Patent Application
20230250430
This application incorporates by reference the Sequence Listing submitted in Computer Readable Form as file P61956PC00 Sequence Listing_ST25.txt created on Jun. 15, 2021 (95,998 bytes).
The present disclosure relates to biosensors, and in particular to biosensors and methods for detecting analytes.
Given the rapid emergence of various infectious disease pandemics, point-of-care tests (POCTs) have gained significant interest due to their applicability in clinical decision making for rapid, simple, and early screening, diagnosis, and treatment monitoring.
For example, there is an urgent need to increase the COVID-19 (caused by the SARS-CoV-2 virus) testing capability around the world. However, nearly all approved molecular tests for this virus are designed to detect viral RNA using RT (reverse transcriptase) followed by either polymerase chain reaction (RT-PCR),[1] or isothermal techniques, such as loop-mediated isothermal amplification (RT-LAMP in Abbott ID NOW[2]), all of which use specific primers and RT to amplify DNA from viral RNA. These methods require substantial technical expertise and advanced equipment to perform; most are slow (requiring 1-6 h for the test alone as well as additional time for shipping samples to testing facilities with suitable biosafety containment, data analysis, and test result turn around); and several have registered a significant number of false positives and negatives.[3] Finally, none of these tests are suitable for self-testing at home or in remote locations with limited access to central testing labs.
Thus, only those patients with advanced symptoms are tested, resulting in substantial underreporting of the true case load as well significant potential for community spread by asymptomatic carriers. Undoubtedly, this low testing rate has resulted in substantial underreporting of the true case load, allowing asymptomatic carriers to further spread the virus. New test platforms are therefore needed that do not compete for the resources used in current tests, offer a shorter test time, and are simple and cost-effective to allow for self-testing, such as POCTs.
The background herein is included solely to explain the context of the disclosure. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge as of the priority date.
The present inventors disclose recognition moieties, biosensors, biosensor systems and kits for detection of a coronavirus such as SARS-CoV-2. In accordance with an aspect of the present disclosure, there is a recognition moiety comprising a catalytic nucleic acid,
wherein the recognition moiety recognizes a target nucleic acid and cleaves the target nucleic acid upon contact to produce a cleavage fragment that acts as a primer for rolling circle amplification (RCA) to generate single-stranded nucleic acid molecules; and
wherein the target nucleic acid is from SARS-CoV-2.
In some embodiments, the catalytic nucleic acid acts as a circular DNA template for performing RCA. In some embodiments, the catalytic nucleic acid comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 10-15, 17-19, 21, 22, 24, 25, 27, 28, 30, 31, 33, 34, 36, 37, 39, 40, 42, 43, 45, 46, 48, 49, 51, 63-96 and 105-295. In some embodiments, the catalytic nucleic acid comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 16, 20, 23, 26, 29, 32, 41, 72, 76, 80, 81, 86-93, 95, 96, 106-109, 111-117, 119-126, 129, 130, 131, 133, 135, 137, 139, 143, 145, 146, 148, 149, 151, 156-160, 162, 164-168, 176, 179, and 181-193. In some embodiments, the catalytic nucleic acid comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 17-19, 21, 22, 66, 80, 81, 91, 92, 96, 109, 123, 112, 114, 130, 139, 145, 151, 160, 179, 182, 203, 215, 230, 236, 249, 259, 262, 266, 268, and 284. In some embodiments, the catalytic nucleic acid comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 80. In some embodiments, the target nucleic acid has a sequence as set forth in at least one of SEQ ID NO: 1-9, 97-104, and 296-307. In some embodiments, target nucleic acid has a sequence as set forth in at least one of SEQ ID NO: 97-104, 296-300, 302, and 303. In some embodiments, the catalytic nucleic acid comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 80, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 98.
In accordance with an aspect of the present disclosure, there is also provided a biosensor for detecting a target nucleic acid comprising:
a) a recognition moiety comprising a catalytic nucleic acid;
b) a polynucleotide kinase or phosphatase; and
c) reagents for performing rolling circle amplification (RCA);
wherein the recognition moiety cleaves the target nucleic acid to produce a cleavage fragment and the polynucleotide kinase or phosphatase removes cyclic phosphate from the cleavage fragment, producing a dephosphorylated cleavage fragment that acts as a primer for RCA to generate single-stranded nucleic acid molecules.
In some embodiments, the reagents for performing RCA comprise a DNA polymerase and deoxyribonucleoside triphosphates. In some embodiments, the catalytic nucleic acid acts as a circular DNA template for performing rolling circle amplification (RCA) or the reagents for performing RCA further comprise a circular DNA template. In some embodiments, the recognition moiety comprises a nuclease. In some embodiments, the nuclease is a ribonuclease, optionally, RNase I.
In some embodiments, the reagents for performing RCA are comprised in a stabilized composition. In some embodiments, the recognition moiety is comprised in a stabilized composition. In some embodiments, the stabilized composition comprises a stabilizing matrix. In some embodiments, the stabilizing matrix comprises pullulan. In some embodiments, the biosensor further comprises lysis agents. In some embodiments, the lysis agents comprise non-denaturing detergents. In some embodiments, the biosensor further comprises a reporter moiety comprising a detectable label that generates a fluorescent, colorimetric, electrochemical, surface plasmon resonance, spectroscopic, or radioactive signal. In some embodiments, the detectable label generates a fluorescent signal.
In some embodiments, the target nucleic acid comprises RNA. In some embodiments, the target nucleic acid is from a pathogen. In some embodiments, the target nucleic acid is from a virus. In some embodiments, the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2. In some embodiments, the recognition moiety comprises nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 10-15, 17-19, 21, 22, 24, 25, 27, 28, 30, 31, 33, 34, 36, 37, 39, 40, 42, 43, 45, 46, 48, 49, 51, 63-96, and 105-295. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 16, 20, 23, 26, 29, 32, 41, 72, 76, 80, 81, 86-93, 95, 96, 106-109,111-117,119-126,129,130, 131, 133, 135, 137, 139, 143, 145, 146, 148, 149, 151, 156-160, 162, 164-168, 176, 179, and 181-193. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 17-19, 21, 22, 66, 80, 81, 91, 92, 96, 109, 123, 112, 114, 130, 139, 145, 151, 160, 179, 182, 203, 215, 230, 236, 249, 259, 262, 266, 268, and 284. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 80. In some embodiments, the target nucleic acid has a sequence as set forth in at least one of SEQ ID NO: 1-9, 97-104, and 296-307. In some embodiments, the target nucleic acid has a sequence as set forth in at least one of SEQ ID NO: 97-104, 296-300, 302, and 303. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 80, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 98.
In some embodiments, the biosensor further comprises a lateral flow device for detecting the target nucleic acid. In some embodiments, the biosensor is for use in for screening, diagnostics, and/or health monitoring.
In accordance with an aspect of the present disclosure, there is also provided a biosensor system for detecting a target nucleic acid comprising
a) a biosensor of described herein;
b) a single-stranded oligonucleotide comprising a first domain and a second domain, wherein the single-stranded oligonucleotide is sequestered by a partially complementary oligonucleotide prior to RCA;
c) a reporter moiety complementary to the first domain of the single-stranded oligonucleotide;
d) a capture probe complementary to the second domain of the single-stranded oligonucleotide; and
e) a solid support comprising the capture probe.
In some embodiments, the single-stranded oligonucleotide is partially hybridized to a second single-stranded oligonucleotide complementary to repeating segments of the single-stranded nucleic acid molecules. In some embodiments, the second single-stranded oligonucleotide preferentially hybridizes to the repeating segments of the single-stranded nucleic acid molecules. In some embodiments, the single-stranded oligonucleotide is generated by cleaving a repeating segment of the single-stranded nucleic acid molecules. In some embodiments, the single-stranded nucleic acid molecules are cleaved by a nicking enzyme. In some embodiments, the solid support comprises a lateral flow test strip.
In some embodiments, the reporter moiety is disposed on a conjugate pad on the lateral flow test strip. In some embodiments, the capture probe is immobilized on the lateral flow test strip in a visualization area. In some embodiments, the single-stranded oligonucleotide hybridizes to the reporter moiety and the capture probe upon flowing up the lateral flow test strip.
