Patent Application
20150218625
Detection and analysis of single-stranded nucleic acid target sequences may include the use of fluorescently labeled oligonucleotide hybridization probes, primers, or both. Detection may or may not be “homogeneous detection”. Homogeneous detection means detection that does not require separation of bound (hybridized to target) primers or probes from unbound primers or probes. Among probes suitable for homogeneous detection are linear probes labeled on one end with a fluorophore and on the other end with a quencher, most often a non-fluorescent quencher (5′ exonuclease probes described in, for example, Livak et al. (1995) PCR Methods Appl. 4:357-362), hairpin probes labeled on one end with a fluorescent moiety such as a fluorophore and on the other end with a quencher (molecular beacon probes described in, for example, Tyagi et al. (1996) Nature Biotechnology 14:303-308), double-stranded probes having a fluorophore on one strand and a quencher on the other strand (yin-yang probes described in, for example, Li et al. (2002) Nucl. Acids Res. 30, No. 2 e5), linear probes having a fluorophore that absorbs emission from a fluorescent dye and reemits at a longer wavelength (probes described in, for example, United States published patent application US2002/0110450), and pairs of linear probes, one labeled with a donor fluorophore and one labeled with a quencher or an acceptor fluorophore that hybridize near to one another on a target strand such that their labels interact. A label pair such as a fluorophore and quencher may interact by FRET (FRET probe pairs described in, for example, U.S. Pat. No. 6,140,054). As an alternative to FRET quenching, molecular beacon probes, 5′ exonuclease probes and yin-yang probes may utilize contact quenching, which does not require substantial spectral overlap between the fluorescent moiety's emission spectrum and the quencher's absorption spectrum. Tyagi et al. (1998) Nature Biotechnology 16: 49-53; European Patent EP 0 892 808. Published international patent application WO 2011/050173 discloses analysis of a single-stranded nucleic acid target sequence by hybridizing to the target sequence multiple probes, including one or multiple “On” probes (fluorophore/quencher dual-labeled probes that signal upon hybridization) and one or more “Off” probes (quencher-labeled probes that upon hybridization quench fluorescence from the “On” probes) and analyzing fluorescence of the “On” probes' fluorophore as a function of temperature, generally by means of a melting curve or annealing curve.
DNA binding dyes (dsDNA-dyes) are dyes that fluoresce when interacting with double-stranded nucleic acids, for example, SYBR® Green. dsDNA-dyes have been used for nucleic acid detection in two ways. The first way is to detect double-strands, whether present alone or in the presence of single strands. This involves stimulating the dye in the presence of double strands and detecting emission from the dye. Detection of double strands by dsDNA-dyes is non-specific; that is, it tells whether or not double-strands are present, but it does not tell the sequence or sequences of the strands. The second is to intercalate a dsDNA-dye into hybrids of fluorescently labeled probes and single-stranded targets, to stimulate the dye at its absorbance wavelength and to detect emission from the probe's fluorescent label at its emission wavelength, wherein the probes' labels are excited by the dye's emission by FRET. Because this involves FRET, the absorption spectrum of the probe's fluorescent moiety must substantially overlap the emission spectrum of the dye. When a dye is used in combination with one or more probes by detecting dye emission as a non-specific indicator of double-strands and by detecting probe emission as an indicator of specific sequences, there is normally a restriction that the probe signal must be detectably distinct from the dye signal. Because the most common dsDNA-dye, SYBR® Green, has essentially the same emission spectrum as the most common fluorescent moiety for probes, the fluorophore FAM (See FIG. 1 of Van Poucke et al. (2012) BioTechniques 52: 81-85), the two cannot normally be used together. See additionally Lind et al. (2006) BioTechniques 40:315-318, who report that FAM has an excitation maximum at 493 nm and an emission maximum at 525 nm, and SYBR® Green has an excitation maximum at 497 nm and an emission maximum at 516 nm. Lind et al. addressed this problem by using a FAM-labeled probe, not with SYBR Green, but with a different dsDNA-dye that is distinguishable from FAM, namely, BEBO, which has an excitation maximum at 515 nm and an emission maximum at 552 nm. Van Poucke et al. reported a TaqMan® (5′ nuclease) assay, a symmetric PCR assay that generates probe fragments carrying a fluorophore label, wherein the probes' label was FAM and wherein SYBR® Green was used to detect that an amplicon was made, in this case a double-stranded amplicon. A melting peak was obtained at about 82° C. Because SYBR signal predominated, that indicated melting of double strands, a non-specific indication that some product had been made. By then detecting at a higher temperature at which the double strands were melted, 85° C., the authors concluded that fluorescence above that resulting from a no-template control (NTC) was from probe fragments. Supporting that conclusion was the fact that there was no high-temperature melting peak, and constantly fluorescing probe fragments would not produce a melting peak. Of course, there was no detection of probe-target hybrids, because they would have melted off at a temperature below the melting temperature of double-stranded amplicon. Neither Lind et al. nor Van Poucke et al. utilized the SYBR® Green dsDNA-dye for analysis of single strands. Van Poucke et al. did not use FAM for any analysis of probe binding as a function of temperature.
