The invention relates to a resistance gene isolated from S. chacoense. Moreover, the invention relates to the use of said resistance gene, for example to clone functional homologues, and the use of said resistance gene(s) in a method to increase or confer at least partial resistance to an oomycete infection in a plant. More in specific the invention provides a resistance gene that is capable of increasing or conferring at least partial resistance to Phytophthora sp. (for example Phytophthora infestans) through genetic engineering techniques or through marker assisted breeding techniques
Late blight, caused by the oomycete Phytophthora infestans, is one of the most serious diseases in worldwide potato production. It was responsible for the Irish potato famine of the mid-19th century, resulting in the death of one million people. Although a lot of effort has been invested in controlling the pathogen, chemical control of P. infestans is still the main crop management strategy, but environmental safety is becoming more important and the pathogen is sometimes able to evolve resistance to the fungicide treatment. Therefore, introduction of resistance into modern potato varieties is the most durable strategy to control the disease.
In the last century, Solanum demissum, which is a hexaploid Mexican species, was extensively used in breeding for late-blight resistance in potato. Initially, a series of 11 R genes derived from S. demissum was described. Of these, R1, R2, R3a/b, R6, and R7 have been localized on the genetic maps of potato (Solanum tuberosum). However, these R genes confer pathovar-specific resistance and those that were introgressed into potato varieties, mainly R1, R2, R3, R4, and R10, were quickly overcome by the pathogen. Hence, new sources for resistance are required, and currently, several other wild Solanum species have been reported as being potential sources of resistance, many of which have been genetically characterized (Table 6).
Recent efforts to identify late blight resistance have focused on major R genes conferring broad-spectrum resistance derived from diverse wild Solanum species. Beside S. demissum, other wild Solanum species such as S. acaule, S. chacoense, S. berthaultii, S. brevidens, S. bulbocastanum, S. microdontum, S. sparsipilum, S. spegazzinii, S., stoloniferum, S. sucrense, S. toralapanum, S. vernei and S. verrucosum have been reported as new sources for resistance to late blight (reviewed by (Jansky, 2000)).
S. chacoense, is a self-incompatible diploid species from South America, and is thought to be a source for late-blight resistance. A recent taxonomic rearrangement of the section Petota revealed its relationship with species like S. berthaultii and S. tarijense. Several accessions of S. chacoense (CHC543-1), S. berthaultii (BER481-3, BER94-2031) and S. tarijense (TAR852-5) have been tested in detached leaf assays (DLA) with multiple isolates (Table 5) and in repeated field trials with isolate IPO-C. In all tests CHC543-5, BER94-2031, BER481-3 and TAR852-2 remained unaffected, underscoring the relevance of the expressed R genes for resistance breeding.
Molecular cloning of the genes responsible for resistance and subsequent introduction of the genes into potato varieties is a third method that circumvents many of the problems encountered in the previous two strategies.
To date, multiple late blight R-genes have been cloned, like the allelic genes RB and Rpi-blb1 on chromosome 8 and Rpi-blb2 on chromosome 6 (Table 6). Recently, also an Rpi-blb3 resistance gene has been isolated (WO 2008/091153). Although the initial results obtained with RB and Rpi-blb1, -2 and -3 are promising, there is a further need for additional R-genes.
The invention now relates to a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection comprising providing a plant or a part thereof with a nucleic acid encoding the amino acid sequence Rpi-chc1 of
The invention further comprises a method for breeding an oomycete, preferably a Phytopthora resistant tetraploid plant, comprising
a. increasing the ploidy level of the gametes of a diploid plant that already contains a nucleic acid sequence as defined above;
b. using said gametes in a cross with gametes of a tetraploid plant; and
c. selecting the offspring of said cross for the presence of said nucleic acid sequence. Preferably in such a method the diploid plant of step a) is plant from the genus S. chocaense, S. berthaultii, S. sucrense, or S. tarijense.
The invention also relates to a method for selecting a plant or plant material or progeny thereof for its susceptibility or resistance to an oomycete infection, said method comprising the steps of testing at least part of said plant or plant material or progeny thereof for the presence or absence of a nucleic acid as defined above. Specifically in such a method the testing involves detecting the presence of one or more of the markers of Table 2 and 8 and it is performed with a primer or a probe that specifically binds to said nucleic acid.
Hence, the invention also relates to a marker for marker assisted selection in plant breeding to obtain resistance against oomycetes, wherein said marker is chosen from the markers presented in Table 2 and 8.
In another embodiment, the invention also relates to an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the amino acid sequence Rpi-chc1 of
The invention further relates to a transgenic or tetraploid cell comprising a nucleic acid according to the invention.
Also part of the invention is a vector comprising a nucleic acid sequence according to the invention. Preferably said vector further comprises the promoter and/or terminator to which the gene is naturally associated, more preferably a truncated promoter having less than 1000 nucleotides upstream of the gene sequence.
The invention also is related to a transgenic or tetraploid host cell comprising a nucleic acid according to the invention or a vector according to the invention, preferably wherein such a host cell is an Agrobacterium cell or a plant cell. The invention also relates to a transgenic or tetraploid plant cell comprising a nucleic acid according to the invention or a vector according to the invention, preferably wherein said plant cell is a cell from a Solanaceae, more preferably Solanum tuberosum, more preferably a tetraploid Solanum tuberosum. In a further embodiment the invention comprises a transgenic or tetraploid plant comprising such a cell and also a part derived from such a plant, preferably wherein said part is a tuber.
Also comprised in the current invention is a protein encoded by an isolated or recombinant nucleic acid according to the invention or a functional fragment thereof, preferably wherein said protein has the amino acid sequence of Rpi-chc1 as depicted in
The invention also relates to an antibody that (specifically) binds to the protein of claim 20.
Two tiling paths consisting of 3 and 4 overlapping BACs from RH89-039-16 (RH106G038, RH137D014, RH009D021 and RH122B15, RH77O23, RH04G12, RH199E15) and two overlapping BACs from CHC543-5 were sequenced and annotated. Positions of markers and BAC end sequences from overlapping BACs are indicated by arrow heads. Positions of sequence contigs are indicated by horizontal arrows. Positions of genes, as predicted by the FGENESH algorithm, are indicated by colored boxes. Protein sequence homology, as found by BlastP search against the NR database is indicated by vertical arrows. RGAs are numbered by underlined figures and their gene structure are numbered correspondingly
A: RH106G03, B: RH137D14, C: RH97D21, D: RH122B15, E: RH77023, F: CHC B1 (B07-1-05), G: CHC B2 (2-D06—3-D21).
The protein with unknown function, ABF81421, is encoded by a gene from Populus trichocarpa.
The N-terminal CC-domain comprises amino acids 1-231. The amino acids depicted in shading are predicted to fold into a coiled structure using the “COIL” algorithm with window size 14. The central domain NB-ARC domain comprises amino acids 232-557. Domains in shading show similarity to the previously described Kinase 1a, Kinase 2, kinase 3a, GLPL, RNBS-D and MHD domains, respectively. The C-terminal LRR-domain consists of 29 imperfect leucine rich repeats. Conserved hydrophobic amino acids (A, V, L, and F) herein are marked by shading. The consensus is shown at the bottom.
The UHD maps of the SH and RH chromosomes are shown on left (van Os et al., 2006). 06-882 and 7677, as produced in this study, are shown in the middle. The positions of Rpi-ber (Rauscher et al., 2006), Rpi-ber1 and Rpi-ber2 (Park et al., 2008) are shown on the right. Red lines indicate the location of Rpi-chc1 related sequences. Green lines indicate the location of late blight resistance genes.