In some embodiments, the target nucleic acid comprises RNA. In some embodiments, the biosensor system further comprises an aptamer for detecting a non-nucleic acid target in a sample. In some embodiments, the detecting a non-nucleic acid target in a sample triggers RCA to generate single-stranded nucleic acid molecules. In some embodiments, the non-nucleic acid target comprises protein. In some embodiments, the non-nucleic acid target is from a pathogen. In some embodiments, the non-nucleic acid target is from a virus. In some embodiments, wherein the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2.
In some embodiments, the aptamer further comprises a nucleic acid assembly comprising a primer for RCA. In some embodiments, binding of the aptamer to the non-nucleic acid target releases the primer for RCA to generate single-stranded nucleic acid molecules. In some embodiments, the biosensor system is for use in screening, diagnostics, and/or health monitoring.
In accordance with an aspect of the present disclosure, there is also provided a method of detecting the presence of a target nucleic acid in a sample, comprising:
a) contacting a biosensor or a biosensor system described herein with the sample in a solution, allowing for production of an RCA product; and
b) detecting single-stranded nucleic acid molecules generated from RCA;
wherein detection of the single-stranded nucleic acid molecules in b) indicates presence of the target nucleic acid in the sample.
In accordance with an aspect of the present disclosure, there is also provided a method for detecting the presence of a target nucleic acid in a sample, comprising:
a) contacting the sample with a recognition moiety, wherein the recognition moiety cleaves the target nucleic acid to produce a cleavage fragment;
b) removing cyclic phosphate from the cleavage fragment with a polynucleotide kinase or phosphatase;
c) performing rolling circle amplification (RCA) on the cleavage fragment under conditions to generate single-stranded nucleic acid molecules; and detecting the single-stranded nucleic acid molecules generated in c);
wherein detection of the single-stranded nucleic acid molecules in d) indicates presence of the target nucleic acid in the sample.
In some embodiments, the method further comprises contacting the sample with lysis agents prior to contacting the sample with the recognition moiety. In some embodiments, detection of the single-stranded nucleic acid molecules is indicated by a fluorescent, colorimetric, electrochemical, surface plasmon resonance, spectroscopic, or radioactive signal. In some embodiments, detection of the single-stranded nucleic acid molecules is indicated by a fluorescent signal. In some embodiments, an increase in the fluorescence signal indicates presence of the target nucleic acid in the sample.
In some embodiments, detection of the single-stranded nucleic acid molecules comprises:
a) providing a first single-stranded oligonucleotide partially hybridized to a second single-stranded oligonucleotide prior to RCA;
b) preferentially hybridizing the second single-stranded oligonucleotide to repeating segments of the single-stranded nucleic acid molecules produced from the RCA, displacing the first single-stranded oligonucleotide;
c) hybridizing a first domain of the first single-stranded oligonucleotide to a reporter moiety, wherein the reporter moiety is disposed near a first end of lateral flow test strip;
d) flowing the reporter moiety hybridized to the first domain of the first single-stranded oligonucleotide from a first end of the lateral flow test strip towards a second end of the lateral flow test strip; and
e) hybridizing a second domain of the first single-stranded oligonucleotide to a capture probe, wherein the capture probe is immobilized on the lateral flow test strip in a visualization area.
In some embodiments, detection of the single-stranded nucleic acid molecules comprises:
a) cleaving a repeating segment of the single-stranded nucleic acid molecules to generate a single-stranded oligonucleotide;
b) hybridizing a first domain of the single-stranded oligonucleotide to a reporter moiety, wherein the reporter moiety is disposed near a first end of lateral flow test strip;
c) flowing the reporter moiety hybridized to the first domain of the single-stranded oligonucleotide from a first end of the lateral flow test strip towards a second end of the lateral flow test strip; and
d) hybridizing a second domain of the single-stranded oligonucleotide to a capture probe, wherein the capture probe is immobilized on the lateral flow test strip in a visualization area.
In accordance with an aspect of the present disclosure, there is also provided a method of detecting a viral infection in a subject comprising testing a sample from the subject for the presence of a target nucleic acid using a biosensor described herein, wherein presence of a target nucleic acid indicates that the subject has a viral infection.
In accordance with an aspect of the present disclosure, there is also provided a method of detecting a viral infection in a subject comprising testing a sample from the subject for the presence of a target nucleic acid using a biosensor system described herein, wherein presence of a target nucleic acid indicates that the subject has a viral infection.
In accordance with an aspect of the present disclosure, there is also provided is a use of a biosensor described herein to determine the presence of the target nucleic acid in the sample.
In accordance with an aspect of the present disclosure, there is also provided is a use of a biosensor system described herein to determine the presence of the target nucleic acid in the sample.
Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating embodiments of the disclosure, are given by way of illustration only and the scope of the claims should not be limited by these embodiments, but should be given the broadest interpretation consistent with the description as a whole.
Certain embodiments of the disclosure will now be described in greater detail with reference to the attached drawings in which:
Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present disclosure herein described for which they are suitable as would be understood by a person skilled in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting.
In understanding the scope of the present disclosure, the term “comprising” and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The foregoing also applies to words having similar meanings such as the terms, “including”, “having” and their derivatives. The term “consisting” and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The term “consisting essentially of”, as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and/or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and/or steps.
Terms of degree such as “substantially”, “about” and “approximately” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±5% of the modified term if this deviation would not negate the meaning of the word it modifies. The modifier “about” used in connection with a quantity is inclusive of the stated value and has the meaning dictated by the context (e.g., it includes the degree of error associated with measurement of the particular quantity). When referring to a period such as a year or annually, it includes a range from 9 months to 15 months. All ranges disclosed herein are inclusive of the endpoints and also any intermediate range points, whether explicitly stated or not, and the endpoints are independently combinable with each other.
As used in this disclosure, the singular forms “a”, “an” and “the” include plural references unless the content clearly dictates otherwise.
In embodiments comprising an “additional” or “second” component, the second component as used herein is chemically different from the other components or first component. A “third” component is different from the other, first, and second components, and further enumerated or “additional” components are similarly different.
The abbreviation, “e.g.” is derived from the Latin exempli gratia and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.” The word “or” is intended to include “and” unless the context clearly indicates otherwise.
The term “and/or” as used herein means that the listed items are present, or used, individually or in combination. In effect, this term means that “at least one of” or “one or more” of the listed items is used or present.
The term “sample” or “test sample” as used herein may refer to any material in which the presence or amount of a target analyte is unknown and can be determined in an assay. The sample may be from any source, for example, any biological (e.g. human or animal samples, including clinical samples), environmental (e.g. water, soil or air) or natural (e.g. plants) source, or from any manufactured or synthetic source (e.g. food or drinks). The sample may be comprised or is suspected of comprising one or more analytes. The sample may be a “biological sample” comprising cellular and non-cellular material, including, but not limited to, tissue samples, saliva, sputum, urine, blood, serum, other bodily fluids and/or secretions. In some embodiments, the sample comprises saliva, sputum, oropharyngeal and/or nasopharyngeal secretions. In some embodiments, the sample comprises saliva.
The term “target”, “analyte” or “target analyte” as used herein may refer to any agent, including, but not limited to, a small inorganic molecule, small organic molecule, metal ion, biomolecule, toxin, biopolymer (such as a nucleic acid, carbohydrate, lipid, peptide, protein), cell, tissue, microorganism and virus, for which one would like to sense or detect. The analyte may be either isolated from a natural source or synthetic. The analyte may be a single compound or a class of compounds, such as a class of compounds that share structural or functional features. The term analyte also includes combinations (e.g. mixtures) of compounds or agents such as, but not limited, to combinatorial libraries and samples from an organism or a natural environment.
The term “treatment or treating” as used herein may refer to an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
The term “virus” as used herein may refer to an organism of simple structure, composed of proteins and nucleic acids, and capable of reproducing only within specific living cells, using its metabolism. In some embodiments, the virus is an enveloped virus, a non-enveloped virus, a DNA virus, a single-stranded RNA virus and/or a double-stranded RNA virus. Non-limiting examples of virus include rhinovirus, myxovirus (including influenza virus), paramyxovirus, coronavirus such as SARS-CoV-2, norovirus, rotavirus, herpes simplex virus, pox virus (including variola virus), reovirus, adenovirus, enterovirus, encephalomyocarditis virus, cytomegalovirus, varicella zoster virus, rabies lyssavirus and retrovirus (including HIV).