This invention includes methods for analyzing single-stranded nucleic acid sequences, either RNA sequences or DNA sequences (ssDNA) utilizing dyes that fluoresce when associated with double strands, so-called DNA binding dyes or dsDNA-dyes. Methods according to this invention utilize a dsDNA-dye in combination with one or more hybridization probes that hybridize to a target nucleic acid sequence and that are labeled with a non-fluorescent quencher moiety, for example, a Black Hole quencher. Such probes are generally referred to herein as “quencher-labeled probes.” Methods according to this invention comprise analyzing fluorescence from a dsDNA binding dye as a function of temperature over a temperature range that includes the melting temperature of such hybridization probe or probes. A target sequence may be a sequence to which the probe or probes are perfectly complementary or less than perfectly complementary. In certain embodiments, quencher-labeled probes can be “in situ probes,” as explained below.
For use with a dsDNA-dye in methods of this invention a quencher-labeled probe or a probe set containing at least one non-fluorescent-quencher-labeled probe can be used to detect and analyze related sequences to which they hybridize. Probe sets useful in methods of this invention may include additionally a probe or probes that include a fluorescent-quencher label or that do not include any quencher label.
dsDNA-binding dyes in general are useful in methods of this invention. The dsDNA-binding dye most commonly used is SYBR® Green dye. Other dsDNA-dyes include ethidium bromide, DAPI, BO and BEBO (Bengtsson et al. (2003) Nucleic Acids Research 31:e45). Yet another is BOXTO (Lind et al. (2006) BioTechniques 40:315-318). At least some of these dyes are reported to be minor groove binding dyes. In methods of this invention dsDNA-dyes may be used alone or in combination.
Hybridization probes useful in methods of this invention include both linear, or random-coil, probes and structured probes. They may be RNA, DNA or combinations of RNA and DNA. They may include non-natural nucleotides, nucleotide analogs and non-natural inter-nucleotide linkages. Non-natural nucleotides and analogs that increase the binding affinity of probes include, for example, 2′-O-methyl ribonucleotides and PNA. Structured probes may comprise one strand (for example, molecular beacon probes) or two strands (for example, yin-yang probes). Certain embodiments of this invention utilize probes that initially comprise primer extensions and whose construction is completed in situ as part of post-amplification detection. For convenience we refer to such probes as “in-situ probes.”
Hybridization probes useful in methods of this invention include unlabeled probes, or unlabeled oligonucleotides, and labeled probes. Labels are categorized with regard to the dsDNA-dye with which the probes are used. To obtain dye emissions one excites a sample with light having a wavelength at or near the absorption maximum of the dye, and emissions are detected at or near the maximum emission wavelength of the dye. This is commonly referred to as reading in the dye channel of an instrument or, if the dye is SYBR® Green, reading in the SYBR® Green channel. As an example, for SYBR® Green dye, a typical excitation is at 470 nm, for example by a blue LED, and detection is made using a 510-nm emission filter. A first category of labels is “dye-quenching labels,” that is, labels that quench dye fluorescence when the probe is hybridized to its target, forming a double-stranded region, and the dye is excited at or near its maximum absorption wavelength. We believe that dye quenching is by fluorescence resonance energy transfer (FRET), and for convenience refer to it herein as FRET quenching. In general, or FRET to occur there should be significant overlap between the emission spectrum of the dye and the absorption spectrum of the label. A dye-quenching label may be a non-fluorescent quencher, for example DABCYL, a Black Hole quencher, a QSY quencher, an Eclipse quencher, a Deep Dark quencher, an Iowa Black quencher or a Blackberry quencher. If a non-fluorescent quencher is highly efficient, for example, a Black Hole Quencher 1 or a Black Hole Quencher 2, a single quencher label will suffice. If the quencher is less efficient, for example DABCYL, at least two quencher labels may be desired or even necessary. Probes with a single quencher moiety are simpler and less expensive to synthesize than dual-labeled probes. In-situ probes, as finally constructed, can include a single non-fluorescent quencher or no label. Alternatively, a dye-quenching label may be a fluorescent moiety, for example a fluorophore or a Quantum Dot, that is not excited directly at the excitation wavelength used to excite the dye but rather accepts energy from the dye by FRET, thereby quenching dye emission, and remits fluorescence at a wavelength different from (longer than) the wavelength at which the dye's emission is detected. For example, the fluorophore Cal Orange accepts energy from the dye