Patent Application
20220282233
Traditional phosphoramidite chemistry synthesizes DNA from the 3′-5′ direction on a solid support microarray. Release of oligonucleotides is typically by chemical cleavage such as such as 35% NH4OH treatment for 2 hours (Kosuri, et al., Nat Methods, 11, 499-507 (2014); Cleary, et al., Nat Methods, 1, 241-248 (2004); Tian, et al., Nature, 432, 1050-1054 (2004)).
More recently enzymatic methods have been used to synthesize long oligonucleotides using modified terminal deoxynucleotidyl transferase (TdT) and modified nucleotide terminators. In this method TdT builds an oligonucleotide from an immobilized primer in the 5′-3′ direction by incorporating a specific nucleotide terminator base on the 3′ end of a tethered oligonucleotide. After washing and deprotection of the nucleotide terminator blocking group, the next nucleotide terminator is added. Cycles of incorporation by TdT, washing and deprotection synthesizes oligonucleotides on a solid support. However, these methods must efficiently remove the synthesized oligonucleotides from the solid support. Currently methods use photoactivation to release oligonucleotides from a solid support. Improved methods to release oligonucleotides from solid supports are needed to maximize yield and efficiency.
Although the number of oligonucleotides that can be produced in a pool by oligonucleotide arrays is large, their individual concentrations are very low and require an additional amplification step. PCR amplification directly on the oligonucleotide array can amplify oligonucleotides, however, efficiency may be lower than in solution PCR (Kosuri, et al. (2014) Nat Methods, 11, 499-507.). Therefore, releasing the oligonucleotides from the array could improve subsequent PCR amplification of the library.
Existing enzyme methods for releasing immobilized DNA generally have a significant preference for double stranded DNA (dsDNA) (such as, EndoV, RNase H2 and glycosylase/lyases). Moreover, it has been reported for some enzyme systems that enzyme concentrations required for cleavage significantly exceeded the single stranded (ss) oligonucleotide concentration which suggested that the enzymes would be impractical for routine use (see for example Shiraishi, et al., Nucleic Acids Res, 43, 2853-2863 (2015)). In some cleavage protocols e.g. chemical cleavage, cleavage of single stranded DNA (ssDNA) from a solid support is inefficient (for example having reaction times of 10 hours or more).
Methods are provided that, for example, include (a) combining ssDNA containing a modified nucleotide (e.g., a ssDNA with a modified nucleotide proximate to its 5′ end) with a DNA cleavage enzyme capable of cleaving the ssDNA at the modified nucleotide (e.g., to generate a first ssDNA fragment having a 3′OH and a second ssDNA fragment having the modified nucleotide); wherein the ratio of enzyme to DNA substrate is less than 1:1 molar ratio (m/m); and (b) cleaving at least 95% of the ssDNA at the modified nucleotide. In some embodiments, a method may comprise (a) combining (i) a ssDNA comprising a modified nucleotide (e.g., proximate to its 5′ end) with (ii) a DNA cleavage enzyme capable of cleaving the ssDNA at the modified nucleotide (e.g., to generate (after cleavage) a first ssDNA fragment having a 3′OH and a second ssDNA fragment comprising the modified nucleotide) wherein the ratio of enzyme to DNA substrate is less than 1:1 molar ratio and cleaving at least 95% of the ssDNA at the modified nucleotide. In some embodiments, methods provided herein may include (a) combining (i) a ssDNA (1) immobilized on a substrate and (2) comprising a modified nucleotide with (ii) a ssDNA cleaving enzyme capable of cleaving the ssDNA at the modified nucleotide (e.g., to generate (after cleavage) a first ssDNA fragment having a 3′OH and a second ssDNA fragment comprising the modified nucleotide) ; and (b) cleaving the immobilized ssDNA to release the second single stranded DNA fragment from the substrate. At least 95% (m/m) of an ssDNA comprising a modified nucleotide may be cleaved in less than 60 minutes.
A method, in some embodiments, may include one or more of the following:
Compositions are provided that include an artificial mixture of a ssDNA-cleaving archaeal endonuclease or glycosylase and a synthetic DNA substrate comprising a modified nucleotide. A composition may have one or more of the following:
The fraction of ssDNA-8oxoG (open circles) and dsDNA-8oxoG (closed circles) cleaved product was calculated, plotted and fit to an exponential rise equation (y=m1+m2*(1−exp(−m3*x)). The rate of ssDNA-8oxoG cleavage was 4.3 min−1 and dsDNA-8oxoG was 1.2 min−1.