The term “recognition moiety” as used herein may refer to a moiety comprising a molecule (e.g. compound) such as, but not limited to, a DNAzyme, aptamer, enzyme, antibody, and/or nucleic acid that is able to recognize the presence of an analyte (e.g. bind to the analyte). In some embodiments, the recognition moiety is able to recognize and cleave the analyte. In some embodiments, the recognition moiety comprises a nuclease. In some embodiments, the recognition moiety comprises a DNAzyme.
The term “reporter moiety” as used herein may refer to a moiety comprising a molecule (e.g. compound) for reporting the presence of an analyte. For example, the moiety is used for transducing the presence of an analyte recognized by the recognition moiety to a detectable signal. The reporter moiety may be a detectable label alone, or alternatively, a molecule modified with a detectable label. In some embodiments, the reporter moiety comprises a detectable label that generates a fluorescent, colorimetric, electrochemical, surface plasmon resonance (SPR) or radioactive signal. In some embodiments, the reporter moiety comprises a biopolymer modified with a detectable label. In some embodiments, the reporter moiety comprises a nucleic acid modified with a detectable label.
The term “capture probe” as used herein may refer to a probe that recognizes and binds, directly or indirectly, to a reporter moiety. In some embodiments, the capture probe is immobilized on a solid support. In some embodiments, the capture probe comprises a biopolymer. In some embodiments, the capture probe comprises a nucleic acid sequence that hybridizes to a complementary sequence.
The term “nucleic acid” as used herein may refer to a biopolymer comprising monomers of nucleotides, such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and other polynucleotides of modified nucleotides and/or nucleotide derivatives, and may be either double stranded (ds) or single stranded (ss). In some embodiments, modified nucleotides may contain one or more modified bases (e.g. unusual bases such as inosine, and functional modifications to the bases such as amino), modified backbones (e.g. peptide nucleic acid, PNA) and/or other chemically, enzymatically, or metabolically modified forms.
The term “aptamer” as used herein may refer to a short, chemically synthesized nucleic acid molecule or oligonucleotide sequence which can be generated by in vitro selection to fold into specific three-dimensional structures that bind to a specific analyte with dissociation constants, for example, in the pico- to nano-molar range. Aptamers may be single-stranded DNA, and may include RNA, modified nucleotides and/or nucleotide derivatives. Aptamers may also be naturally occurring RNA aptamers termed “riboswitches”. Functional aptamer sequences may also be rationally designed, truncated, conjugated or otherwise modified from original parent (or full length) sequences.
The term “catalytic nucleic acid”, “catalytic DNA”, “deoxyribozyme”, “DNA enzyme” or “DNAzyme” as used herein may refer to a nucleic acid molecule or oligonucleotide sequence that can catalyze or initiate a reaction. DNAzymes may be single-stranded DNA, and may include RNA, modified nucleotides and/or nucleotide derivatives. In some embodiments, the DNAzyme is “RNA-cleaving” and catalyzes the cleavage of a particular substrate, for example a nucleic acid sequence comprising one or more ribonucleotides, at a defined cleavage site. In some embodiments, the substrate is a target nucleic acid in a sample. In some embodiments, the DNAzyme cleaves a single ribonucleotide linkage. In some embodiments, the single ribonucleotide linkage is in a nucleic acid sequence wherein the remaining nucleotides are ribonucleotides. In some embodiments, the single ribonucleotide linkage is in a nucleic acid sequence wherein the remaining nucleotides are deoxyribonucleotides. In some embodiments, the DNAzyme cleaves a nucleic acid sequence at a single ribonucleotide linkage thereby producing a nucleic acid cleavage fragment.
The term “nuclease” as used herein may refer to a protein, such as an enzyme, capable of catalyzing the degradation of a nucleic acid into smaller components by cleaving the phosphodiester bonds between nucleotides of the nucleic acid. Nucleases may be an exonuclease that cleaves a nucleic acid from the ends or an endonuclease that can act on regions in the middle of a nucleic acid. Nucleases may be further subcategorized as a deoxyribonuclease that digests DNA and a ribonuclease that digests RNA.
The term “hybridizes”, “hybridized” or “hybridization” as used herein refers to the sequence specific non-covalent binding interaction with a complementary, or partially complementary, nucleic acid sequence.
The term “rolling circle amplification” or “RCA” as used herein may refer to a unidirectional nucleic acid replication that can rapidly synthesize multiple copies of circular nucleic acid molecules. In some embodiments, rolling circle amplification is an isothermal enzymatic process where a short DNA or RNA primer is amplified to form a long single stranded DNA or RNA using a circular nucleic acid template and an appropriate DNA or RNA polymerase. The product of this process is a concatemer containing ten to thousands of tandem repeats that are complementary to the circular template. A method of RCA comprises annealing a primer to a circular template where the circular template comprises a region complementary to the primer and amplifying the circular template under conditions that allow rolling circle amplification.
Rolling circle amplification conditions are known in the art. For example, rolling circle amplification occurs in the presence of a polymerase that possesses both strand displacement ability and high processivity in the presence of template, primer and nucleotides. In some embodiments, rolling circle amplification conditions comprise temperatures from about 20° C. to about 42° C., or about 22° C. to about 30° C., a reaction time sufficient for the generation of detectable amounts of amplicon and performing the reaction in a buffer. In some embodiments, the rolling circle amplification conditions comprise the presence of Phi29-, Bst-, or Vent exo-DNA polymerase. In some embodiments, the rolling circle amplification conditions comprise the presence of Phi29-DNA polymerase.
The term “sequester” as used herein may refer to a molecule such as nucleic acid that is not available for interaction until it has been released. For example, a first nucleic acid may be in a duplex formation through partial hybridization to a second nucleic acid having an incomplete complementary sequence, and in the presence of a third nucleic acid that has a stronger binding affinity to the second nucleic acid compared to the first nucleic acid, the first nucleic acid is displaced from its interaction with the second nucleic acid, thereby released from its sequestration. As a further example, a bDNA (bridging DNA) may be in a duplex formation through partial hybridization to a tDNA (toehold DNA) such that some amount of the tDNA sequence hangs off the end (i.e. the toehold). In this instance, the bDNA is sequestered. By using the toehold DNA displacement mechanism, the presence of the RCA product (RCAP), the higher complementarity of the tDNA to the RCAP causes the bDNA/tDNA duplex to dissociate, releasing the bDNA from sequestration, making it available for subsequent interactions.
Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below.
The present disclosure discloses a recognition moiety for detecting nucleic acid targets such as SARS-CoV-2 viral RNA.
Accordingly, provided herein is a recognition moiety comprising a catalytic nucleic acid,
wherein the recognition moiety recognizes a target nucleic acid and cleaves the target nucleic acid upon contact to produce a cleavage fragment that acts as a primer for rolling circle amplification (RCA) to generate single-stranded nucleic acid molecules; and
wherein the target nucleic acid is from SARS-CoV-2.
In some embodiments, the catalytic nucleic acid acts as a circular DNA template for performing RCA. In some embodiments, the catalytic nucleic acid comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 10-15, 17-19, 21, 22, 24, 25, 27, 28, 30, 31, 33, 34, 36, 37, 39, 40, 42, 43, 45, 46, 48, 49, 51, 63-96, and 105-295. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 16, 20, 23, 26, 29, 32, 41, 72, 76, 80, 81, 86-93, 95, 96, 106-109, 111-117, 119-126, 129, 130, 131, 133, 135, 137, 139, 143, 145, 146, 148, 149, 151, 156-160, 162, 164-168, 176, 179, 181-193, 215, 230, 236, 249, 259, 262, 266, 268, 277, and 284-286. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 17-19, 21, 22, 66, 80, 81, 91, 92, 96, 109, 123, 112, 114, 130, 139, 145, 151, 160, 179, 182, 203, 215, 230, 236, 249, 259, 262, 266, 268, and 284. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 80. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 92. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 109. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 123. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 130. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 139. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 151. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 179. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 182. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 215. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 249. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 259. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 262. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 266. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 268. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 284. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 112. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 114. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 81. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 91. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 160. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 145. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 230. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 236. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 203. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 96. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 19. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 66. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 22.