SYBR® Green. Such a label is stimulated indirectly by exciting the ds-DNA dye, but its fluorescence is acquired, not at a wavelength at or near the maximum emission of the dye, but rather at a longer wavelength at or near the emission maximum of the fluorescent label. When emissions are detected at or near the wavelength of maximum dye emission, fluorescence emission from the label is not detected, and its impact is simply quenching of the dye. Fluorescent labels of this category are known for use in ResonSense® probes. A ResonSense® probe is a single-stranded oligonucleotide labeled with a fluorophore that accepts fluorescence from the dsDNA-dye. When a sample containing a hybridized ResonSense® probe is illuminated at the absorption wavelength of the dsDNA-dye, the label absorbs energy from the dye by FRET and reemits light at a longer wavelength equivalent to the emission spectrum of the fluorophore. The fluorophore is one that is spectrally distinct from the dye. When a probe so labeled is not hybridized, excitation of the dye does not indirectly excite the fluorophore, so the fluorophore need not be quenched. However, if it desired to stimulate the fluorophore directly, a probe with a dye-quenching fluorescent label is dual-labeled and of a construction that causes it to be quenched when unhybridized but to be unquenched and to emit a detectable signal when hybridized, for example, a quenched ResonSense® probe, a molecular beacon probe or a yin-yang probe. A second category of labels is labels that are excited by the wavelength of light used to excite the dye. An example is the fluorophore FAM when used with SYBR® Green dye. FAM has a maximum excitation wavelength of 493 nm and a maximum emission wavelength of 525 nm, whereas SYBR® Green has a maximum excitation wavelength of 497 nm and a maximum emission wavelength of 521 nm. Excitation of the dye also excites the label, and detection at an emission wavelength appropriate for the dye detects emissions from both the dye and the label. A label of this category results in an emission spectrum that is different from the emission spectrum (both as a melting curve and first derivative curve) that would be obtained from the dye alone in the absence of the label. We refer to labels of this category as “dye-coincident labels.” A probe with a dye-coincident label is dual-labeled and of a construction that causes it to be quenched when unhybridized but to be unquenched and to emit a detectable signal when hybridized, for example, a molecular beacon probe or a yin-yang probe. A third category of labels are labels that neither are excited by the light used to excite the dye nor are capable of accepting energy from the dye by FRET, because their absorption spectra overlap neither the absorption spectrum nor the emission spectrum of the dye. An example is the fluorophore Alexa Fluor 790 when used with the dye DAPI. Alexa Fluor 790 absorbs at a wavelength longer than DAPI's emission, so excitation of the dye does not excite the label either directly or indirectly. Labels in this category are irrelevant insofar as concerns excitation and detection at wavelengths appropriate for the dye, but they can be used to gain information by separate excitation and detection. We refer to labels of this category as “non-overlapping labels.” A probe with a non-overlapping label is dual-labeled and of a construction that causes it be quenched when unhybridized but to be unquenched and to emit a detectable signal when hybridized, for example, a molecular beacon probe or a yin-yang probe.
In this specification we refer to melting temperatures (“Tms”) of primers and probes. “Melting temperature” is the temperature at which a nucleic acid hybrid, for example, a probe-target hybrid or primer-target hybrid, is 50% double-stranded and 50% single-stranded. It will be appreciated that the Tm of a probe relative to a more complementary target sequence is higher than the Tm of that probe relative to a less complementary target sequence containing a deletion, an addition, or one or more mismatched nucleotides For a particular assay the relevant Tm's may be measured. Tm's may also be estimated by calculation utilizing known techniques. For this purpose we utilize Tm[0], a calculated Tm utilizing the “nearest neighbor” method (Santa Lucia, J. (1998), PNAS (USA) 95: 1460-1465; and Allawi, H. T. and Santa Lucia, J. (1997), Biochem. 36: 10581-10594). For labeled probes, both linear and structured, it will be understood that the calculated Tm[0] is an approximation. For instance, the data obtained in Example 1 shows that labeling a probe with a Black Hole Quencher 1 reduces the actual Tm of the probe by about 5° C. “In-situ probes,” described more fully below, have both an initial Tm and a final Tm. The initial Tm is the temperature at which 50% of the 3′ ends of the initial probe sequence in the primer extension touch down on the target sequence within the same strand. Following extension in situ to create the final probe, the initial Tm of the hybrid is replaced by the higher final Tm.