The Rpi-chc1 ORF was cloned in between one of four promoter/terminator sequences; its own 3 kb promotor and 0.5 kb terminator (p-chc1-long), 0.9 kb of its own promotor and 0.5 kb terminator (p-chc1-short), the double 35S promoter in pMDC32 or the Rpi-blb3 promotor/terminator combination (Lokossou et al., 2009). Co-agro-infiltration with PEX-RD12 was performed at five serial dilutions (OD600=2.0, 1.0, 0.5, 0.2, 0.1), as indicated. R3a mixed with Avr3a was used as positive control (+) and Rpi-chc1 was used as a negative control (−). Pictures were taken 6 days post infiltration.
A. Selection of Rpi-chc1 specific primer pairs. Primer combinations a: 581+582, b: 585+587, c: 585+589, d: 586+587, e: 586+589, f: 588+589 refer to Table 8. Templates used were 1: chc543-5 (donor plant for Rpi-chc1), 2: chc544-5 (susceptible parent of mapping population, 3: RH89-39-16 (susceptible plant, donor of Rpi-chc1 homologous sequences, 4: CHC BAC-1 (BAC clone containing three inactive RGA's), 5: CHC BAC-2 (BAC clone containing Rpi-chc1), 6: MQ.
B. 225 genotypes from taxonomic groups 10-12 till 10-17, listed in Table 7 were screened with primer combination D. White arrowheads indicate the fragments of the expected size in 6 genotypes.
As used herein, the term “plant or part thereof” means any complete or partial plant, single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which potato plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems shoots, tubers, including potato tubers for consumption or ‘seed tubers’ for cultivation or clonal propagation, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.
As used herein, the term “population” means a genetically heterogeneous collection of plants sharing a common genetic derivation.
As used herein, the term “variety” is as defined in the UPOV treaty and refers to any plant grouping within a single botanical taxon of the lowest known rank, which grouping can be: (a) defined by the expression of the characteristics that results from a given genotype or combination of genotypes, (b) distinguished from any other plant grouping by the expression of at least one of the said characteristics, and (c) considered as a unit with regard to its suitability for being propagated unchanged.
The term “cultivar” (for cultivated variety) as used herein is defined as a variety that is not normally found in nature but that has been cultivated by humans, i.e. having a biological status other than a “wild” status, which “wild” status indicates the original non-cultivated, or natural state of a plant or accession. The term “cultivar”specifically relates to a potatoplant having a ploidy level that is tetraploid. The term “cultivar” further includes, but is not limited to, semi-natural, semi-wild, weedy, traditional cultivar, landrace, breeding material, research material, breeder's line, synthetic population, hybrid, founder stock/base population, inbred line (parent of hybrid cultivar), segregating population, mutant/genetic stock, and advanced/improved cultivar.
As used herein, “crossing” means the fertilization of female plants (or gametes) by male plants (or gametes). The term “gamete” refers to the haploid or diploid reproductive cell (egg or sperm) produced in plants by meiosis, or by first or second restitution, or double reduction from a gametophyte and involved in sexual reproduction, during which two gametes of opposite sex fuse to form a diploid or polyploid zygote. The term generally includes reference to a pollen (including the sperm cell) and an ovule (including the ovum). “Crossing” therefore generally refers to the fertilization of ovules of one individual with pollen from another individual, whereas “selfing” refers to the fertilization of ovules of an individual with pollen from genetically the same individual.
The term “backcrossing” as used herein means the process wherein the plant resulting from a cross between two parental lines is crossed with one of its parental lines, wherein the parental line used in the backcross is referred to as the recurrent parent. Repeated backcrossing results in the genome becoming more and more similar to the recurrent parent, as far as this can be achieved given the level of homo- or heterozygosity of said parent.
As used herein, “selfing” is defined as refers to the process of self-fertilization wherein an individual is pollinated or fertilized with its own pollen.
The term “marker” as used herein means any indicator that is used in methods for inferring differences in characteristics of genomic sequences. Examples of such indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), insertion mutations, microsatellite markers (SSRs), sequence-characterized amplified regions (SCARs), cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location.
As used herein, “locus” is defined as the genetic or physical position that a given gene occupies on a chromosome of a plant.
The term “allele(s)” as used herein means any of one or more alternative forms of a gene, all of which alleles relate to the presence or absence of a particular phenotypic trait or characteristic in a plant. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. It is in some instance more accurate to refer to “haplotypes” (i.e. an allele of a chromosomal segment) in stead of “allele”, however, in these instances, the term “allele” should be understood to comprise the term “haplotype”.
The term “heterozygous” as used herein, and confined to diploids, means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.
As used herein, and confined to diploids, “homozygous” is defined as a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.
As used herein, and confined to tetraploids, the term “nulliplex”, “simplex”, “duplex”, “triplex” and “quadruplex”, is defined as a genetic condition existing when a specific allele at a corresponding locus on corresponding homologous chromosomes is present 0, 1, 2, 3 or 4 times, respectively. At the tetraploid level the phenotypic effect associated with a recessive allele is only observed when the allele is present in quadruplex condition, whereas the phenotypic effect associated with a dominant allele is already observed when the allele is present in a simplex or higher condition.
The terms “haploid”, “diploid” and “tetraploid” as used herein are defined as having respectively one, two and four pairs of each chromosome in each cell (excluding reproductive cells).
The term “haplotype” as used herein means a combination of alleles at multiple loci that are transmitted together on the same chromosome. This includes haplotypes referring to as few as two loci, and haplotypes referring to an entire chromosome depending on the number of recombination events that have occurred between a given set of loci.
As used herein, the term “infer” or “inferring”, when used in reference to assessing the presence of the fungal resistance as related to the expression of the Rpi-chc1 gene, means drawing a conclusion about the presence of said gene in a plant or part thereof using a process of analyzing individually or in combination nucleotide occurrence(s) of said gene in a nucleic acid sample of the plant or part thereof. As disclosed herein, the nucleotide occurrence(s) can be identified directly by examining the qualitative differences or quantitative differences in expression levels of nucleic acid molecules, or indirectly by examining (the expression level of) a the Rpi-chc1 protein.
The term “primer” as used herein refers to an oligonucleotide which is capable of annealing to the amplification target allowing a DNA polymerase to attach thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH. The (amplification) primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and source of primer. A “pair of bi-directional primers” as used herein refers to one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification.
As used herein, the term “probe” means a single-stranded oligonucleotide sequence that will recognize and form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence analyte or its cDNA derivative.
The terms “stringency” or “stringent hybridization conditions” refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence. The terms as used include reference to conditions under which a probe or primer will hybridise to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridise specifically at higher temperatures. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe or primer.
Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+ ion, typically about 0.01 to 1.0 M Na+ ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60° C. for long probes or primers (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringent conditions or “conditions of reduced stringency” include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37° C. and a wash in 2×SSC at 40° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60° C. Hybridization procedures are well known in the art and are described in e.g. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K. eds. (1998) Current protocols in molecular biology. V. B. Chanda, series ed. New York: John Wiley & Sons.
The present invention describes the cloning of the Rpi-chc1 gene. Rpi-chc1 was mapped to a new R gene locus on chromosome 10 using a S. chacoense mapping population. Markers highly linked to Rpi-chc1 were used to generate a physical map of the R locus. Three R gene analogs (RGA) present on one of two BAC clones that encompassed the Rpi-chc1 locus were targeted for complementation analysis, one of which turned out to be the functional Rpi-chc1 gene. Outside the R-gene clusters described in this invention, Rpi-chc1 shares the highest amino acid sequence identity (40%) to a protein encoded by a gene with unknown function, designated ABF81421, from poplar (Populus trichocarpa). Lower percentages of homology (<30%) were found with R proteins previously identified within the Solanaceae (Table 3).