In some embodiments, the recognition moiety cleaves a target nucleic acid, wherein the target nucleic acid has a sequence as set forth in at least one of SEQ ID NO: 1-9, 97-104, and 296-307. In some embodiments, the target nucleic acid has a sequence as set forth in at least one of SEQ ID NO: 97-104, 296-300, 302, and 303. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 80, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 98. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 92, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 99. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 109, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 297. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 123, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 298. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 130, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 299. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 139, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 300. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 151, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 300. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 179, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 303. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 182, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 303. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 215, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 305. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 249, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 306. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 259, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 306. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 262, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 306. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 266, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 306. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 268, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 307. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 284, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 307. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 112, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 297. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 114, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 297. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 81, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 98. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 91, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 99. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 160, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 302. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 145, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 300. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 230, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 301. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 236, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 301. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 203, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 304. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 96, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 296. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 19, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 1 or 97. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 66, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 97. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 22, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 2 or 97.
The present disclosure also discloses cleavage-amplification biosensor platform for detecting nucleic acid targets, such as SARS-CoV-2 viral RNA, for use as a simple, non-reverse transcription based POCT.
Accordingly, provided herein is a biosensor for detecting a target nucleic acid comprising a recognition moiety comprising a catalytic nucleic acid, a polynucleotide kinase or phosphatase, and reagents for performing rolling circle amplification (RCA), wherein the recognition moiety cleaves the target nucleic acid to produce a cleavage fragment and the polynucleotide kinase or phosphatase removes cyclic phosphate from the cleavage fragment, producing a dephosphorylated cleavage fragment that acts as a primer for RCA to generate single-stranded nucleic acid molecules. In some embodiments, the biosensor comprises a polynucleotide kinase. In some embodiments, the biosensor comprises a polynucleotide phosphatase.
In some embodiments, the recognition moiety comprises a nuclease. In some embodiments, the recognition moiety comprises a ribonuclease. In some embodiments, the recognition moiety comprises RNase I.
In some embodiments, the reagents for performing RCA comprise a DNA polymerase and deoxyribonucleoside triphosphates. In some embodiments, the reagents for performing RCA comprise a circular DNA template. In some embodiments, the circular DNA template comprises a nucleic acid having a sequence as set forth in any one of SEQ ID NO: 10-15, 17-19, 21, 22, 24, 25, 27, 28, 30, 31, 33, 34, 36, 37, 39, 40, 42, 43, 45, 46, 48, 49, 51, 63-96 and 105-295. In some embodiments, the circular DNA template comprises a nucleic acid having a sequence as set forth in any one of SEQ ID NO: 308-342. In some embodiments, the catalytic nucleic acid is circularized. In some embodiments, the circularized catalytic nucleic acid acts as a circular DNA template for performing RCA. In some embodiments, the target nucleic acid hybridizes to the circular DNA template prior to cleavage by the nuclease.
In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 80 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 308. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 81 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 308. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 86 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 309. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 87 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 310. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 88 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 311. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 90 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 312. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 112 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 313. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 215 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 314. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 125 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 315. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 129 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 316. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 131 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 317. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 133 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 318. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 135 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 319. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 137 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 320. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 145 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 321. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 151 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 322. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 157 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 323. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 158 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 324. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 160 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 325. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 168 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 326. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 179 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 327. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 181 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 328. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 188 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 329. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 189 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 330. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 193 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 331. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 249 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 332. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 259 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 333. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 262 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 334. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 266 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 335. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 268 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 336. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 277 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 337. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 284 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 338. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 285 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 339. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 286 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 340. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 230 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 341. In some embodiments, the recognition moiety comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 236 and the circular DNA template comprises a nucleic acid having a sequence as set forth in SEQ ID NO: 342.
In some embodiments, the reagents for performing RCA are comprised in a stabilized composition. In some embodiments, the recognition moiety is comprised in a stabilized composition. In some embodiments, the stabilized composition comprises a stabilizing matrix. In some embodiments, the reagents and/or recognition moiety are encapsulated in a stabilizing matrix. In some embodiments, the stabilizing matrix is a water soluble solid polymeric matrix. In some embodiments, the water soluble solid polymeric matrix is a polysaccharide. In some embodiments, the water soluble solid polymeric matrix comprises pullulan. In some embodiments, the reagents are encapsulated with pullulan. Pullulan is a natural polysaccharide produced by the fungus Aureobasidium pullulans. It readily dissolves in water but resolidifies into films upon drying.
In some embodiments, the biosensor comprises lysis agents. In some embodiments, the lysis agents comprise non-denaturing detergents. In some embodiments, the lysis agents are comprised in a stabilized composition. In some embodiments, the lysis agents are encapsulated in a stabilizing matrix. In some embodiments, the lysis agents are encapsulated with pullulan.
In some embodiments, the biosensor comprises a sample collection device, including, but is not limited to, a vial, a test tube and a microcentrifuge tube. In some embodiments, the biosensor comprises multiple sample collection devices.
In some embodiments, the biosensor comprises a reporter moiety for detection of a signal through RCA. In some embodiments, detection of a signal through RCA indicates the presence of the target in a sample. In some embodiments, the lack of detection of a signal through RCA indicates the absence of the target in a sample. In some embodiments, detection of a signal through RCA indicates presence of single-stranded nucleic acid molecules generated from the RCA reaction. A person skilled in the art would understand that there are numerous ways to detect the presence of single-stranded nucleic acid molecules generated through RCA and includes, without limitation, fluorescent, radioactive, electrochemical, spectroscopic and colorimetric detection and/or quantification. For example, the single-stranded nucleic acid molecules generated through RCA can be labeled radioactively or detected by hybridizing with a complementary nucleic acid molecule, optionally coupled to a detectable label. In some embodiments, the reporter moiety comprises a detectable label that generates a fluorescent, colorimetric, electrochemical, surface plasmon resonance, spectroscopic, or radioactive signal. In some embodiments, the detectable label generates a fluorescent signal. In some embodiments, the detectable label is a fluorescent dye for binding nucleic acids. In some embodiments, the fluorescent dye is SYBR™ Gold, SYBR™ Green or SYBR™ Safe. In some embodiments, the detectable label is an electrochemical label, such as a redox moiety.
In some embodiments, the target nucleic acid comprises RNA. In some embodiments, the target nucleic acid is from a pathogen. In some embodiments, the target nucleic acid is from a virus. In some embodiments, the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2.
In some embodiments, the recognition moiety comprises nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 10-15, 17-19, 21, 22, 24, 25, 27, 28, 30, 31, 33, 34, 36, 37, 39, 40, 42, 43, 45, 46, 48, 49, 51, 63-96 and 105-295. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 16, 20, 23, 26, 29, 32, 41, 72, 76, 80, 81, 86-93, 95, 96, 106-109, 111-117, 119-126, 129, 130, 131, 133, 135, 137, 139, 143, 145, 146, 148, 149, 151, 156-160, 162, 164-168, 176, 179, and 181-193. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in at least one of SEQ ID NO: 17-19, 21, 22, 66, 80, 81, 91, 92, 96, 109, 123, 112, 114, 130, 139, 145, 151, 160, 179, 182, 203, 215, 230, 236, 249, 259, 262, 266, 268, and 284. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 80. In some embodiments, the target nucleic acid has a sequence as set forth in at least one of SEQ ID NO: 1-9, 97-104, and 296-307. In some embodiments, the target nucleic acid has a sequence as set forth in at least one of SEQ ID NO: 97-104 and 296-300, 302, and 303. In some embodiments, the recognition moiety comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 80, and the target nucleic acid has a sequence as set forth in SEQ ID NO: 98.
In some embodiments, the sample is a biological sample from a subject suspected of having an infection. In some embodiment, the sample is a biological sample from a subject suspected of having a viral infection. In some embodiments, the sample is a biological sample from a subject suspected of having COVID-19. In some embodiments, the biological sample is a sample of saliva, sputum and/or nasopharyngeal secretions, for example, an oropharyngeal and/or nasopharyngeal swab from the subject. In some embodiments, the biological sample is a sample of saliva from the subject.
In some embodiments, the biosensor is for use in screening, diagnostics, and/or health monitoring. In some embodiments, the biosensor is a point-of-care test.
In some embodiments, the biosensor comprises a lateral flow device for detecting the target nucleic acid.
Accordingly, also provided herein is a biosensor system for detecting a target nucleic acid comprising the biosensor as described herein, a second single-stranded oligonucleotide comprising a first domain and a second domain, wherein the single-stranded oligonucleotide is sequestered by a partially complementary oligonucleotide prior to RCA, a reporter moiety complementary to the first domain of the single-stranded oligonucleotide, a capture probe complementary to the second domain of the single-stranded oligonucleotide; and a solid support comprising the capture probe.