Methods of this invention utilize probe sets, by which we mean one probe or multiple probes that hybridize to a target sequence. A single probe, including a single in-situ probe, may be utilized for detection of a single nucleotide polymorphism (“SNP”). In such an embodiment the probe is a dye-quenching probe whose complementary sequence in the target includes the SNP. When a probe set for a particular target sequence comprises a single probe, the probe includes a non-fluorescent quencher label. An example of such an embodiment is illustrated by Example 1, wherein a single probe is labeled with either one or two Black Hole quenchers. A single dye-quenching probe can also be multiply labeled with a non-fluorescent dye-quenching label and a fluorescent dye-quenching label, a dye-coincident label or a non-overlapping label. We normally design a single probe to be more complementary to a wild-type or drug-sensitive variant of the target sequence, and less complementary to mutant or drug-resistant variants. In certain embodiments, including some embodiments utilizing in-situ probes, we do the reverse. In the case of self-reporting in-situ probe, it is generally desirable to design the 3′end of the single-strand to be more perfectly complementary to one sequence variant, for instance the wild-type version of the sequence, and less perfectly complementary to other versions, SNPs, within the sequence to which the 3′ end initially hybridizes.
When a probe set contains multiple probes, the probe set includes at least one dye-quenching probe labeled at least with a non-fluorescent quencher, as described in the preceding paragraph. A dye-quenching probe may be an in-situ probe. Preferred multiple-probe sets include two or more of such dye-quenching probes. An example of such an embodiment is illustrated by Example 2, wherein the probe set includes six probes, each singly labeled with a Black Hole quencher. Here again, such probes in multi-probe sets can be multiply labeled with a dye-quenching fluorescent label (see Example 5), a dye-coincident label (see Example 3) or a non-overlapping label. In some embodiments a set of multiple probes can include one or more unlabeled probes or one or more probes that are labeled only with a fluorescent dye-quenching label. An in-situ probe, for example, may be unlabeled in certain embodiments. In the case of multi-probe sets it is required that there be sufficient dye quenching to provide meaningful distinguishing information regarding the target sequence be obtained when a sample is excited at or near the maximum absorption wavelength of the dsDNA-dye and detection is at or near the maximum emission wavelength of the dye, as is explained below in connection with Example 5.
Principal criteria that are utilized to design a multi-probe set are the temperature range that is to be utilized for detection and the length of the target sequence to which the set hybridizes. The temperature range is below the Tm of double-stranded amplicons, which determines an upper limit. The lower limit is a chosen temperature within the capability of the detection instrument, usually at least as high as room temperature. With a temperature range selected, the probe Tm's are designed to be in the range. To fit a given type of probe, say a DNA probe, in the range, one can adjust the length of the probe or its degree of complementarity to the target-sequence variants, or both. When probes of a multi-probe set hybridize to their single-stranded nucleic acid target sequence, the probes spread along the target sequence so as to pick up sequence variations. They may hybridize directly next to one another, there may be modest overlap of adjacent probes, or there may be gaps of one, a few, or even many nucleotides between adjacently hybridized probes. We prefer that gaps be minimized Probes in a probe set may have, and generally do have, different probe-target Tm's, which permits variations in fluorescent contours and fluorescent signatures to occur at multiple temperatures in the detection range. Probes Tm's differing by at least 2° C. will change the fluorescence signature by altering the shape of a valley (or peak). Probes whose Tm's differ by 5° C. or more advantageously lead to separate melting or annealing peaks. However, certain embodiments may include two probes having the same or almost the same Tm, which we refer to as “Tm stacking,” in which case both probes will contribute to a single melting or annealing peak, for example see
Methods of this invention include use of multiple probe sets in the same detection mixture, that is, a probe set for each of at least two target sequences. The probe sets may be distinguishable by Tm. For example, a probe set for a first target sequence may include probes having Tms in a range of 55-70° C., and a probe set for a second target sequence may include probes having Tms in a range of 40-54° C. Alternately, two probe sets may have overlapping Tms. See Example 3, in which a probe set for a 16s-gene target sequence is used in a single detection mixture with a probe set for a gyrase B-gene target sequence, and each probe set, when used alone, produced (negative) melting peaks near 50° C. Nonetheless, when the sets were used together, combined detection has been shown to be capable of yielding strain-distinguishing information.
In-situ probes-can be used in combination with additional quencher-only probes or dual-labeled probes. Sequence-specific probes are particularly useful in such sets because they selectively hybridize to, or selectively fail to hybridize to, particular SNP's. Formation of such a probe-target hybrid significantly reduces the flexibility of said single strand and thus inhibits formation of a self-reporting in-situ probe. The Tm of the sequence-specific probe is designed to be higher, for instance 60° C., than the Tm of the initial Tm of the 3′end to its target, say 45° C. Upon extension of the 3′ end of the final-Tm of the 3′end will increase and can become equal to or higher than the Tm of the sequence-specific probe.