In a first embodiment, the invention provides an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the amino acid sequence Rpi-chc1 (=CHC_B2-3) as presented in
The term “nucleic acid” means a single or double stranded DNA or RNA molecule.
Also included are the complementary sequences of the herein described nucleotide sequences.
The term “functional fragment thereof” is typically used to refer to a fragment of the Rpi-chcl protein that is capable of providing at least partial resistance or increasing resistance in a plant of the Solanaceae family against an oomycete infection. Such a fragment is, for example, a truncated version of the Rpi-chc1 protein as presented in
The term “functional homologue” is typically used to refer to a protein sequence that is highly homologous to or has a high identity with the herein described Rpi-chc1 protein, which protein is capable of providing at least partial resistance or increasing resistance in a plant of the Solanaceae family against an oomycete infection. Included are artificial changes or amino acid residue substitutions that at least partly maintain the effect of the Rpi-chc1 protein. For example, certain amino acid residues can conventionally be replaced by others of comparable nature, e.g. a basic residue by another basic residue, an acidic residue by another acidic residue, a hydrophobic residue by another hydrophobic residue, and so on. Examples of hydrophobic amino acids are valine, leucine and isoleucine. Phenylalanine, tyrosine and tryptophan are examples of amino acids with an aromatic side chain and cysteine as well as methionine are examples of amino acids with sulphur-containing side chains. Serine and threonine contain aliphatic hydroxyl groups and are considered to be hydrophilic. Aspartic acid and glutamic acid are examples of amino acids with an acidic side chain. In short, the term “functional homologue thereof” includes variants of the Rpi-chc1 protein in which amino acids have been inserted, replaced or deleted and which at least partly maintain the effect of the Rpi-chc1 protein (i.e. at least partly providing or increasing resistance in a plant of the Solanaceae family against an oomycete infection). Preferred variants are variants which only contain conventional amino acid replacements as described above. A high identity in the definition as mentioned above means an identity of at least 80, 85 or 90%. Even more preferred are amino acids that have an identity of 91, 92, 93, 94 or 95%. Most preferred are amino acids that have an identity of 96, 97, 98 or 99% with the amino acid sequence of Rpi-chc1. Homologous proteins are for example the sequences aligned with CHC_B2-3 in
A functional homologous nucleic acid sequence is a nucleic acid sequence that encodes a functional homologous protein as described above.
Homology and/or identity percentages can for example be determined by using computer programs such as BLAST, ClustalW or ClustalX.
Many nucleic acid sequences code for a protein that is 100% identical to the Rpi-chc1 protein as presented in
Fragments as well as homologues of the herein described Rpi-chc1 gene and protein can for example be tested for their functionality by using an Agrobacterium tumefaciens transient transformation assays (agro-infiltration) and/or by using a detached leaf assay.
The experimental part for example describes a functional screen for testing candidate genes using agro-infiltration, whereby 4 week old wild type Nicotiana benthamiana plants are infiltrated with Agrobacterium strains containing the candidate Rpi-chc1 homologues. The infiltrated leaves are subsequently challenged one day after infiltration with a P. infestans strain that is virulent on N. benthamiana, for example IPO-C or 90128, in detached leaf assays. This system is equally suitable for testing candidate homologous fragments of Rpi-chc1. A person skilled in the art thus can easily determine whether or not an Rpi-chc1 homolog or fragment can be considered to be a functional homolog or fragment.
Transient gene expression, as is achieved through agro-infiltration, is a fast, flexible and reproducible approach to high-level expression of useful proteins. In plants, recombinant strains of Agrobacterium tumefaciens can be used for transient expression of genes that have been inserted into the T-DNA region of the bacterial Ti plasmid. A bacterial culture is infiltrated into leaves, and upon T-DNA transfer, there is ectopic expression of the gene of interest in the plant cells. However, the utility of the system is limited because the ectopic RNA expression ceases after 2-3 days. It is shown that post-transcriptional gene silencing (PTGS) is a major cause for this lack of efficiency. A system based on co-expression of a viral-encoded suppressor of gene silencing, the p19 protein of tomato bushy stunt virus (TBSV), prevents the onset of PTGS in the infiltrated tissues and allows high level of transient expression. Expression of a range of proteins was enhanced 50-fold or more in the presence of p19 so that protein purification could be achieved from as little as 100 mg of infiltrated leaf material. Although it is clear that the use of p19 has advantages, an agroinfiltration without p19 can also be used to test the functionality of candidate fragments and functional homologues.
Alternatively, each candidate gene (for example being a fragment or homologue) construct is targeted for transformation to a susceptible potato cultivar, for example Desiree. Primary transformants are challenged in detached leaf assays using for example isolates IPO-0, IPO-C or 90128. Transformants that are resistant to these isolates harbour for example functional fragments or homologues of Rpi-chc1.
In yet another embodiment, the invention provides a vector comprising a nucleic acid as provided herein, i.e. a nucleic acid capable of providing at least partial resistance or increasing resistance in a plant of the Solanaceae family against an oomycete infection. More particularly, the invention provides a vector comprising an isolated, synthetic or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the amino acid sequence Rpi-chc1 of
Examples of a suitable vector are pBeloBACII, pBINplus, pKGW-MG or any commercially available cloning vector.
As will be outlined below there are multiple ways in which a nucleic acid of the invention can be transferred to a plant. One suitable means of transfer is mediated by Agrobacterium in which the nucleic acid to be transferred is part of a binary vector and hence it is preferred that the above described vector is a binary vector. Another suitable means is by crossing a plant which contains the gene encoding Rpi-chc1 to a plant that does not contain the gene and to identify those progeny of the cross that have inherited the Rpi-chc1 gene.
The invention further provides a host cell comprising a nucleic acid as described herein or a vector as described herein. Examples of a preferred host cell are an E. coli cell suitable for BAC clones (e.g. DH10B) or an Agrobacterium (host) cell. In another embodiment, said host cell comprises a plant cell. A preferred plant cell is a cell derived from a member of the Solanaceae family and even more preferred said plant cell comprises a cell from Solanum tuberosum, Solanum lycopersicum, formerly known as Lycopersicon esculentum, pepper and eggplant. From such a cell, a transgenic or genetically modified plant (for example a potato or tomato plant) can be obtained by methods known by the skilled person (for example regeneration protocols).
The invention further provides a leaf, tuber, fruit or seed or part or progeny of a genetically modified plant as described herein.
In yet another embodiment, the invention provides a protein encoded by the herein described isolated or recombinant nucleic acid or a functional fragment or a functional homologue thereof. In a preferred embodiment, the invention provides a protein encoded by a nucleic acid sequence as depicted in
The herein described Rpi-chc1 protein comprises 1302 amino acids and the LRR domains of Rpi-chc1 consist of 29 imperfect repeats (
As already described, a functional fragment or a functional homologue thereof of Rpi-chc1 is a fragment or homologue that is capable of providing at least partial resistance or increasing resistance in a plant of the Solanaceae family against an oomycete infection.
Means to test the functionality of a functional fragment or a functional homologue of Rpi-chc1 have been provided above.
Based on the herein described nucleic acid sequences, the invention also provides probes and primers (i.e. oligonucleotide sequences complementary to one of the (complementary) DNA strands as described herein). Probes are for example useful in Southern or northern analysis and primers are for example useful in PCR analysis. Primers based on the herein described nucleic acid sequences are very useful to assist plant breeders active in the field of classical breeding and/or breeding by genetic modification of the nucleic acid content of a plant (preferably said plant is a Solanum tuberosum, Solanum lycopersicum, formerly known as Lycopersicon esculentum), pepper or eggplant in selecting a plant that is capable of expressing for example Rpi-chc1 or a functional fragment or functional homolog thereof.