Aspects of the present disclosure can be further understood in light of the embodiments, section headings, figures, descriptions and examples, none of which should be construed as limiting the entire scope of the present disclosure in any way. Accordingly, the claims set forth below should be construed in view of the full breadth and spirit of the disclosure.
Each of the individual embodiments described and illustrated herein has discrete components and features which can be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present teachings. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Still, certain terms are defined herein with respect to embodiments of the disclosure and for the sake of clarity and ease of reference.
Sources of commonly understood terms and symbols may include: standard treatises and texts such as Kornberg and Baker, DNA Replication, Second Edition (W. H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Singleton, et al., Dictionary of Microbiology and Molecular biology, 2d ed., John Wiley and Sons, New York (1994), and Hale & Markham, the Harper Collins Dictionary of Biology, Harper Perennial, N.Y. (1991) and the like.
As used herein and in the appended claims, the singular forms “a” and “an” include plural referents unless the context clearly dictates otherwise. For example, the term “a protein” refers to one or more proteins, i.e., a single protein and multiple proteins. It is further noted that the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements or use of a “negative” limitation.
Numeric ranges are inclusive of the numbers defining the range. All numbers should be understood to encompass the midpoint of the integer above and below the integer i.e., the number 2 encompasses 1.5-2.5. The number 2.5 encompasses 2.45-2.55 etc. When sample numerical values are provided, each alone may represent an intermediate value in a range of values and together may represent the extremes of a range unless specified.
In the context of the present disclosure, “non-naturally occurring” refers to a polynucleotide, polypeptide, carbohydrate, lipid, or composition that does not exist in nature. Such a polynucleotide, polypeptide, carbohydrate, lipid, or composition may differ from naturally occurring polynucleotides polypeptides, carbohydrates, lipids, or compositions in one or more respects. For example, a polymer (e.g., a polynucleotide, polypeptide, or carbohydrate) may differ in the kind and arrangement of the component building blocks (e.g., nucleotide sequence, amino acid sequence, or sugar molecules). A polymer may differ from a naturally occurring polymer with respect to the molecule(s) to which it is linked. For example, a “non-naturally occurring” protein may differ from naturally occurring proteins in its secondary, tertiary, or quaternary structure, by having a chemical bond (e.g., a covalent bond including a peptide bond, a phosphate bond, a disulfide bond, an ester bond, and ether bond, and others) to a polypeptide (e.g., a fusion protein), a lipid, a carbohydrate, or any other molecule. Similarly, a “non-naturally occurring” polynucleotide or nucleic acid may contain one or more other modifications (e.g., an added label or other moiety) to the 5′-end, the 3′ end, and/or between the 5′- and 3′-ends (e.g., methylation) of the nucleic acid. A “non-naturally occurring” composition may differ from naturally occurring compositions in one or more of the following respects: (a) having components that are not combined in nature, (b) having components in concentrations not found in nature, (c) omitting one or components otherwise found in naturally occurring compositions, (d) having a form not found in nature, e.g., dried, freeze dried, crystalline, aqueous, and (e) having one or more additional components beyond those found in nature (e.g., buffering agents, a detergent, a dye, a solvent or a preservative). All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
Solutions are provided to the problem of cleaving ssDNA at a targeted site where the cleaved portion or fragment released after cleavage retains a terminal modified nucleotide at the 5′ cleaved end. As illustrated in
In some embodiments, a ssDNA may comprise, in a 5′ to 3′, a 5′ end, a modified nucleotide (“X”), a barcode or priming site (e.g., a next generation sequencing (NGS) barcode or NGS priming site), a complementary capture sequence, and a 3′ end (
Benefits of achieving cleavage in this manner is that immobilized ssDNA can be released from a solid surface while retaining a tag for further manipulation. Another benefit of embodiments of the methods described herein is that the ratio of enzyme to substrate is less than 1:1. Another benefit of embodiments of the methods described herein is that ssDNA is cleaved with a significant preference over dsDNA that is a useful feature in sequencing protocols. Another benefit of embodiments of the methods described herein that the cleavage reaction requires only a single enzyme.
Another benefit of embodiments of the methods described herein is the presence of a 3′OH on the cleaved end of the ssDNA cleavage product that no longer includes the modified nucleotide. Embodiments of the methods enable more efficient cleavage of modified ssDNA from a solid support for oligonucleotide synthesis, gene assembly and nucleic acid capture and enrichment.