Methods of this invention include contacting, under hybridizing conditions, a sample that includes copies of at least one single-stranded oligonucleotide that is a nucleic acid strand containing at least one target sequence with a dsDNA-dye and a probe set for the at least one target sequence, so as to hybridize the probes in the set to the target sequence or sequences. Such a nucleic acid strand may be DNA or RNA. It may contain a single target sequence, in which case the target sequence may comprise essentially the entire strand, or it may contain at least two target sequences, in which case the strand is sufficiently long to encompass all target sequences. Copies of the single-stranded nucleic acid target sequence can be provided by any means. Single-stranded nucleic acid target sequences for analysis can in some instances be obtained directly by isolation and purification of nucleic acid target strands in a sample. For example, DNA plus strands containing target sequences can be obtained from samples containing double-stranded DNA by separating plus and minus DNA strands and isolating target-sequence containing strands, for example the plus strands, by removing the complementary strands, for example the minus strands. Some embodiments of methods according to this invention include nucleic acid amplification. If the amplification is symmetric, the amplification product or products are double-stranded, and copies of the at least one target strand can be obtained by separating plus and minus strands, as described above. Numerous known amplification methods can be used, including methods that employ the polymerase chain reaction (PCR), NASBA, SDA, and rolling circle amplification. For example a symmetric PCR method may include labeling one primer with biotin and separating the biotin-containing product strands from the other strands by capture onto an avidin-containing surface, which is then washed. Amplification can start with double-stranded nucleic acid strands that contain a target sequence, or amplification can start with single strands that contain a target sequence or a sequence complementary to a target sequence. Amplification may include reverse transcription followed by amplification of cDNA, where the starting sample is RNA. The above methods can be performed in a microfluidics device, which may permit, for example, the inclusion of wash steps. For use of dsDNA-dye in a microfluidics device, methods of this invention include adding to the source of dye a double-stranded carrier to overcome the problem of the dye sticking to the walls of the device.
In certain preferred methods, copies of the single-stranded target sequence are provided by non-symmetric nucleic acid amplification. Single-stranded deoxyribonucleotide (DNA) target sequences for analysis, either conserved sequences or variable sequences, can be obtained by non-symmetric amplification methods that utilize one primer in a limiting amount such that it runs out during the amplification reaction (the limiting primer), after which single-stranded amplification product continues to be produced utilizing the other primer (the excess primer). Most commonly used non-symmetric amplification methods are PCR methods, including asymmetric PCR and LATE-PCR, either of which can be combined with reverse transcription for starting with an RNA sequence. Our preferred amplification method is LATE-PCR. Non-symmetric amplification methods generate both double-stranded amplification products, or “amplicons”, and single-stranded amplification products (amplicons) that contain target sequences to be analyzed.
Presence of double strands in the sample during fluorescence acquisition has implications for design of the detection method. When double strands are present with single strands in a sample being analyzed, the dsDNA-dye is added in an amount sufficient to bind not only to the double strands, but also to the relatively short probe-target hybrids. If the sample contains only single-stranded nucleic acids, probe Tm's are not constrained. They can range from very low, generally room temperature, to very high, 90° C. for example. However, if signal-producing double strands are also present during fluorescence acquisition, for example, double-stranded amplification products (or double-stranded “amplicons”), probe Tm's are kept below the Tm or Tm's of the signal-producing double strands.
Methods of this invention include stimulating a sample containing at least one target, dye and a probe set for the at least one target with light of a wavelength at or near the dye's absorption maximum and detecting emissions at or near the dye's emission maximum over a temperature range that includes the Tms of the probes. Considering a single target sequence-containing strand, which in certain embodiments is a single-stranded amplicon, the highest Tm will be the melting temperature of the strand itself if hybridized to its complementary sequence, or complement. Probes in a probe set, being shorter than the entire strand, will have lower Tm's, so detection of probe melting takes place at temperatures below the strand Tm. The temperature range for detection preferably includes the Tm of double-stranded target, if present. The step of detecting may be performed as a melt, in which the temperature is lowered to the bottom of the range and then progressively increased over time to the top of the range with frequent acquisition of emissions to generate a fluorescent contour, namely, a melting curve. This step may be performed in the opposite manner, in which the temperature is raised to the top of the range and then progressively lowered over time to the bottom of the range with frequent acquisition of emissions to generate an annealing curve. In some cases, it may be desirable to carry out two cycles of melting or annealing. For instance, when in-situ probes are used with sequence-specific probes the first cycle of melting can result in 3′end extension, thereby increasing the initial Tm to the final-Tm. This change, in turn, can alter the level of sequence-specific probe hybridization. This change in Tm can be observed by using two rounds of annealing or melting of probe-target hybrids.