In some embodiments, the single-stranded oligonucleotide is partially hybridized to a second single-stranded oligonucleotide complementary to repeating segments of the single-stranded nucleic acid molecules. In some embodiments, the second single-stranded oligonucleotide preferentially hybridizes to the repeating segments of the single-stranded nucleic acid molecules.
In some embodiments, the single-stranded oligonucleotide is generated by cleaving a repeating segment of the single-stranded nucleic acid molecules. In some embodiments, the single-stranded nucleic acid molecules are cleaved by a nicking enzyme. In some embodiments, the nicking enzyme is Nb.BbvCl.
In some embodiments, the solid support comprises a lateral flow test strip. In some embodiments, the lateral flow test strip further comprises a sample pad, a conjugate pad, and an adsorption pad. In some embodiments, the sample pad is a first end of a lateral flow test strip. In some embodiments, the adsorption pad is a second end of a lateral flow test strip. In some embodiments, the reporter moiety is disposed on a conjugate pad on the lateral flow test strip. In some embodiments, the reporter moiety comprises a detectable label. In some embodiments, the detectable label is colorimetric. In some embodiments, the detectable label is a gold nanoparticle. In some embodiments, the capture probe is immobilized on the lateral flow test strip in a visualization area. In some embodiments, the single-stranded oligonucleotide hybridizes to the reporter moiety and the capture probe upon flowing up the lateral flow test strip.
In some embodiments, the solid support comprises an electrode. In some embodiments, the capture probe is immobilized on a sensing region of the electrode. In some embodiments, the single-stranded oligonucleotide hybridizes to the reporter moiety and the capture probe upon disposition on the sensing region of the electrode.
In some embodiments, the biosensor system comprises an aptamer for detecting a non-nucleic acid target in a sample. In some embodiments, detecting a non-nucleic acid target in a sample triggers RCA to generate single-stranded nucleic acid molecules. In some embodiments, the non-nucleic acid target comprises protein. In some embodiments, the non-nucleic acid target is from a pathogen. In some embodiments, the non-nucleic acid target is from a virus. In some embodiments, the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2. In some embodiments, the aptamer comprises a nucleic acid assembly comprising a primer for RCA. In some embodiments, binding of the aptamer to the non-nucleic acid target releases the primer for RCA to generate single-stranded nucleic acid molecules. In some embodiments, the single-stranded nucleic acid molecules generated through RCA initiated from aptamer binding are detected using the signal detection methods described herein.
In some embodiments, the biosensor system is for use in screening, diagnostics, and/or health monitoring. In some embodiments, the biosensor system is a point-of-care test.
The present disclosure also provides a method of detecting the presence of a target nucleic acid in a sample comprising contacting the biosensor or biosensor system as described herein with the sample in a solution, allowing for production of an RCA, detecting single-stranded nucleic acid molecules generated from RCA, wherein detection of the single-stranded nucleic acid molecules generated from RCA indicates presence of the target nucleic acid in the sample.
Accordingly, provided is a method for detecting the presence of a target nucleic acid in a sample comprising contacting the sample with a recognition moiety, wherein the recognition moiety cleaves the target nucleic acid to produce a cleavage fragment; removing cyclic phosphate from the cleavage fragment with a polynucleotide kinase or phosphatase; performing rolling circle amplification (RCA) on the cleavage fragment under conditions to generate single-stranded nucleic acid molecules; and detecting the single-stranded nucleic acid molecules generated through RCA wherein detection of the single-stranded nucleic acid molecules generated through RCA indicates presence of the target nucleic acid in the sample. In some embodiments, the method comprises removing cyclic phosphate from the cleavage fragment with a polynucleotide kinase. In some embodiments, the method comprises removing cyclic phosphate from the cleavage fragment with a polynucleotide phosphatase.
In some embodiments, the method comprises contacting the sample with lysis agents prior to contacting the sample with the recognition moiety.
In some embodiments, detection of the single-stranded nucleic acid molecules is indicated by a fluorescent, colorimetric, electrochemical, surface plasmon resonance, spectroscopic, or radioactive signal. In some embodiments, detection of the single-stranded nucleic acid molecules is indicated by a fluorescent signal. In some embodiments, an increase in the fluorescence signal indicates presence of the target nucleic acid in the sample.
In some embodiments, detection of the single-stranded nucleic acid molecules comprises providing a first single-stranded oligonucleotide partially hybridized to a second single-stranded oligonucleotide prior to RCA; preferentially hybridizing the second single-stranded oligonucleotide to repeating segments of the single-stranded nucleic acid molecules produced from the RCA, displacing the first single-stranded oligonucleotide; hybridizing a first domain of the first single-stranded oligonucleotide to a reporter moiety, wherein the reporter moiety is disposed near a first end of lateral flow test strip; flowing the reporter moiety hybridized to the first domain of the first single-stranded oligonucleotide from a first end of the lateral flow test strip towards a second end of the lateral flow test strip; and hybridizing a second domain of the first single-stranded oligonucleotide to a capture probe, wherein the capture probe is immobilized on the lateral flow test strip in a visualization area.
In some embodiments, detection of the single-stranded nucleic acid molecules comprises cleaving a repeating segment of the single-stranded nucleic acid molecules to generate a single-stranded oligonucleotide; hybridizing a first domain of the single-stranded oligonucleotide to a reporter moiety, wherein the reporter moiety is disposed near a first end of lateral flow test strip; flowing the reporter moiety hybridized to the first domain of the single-stranded oligonucleotide from a first end of the lateral flow test strip towards a second end of the lateral flow test strip; and hybridizing a second domain of the single-stranded oligonucleotide to a capture probe, wherein the capture probe is immobilized on the lateral flow test strip in a visualization area.
Provided herein is also a kit for detection of a target nucleic acid in a sample comprising the biosensor or biosensor system as described herein and/or components required for the methods as described herein, and instructions for use of the kit.
In some embodiments, the biosensor, biosensor system, kit and/or method of detection described herein can be used for detecting any suitable analyte, such as, and without being limited thereto, a wide range of small molecule, protein and nucleic acid analytes, including infection-causing pathogens in point-of-care testing for screening, diagnostics and/or health monitoring. Accordingly, provided the use of the biosensor, biosensor system and/or kit as described herein to determine the presence of an analyte in a sample.
In some embodiments, the sample is a biological sample, and the presence of the target nucleic acid in the sample is indicative of, or associated, with a disease, disorder or condition.
In some embodiments, the target nucleic acid comprises RNA. In some embodiments, the target nucleic acid is from a pathogen. In some embodiments, the target nucleic acid is from a virus. Accordingly, provided is a method of detecting a viral infection in a subject comprising testing a sample from the subject for the presence of a target nucleic acid using the biosensor, biosensor system and/or kit described herein, wherein presence of a target nucleic acid indicates that the subject has a viral infection.
In some embodiments, the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2. In some embodiment, the coronavirus causes COVID-19. In some embodiments, the biosensor, biosensor system and/or kit as disclosed herein can be used in clinical screening and diagnosis of COVID-19. Accordingly, provided herein is a method of detecting COVID-19 in a subject comprising testing a sample from the subject for the presence of SARS-CoV-2 RNA by the methods disclosed herein, wherein the presence of SARS-CoV-2 RNA indicates that the subject has COVID-19. In some embodiments, the method further comprises testing the sample for the presence of SARS-CoV-2 RNA using PCR for validation purposes.
Also provided is a use of the biosensor, biosensor system described herein to determine the presence of a target nucleic acid described herein in a sample.
In accordance with another aspect, there is provided a kit for detection of a target nucleic acid in a sample comprising the biosensor or biosensor system described herein and instructions for use.
In accordance with another aspect, there is provided a kit for detection of a target nucleic acid in a sample, wherein the kit comprises the components required for the methods described herein and instructions for use of the kit.
In accordance with another aspect, there is provided use of the biosensor described herein to determine the presence of an analyte in a sample.
In accordance with another aspect, there is provided use of the biosensor system described herein to determine the presence of an analyte in a sample.
In accordance with another aspect, there is provided use of the kit described herein to determine the presence of an analyte in a sample.