Embodiments of the methods of cleavage of modified ssDNA, where for example, the DNA is immobilized on a solid support include; cleavage of captured and extended ssDNA/RNA from beads; cleavage of captured and extended ssDNA/RNA from beads from single cells; cleavage of chemically synthesized oligonucleotides from solid support array; cleavage of enzymatically synthesized oligonucleotides from solid support array; cleavage of barcoded oligonucleotides from a solid support; cleavage of ssDNA: protein from a solid support; and/or cleavage of an aptamer pool from a solid support.
Examples of ssDNA cleaving enzymes with a preference for ssDNA over dsDNA, that preferably have a reaction time of less than 10 hours and preferably an effectiveness at a molar ratio of enzyme to substrate that is less than 1:1 include the following: EndoQ, for example, thermostable EndoQs such as 9° N EndoQ, Tko Endo Q; 8-Oxoguanine DNA Glycosylase (AGOG), Argonautes (see for example sequences that are illustrative members of the family (SEQ ID NO: 1-3)). In some embodiments, for example, where AGOG is the ssDNA cleaving enzyme, the modified nucleotide may be consumed in the cleavage reaction such that neither of the ssDNA fragments generated will comprise the modified nucleotide present in the substrate ssDNA.
These enzymes may be reagents that are lyophilized, purified, and/or immobilized. For ease of purification or handling, these enzymes may be fused to affinity binding proteins. The reagent enzymes may be in a storage buffer or before during or after addition to the ss oligonucleotide, in a reaction buffer.
Examples of modified nucleotides include deoxyuridine, deoxyinosine, 8-oxoguanine, apurinic site, tetrahydrofuran site, NMP, apyridimic NMP, rNMP and deoxyxanthosine, or thymine glycol. Other examples may include benzyl guanine and modifications thereof where the modification may include a label for detection or mobilization.
Examples of solid substrates for attaching ssDNA include for example, bead, arrays, plates or papers, microfluidic devices, tubes, and/or columns.
Molecular biology uses for ssDNA is continually increasing in ways that may utilize a dsDNA complement. For example, ssDNA can be used to hybridize to a nucleic acid (RNA, dsDNA, cDNA); immobilized ssDNA can be hybridized to target nucleic acids and extended to couple the sequence to a solid support rather than relying on hybridization alone for capture. SsDNA may also be used for synthesis and other applications where a single stranded complement is not required.
Examples use oligonucleotide synthesis, gene assembly and nucleic acid capture and enrichment, Next Generation Sequencing (NGS) or Sanger sequencing or by other methods such as quantitative polymerase chain reaction (qPCR) or dideoxy PCR (ddPCR). Cleaved oligos can be used for gene assembly methods (Klein, et al., Nucleic Acids Res, 44, e43 (2016)), PCR primers or other techniques.
Kits may be provided for use in the various contexts described above. For example, a kit to capture polyA mRNA on beads for reverse transcription or for nucleic acid capture and release as part or all of a sequencing workflow may include a ssDNA cleaving endonuclease (EndoQ for dU or dI, AGOG for 8-oxoG) and one or more of the following components: streptavidin beads, a capture oligonucleotide [biotin-primer(dU or dI or 8oxoG or dX)-poly(T)], reverse transcriptase, dNTPs; NEBNext® Ultra II Library Preparation Kit (New England Biolabs, Ipswich, Mass.).
The reagents in the kits may be stored as separate components in different tubes or may form a mixture as most convenient for the user and the use. Instructions are also included in the kit.