Hence, in a further embodiment, the invention provides a binding molecule capable of binding to a nucleic acid encoding Rpi-chc1 or a functional fragment or functional homolog thereof as described herein or its complementary nucleic acid. In a preferred embodiment, said binding molecule is a primer or a probe. As mentioned, such a binding molecule is very useful for plant breeders and hence the invention further provides a method for selecting a plant or plant material or progeny thereof for its susceptibility or resistance to an oomycete infection. Preferably, the nucleic acid of a plant to be tested is isolated from said plant and the obtained isolated nucleic acid is brought in contact with one or multiple (preferably different) binding molecule(s). One can for example use a PCR analysis to test plants for the presence of absence of Rpi-chc1 in the plant genome. Such a method would be especially preferable in marker-free transformation protocols, such as described in WO 03/010319.
The herein described Rpi-chc1 protein can also be used to elicit antibodies by means known to the skilled person. The invention thus also provides an antibody that (specifically) binds to the protein encoded by the herein described isolated or recombinant nucleic acid (for example the nucleic acid sequence of
Based on the herein provided nucleic acid sequences, the invention also provides the means to introduce or increase resistance against an oomycete infection in a plant. The invention therefore also provides a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection comprising providing a plant or a part thereof with:
Such a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection may be based on classical breeding, departing from a parent plant that already contains the Rpl-chc1 gene or a functional homolog thereof, or it involves the transfer of DNA into a plant, i.e., involves a method for transforming a plant cell comprising providing said plant cell with a nucleic acid as described herein or a vector as described herein or a host cell as described herein.
There are multiple ways in which a recombinant nucleic acid can be transferred to a plant cell, for example Agrobacterium mediated transformation. However, besides by Agrobacterium infection, there are other means to effectively deliver DNA to recipient plant cells when one wishes to practice the invention. Suitable methods for delivering DNA to plant cells are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts, by desiccation/inhibition-mediated DNA uptake (Potrykus et al., Mol. Gen. Genet., 199:183-188, 1985), by electroporation (U.S. Pat. No. 5,384,253), by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. No. 5,302,523; and U.S. Pat. No. 5,464,765), and by acceleration of DNA coated particles (U.S. Pat. No. 5,550,318; U.S. Pat. No. 5,538,877; and U.S. Pat. No. 5,538,880). Through the application of techniques such as these, cells from virtually any plant species may be stably transformed, and these cells may be developed into transgenic plants.
In case Agrobacterium mediated transfer is used, it is preferred to use a substantially virulent Agrobacterium such as A. tumefaciens, as exemplified by strain A281 or a strain derived thereof or another virulent strain available in the art. These Agrobacterium strains carry a DNA region originating from the virulence region of the Ti plasmid pTiBo542, which coordinates the processing of the T-DNA and its transfer into plant cells. Agrobacterium-based plant transformation is well known in the art (as e.g. described in, for example by Komari, T. et al.: Plant Transformation Technology: Agrobacterium-Mediated Transformation, in: Handbook of Plant Biotechnology, Eds. Christou, P. and Klee, H., John Wiley & Sons, Ltd, Chichester, UK 2004, pp. 233-262). Preferably a marker-free transformation protocol is used, such as described in WO 03/010319.
Alternatively, the nucleic acid of the Rpi-chc1 gene or a functional homolog thereof may be introduced into a plant by crossing. Such a crossing scheme starts off with the selection of a suitable parent plant. This may for instance be an original Solanum chacoense variety (such as accession CHC543-5), an original S. tarijense variety (such as accession TAR852-5), an original S. sucrense variety (such as accession SUC849-2) or an original S. berthaultii variety (such as accession BER481-3 or BER94-2031) or a plant that has obtained the desired nucleic acid by genetic engineering as described above.
Any suitable method known in the art for crossing selected plants may be applied in the method according to the invention. This includes both in vivo and in vitro methods. A person skilled in the art will appreciate that in vitro techniques such as protoplast fusion or embryo rescue may be applied when deemed suitable.
Selected plants that are used for crossing purposes in the methods according to the invention may have any type of ploidy. For example, selected plants may be haploid, diploid or tetraploid. However, crossing diploid plants, such as S. chacoense, S. tarijense and S. berthaultii, will only provide diploid offspring. Crossing a diploid plant with a tetraploid plant will result in triploid offspring that is sterile.
Thus, when plants are selected that are diploid, their ploidy must be increased to tetraploid level before they can be crossed with another tetraploid plant in the methods according to the invention. Methods for increasing the ploidy of a plant are well known in the art and can be readily applied by a person skilled in the art. For example, ploidy of a diploid plant for crossing purposes can be increased by using 2N gametes of said diploid plant. Ploidy can also be increased by inhibiting chromosome segregation during meiosis, for example by treating a diploid plant with colchicine. By applying such methods on a diploid plant, embryos or gametes are obtained that comprise double the usual number of chromosomes. Such embryos or gametes can then be used for crossing purposes. For potatoes a resistant tetraploid plant is preferred, since tetraploid plants are known to have higher yields of tubers.
Since the resistance characteristic has appeared to be a dominant trait, it is sufficient if only one allele with the functional gene is present.
Preferably, selected plants are crossed with each other using classical in vivo crossing methods that comprise one or more crossing steps including selfing. By applying such classical crossing steps characteristics of both the parents can be combined in the progeny. For example, a plant that provides a high yield can be crossed with a plant that contains large amounts of a certain nutrient. Such a crossing would provide progeny comprising both characteristics, i.e. plants that not only comprise large amounts of the nutrient but also provide high yields.
When applying backcrossing, F1 progeny is crossed with one of its high-yielding parents P to ensure that the characteristics of the F2 progeny resemble those of the high-yielding parent. For example, a selected diploid potato with oomycete resistance is made tetraploid by using colchicine and then crossed with a selected high-yielding tetraploid potato cultivar, with the purpose of ultimately providing a high-yielding tetraploid progeny having oomycete resistance. Also selfing may be applied. Selected plants, either parent or progeny, are then crossed with themselves to produce inbred varieties for breeding. For example, selected specimens from the above mentioned F1 progeny are crossed with themselves to provide an F2 progeny from which specimens can be selected that have an increased level of resistance.
After transfer of a nucleic acid into a plant or plant cell, it must be determined which plants or plant cells have been provided with said nucleic acid. When selecting and crossing a parental genotype in a method according to the invention, a marker is used to assist selection in at least one selection step. It is known in the art that markers, indicative for a certain trait or condition, can be found in vivo and in vitro at different biological levels. For example, markers can be found at peptide level or at gene level. At gene level, a marker can be detected at RNA level or DNA level. Preferably, in the present invention the presence of such a marker is detected at DNA level, using the above described primers and/or probes. Alternatively, proper expression of the Rpi-chc1 protein or a functional homolog thereof can be assessed in plant parts by performing an immunoassay with an antibody that specifically binds the protein. Next to the primers and probes according to the invention, use can also be made of specific markers that are to be found in the vicinity of the coding sequence. Such markers are indicated in the experimental part below and comprise the markers as indicated in Table. 2. Markers are derived from accompanying BAC sequences.
