GI50 0.6 μM vs. 7.1 μM). Similarly, the activity of (1→2)abeo ethynylchartreusin was 5-fold higher in the presence of light (GI50 1.7 μM vs. GI50 8.6 μM):















without light
with light


Compound
GI50 [μM]
GI50 [μM]







chartreusin
7.96
7.65


vinylchartreusin
7.05
0.61


(1→2) abeo-vinylchartreusin
9.35
3.06


(1→2) abeo-etynylchartreusin
8.61
1.69









DNA Adduct Formation


500 μL of herring sperm DNA (5 mg/mL in PBS-buffer, pH 7.5) were threaded with 20 μL (1 mg/mL in DMSO) substrate. The solution was stirred for 1 h at RT and then irradiated for 3 min with a laser (λ=405 nm, P=20 mW). Then 500 μL 6N hydrochloric acid were added and the solution was heated in a closed HPLC vial for 4 min at 100° C. The solution was freeze dried. The residue was dissolved in methanol and suspected to LC-HRMS.


UV-VIS Titration of Chartreusin and its Analogues


A 1 mg/mL solution of chartreusin or its analogs in DMSO was diluted to 1 mL with PBS-buffer (pH 7.5) to a final concentration of 50 μmol/L in a fused quartz cuvette. Then a 10 mg/mL herring sperm DNA solution (GC content≈43%, Mmiddle=649.66 g/mol) in PBS buffer was added to give the ratios substrate: DNA as 1:0, 1:0.5, 1:1, 1:2, 1:5, 1:10, 1:20, 1:30, 1:50 and 1:100. After each dilution step a UV-VIS spectrum between 300 and 500 nm was recorded.