In some embodiments a complete melting curve or annealing curve can be replaced by fluorescence acquisition at only a few selected temperatures, in some cases only a single selected temperature. If one or more of the probes contains a non-overlapping label, the method may include separately stimulating that label directly with light of an appropriate wavelength, and detecting emission at or near the label's emission maximum as a function of temperature or as a function of cycle number for real-time detection, or both. If one or more of the probes contains a fluorescent dye-quenching label, the method may include stimulating that label either directly or indirectly (by exciting the dye) and detecting emission from the label as a function of temperature or as a function of cycle number for real-time detection, or both. Detecting is normally done at a relatively narrow wavelength range that, for example, acquires fluorescence only from the dsDNA-dye and a dye-coincident label and excludes fluorescence from other fluorophores. However, detecting at a broad wavelength range that acquires fluorescence from the dye, dye-coincident label and at least one additional fluorophore is not excluded.
Methods of this invention include a step of comparing the emission as a function of temperature at the dye's wavelength from the sample containing the target nucleic acid sequence to at least one corresponding emission for a reference sample of known composition, generally a sample of known sequence. Melting curves can be compared, as can annealing curves. Readings at select temperatures can be compared to readings at select temperatures. When detection includes obtaining a temperature-dependent fluorescent contour, measured either as a melting fluorescent contour or an annealing fluorescent contour, the fluorescent contour can be mathematically converted into a fluorescent signature, which is the first derivative of the fluorescent contour. Comparison with a reference can be comparison of fluorescent signatures. The lowest value of each negative peak below background, which we sometimes refer to as a “valley”, or the total area of each valley below background, is proportional to the amount of the target present initially in the sample. A fluorescent signature can be further converted into a normalized fluorescent signature by dividing all values of the fluorescent signature by the lowest valley or the highest positive peak value, if there is a fluorescent label that contributes a fluorescent peak. Comparison with a reference can be comparison of normalized fluorescent signatures. Another comparison useful in methods of this invention is a ratio of fluorescence at two selected temperatures, wherein the ratio of a sample containing the target is compared to the ratio of a reference. Comparisons can be done by analyzing a sample and one or more references in parallel. Alternatively, comparison can be to a library of fluorescent signatures or other results obtained from reference samples.
Methods according to this invention may be used, for example, to analyze a sample for the presence of a human or pathogen mutation, or to screen a sample to detect which one of multiple possible target species is present. Methods of this invention may include multiplex detection; that is, probe set may be included for more than one target.
This invention also includes reagent kits for performing analytical methods according to this invention that include non-symmetric nucleic acid amplification to supply ssDNA target sequences for analysis. Such kits include, for each target, at least a limiting primer and an excess primer, dNTPs, dsDNA-dye, at least one probe set as described above, and DNA polymerase.
While wishing not to be bound by any theory, we believe, based significantly on the work reported in the Examples, that a fluorescent contour of a closed-tube reaction that contains multiple fluorescent or quenching components provides an instantaneous or near instantaneous temperature-dependent description of all of the components of the system (whether an oligonucleotide or a dsDNA-dye), including those whose fluorescence or absorption increases as a function of temperature and those whose fluorescence or absorption decreases as a function of temperature, as well as all molecular interactions of all such fluorescent and non-fluorescent components in the system including, for instance, the proportion of each dye-quenching probe that is hybridized to or not-hybridized to a possible target at a particular temperature. Although we sometimes refer to the first derivative of a “fluorescent contour,” that is, a graph of fluorescence intensity versus temperature, in such a system as a melt curve or annealing curve, it is not a traditional melt curve or annealing curve whose peak traditionally defines the melting temperature, Tm value, of a probe/target hybrid. Rather, in methods of this invention a fluorescent contour and its first derivative, a “fluorescent signature,” describe the sum of numerous temperature-dependent dynamic equilibriums among all of the reaction components in all of their possible conformations, as well as all interactions of these components. It is nonetheless surprising that alteration of a single component, such as the sequence of an amplified target, leads to a significantly detectable change in the fluorescent signature obtained from a dsDNA-dye.
In methods of this invention a dsDNA-dye is included in reaction mixture during fluorescence acquisition. Determining an optimum amount of dye in a particular embodiment is readily done by simple trial and error. In the Examples we performed LATE-PCR amplifications in which SYBR® Green concentrations of 0.24× and 0.48× were satisfactory, but a concentration of 0.72× prevented amplification (complete inhibition). We also performed LATE-PCR reactions using a microfluidics device having fill channels of PDMS, to which SYBR® Green dye is known to stick. In that case we included in the reaction mixture a source of double strands that carried sufficient dye into the reaction mixture during amplification when the initial SYBR® Green concentration was 0.96×.