The above disclosure generally describes the present disclosure. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for the purpose of illustration and are not intended to limit the scope of the disclosure. Changes in form and substitution of equivalents are contemplated as circumstances might suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.
The following non-limiting examples are illustrative of the present disclosure:
A simple, point-of-care test (POCT) for SARS-CoV-2 that does not require RT and thermophilic DNA polymerases or the expensive equipment used in the current tests has been developed. The tests can be formatted as solution-based fluorescence assays for use with portable fluorescence readers suitable for physician's offices; as color-based lateral flow tests (similar to pregnancy tests) or as electrochemical sensors (similar to glucose meters) to allow for self-testing by untrained users. Such tests would be suitable to be performed by home users and could improve the rate of testing for priority populations such as older adults, residents of long-term care homes, and those in remote locations who do not have access to centralized testing facilities.
Key RNA sequences of the SARS-CoV-2 virus have been validated and used by, for example, government health institutes (e.g. China's CDC, Germany's Charite, Japan's National Institute of Infectious Diseases and USA's CDC) for diagnosing COVID-19 using RT-PCR assays. Therefore, to develop a simple and rapid test that avoids the need for the common reagents used for RT-PCR based tests and minimize false positives and negatives, DNAzymes sequences (see all oligonucleotide sequences in Table 1) were designed to cleave the SARS-CoV-2 viral RNA genome at positions within or near these key RNA genomic sequence regions (such as the RNA of the E, 5-UTR and N genes; Table 2). Further, DNAzymes were designed based on RNA secondary structure prediction of viral genes, targeting weakly structured regions (denoted as “dZ” series in Tables 1 and 2). A schematic overview of the DNAzyme-based POCT for detecting SARS-CoV-2 viral RNA is depicted in
The lysis and RCA reagents in Vial 1 and Vial 2, respectively, can be formed as a dry tablet formulated with pullulan,[11,12] which stabilizes enzymes and other molecules. Addition of samples to each vial, causes rehydration of the tablet allowing the entrapped enzymes and other molecules to function without having been degraded while in the dry form.
Using the dry tablet format to stabilize reaction reagents, the procedure may also be further simplified in a single vial format using, for example, tablets of different sizes or compositions to rehydrate at different rates.
Conceptual design and preparation of oligonucleotides: RNA substrates (SEQ ID NO: 1-9, 97-104 and 296-307) were designed to provide test substrates for DNAzyme analysis based on the cleavage targets of DNAzymes (Table 3). For example, RNA substrates were generated by subcloning 105 bp fragments from a vector containing a SARS-CoV-2 nucleocapsid (N) gene followed by RNA transcription with T7 RNA polymerase (Invitrogen T7 RNA Polymerase). Transcripts were dephosphorylated by alkaline phosphatase (Thermo FastAP), 5′ radiolabeled with γ32p-ATP by PNK (Thermo PNK) reaction and purified by denaturing urea PAGE. The 10-23 DNAzyme sequences were designed with binding arms targeting a specific site within the SARS-CoV-2 viral RNA genome, such that site-directed DNAzyme cleavage of the RNA generates an RNA primer for RCA as depicted in the schematic of
10-23 DNAzyme sequences designed with binding arms targeting a specific site within the SARS-CoV-2 N1 nucleocapsid gene (n1 RNA), such as GU1c, were made first for initial testing (Table 3). DNA sequences were ordered from IDT and purined by denaturing PAGE.
DNAzyme cleavage screening: 10-23 DNAzyme sequences were designed with binding arms targeting a specific site within the SARS-Cov-2 viral gene transcripts based on secondary structure prediction performed using RNAfold WebServer (http://ma.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi). Cleavage reactions were performed with 500 nM 10-23 DNAzyme and <50 nM 32P-RNA in reaction buffer (50 nM HEPES pH 7.4, 100 mM NaCl and 10 mM MgCl2). Reactions were initiated by addition of reaction buffer followed by incubation at 23° C. for 10 minutes. Reactions were quenched by addition of EDTA to 30 mM. Cleavage fragments were analyzed by resolution on 10% and/or 5% urea PAGE.
DNAzyme mediated cleavage of N1 nucleocapsid RNA: A reaction containing 100 nM 5′32P radiolabeled RNA (n1 RNA) and 500 nM n1GU1c DNAzyme was annealed by heating at 90° C. for 2 minutes and cooling at 23° C. for 5 minutes. The cleavage reaction was initiated by addition of Buffer 1 to 1× (50 nM HEPES pH 7.4, 10 mM MgCl2, 100 nM NaCl) and IOU PNK (Thermo Fisher Scientific) and incubated at 23° C. for 10 minutes or 1 hour for
Analysis of RCA product from DNAzyme cleavage reactions: For
Fluorescence detection of viral RNA cleavage fragments: DNAzyme cleavage reactions were performed as described above, with a range of n1 RNA concentrations ranging from 0-30 nM. Cleavage reactions were diluted 1:3 by supplementation with 33 nM RCA1 CDT, 1×Phi29DP buffer, 1×SYBR™ Gold nucleic acid stain (Invitrogen), 333 μM dNTP and 10 U Phi29DP (Thermo Fisher Scientific), final volume 30 μl. Reactions were incubated at 30° C. in a BioRad CFX-96 realtime thermal cycler and fluorescence measurement collected at one minute intervals for one hour. Raw fluorescence measurements were normalized and plotted using Microsoft Excel.
Cleavage by DNAzyme sequences designed for targeting the full nucleocapsid (
The GU1c DNAzyme is capable of efficiently cleaving N1 nucleocapsid RNA at a specific G-U junction (
This reaction mixture was then used to conduct RCA in Vial 2, as the RNA cleavage fragments generated by DNAzyme cleavage serve as primers to complementary circular templates for RCA (Table 4), generate a large amount of output DNA (product of the RCA reaction) for detection.
As shown in
As shown in
Digestion of n1 RNA by RNase I: The reaction was assembled by combining 10 nM 32P labelled n1 RNA (1 μL), 0.1 μM RCA1 CDT (1 μL), Phi29DP reaction buffer (1 μL), and ddH2O to a total of 9 μL. RNase I (1 μL) was then added and mixed by pipette. The reaction was incubated at 30° C. for 10 minutes. To analyze the reaction, the reaction product (10 μL) was run on a 10% urea denaturing PAGE at 35 W for 20 min.
RNase I concentration optimization: the reaction was assembled by combining 10 nM 32P labelled n1 RNA (1 μL), 0.1 μM RCA1 CDT (1 μL), Phi29DP reaction buffer (1 μL), and ddH2O up to 9 μL. Subsequently RNase I (1 μL) was added and mixed by pipette. The reaction was incubated at 30° C. for 10 minutes, then the reaction product (10 μL) was analyzed using 10% urea denaturing PAGE at 35 W for 20 min.
Optimization of circular templates for n1 RNA complementarity and RNase I activated RCA: circular sequences with various complementarity that ranged from 16 nt to 35 nt to the n1 RNA target were designed and are shown in Table 3. To examine which oligonucleotide showed the best protective effect, reactions were assembled by combining 10 nM 32P labelled n1 RNA (1 μL), 0.1 μM CDT (1 μL), Phi29DP reaction buffer (1 μL), and ddH2O to 9 μL. Subsequently, 0.005 U RNase I (1 μL) was added and mixed by pipette. The reactions were incubated at 30° C. for 10 minutes, then the reaction product (10 μL) was run on a 10% urea denaturing PAGE at 35 W for 20 min.
RCA reaction with extended circular template: the reaction was assembled by combining 0.1 μM CDT (1 μL), 0.005 U RNase I (1 μL), 10 U Phi29 (1 μL), 10 mM dNTP (1 μL), Phi29DP reaction buffer (1 μL), and ddH2O up to 9 μL. Subsequently, n1 RNA (1 μL) was added and mixed by pipette. The reactions were incubated at room temperature for 15 minutes then the reaction product (10 μL) was run on a 0.6% agarose gel stained with SYBR™ Safe at 100 W for 60 min.
RNase I activated RCA in the presence of n1 RNA: the reaction was prepared by adding 0.1 μM CDT (1 μL), 0.05 U RNase I (1 μL), 10 U Phi29DP (1 μL), 10 mM dNTP (1 μL), Phi29 reaction buffer (1 μL), and ddH2O to 9 μL. Subsequently, n1 RNA (1 μL) was added and the reaction was mixed by pipette. The reactions were incubated at room temperature for 15 minutes. Half of the reaction product was mixed with 50 nM cDNA and BamHI for single unit digestion. Finally, the reactions were analyzed by 0.6% agarose gel stained with SYBR™ Safe at 100 W for 60 min.