In case of transgenic approaches selecting a transformed plant may be accomplished by using a selectable marker or a reporter gene. Among the selective markers or selection genes that are most widely used in plant transformation are the bacterial neomycin phosphotransferase genes (nptI, nptII and nptIII genes) conferring resistance to the selective agent kanamycin, suggested in EP131623 and the bacterial aphlV gene suggested in EP186425 conferring resistance to hygromycin. EP 275957 discloses the use of an acetyl transferase gene from Streptomyces viridochromogenes that confers resistance to the herbicide phosphinotricin. Plant genes conferring relative resistance to the herbicide glyphosate are suggested in EP218571. Suitable examples of reporter genes are beta-glucuronidase (GUS), beta-galactosidase, luciferase and green fluorescent protein (GFP).
In a preferred embodiment, the invention provides a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection comprising providing a plant or a part thereof with:
The invention also provides a plant that is obtainable by using a method for providing at least partial resistance or increasing resistance in a plant against an oomycete infection as described above. A preferred plant is a plant from the Solanaceae family and even more preferred said plant is a Solanum tuberosum or a Solanum lycopersicum, formerly known as Lycopersicon esculentum, Solanum melononga, Capsicum spp., such as C. annuum, C. baccatum, C. chinense, C. frutescens and C. pubescens. The invention thus also provides a plant that has been provided with a nucleic acid encoding a Rpi-chc1 protein or a functional fragment or a functional homologue thereof.
The invention further provides a plant part or progeny of a plant according to the invention comprising a nucleic acid encoding the Rpi-chc1 amino acid sequence of
In a preferred embodiment, the herein described nucleic acid is transferred to a Solanum variety other than Solanum chacoense, i.e. the herein described nucleic acid is preferably provided to a non-chacoense background, preferably S. lycopersicon or S. tuberosum. Of the latter most preferred is a tetraploid variety and more preferably to a commercial interesting variety such as Bintje, Desiree or Premiere, Spunta, Nicola, Favorit, Russet Burbank, Aveka or Lady Rosetta.
It is also possible to provide the resistance according to the invention to a plant that is already partially resistant to an oomycete infection, wherein said plant is provided with a nucleic acid encoding a further resistance gene, such as Rpi-blb1,-2, -3, Rpi-vnt1 or Rpi-mcq1.
The invention further provides use of an isolated or recombinant nucleic acid sequence comprising a nucleic acid sequence encoding the Rpi-chc1 amino acid sequence of
In yet another embodiment, the invention provides a method for producing Rpi-chc1 protein or a functional fragment or a functional homologue thereof comprising functionally linking a nucleic acid as described herein to a regulatory sequence and allowing said nucleic acid to be expressed in a host cell. Examples of a regulatory sequence are a promoter and/or terminator sequence. Further, as will become clear from Example 2, it is preferred that the Rpi-chc1 sequence is expressed under control of its own promoter and terminator. Therefore, the invention further provides the promoter and/or terminator sequences of Rpi-chc1 (
The invention will be explained in more detail in the following, non-limiting examples.
A recent taxonomic regrouping of the Solanum section Petota revealed the lack of species structure in this section (Jacobs et al., 2008). In order to identify late blight resistance traits from the taxonomic group 10-14 (Jacobs et al., 2008) we selected several accessions and tested their resistance levels to Phytophthora infestans in field trials. Five accessions, that were previously determined as S. tarijense (TAR), S. berthaultii (BER), and S. chacoense (CHC), with high resistance levels were selected (TAR852-5, BER94-2031-01, BER481-3, BER493-7, CHC543-5). In order to study the genetic basis of these resistances, crosses were generated using BER493-7, CHC543-5, BER94-2031-01 as resistant parents. The resulting F1 populations were tested for the segregation of resistance to P. infestans in a detached leaf assay (Table 1).
In populations 7650 and 06-882 a clear 1:1 segregation was found, a hallmark for the segregation of a single dominant resistance gene. In population 7767 also a 1:1 segregation was found, however, also a group of 10 plants with intermediate (Q) resistance levels was found.
From literature it was known that a late blight resistance gene from S. berthaultii (Rpi-ber) was closely linked to TG63 on the long arm of chromosome 10 (Rauscher et al., 2006), a region to which also the tomato Ph-2 QTL from S. pimpenellifolium mapped (Moreau et al., 1998). We therefore developed CAPS markers in TG63 in the three populations. Using the polymorphism described in Table 2, it was found that the resistances in 06-882 and 7650 were closely linked to TG63 since one and two recombinants were found respectively. Also the resistance in 7677 was linked to TG63 albeit a higher recombination frequency (15 recombinations) was observed. It is concluded that this area on chromosome 10 is very important for resistance to late blight. Therefore, we set out to exploit the well characterised RH89-039-16 physical map in order to generate a reference map of the TG63 locus. Using the polymorphism described in Table 2, TG63 was mapped to RH10B41. At this map position the contig 6701 was anchored. BAC end sequences in this contig were used to generate markers suitable for mapping in population 7650. RH199E15S (Table 2) was found to co-segregate with resistance in 7650 and 06-882, indicating that 6710 from RH89-039-16 was in a locus synthenic with the Rpi-chc1 and Rpi ber locus.
Besides anchoring TG63 genetically, it was also located in the physical map of RH89-039-16 by PCR screening the RH BAC library. A positive contig, 2203, was found. Remarkably, contig 2203 was anchored to RH10B38 using two independent markers (Jan de Boer, PGSC). CAPS markers were developed based on BAC end sequences in contig 2203 and mapped in the 06-882 and 7650 populations. Also these markers were closely linked to resistance, indicating that also this contig is in a locus synthenic with the Rpi-chc1 and Rpi-ber locus.