Probe sets used in methods of this invention include use of at least one labeled hybridization probe. Hybridization probes useful in methods of this invention include both linear, or random-coil, probes and structured probes. They also include in-situ probes. They may be RNA, DNA or combinations of RNA and DNA. They may include non-natural nucleotides, nucleotide analogs and non-natural inter-nucleotide linkages, for example, PNA probes or 2′-O-methyl ribonucleotides. They may be linear (random coil) or structured, for example LNA probes. Structured probes may comprise one strand (for example, molecular beacon probes) or two strands (for example, a yin-yang oligonucleotide structure). Additional probe types that may be used include Light Cycler probes and minor groove binding probes. Several such probes are described in WO 20111/050173A1, where they are referred to as signaling probes.
Structured probes useful in methods of this invention also include “in-situ probes.” Construction and use of in-situ probes is shown schematically in
The final in-situ probe construction is shown in
The in-situ probe shown in
For this approach, probing sequence 86 is designed to be very allele-specific so that it will not hybridize to the normal target sequence at reasonably low temperature to be used during in-situ probe formation and during detection. Such allele-specific intra-molecular priming and extension can be achieved by methods known in the art for the design of allele-specific primers. See, for example, Tyagi et al. U.S. Pat. No. 6,277,607. In detection by melting at temperatures above the stem-formation temperature, the normal single-strands will not generate a dye signal, because they remain single-stranded. Detection of mutant-specific in-situ probes depends only on the absolute number of mutant targets in the mixture and the sensitivity of detection in the dye channel.
Probe sets used in methods of this invention include at least one probe having a dsDNA-dye-quenching label. Preferred dye-quenching labels are non-fluorescent quenchers, more preferably non-fluorescent quenchers that are efficient acceptors of energy from the deDNA-dye that is utilized. Less efficient non-fluorescent quenchers or fluorescent moieties that accept energy from the dsDNA-dye by FRET are less preferred as dye-quenching labels. If a probe has, for example, only a fluorescent quencher for the dye, that is, a linear ResonSense® probe, the label will not be excited at the excitation wavelength used to excite the dye, when the probe is not hybridized; but, when the probe is hybridized, the label will be excited indirectly by excitation of the dye. A probe with a dye-quenching label may include at least one additional label. For example, a non-fluorescent dye-quenching label may be added to a ResonSense® probe, which provides additional dye quenching and also permits fluorescence acquisition at the emission wavelength of fluorescent label by exciting that label directly. A probe with a non-fluorescent dye-quenching label may also include at least one dye-coincident or non-overlapping label, for example a fluorophore or Quantum Dot, and have a structure that causes a detectable change in fluorescent signal from its fluorescent label when it hybridizes to a nucleic acid target sequence. When such a probe is in solution, the fluorescent label is quenched by the non-fluorescent quencher label. That quenching may be achieved by any mechanism, typically by FRET (Fluorescence Resonance Energy Transfer) between a fluorescent moiety, or by contact quenching, which is generally more efficient and, therefore, preferred. We sometimes refer to such probes as “signaling probes” or simply as “On” probes. On probes may be linear (end-labeled linear probes such as those sold as TaqMan® probes for the 5′ exonuclease assay). They may be molecular beacon probes (Tyagi et al. (1996) Nature Biotechnology 14:303-308), including Low-Tm molecular beacons (WO 2006/044994; Sanchez et al. (2004) PNAS (USA) 101: 1933-1938). Molecular beacon probes are single-stranded hairpin-forming oligonucleotides bearing a fluorescent label moiety, typically a fluorophore, on one end, and a non-fluorescent quencher (here one that quenches emission both from the fluorophore and the dsDNA-dye) on the other end. When a molecular beacon probe is in solution, it assumes a closed conformation wherein the quencher interacts with the fluorescent moiety, and the probe is dark. When the probe hybridizes to its target the fluorophore and the quencher moieties are separated and the probe fluoresces in the color of the fluorescent moiety. We sometimes refer to such probes as “Lights-On” or simply “On” probes. An additional type of “On” probe that we have developed is a double-stranded probe having the oligonucleotide structure of yin-yang probes (Li et al. (2002) Nucl. Acids Res. 30, No. 2 e5), wherein the quencher-labeled strand, rather than the fluorescently labeled strand, has a higher Tm.