To begin to examine the RNase I activated RCA method, first the digestion of n1 RNA by RNase I was investigated.
The concentration of RNase I was then optimized for best performance of activated RCA reaction (
The n1 RNA digestion by RNase I is inhibited by adding complementary sequence (
As shown in
Finally, the full length of n1 RNA was examined as a primer for RNase I activated RCA assay (
Fluorescence intensity (relative fluorescence units; RFU) generated from coupled DNAzyme-RCA reactions was measured using DNAzyme sequences for targeting RNA transcripts of RdRp, 3CL, NSP1, NSP2, NSP3, NSP6, NSP8, NSP15, helicase, exonuclease and methyltransferase.
Using human pooled saliva (Innovative Research) treated with 2.5 mg/ml Proteinase K (Thermo Scientific) and heated at 90° C. for 10 minutes. Select 10-23 DNAzyme sequences were used to cleave complementary in vitro transcribed RNA substrates (50 nM DNAzyme:10 nM RNA transcript) in reactions containing 50% v/v treated human pooled saliva. RNA cleavage reactions were initiated with reaction buffer (previously described) and incubated at 23° C. for 1 hour. Cleavage reactions are diluted 1:1 with RCA reagents (10 nM circular RCA template, 250 μM dNTP, 1× SybrGold, 0.25 U/μl PNK, 0.25 U/μl phi29 DNA polymerase and 1×phi29 reaction buffer) and incubated at 23° C. for 4 hours using a Biorad CFX-96 realtime thermal cycler while monitoring fluorescence.
Detection of RCAP generated from using RNase I or DNAzyme-cleaved SARS-CoV-2 RNA as RCA primers in a lateral flow device (LFD) format can provide a rapid qualitative (yes/no) answer that is simple to read visually without specialized equipment. A lateral flow device is typically formed by lateral flow test strip with a sample pad and a conjugate pad on one end of the strip and an adsorption pad on the other. A test line providing the visualization area for a positive test result and a control line for visualizing functionality of the test may be located between the two ends of the strip. Given the simplicity of the LFD test, it should be appropriate for home use, eliminating the need for containment facilities, expensive equipment or skilled operators. This diagnostic platform device provides an unmet need for a rapid, low-cost test for COVID-19 and is applicable in low resource settings both in rural and urban settings for equitable testing.
Translation of RNA target binding and cleavage to detection on the LFD is done via RCAP facilitated release of a short DNA strand (denoted as bridging DNA or bDNA) from a bDNA/tDNA duplex (t: toehold) using the toehold DNA displacement mechanism.[13,14] Briefly, the bDNA and tDNA in the duplex are not fully hybridized (i.e. these sequences are not completely complementarity) such that some amount of the tDNA sequence hangs off the end (i.e. the toehold). In the presence of the RCAP, the higher complementarity of the tDNA to the RCAP causes the bDNA/tDNA duplex to dissociate, releasing the bDNA. A portion of the free bDNA is designed to be complementary to an oligonucleotide sequence (denoted as cDNA1) attached to a gold nanoparticle (AuNP). The other portion of the bDNA is free to bind another complementary oligonucleotide sequence (denoted as cDNA2) attached to the surface of the LFD such that bDNA binding to the cDNA2 captures the bDNA/cDNA1/AuNP complex on the LFD.
When an LFD modified with cDNA1 and cDNA2 is added to Vial 2 (already containing bDNA and tDNA) after RCA, the solution containing displaced bDNA will be flowed up the LFD (
As RCA produces many repeating units in an RCAP per input RNA molecule, the method releases many bDNA per RNA cleavage by the DNAzyme. As such, bDNA concentration increases when there is a higher level of viral RNA to bridge more cDNA1 and cDNA2, producing a darker test line on the LFD.
The toehold mechanism can also be used to develop an electrochemical sensing assay where target-dependent current is measured by a portable potentiostat reader (
This toehold-mechanism-to-LFD design allows for multiplexed assay format, where different regions of the genomic RNA are probed simultaneously to increase the test specificity.
Synthesis of gold nanoparticles (GNPs): Gold nanoparticles of ˜20 nm diameter were synthesized in 100 mL volume. First, all glassware, including two sets of a necked round-bottom flask, stirrer bar, and condenser were washed with Aqua Regia (3:1 HCl: HNO3) to remove all contaminants which can potentially lead to the aggregation of particles during synthesis or storage. Afterwards, all glasswares were washed with copious amounts of ddH2O water and dried. Next, 100 mL of 2.2 mM sodium citrate was heated at 100° C. with a heating mantle in a 250 mL two-necked round-bottomed flask for 30 min under vigorous stirring. A cleaned condenser was equipped in one neck to prevent solvent evaporation during synthesis. The second neck was closed using a rubber septum. Once boiling commenced, 668 μL of HAuCl4 (25 mM) was injected through the second neck. The color of the solution changed from yellow to dark blue and then to cherry red in 10 min. The heating at 100° C. was continued for a total of 25 min and then lowered to 90° C. for an additional 30 min. next, 668 μL of HAuCl4 (25 mM) was injected again and heated for 30 min under vigorous stirring. The addition of of HAuCl4 (25 mM) was repeated for two more rounds to produce ˜20 nm GNP (0.8 nM). The resulting suspension was analyzed using UV-Vis for their size and concentration.
Coupling of DNA with citrate capped AuNP: 600 μL of the gold nanoparticle (AuNP) suspension was taken in a glass vial. To this AuNP suspension, 20 μL (100 μM stock) of thiol-DNA (control and test DNA were coupled in separate vials) was added to the above vial followed by 380 μL water to adjust the volume up to 1.0 mL. After brief vortex, the suspension was incubated at room temperature for 24 h. 10 μL of Tris-HCl (1 M, pH.7.5) and 90 μL NaCl (1 M) were mixed in the suspension and incubated for another 24 h. 5 μL of Tris-HCl (1 M, pH.7.5) and 50 μL NaCl (1 M) were added and the reaction was incubated at room temperature for another 24 h. Finally, the AuNP suspension was centrifuged at 14000 rpm (˜21000 g) at room temperature for 20 min. The clear supernatant was discarded and the particles were re-dispersed again with 500 μL buffer (20 mM, pH 7.5, NaCl 150 mM). The washing step was repeated one more time and resuspended in 500 uL buffer (20 mM, pH 7.5, NaCl 150 mM, 250 mM sucrose) and this ready to use suspension was stored at 4° C.
Fabrication of LFD: TL-DNA (test line DNA) and CL-DNA (control line DNA) were printed on nitrocellulose paper (NCP) as follows: 5 μM of streptavidin (Millipore, Burlington, Canada) and 25 μM of each of TL- and CL-DNA were individually mixed in 200 μL of PBS (pH 7.4) and incubated at room temperature for 30 min. After incubation, the streptavidin-DNA conjugate was passed through centrifugal column (Amicon @Ultra-0.5 mL, Millipore) of 30K molecular cut off size for 10 min at 14000 g. The conjugate was washed twice with 200 μL of PBS. After washing, the concentrated streptavidin-DNA was recovered by placing the filter device upside down into a clean micro centrifuge tube and centrifugation at 1000 g for 2 min. The recovered streptavidin-DNA was diluted to a final volume of 100 μL using PBS buffer. Nitrocellulose paper (NCP, Immunopore FP grade from GE Healthcare) was cut into a 25×300 mm piece. Control and test lines (0.5 mm diameter) were printed on the NCP ˜22 mm below the top edge with 5 mm inter line distance using a Scienion sciflexarrayer s5 non-contact microarray printer. After printing, the NCP was air dried for 30 min. The printed NCP obtained in the above step was attached onto the backing card for cutting and handling. Meanwhile, the absorbent pad (Ahlstrome grade 270) was cut into 20×300 mm in size and attached on the backing cardjust above the prineted lines of NCP obtained in the above step. The assembled pieces were then cut into 4 mm diameter (wide) by CM5000 Guillotine Cutter (BioDot). Glass fiber was used as sample pad and conjugate pads both in 4×10 mm size. Before cutting the sample pad glass fibre, it was immersed in the sample pad buffer (Tris-HCl 25 mM, pH 7.5, including 300 mM NaCl, 0.1% SDS and dried for 2 hrs. In the conjugate pad glass fibre, mixture of gold conjugates (mixture of equivalent amount of both test and control) was pipetted twice and dried at room temperature before cutting. Next, the glass fibres were cut into 4×10 mm size and attached in the designated location (bottom of the LFD) with 0.5 mm overlap of each pad. This ready to use dipstick device was stored at room temperature until use.