All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
The efficiency of 9° N EndoQ cleavage of uracil was determined in ssDNA or dsDNA templates (schematically depicted in
Similarly, the rate of dsDNA-dU cleavage by 9° N EndoQ was determined. Substrate dsDNA-dU was prepared by annealing a FAM-labeled ssDNA substrate (10 nM) containing a dU (ssDNA-dU: Biotin-TGGAGATTTTGATCACGGTAACCdUATCAGAATGACAACAAGCCCGAATTCACCCAGGAGG-FAM) to an unlabeled complementary template oligonucleotide (12 nM) (CCTCCTGGGTGAATTCGGGCTTGTTGTCATTCTGATAGGTTACCGTGATCAAAATCTCCA) in 1× CutSmart buffer using standard annealing protocols. Cleavage reactions (100 μl) were 10 nM dsDNA-U in 1× CutSmart buffer with 10 nM 9° N EndoQ at 65° C. Reaction aliquots (10 μl) were removed at 0, 0.25, 0.5, 1, 2, 5, 10 and 20 minutes and mixed with 10 μl 50 mM EDTA to halt the reaction. Reaction products were separated and analyzed by capillary electrophoresis. The fraction of cleaved product was calculated, plotted and fit to an exponential rise equation (y=m1+m2*(1−exp(−m3*x)) (
The efficiency of Tko EndoQ cleavage of dU was determined in ssDNA or dsDNA templates (schematically depicted in
Similarly, the rate of dsDNA-dU cleavage by Tko EndoQ was determined. Substrate dsDNA-dU was prepared by annealing a FAM-labeled ssDNA substrate (10 nM) containing a dU (ssDNA-dU: Biotin- TGGAGATTTTGATCACGGTAACCdUATCAGAATGACAACAAGCCCGAATTCACCCAGGAGG-FAM) to an unlabeled complementary template oligonucleotide (12 nM) (CCTCCTGGGTGAATTCGGGCTTGTTGTCATTCTGATAGGTTACCGTGATCAAAATCTCCA) in 1× CutSmart buffer using standard annealing protocols. Cleavage reactions (100 μl) were 10 nM dsDNA-U in 1× CutSmart buffer with 10 nM Tko EndoQ at 65° C. Reaction aliquots (10 μl) were removed at 0, 0.25, 0.5, 1, 2, 5, 10 and 20 minutes and mixed with 10 μl 50 mM EDTA to halt the reaction. Reaction products were separated and analyzed by capillary electrophoresis. The fraction of cleaved product was calculated, plotted and fit to an exponential rise equation (y=m1+m2*(1−exp(−m3*x)) (
The efficiency of 9° N EndoQ cleavage of inosine was determined in ssDNA or dsDNA templates (schematically depicted in
Similarly, the rate of dsDNA-dI cleavage by 9° N EndoQ was determined. Substrate dsDNA-dI was prepared by annealing a FAM-labeled ssDNA substrate (10 nM) containing a dI(ssDNA-dI: Biotin-TGGAGATTTTGATCACGGTAACCdIATCAGAATGACAACAAGCCCGAATTCACCCAGGAGG-FAM) to an unlabeled complementary template oligonucleotide (12 nM) (CCTCCTGGGTGAATTCGGGCTTGTTGTCATTCTGATTGGTTACCGTGATCAAAATCTCCA) in 1× CutSmart buffer using standard annealing protocols. Cleavage reactions (100 μl) were 10 nM dsDNA-dI in 1× CutSmart buffer with 10 nM 9° N EndoQ at 65° C. Reaction aliquots (10 μl) were removed at 0, 0.25, 0.5, 1, 2, 5, 10 and 20 minutes and mixed with 10 μl 50 mM EDTA to halt the reaction. Reaction products were separated and analyzed by capillary electrophoresis. The fraction of cleaved product was calculated, plotted and fit to an exponential rise equation (y=m1+m2*(1−exp(−m3*x)) (
The efficiency of Tko EndoQ cleavage of inosine was determined in ssDNA or dsDNA templates (Schematically depicted in
Similarly, the rate of dsDNA-dI cleavage by Tko EndoQ was determined. Substrate dsDNA-dI was prepared by annealing a FAM-labeled ssDNA substrate (10 nM) containing a dI(ssDNA-dI: Biotin-TGGAGATTTTGATCACGGTAACCdIATCAGAATGACAACAAGCCCGAATTCACCCAGGAGG-FAM) to an unlabeled complementary template oligonucleotide (12 nM) (CCTCCTGGGTGAATTCGGGCTTGTTGTCATTCTGATTGGTTACCGTGATCAAAATCTCCA) in 1× CutSmart buffer using standard annealing protocols. Cleavage reactions (100 μl) were 10 nM dsDNA-dI in 1× CutSmart buffer with 10 nM Tko EndoQ at 65° C. Reaction aliquots (10 μl) were removed at 0, 0.25, 0.5, 1, 2, 5, 10 and 20 minutes and mixed with 10 μl 50 mM EDTA to halt the reaction. Reaction products were separated and analyzed by capillary electrophoresis. The fraction of cleaved product was calculated, plotted and fit to an exponential rise equation (y=m1+m2*(1−exp(−m3*x)) (