Claims
  • 1. A compound of formula (I)
  • 2. A compound according to claim 1, wherein R2 is a hydrogen atom or a 1,4′-bipiperidine-1′carboxylate group.
  • 3. A compound according to claim 1, wherein R2 is a group of formula —X—(CH2—CH2—O)n—R5 wherein X is a bond, a —C(═O)—, —C(═O)—O— or a —C(═O)—Y—O-group, wherein Y is a group of formula (CH2)m, wherein m is an integer from 1 to 20, n is an integer of from 2 to 100, and R5 is hydrogen or an alkyl group.
  • 4. A compound according to claim 1, wherein R3 is an ethyl or a vinyl group and R4 is a hydrogen atom or wherein R4 is an ethyl or a vinyl group and R3 is a hydrogen atom.
  • 5. A compound selected from the group consisting of:
  • 6. A compound of formula (II):
  • 7. A compound according to claim 6, wherein R3 is a hydrogen atom, a halogen atom, a hydroxy group, a (C1-C8) alkoxy group, a (C2-C8) alkyl group, a (C2-C8) haloalkyl group, a (C2-C8) alkenyl group, or a (C2-C8) alkynyl group and R4 is hydrogen; or wherein R3 is hydrogen and R4 is a hydrogen atom, a halogen atom, a hydroxy group, a (C1-C8) alkoxy group, a (C2-C8) alkyl group, a (C2-C8) haloalkyl group, a (C2-C8) alkenyl group, or a (C2-C8) alkynyl group.
  • 8. A compound according to claim 6, wherein R3 is an ethyl or a vinyl group and R4 is a hydrogen atom or wherein R4 is an ethyl or a vinyl group and R3 is a hydrogen atom.
  • 9. A pharmaceutical composition comprising a compound according to claim 1, claim 5, or claim 6 or a pharmaceutically acceptable salt, solvate or hydrate thereof, optionally in combination with a pharmaceutically acceptable carrier.
  • 10. A compound according to claim 1, claim 5, or claim 6 for use in the treatment of cancer, psoriasis or bacterial infections.
  • 11. A pharmaceutical composition according to claim 9 for use in the treatment of cancer, psoriasis or bacterial infections.
Priority Claims (1)
Number Date Country Kind
12005528 Jul 2012 EP regional
PCT Information
Filing Document Filing Date Country Kind
PCT/EP2013/002257 7/30/2013 WO 00
Publishing Document Publishing Date Country Kind
WO2014/019685 2/6/2014 WO A
US Referenced Citations (1)
Number Name Date Kind
4927919 Yamada May 1990 A
Foreign Referenced Citations (2)
Number Date Country
021982 Jan 1981 EP
0516155 Dec 1992 EP
Non-Patent Literature Citations (22)
Entry
A. Jemal, et al.; “Global Cancer Statistics”: American Cancer Journal: American Cancer Society, Inc.: vol. 61, No. 2, 2011: p. 69-90.
P.G. Grothaus et al.; “Plant Natural Products in Anticancer Drug Discovery”: Current Organic Chemistry 14, Bentham Science Publishers Ltd., 2010; p. 1781-1791.
P. Kirubakaran. et al.; “In silico studies on marine actinomycetes as potential inhibitors for Glioblastoma multiforme”: Bioinformation vol. 6(3); 2011; p. 100-106.
J. Verweij et al.; “Phase II studies of Elsamitrucin in breast cancer, colorectal cancer, non-small cell lung cancer and ovarian cancer”: Annals of Oncology 5, 1994; Klwer Academic Punlishers; Netherlands; p. 375-376.
G. Asai et al.; “Pharmacokinetic and pharmacodynamic study of IST-622, a novel synthetic derivative of chartreusin, by oral administration in a phase II study of patients with breast cancer”: Cancer Chemother Pharmacol, 49, Springer-Verlag 2002; p. 468-472.
Z. Xu et al.; “Biosynthesis of the Antitumor Agent Chartreusin Involves the Oxidative Rearrangement of an Anthracyclic Polyketide”; Chemistry & Biology, vol. 12, Elsevier Ltd., 2005; p. 579-588.
D. Mal et al.; “Convergent and rapid assembly of benzonaphthopyranone cores of chartreusin, chrymutasins and hayumicins”; Tetrahedron Letters; 45, Elsevier Ltd., 2004; p. 7895-7898.
T. Harayama et al.; “Convenient Synthesis of a Simple Coumarin from Salicylaldehyde and Wittig Reagent II: Synthesis of Bromo- and Methoxycarbonylcoumarins”: Chem. Pharm. Bull. vol. 42, Pharmaceutical Society of Japan, 1994; p. 2170-2173.
T. Kieser et al.;“Practical Streptomyces Genetics”: The John Innes Foundation, Norwich, U.K., 2000.
J. Sambrook.; “Molecular Cloning”: a Laboratory Manual, 2nd ed., Cold Spring Harbor, N.Y., 1989.
M. Bierman et al.; “Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to streptomyces spp”: Gene 116, Elsevier Science Publishers B.V.,1992; p. 43-49.
K. Jakobi; “A Gene Cluster Encoding Resistomycin Biosynthesis in Streptomyces resistomycificus; Exploring Polyketide Cyclization beyond Linear and Angucyclic Patterns”: American Chemical Society 2004, 126, p. 2298-2299.
J. Vara et al.; “Cloning of Genes Governing the Deoxysugar Portion of the Erythromycin Biosynthesis Pathway in Saccharopolyspora erythraea”: Journal of Bacteriology vol. 171, No. 11, American Society for Microbiology, 1989, p. 5872-5881.
K. Raty et al.; “Cloning and characterization of Streptomyces galilaeus aclacinomycins polyketide synthase (PKS) cluster”: Gene 293, Elsevier Science B.V.; 2002, p. 115-122.
K. Scherlach et al.; “Antimitotic Rhizoxin Derivatives from a Cultured Bacterial Endosymbiont of the Rice Pathogenic Fungus Rhizopus microsporus”: Journal of the American Chemical Society 128, 2006, p. 11529-11536.
N. Ueberschaar et al.; “Rational Design of an Apoptosis-Inducing Photoreactive DNA Intercalator”: Angewandte Chemie Int. Ed., 2013, 52, Wiley-VCH Verlag GmbH & Co. KGaA 2013, p. 6185-6189.
A. Lorico et al.; “Biochemical Characterisation of Elsamicin and Other Coumarin-related Antitumour Agents as Potent Inhibitors of Human Topoisomerase II”: European Journal of Cancer, vol. 29, No. 14, Pergamon Press, Oxford, GB, 1. 1993, p. 1985-1991.
T. Tashiro et al.; “Antitumor effects of IST-622, a novel synthetic derivative of chartreusin, against murine and human tumor lines following oral administration”: Chancer Chemotherapy and Pharmacology, Springer Verlag, Berlin, vol. 34, No. 4, 1994, p. 287-292.
H. Uchida et al.; “Chrymutasins: Novel-Aglycone Antitumor Antibiotics from a Mutant of Streptomyces chartreusis. I. Taxonomy, Mutation, Fermentation Isolation and Biological Activities”: The Journal of Antibiotics, vol. 47, No. 6, 1994, p. 648-654.
M. Takai et al.; “Synthesis and Antitumor Activity of Analogues of the Antitumor Antibiotic Chartreusin”: Journal of Mecical Chemistry, vol. 23, No. 5, The American Chemical Society,1980, p. 549-553.
Ueberschaar et al. Bipiperidine conjugates as soluble sugar surrogates in DNA-intercalating antiproliferative polyketides. ChemComm. The Royal Society of Chemistry 2016. 4 pages.
Ueberschaar et al. Supplementary Material for Bipiperidine conjugates as soluble sugar surrogates in DNA-intercalating antiproliferative polyketides. ChemComm. The Royal Society of Chemistry 2016. 51 pages.
Related Publications (1)
Number Date Country
20150197539 A1 Jul 2015 US