RCA: sequences design and LFD test: Four DNA sequences were designed (Table 6): 1) a template for converting into a circle, 2) a ligation template to make the circle, 3) a toehold sequence (tDNA) and 4) a bridging sequence (bDNA). tDNA was completely complementary to a part of the RCA product while tDNA and bDNA are partially complementary to each other. In this case, if there is no RCA product tDNA and bDNA will remain as duplex and will not bind to the test AuNP-DNA and no line will be generated in the test line. If there is RCA product, the tDNA will be hybridized with the RCA product releasing the bDNA available for binding to TL-DNA and be captured in the test line generating a red line. The duplex between tDNA and bDNA was native PAGE purified so that there is no free bDNA to generate false positive results.
Preparing the DNA circle: One nanomole of circular template was phosphorylated at the 5′-end by treating with 10 U of PNK in presence of 10 mM ATP and 1×PNK buffer A for 35 min at 37 C in 100 uL volume. The reaction was quenched by heating at 90 C for 5 min. Next, an equivalent amount of the ligation template was added to the reaction mixture and heated at 90 C for 1 min. To this mixture sequentially added 30 uL PEG4000, 30 uL of 10×T4 DNA ligase buffer and 5 uL of T4 DNA ligase. The volume was adjusted to 300 uL by ddH2O. The ligation reaction was conducted at room temperature for 1 h. The circle was isolated by ethanol precipitation and purified by 10% denaturing PAGE (dPAGE), recovered from the gel using elution buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA)), dissolved in ddH2O, quantified by UV and stored at −20° C. until use.
RCA and LFD test: RCA reaction was conducted in 100 uL volume in 1×Phi29DP buffer including 10 nM each of circle and primers, 0.5 mM dNTPs, 50 nM of tDNA-bDNA duplex for 10 min at room temperature. LFD was directly dipped into this reaction mixture and allowed to flow for min before taking the photograph (strip e in
An alternative route for generating bDNA is depicted in the schematic representation of bDNA generation by DNAzyme initiated RCA coupled nicking enzyme (
The RCA-coupled nicking was tested using a CDT with nicking sites (Nick-CDT) and RCA primer (Nick-primer) as shown in Table 7. Similarly, CDTs with nicking sites. First, the ligation reaction to make circle was conducted in 30 μL reaction volume in 1× splintR ligase buffer (NEB) at 37° C. for 20 min in the presence of 33 nM of N1PdL2 (5′ phosphorylated), 1 nM of target RNA and 12 units of SplintR ligase. Next, to this reaction mixture, sequentially 1 μL of primer (1 μL stock), 5 μL 10×Phi29 buffer, 2.5 μL dNTPs (10 mM stock), 0.5 μL BSA (20 mg/mL stock), 5 units of Phi29 DNA polymerase and 5 units of Nb.BbvCI nicking enzyme were added. The reaction volume was adjusted to 50 μL with autoclaved ddH2O and the reaction as conducted at 30° C. for 30 min. Two control experiments were conducted. In the first control, ligation was conducted in the absence of RCA-primer whereas in the second control, nicking enzyme was omitted. The reaction mixtures were analyzed by denaturing PAGE. Similarly, target RNA triggered RCA-coupled nicking can be performed using CTDs complementary to target RNA, such as n1 RNA using sequences provided in Table 7.
The results showed that the RCA in the presence of nicking enzyme produced significantly higher RCA product compared to the RCA reaction that was conducted in the absence of nicking enzyme (
This DNAzyme-based LFD platform can be further multiplexed by linking with other functional nucleic acids, such as DNA aptamers[15] for the detection of specific SARS-CoV-2 protein biomarkers (e.g. S1, N and RdRP proteins). As nucleic acids, aptamers for these target proteins can be integrated with the RCA detection platform to develop an aptamer-initiated RCA assay.[16,17] Linking protein-aptamer binding to RCA can be done using a method, “digestion-initiated RCA”,[17] that makes use of the ability for Phi29DP to carry out 3′-5′ exonucleolytic degradation of single-stranded DNA, in addition to polymerization and strand displacement.[18] Briefly, it uses a tripartite DNA assembly made of a CDT, a pre-primer (PP) and an aptamer probe (AP). Their sequences are designed to allow the formation of two DNA duplexes, one involving the CDT and the 5′-end of the PP and other involving the 3′-end of the PP and the 5′-end of the AP. In the absence of the target, the formation of the two duplexes prevents RCA by Phi29DP. With the target, the AP makes a partner switch from the PP to the target. This event produces a single-stranded region in the PP, which is trimmed by Phi29DP, converting the PP into a mature primer (MP) for RCA. Detection of the RCAP generated from aptamer detection can then be designed similarly using the toehold mechanism integrated with a simple LFD readout such that a single POCT can detect both viral RNA and viral proteins simultaneously. This simple integration allows for testing of multiple different targets for increased accuracy.
The POCT systems described herein allow for the rapid detection of SARS-CoV-2 that is highly specific and sensitive both analytically and clinically, simple to use, produced with easy to obtain reagents, cost-efficient and performed at room temperature with no extraction step. This can make such POCTs available for wide-spread deployment from common to non-standard and remote testing locations, including screening at places of employment, ports of entry, or at home, to improve patient-centered care. The simplicity of a one-stop sample-to-answer test that can be used anywhere by anyone will be crucial to drive down the spread of the virus, allow more rapid contact tracing, and thus limit outbreaks at an earlier stage.
While the present disclosure has been described with reference to examples, it is to be understood that the scope of the claims should not be limited by the embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.
For the sequences in Table 1, all suffix variants (e.g. N_CDCn1_GU1_1023b to N_CDCn1_GU1_1023g) target the same dinucleotide junction on the RNA, but vary in modifications to the DNAzyme binding arms or catalytic core. “b” suffixes have corrected catalytic cores, where the original sequences had an error. “c” suffixes have 11+7 binding arms referring to the number of pairing bases 5′ and 3′ of the cleavage sites. “d” suffixes have 12+8 binding arms. “e” suffixes have 13+8 binding arms. “f” suffixes have 15+8 binding arms. “g” suffixes have 20+8 binding arms. The sequences in Table 1 with “_DNA” suffix are control DNA primers corresponding to the priming cleavage product that would be generated by a given DNAzyme candidate. These are positive control primers to test RCA templates. “dZ” prefixes are 10-23 core, and “dY” prefixes are 8-17 core. The “a” suffixes for the dZ sequence DNAzymes are 15+8 binding arms and were used for the cleavage fragment screening described herein. In particular, at least these specific variants were screened: n1GU1=#15; n1GU3=#19; n2AU6=#22; n2AU7=#25; n3AU10=#28; n3GU5=#31; S_Japan_GU1=#40; and S_Japan_AU11=#43.
CGTAA TGCGG GGTGC
GGTGT ATTCA
CGTAA TGCGG GGTGC ATTTCG
GGTGT ATTCA
CGTAA TGCGG GGTGC ATTTCG CTGAT
GGTGT ATTCA
CGTAA TGCGG GGTGC ATTTCG CTGAT
GGTGT ATTCA
CGTAA TGCGG GGTGC ATTTCG CTGAT
GGTGT ATTCA
TGTAATCAGTTCCTTTTTCTTTTGG
TCAGC
TTCAGTTCATAGGATCATCCAG
AGC
TTCAGTTCATAGGATCATCCAGAA
CCTCAGC
TCA
All publications, patents and patent disclosures are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent disclosure was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present disclosure is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.
This application claims the benefit of 35 U.S.C. § 119 based on the priority of U.S. Provisional Patent Application Nos. 63/039,518, filed Jun. 16, 2020; and 63/169,082, filed Mar. 31, 2021; each of these applications being incorporated herein in their entirety by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CA2021/050818 | 6/15/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63039518 | Jun 2020 | US | |
| 63169082 | Mar 2021 | US |