Using BAC-end sequences, three additional RH BAC contigs flanking contigs 2203 and 6701 were identified (
In order to clone Rpi-chc1, two BAC libraries were constructed using DNA derived from the resistant clone CHC543-5. The first library was constructed in the pCC1BAC BAC vector and contained approximately 22.000 clones with an average insert size of ˜70 Kbp, corresponding to 1 genome equivalent. A second library was constructed in the pIndigoBAC-5 BAC vector and contained approximately 110.000 clones with an average insert size of ˜45 Kbp, corresponding to 3 genome equivalents. The first library was screened with marker RH106G03T (Table 2,
By sequencing these two BACs, it was found that CHC B1 contained two RGAs and CHC B2 contained three RGAs, which were named CHC B1-1, CHC B1-2, CHC B2-1, CHC B2-2, and CHC B2-3 respectively (
Complementation analysis was carried out in Nicotiana benthamiana using the Agrobacterium tumefaciens transient assay (agroinfiltration) whereby 4-week old wild type N. benthamiana plants were infiltrated with the Agrobacterium strain AGL1+virG containing pBINplus:CHC B2-1, pBINplus:CHC B2-2, and pBINplus:CHC B2-3 respectively. As controls we used pBINplus without an insert and pBINplus:Rpi-blb1. Infiltrated leaves were challenged after two days with P. infestans strain 90128 in detached leaf assays (DLA). Leaves infiltrated with pBINplus:CHC B2-3 and pBINplus:Rpi-blb1 showed resistance to infection, while pBINplus:CHC B2-1, pBINplus:CHC B2-2 and pBINplus without an insert were colonized by Phytophtora as was apparent from the sporulating lesions (
Interestingly, Rpi-chc1 shares the highest homology (75-98%) with other RGAs from the Rpi-chc1 gene cluster from S. chacoense and with genes from synthenic clusters on chromosome 10 from S. tuberosum clone RH89-039-16 (Table 3,
Rpi-chc1 comprises an ORFs of 3909 nucleotides (nt) that encode a protein of 1302 amino acids harboring all sequences characteristic of a CC-NB-LRR R-proteins (
In order to identify positions in the genome that contain Rpi-chc1 related nucleotide sequences a new technique was developed that is derived from the NBS profiling (Brugmans et al., 2008; van der Linden et al., 2004) and will be referred to as “locus directed profiling”. Instead of the primers that were used previously, which target domains that are generally present in all R-genes, we now used primers that are conserved within the family of Rpi-chc1 sequences (Table 2). This way only Rpi-chc1 related genes are expected to be targeted. Genomic DNA from parents and offspring from different populations (SHxRH, 06-882) was digested with either RsaI, HaeIII, AluI or MseI. An adaptor was ligated to the digestion products and using an adaptor primer combined with the Rpi-chc1 family specific primer, multiple fragments of varying molecular weight were created in a PCR reaction. Polymorphic bands were detected in the two populations using the Licor polyacrylamide gelsystem. Polymorphic bands were
populus2.pro
populus.pro
oryza.pro
vitis.pro
populus2.pro
populus.pro
oryza.pro
vitis.pro
Cucumis
melo.pro
populus2.pro
populus.pro
oryza.pro
vitis.pro
Cucumis
melo.pro
populus2.pro
populus2.pro
populus.pro
populus.pro
oryza.pro
oryza.pro
vitis.pro
vitis.pro
Cucumis
Cucumis
melo.pro
melo.pro
Cucumis
melo.pro
scored in 40 offspring plants from the SHxRH population and successively the marker segregation patterns were fitted to the UHD map (van Os et al., 2006). 73% of the markers mapped to the long arm of chromosome 10 where the Rpi-chc1 gene is located. Also sequence analysis of the isolated marker fragments showed strong homology to the Rpi-chc1 gene family (Table 4b). Altogether these data show that “locus directed profiling” was a successful approach to generate markers in a specified genomic area. On chromosome 10 three different loci were tagged with high frequency (Table 4A). Interestingly, the first two loci coincided with the map positions of contigs 2203 and 6701, which map to RH10B38-39 and RH10B41-42 respectively. A third group of markers mapped to RH10B54. Interestingly, the Rpi-ber1 gene (Park et al., 2008) is in the same marker interval as the RH10B54 cluster. In order to test whether the Rpi-ber gene was potentially a Rpi-chc1 homolog, in population 06-882, 58 Rpi-chc1 locus directed profiling markers were developed. 34 of these markers derived from the resistant parent. 28 of them were linked to resistance (9 in coupling phase, 19 in repulsion phase). 2 coupling phase markers and 7 repulsion phase markers were completely linked to resistance in the first 1771 individuals of the population. This strongly suggests that Rpi-ber is a Rpi-chc1 homolog. Within the 28 linked Rpi-chc1 locus directed profiling markers, four groups of recombination patterns could be distinguished, each group is marked by the name of a representative marker in
In a different population (7677) deriving from S. berthaultii accession 493-7 an NBS profile marker generated with the previously described NBS5a6 primer was found to be closely linked to Phytophthora resistance in this population. It mapped to the telomeric site relative to TG403 on the long arm of chromosome 10 (
Plant Material and Phytophthora infestans Isolates
In this study we used four late blight resistant clones TAR852-5 (deriving from CGN22729), BER94-2031-01 (deriving from PI473331), BER481-3 (deriving from CGN18190) BER493-7 (deriving from CGN17823), CHC543-5 (deriving from BGRC63055). CHC543-5 was crossed with CHC544-5 to produce population 7650. BER94-2031-01 was crossed with the susceptible clone G254 to generate population 06-882. BER493-7 was crossed with RH89-039-16 to produce population 7677. Potato cultivar Desiree was used for transformation. Wild-type Nicotiana benthamiana plants were used for transient complementation assays.
Characteristics and origin of P. infestans isolates used in this study are indicated in Table 5.
Clone CHC543-5 was used as a DNA source for the construction of the BAC libraries. High-molecular weight DNA preparation and BAC library construction were carried out as described by (Rouppe van der Voort et al., 1999). For the first library pCC1BAC backbone was used. For the second library pIndigoBAC-5 was used, both from Epicenter. Approximately 22,000 clones with an average insert size of ˜70 Kbp, corresponding to 1 genome equivalents, were obtained for library 1, and approximately 110,000 clones with an average insert size of ˜45 Kbp, corresponding to 3 genome equivalents, were obtained for library 2. The BAC clones were stored as bacterial pools containing approximatively 700 to 1000 white colonies. These were generated by scraping the colonies from the agar plates and successive resuspension into LB medium containing 18% glycerol and 12.5 μg ml−1 chloramphenicol using a sterile glass spreader. These so-called super pools were stored at −80° C. Marker screening of the BAC libraries was done, first by isolating plasmid DNA from each pool using the standard alkaline lysis protocol and PCR was carried out to identify positive pools. Bacteria corresponding to positive pools were diluted and plated on LB agar plate containing chloramphenicol (12.5 μg ml−1). Individual white colonies were picked into 384-well microtitre plates and single positive BAC clones were subsequently identified by marker screening as described by (Rouppe van der Voort et al., 1999). Names of BAC clones isolated from the super pools carry the prefix CHC and are extended with a number (B1 and B2), corresponding to the order in which they were identified.
Candidate RGAs were subcloned from BAC clone CHC B2 as follows. Primers were designed approximately 3 kb upstream of the predicted start codon and approximately 700 by downstream of the predicted stop codon.
BAC clone sequencing was performed using a shotgun cloning strategy of 2 kb and 6 kb libraries and was carried out by Macrogen (South-Korea). Sequencing reactions were performed using the dye terminator principle. Sequence contigs were assembled by Macrogen. Gap closing was done using primer walking on shotgun clones or directly on the BAC.
The contig sequences were analyzed using the web-based application FGENESH (Softberry) in order to predict gene structure. RGAs and RGAs from publically accessible databases were aligned for homology and distance analysis using the DNA star software package (Lasergene). Conserved domains were identified using the web-based application SMART (EMBL)
Detached leaf assays were used to determine the resistance phenotypes of primary transformants and N. benthamiana leaves. For the phenotyping of the CHC population isolate 90128 was used. For the phenotyping of the ber population, isolate IPO-C was used. The resistance spectra of the resistant parents was determined using the isolates described in Table 5. Inoculum preparation and inoculation were performed as described by (Vleeshouwers et al., 1999). Six days after inoculation, plant phenotypes were determined. Leaves showing no symptoms or a localized necrosis at the point of inoculation were scored as resistant and those with clear sporulating lesions as susceptible.
Transient Complementation in N. benthamiana
Agrobacterium transient transformation assays (agro-infiltration) were carried out on N. benthamiana. Recombinant A. tumefaciens AGL1+ cultures were grown in LB medium (10 gram bacteriological peptone, 10 gram NaCl and 5 gram yeast extract in 1 liter MQ water) supplemented with 5 mg/1 Tetracycline and 50 mg/1 Kanamycin for the pBINplus constructs. After one or two days a calculated amount of culture (according to OD 0.5 at 600 nm) was transferred to YEB medium (5 gram beef extract, 5 gram bacteriological peptone, 5 gram sucrose, 1 gram yeast extract, 2 ml 1 M MgSO4 in 1 liter MQ water) supplemented with Kanamycin for all strains. After 1 day overnight cells were centrifuged at 3500 rpm and re-suspended in MMA medium (20 gram sucrose, 5 gram MS salts and 1.95 gram MES) supplemented with 1 ml 200 mM acetosyringone to a final OD of 0.2 and infiltrated into 4 weeks old plants with a 3 ml syringe. Infiltrated leaves were subsequently challenged after two days with P. infestans strain 90128 in detached leaf assays (DLA). Hypersensitive response (HR) or P. infestans sporulation were scored from 5 to 7 days post inoculation.