The efficiency of AGOG cleavage of 8-oxoG was determined in ssDNA or dsDNA templates (Schematically depicted in
To determine the rates of glycosylase and lyase activity of AGOG on ssDNA-8oxoG or dsDNA-8oxoG, single-turnover kinetic assays were performed with AGOG in excess of the substrate. For each timepoint, a 10 μL reaction was made in 1× ThermoPol® buffer (New England Biolabs, Ipswich, Mass.) containing 20 nM of substrate ssDNA-8oxoG or dsDNA-8oxoG. To start the reaction, 100 nM AGOG (final concentration) was added. A control experiment demonstrated that the substrate was saturated with a 5-fold excess of AGOG. When measuring the base removal step of the reaction, the reactions were stopped at the appropriate time points with equal volume 0.1 N NaOH, 0.25% SDS and then neutralized with equal volume 1 M Tris-HCl pH 7.5. For measuring the rate of the total reaction, the reactions were stopped with equal volume 80% formamide, 50 mM EDTA. In all cases, the reactions were cleaned-up and analyzed using capillary electrophoresis as described above. The concentration of product was graphed as a function of time and fit to a single-exponential equation ((y=m1+m2*(1−exp(−m3*x))) to obtain the observed rate of substrate cleavage (kobs) using KaleidaGraph (Synergy Software, Reading, Penn.). The rate of AGOG cleavage of ssDNA-8oxoG was 4.3 min−1 and ssDNA-8oxoG was 1.2 min−1 (see
The efficiency of 9° N RNaseH2 cleavage of rG was determined in ssDNA or dsDNA templates (schematically depicted in
Similarly, the rate of dsDNA-rG cleavage by 9° N RNaseH2 was determined (Heider, et al., J Biol Chem, 292, 8835-8845 (2017)). The rate of dsDNA-l cleavage (m3) was 3,500 min-1 (Table 1 and
Biotin-ssDNA-dU-3′-FAM (1 μM) was attached to streptavidin magnetic beads. After washing unbound ssDNA with a wash buffer (0.5 NaCl, 20 mM TrisHCl, pH 7.5), 10 nM 9° N EndoQ or Tko EndoQ was added in 100 μl 1× CutSmart buffer and cleaved at dU to release the FAM-labeled product from the magnetic bead (Schematically depicted in
Biotin-ssDNA-dI-3′-FAM (1 μM) was attached to streptavidin magnetic beads. After washing unbound ssDNA with a wash buffer (0.5 NaCl, 20 mM TrisHCl, pH 7.5), 10 nM 9° N EndoQ was added in 100 μl 1× CutSmart buffer and cleaved at uracil to release the FAM-labeled product from the magnetic bead (Schematically depicted in
Biotin-ssDNA-dU-3′-FAM (1 μM) was attached to streptavidin magnetic beads and washed (5 times) to remove unbound ssDNA with a wash buffer (0.5 NaCl, 20 mM TrisHCl, pH 7.5). A 50 μl reaction with 200 nM ssDNA-dU-beads, 1× CutSmart buffer and various amounts (100 nM to 3.16 nM) of 9° N EndoQ was incubated at 65° C. for 20 minutes. The ratio of EndoQ to ssDNA-dU was 1:1, 1:2, 1:4, 1:8, 1:16, 1:32, 1:64 and 1:128. EndoQ cleaved at uracil to release the FAM-labeled product from the magnetic bead (schematically depicted in
Biotin-ssDNA-dU-3′-FAM was attached to a streptavidin coated polystyrene plate (Thermo Nunc Immobilizer Streptavidin C8) by incubating 0.5 μM Biotin-ssDNA-dU-3′-FAM in 100 μl wash buffer (0.5 NaCl, 20 mM TrisHCl, pH 7.5) for 30 minutes at 25° C. Unbound ssDNA was washed off with a wash buffer (0.5 NaCl, 20 mM TrisHCl, pH 7.5). 9° N EndoQ or Tko EndoQ (10 nM) was added in 1× CutSmart Buffer to cleaved at dU to release the FAM-labeled product from the plate (schematically depicted in
Biotin-ssDNA-dI-3′-FAM was attached to a streptavidin coated polystyrene plate (Thermo Nunc Immobilizer Streptavidin C8) by incubating 0.5 μM Biotin-ssDNA-dI-3′-FAM in 100 μl wash buffer (0.5 NaCl, 20 mM TrisHCl, pH 7.5) for 30 minutes at 25° C. Unbound ssDNA was washed off with a wash buffer (0.5 NaCl, 20 mM TrisHCl, pH 7.5). 9° N EndoQ or Tko EndoQ (10 nM) was added in 1× CutSmart Buffer to cleaved at dI to release the FAM-labeled product from the plate (Schematically depicted in
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2020/047504 | 8/21/2020 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62890291 | Aug 2019 | US |