Plant Material and Phytophthora infestans Isolates
In this study we used 225 Solanum plants, their names as used in this study and accession numbers are listed in Table 7. Nine late blight resistant plants were used for the isolation of functional homologs of Rpi-chc1 (tar852-5, ber94-2031-01 which derives from PI473331, ber481-3, ber493-5, -7, -9, chc543-5, ber324-2, ber487-1, ber561-2, and scr849-1). CHC543-5 was crossed with CHC544-5 to produce population 7650. BER94-2031-01 was crossed with the susceptible clone G254 to generate population 06-882. BER493-7 was crossed with RH89-039-16 to produce population 7677. Potato cultivar Desiree was used for transformation. Wild-type Nicotiana benthamiana plants were used for transient complementation assays.
Characteristics and origin of P. infestans isolates used in this study are indicated in Table 5.
Rpi-chc1 homologs were PCR amplified using the long range high fidelity thermostable DNA polymerase Phusion® according to the manufacturer's instructions (New England Biolabs). Primers were designed, overlapping the start and stop codons of Rpi-chc1 and contained AttB1 and AttB2 extensions (MN595 and MN597, Table 8). PCR products were recombined into pDONR221 using BP clonase® according to manufacturer's instructions (InVitroGen). DNA sequencing was performed at Baseclear (The Netherlands) using standard and custom primers (MN622-MN650, Table 8). Sequences were analyzed and aligned for homology and phylogeny analysis using the DNA star software package (Lasergene).
Promoter Terminator Constructs
In order to produce clones containing the promoter and terminator of Rpi-chc1 for construction of triple point gateway application mediated expression constructs, specific primers were designed (MN598, MN599, MN600, MN601, MN670; Table 8) matching the Rpi-chc1 promoter and terminator sequences, to which AttB4, AttB1 and AttB2, AttB3 recombination sites were added, respectively. PCR products were generated using the long range high fidelity thermostable DNA polymerase Phusion® according to the manufacturer's instructions. PCR products were recombined using BP clonase®. The occurrence of PCR errors was ruled out using sequence analysis of the resulting clones using primers MN651 and 652 as listed in Table8. Triple point gateway reactions were performed using these constructs and ORF sequences in pDONR221 by LR clonase.
Detached leaf assays were used to determine the resistance phenotypes of primary transformants and N. benthamiana leaves. For the phenotyping of the CHC transgenics isolate 90128 was used. For the phenotyping of the Rpi-chc1 homologs in N. benthamiana, isolate IPO-C was used. Inoculum preparation and inoculation were performed as described by Vleeshouwers et al., 1999. Six days after inoculation, plant phenotypes were determined. Leaves showing no symptoms or a localized necrosis at the point of inoculation were scored as resistant and those with clear sporulating lesions as susceptible.
Transient Complementation in N. benthamiana
Agrobacterium transient transformation assays (agro-infiltration) were carried out on N. benthamiana. Recombinant A. tumefaciens COR308 cultures were grown in LB medium (10 gram bacteriological peptone, 10 gram NaCl and 5 gram yeast extract in 1 liter MQ water) supplemented with 5 mg/1 tetracycline and 50 mg/1 kanamycin for the pBINplus constructs. After one or two days a calculated amount of culture (according to OD 0.5 at 600 nm) was transferred to YEB medium (5 gram beef extract, 5 gram bacteriological peptone, 5 gram sucrose, 1 gram yeast extract, 2ml 1 M Mg504 in 1 liter MQ water) supplemented with kanamycin for all strains. After 1 day overnight cells were centrifuged at 3500 rpm and re-suspended in MMA medium (20 gram sucrose, 5 gram MS salts and 1.95 gram MES) supplemented with 1 ml 200 mM acetosyringone to a final OD of 0.2 and infiltrated into 4 weeks old plants with a 3m1 syringe. Infiltrated leaves were subsequently challenged after two days with P. infestans strain 90128 in detached leaf assays (DLA). Hypersensitive response (HR) or P. infestans sporulation were scored from 5 to 7 days post inoculation
A set of 90 effectors was present in Agrobacterium tumefaciens COR308 in a PVX plasmid (PEX set). The binary plasmids contain an effector from Pi cloned inside the PVX genome. Upon agro-infiltration both effector and PVX will be expressed. Within the time course of the experiment PVX can not spread systemically and we are only interested in the local expression of the effector. Upon recognition of the encoded effector by the R-gene, an HR can be observed between 3 and 5 dpi. PVX symptoms are visible after 6 days and are generally first observed in non-infiltrated leaves.
As a positive control we used R3α and Avr3a-KI, an R-gene-Avr-gene combination which is known to give a strong response (Armstrong et al., 2005). Screening with the Rpi-chc1 candidate showed necrotic spots with two potential effectors genes RD 12-1 and RD 12-2 (
In the previous example we described the map based cloning of the Rpi-chc1 gene from Solanum chacoense accession 543-5. Rpi-chc1 is the founder of a previously undescribed R gene family of the CC-NB-LRR class and is located on chromosome 10 near marker TG63. The gene was present in a gene cluster with five homologs. Genetic analysis revealed that only three of these homologs (CHC
B2-1, CHC B2-2, and CHC B2-3 could potentially encode Rpi-chc1. Transient complementation analysis in N. benthamiana suggested that CHC B2-3 was the active copy.
In this experiment we show by stable transformation of the susceptible cv. Desiree that indeed CHC B2-3 could complement the Phytophthora infestans (Pi) susceptibility (
In order to understand the activity spectrum of Rpi-chc1, it was investigated which component of Pi was recognized. Until now all Pi components being recognized by host R-proteins are effectors of the RXLR class. Pi isolate T30-4 is a-virulent on plants expressing Rpi-chc1 and therefore the cognate component must be expressed in this isolate. Recently the genome of T30-4 was sequenced and its genome appears to encode hundreds of RXLR effectors (Haas et al., 2009). Sixty-five RXLR effectors comprising all known Avr's (Avr1, Avr2, Avr3a, Arv4, Avr-blb1, Avr-blb2) and also a few non RXLR effectors (Infl, PiNIP) effectors were cloned into the plant expression vector pGR106 and are referred to as the PEX set (Vleeshouwers et al., 2008). The PEX set was screened by co-agro-infiltration with Rpi-chc1 in N. benthamiana. This way both the selected effector and the Rpi-chc1 gene are expressed in the same cells. In case the effector is recognized by Rpi-chc1 it will induce a hypersensitive response (HR) and will result in a necrotic lesion in the infiltrated area of the leaf. This phenomenon was well described for the co-infiltration of R3a and Avr3a (Armstrong et al., 2005) which was included in our experiments as a positive control (
It can not be excluded that also these paralogs are recognized by Rpi-chc1 in the interaction with Pi. Neither can it be ruled out that additional unrelated Pi components can be recognized since dual specificity R-genes have been described (Jones and Dangl, 2006).
In order to determine which regulatory sequences were most suited to drive the expression of the open reading frames of Rpi-chc1, we used the strategy described before (Lokossou et al., 2009) in which the candidate ORFs are cloned in between the desired promoters and terminators using a triple point gateway strategy. The Rpi-chc1 ORF was cloned in between its own 3 kb promoter and 0.5 kb terminator (p-chc1-long) which were also present in the initial complementation analyses as presented in
Germplasm Screen for Rpi-chc1 like Sequences.
To further support the suggestion that Rpi-chc1 can be active in a wide range of Solanum species and also study divergence of the Rpi-chc1 allele sequence and activity in the germplasm we screened 225 genotypes (Table 7) from our germplasm collection for the presence of Rpi-chc1 related sequences using a sequence alignment of the active Rpi-chc1 and several related sequences identified in the initial application that were derived from RH89-039-16 and from the inactive paralogs in chc543-5. Primer pairs (Table 8) were designed in such a way that only the active copy was predicted to be amplified by PCR. As shown in
Genotype chc543-5, from which Rpi-chc1 was isolated, is located in taxonomic group 10-14 (Jacobs et al., 2008). In order to screen for other Rpi-chc1 homologous sequences, 225 genotypes in our germplasm collection (Table 7) located in taxonomic groups 10-12 till 10-17 were selected. DNA integrity was confirmed using Ef1-α PCR (data not shown) and successively primer combination D was used to screen for Rpi-chc1 related sequences. Six genotypes were found to be positive in this screen (
Rpi-chc1 Homolog Mining
In order to further characterize functional and sequence conservation or divergence of Rpi-chc1 we set out to clone the open reading frames from the plants that were positive in the germplasm screen and in addition from plants known to contain resistance genes on chromosome 10 (described in
Now we have identified 21 new Rpi-chc1 homologs and we have shown sequence diversification, the question arises if functionality is conserved or diversified among those sequences. All identified sequences, which are ORFs, were subcloned using triple point gateway recombination under the control of the Rpi-chc1-short promoter and the Rpi-chc1 terminator in the binary vector pDEST236. Based on the results in
ahost potato,
bmating type A1
S. berthaultii
S. bulbocastanum
S. caripense
S. demissum
S. microdontum
S. mochiquense
S. papita
S. paucissectum
S. phureja
S. pinnatisectum
S. stoloniferum
S. venturii
S. vernei
S. tuberosum
arnezii PI545880
yungasense PI614703
aracc-papa GLKS82
aracc-papa GLKS81
arnezii GLKS2832
astleyi GLKS2836
candolleanum GLKS2175
curtilobum GLKS5346
doddsii GLKS2882
doddsii GLKS2882
morelliforme BGRC7200
ochranthum BGRC53684
ochranthum BGRC53684
phureja GLKS1467
phureja BGRC15481
phureja GLKS1455
stenotomum goniocalyx
tarijense BGRC18324
tuberosum andigena
tuberosum andigena
tuberosum andigena
tundalomense GLKS2343
ugentii GLKS2887
alandiae BGRC10057
chacoense CPC5901
gandarillasii CPC7044
neocardenasii CPC7208
neorossii CPC6047
stenotomum CPC4741
berthaultii CGN20644
berthaultii CGN20644
berthaultii CGN20644
berthaultii CGN20650
berthaultii CGN20650
berthaultii CGN18042
chacoense CGN18248
chacoense CGN18248
gandarillasii CGN20560
gourlayi CGN17851
gourlayi CGN17851
hondelmannii CGN18106
hondelmannii CGN18182
hondelmannii CGN18182
hondelmannii CGN18182
leptophyes CGN18140
leptophyes CGN18140
leptophyes CGN18174
phureja CGN17667
phureja CGN17667
phureja CGN18301
raphanifolium CGN17753
sparsipilum CGN18154
sparsipilum CGN18154
sparsipilum CGN18225
sparsipilum CGN18225
sparsipilum CGN18230
sparsipilum CGN18230
sparsipilum CGN18230
sucrense CGN18205
sucrense CGN18205
sucrense CGN18205
tarijense CGN17861
tarijense CGN17861
tarijense CGN17861
ajanhuiri CGN22389
alandiae CGN22349
alandiae BGRC28490
alandiae CGN20651
alandiae CGN20651
andreanum CGN17679
chacoense CGN17679
arnezii BGRC27309
astleyi CGN18207
astleyi CGN18211
astleyi CGN18211
avilesii CGN18256
avilesii CGN18255
avilesii CGN18255
brevicaule
avilesii CGN18256
berthaultii CGN18118
berthaultii CGN18190
berthaultii CGN20636
berthaultii CGN20636
berthaultii CGN22716
berthaultii CGN22716
berthaultii CGN20645
berthaultii CGN20645
berthaultii CGN18246
berthaultii CGN18246
berthaultii BGRC28496
berthaultii CGN22727
berthaultii CGN17823
berthaultii CGN17823
brevicaule CGN17841
brevicaule CGN22321
brevicaule CGN22321
chacoense CGN18365
chacoense BGRC24528
chacoense BGRC24528
chacoense BGRC63055
chacoense CGN17702
chacoense CGN18294
chacoense CGN18294
chacoense CGN18365
berthaultii BGRC55178
chomatophilum BGRC55178
gourlayi CGN17591
gourlayi CGN18039
gourlayi BGRC17316
gourlayi CGN17592
gourlayi CGN17592
gourlayi CGN22336
gourlayi CGN21335
gourlayi pachytrichum
gourlayi pachytrichum
gourlayi pachytrichum
gourlayi pachytrichum
gourlayi pachytrichum
gourlayi pachytrichum
gourlayi vidaurrei
gourlayi vidaurrei
gourlayi vidaurrei
gourlayi vidaurrei
gourlayi vidaurrei
gourlayi vidaurrei
gourlayi vidaurrei
gourlayi vidaurrei
hawkesianum CGN17888
hawkesianum CGN17889
hondelmannii CGN18192
hondelmannii CGN18192
hoopesii CGN18363
hoopesii CGN18363
hoopesii CGN18368
hoopesii CGN18372
incamayoense CGN21320
incamayoense CGN21320
incamayoense CGN17874
incamayoense CGN17875
incamayoense CGN17875
incamayoense CGN17968
incamayoense CGN17968
incamayoense BGRC17334
infundibuliforme CGN17720
infundibuliforme CGN17720
infundibuliforme CGN23063
infundibuliforme CGN22334
infundibuliforme CGN22334
brevicaule
leptophyes CGN18167
leptophyes CGN20611
neorossii CGN18280
neorossii CGN18280
okadae BGRC27158
oplocense CGN23049
oplocense CGN21352
oplocense CGN21319
oplocense CGN17871
oplocense CGN18086
ruiz-lealii CGN18117
sparsipilum CGN18096
sparsipilum CGN18096
sparsipilum CGN18221
sparsipilum CGN20653
sparsipilum CGN20653
sparsipilum CGN20602
sparsipilum CGN20602
sparsipilum CGN20602
spegazzinii CGN23015
stenotomum CGN18161
stenotomum CGN18161
sucrense CGN20628
sucrense CGN20630
sucrense CGN20630
sucrense CGN20628
sucrense CGN20630
sucrense CGN20631
sucrense CGN18187
sucrense CGN18187
sucrense CGN18206
sucrense CGN18206
sucrense CGN18206
tarijense CGN22729
tarijense BGRC27348
tarijense CGN18198
tarijense CGN18198
tarijense BGRC8232
tarijense CGN17975
tarijense BGRC18609
tarijense BGRC18610
tarijense BGRC18610
tarijense CGN18107
tarijense BGRC17022
tarijense CGN17978
tarijense BGRC17438
tuberosum andigena
ugentii CGN18364
virgultorum BGRC31203
virgultorum CGN17775
virgultorum CGN17775
ATGAATTATTGTCTTCCTTCGAGTAC
TCAGAAAGTGAAAGAGAAACCGAG
ACGCATCAGGAAGAGAGGAG
ATACAATCATTCAAACAGTAAT
GTCGCTTGCATTTTTAATTAG
GCGGTTCCTCTGTGAAACAC
TGATTTGTTTTTCCTATTCCTGAC
Number | Date | Country | Kind |
---|---|---|---|
09170769.5 | Sep 2009 | EP | regional |
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/NL2010/050612 | 9/20/2010 | WO | 00 | 5/30/2012 |