For use in this invention fluorescent labels of On probes fall, for example, into one of several categories:
Probe sets used in methods of this invention may comprise or include probes that have only one or more dye-quenching labels. If the label or labels are non-fluorescent quenchers, we refer to such probes as “quencher-only” probes or simply as “Off” probes. Quencher-only probes useful in methods of this invention include linear probes and hairpin probes (probes described in WO 2011/0501731, where they are referred to as quencher probes, which is herein incorporated by reference). In some embodiments the non-fluorescent quencher of a quencher-only probe is replaced with a fluorescent moiety that absorbs energy from the dsDNA-dye by FRET. Such a probe is known as a ResonSense® probe. A ResonSense® probe is a single-stranded oligonucleotide labeled with a fluorophore that accepts fluorescence from the dsDNA-dye. Excitation of a sample at the absorption wavelength of the dsDNA-dye results in indirect excitation of the fluorophore, which reemits visible light at a longer wavelength equivalent to the emission spectrum of the fluorophore. The fluorophore is one that is spectrally distinct from the dye. When emission is detected at the wavelength of the dye, the ResonSense® probe acts as a dye-quenching probe, that is, it acts as an Off probe in the dye channel. A ResonSense® probe differs from a quencher-only probe labeled with a non-fluorescent quencher in that, in addition to quenching at the wavelength of the dsDNA-dye, it can also signal at its own emission wavelength when the dye is excited. When a ResonSense® probe is used, analysis generally includes exciting the dye and detecting fluorescence, not only at the emission wavelength of the dsDNA dye, but also separately detecting fluorescence at the emission wavelength of the ResonSense® probe's fluorescent moiety. Off probes other than in-situ probes, and ResonSense® probes typically are simply linear (or random-coil) probes. Structured quencher-only probes are not excluded, however. For example, such a probe could have the hairpin structure of a molecular beacon probe but contain only one or more dye-quenching labels, either fluorescent or non-fluorescent. Or it could have the double-stranded structure of a yin-yang probe (Li et al. (2002) Nucl. Acids Res. 30, No. 2 e5), wherein the probe strand that is complementary to a single-stranded target is labeled only with one or more dye-quenching labels, either fluorescent or, preferably, non-fluorescent quencher, particularly where the quencher-labeled strand has the higher Tm against its target, in this case the single-stranded target sequence being investigated.
Probe sets used in methods of this invention may include On probes, probes that have at least one fluorescent label and at least one non-fluorescent quencher label and that have a structure such that, when not hybridized, the fluorescent label is quenched, but, when hybridized, the fluorescent label is unquenched. Commonly, such On probes are dual-labeled with a fluorophore and a non-fluorescent quencher. When preferred multi-probe sets are hybridized on a target sequence, the fluorescent label of an On probe lies within quenching distance of a non-fluorescent quencher of an Off probe or another On probe. See Example 5, where the fluorophore of On probe 5 is quenched by Off probe 6. In probe sets of this invention, either an On probe or the adjacent probe that quenches it may have the higher Tm. As stated above, certain preferred On probes are single-stranded molecular beacon probes. Another type of useful Off probes is double-stranded and dual-labeled probes that are comprised of a pair of partially complementary oligonucleotides, one of which is labeled with only a non-fluorescent quencher and the other of which is labeled with only a fluorophore (either dye-quenching or non-overlapping), such that when the temperature is lowered in the absence of a target the two strands hybridize to one another, thereby quenching fluorescence of the fluorophore. Probes of this type can be distinct from customary yin-yang probes inasmuch as the non-fluorescent-quencher-labeled strand is the strand that is complementary to the single-stranded target sequence being analyzed. That strand has a higher Tm for the target strand than for the fluorophore-labeled strand of the probe. When the non-fluorescent-quencher-labeled strand binds to its target, it acts like a single-stranded quencher-only probe whose hybridization to the target is detected as decrease in the total dsDNA-dye fluorescence of the system. Detection of fluorescence from now unquenched, single-stranded copies of the fluorophore-labeled strand in a different fluorescent channel is observed as an increase in fluorescence, which serves as a measure of accumulated target strand. The extent of complementarity between the two probe strands is adjustable by altering the composition of either strand, preferably providing that the Tm of the quencher-labeled strand to the target exceeds its Tm to the fluorophore-labeled strand. When that Tm to the target is only a few degrees higher, typically ≦5° C., binding of the quencher-labeled stand to the target will be sequence specific. In contrast, when that Tm to the target is many degrees higher, typically ≧10° C., binding of the quencher strand to the target will be mismatch tolerant. Double-stranded probes in which one strand is quencher-labeled and the other strand is unlabeled are similar except that only one of the strands is labeled. The unlabeled strand does not generate a signal indicative of binding of the quencher-labeled strand to the target strand.
Probe sets useful in methods of this invention can also include one or more unlabeled probes. The gyrase B probe set in Example 3 includes an unlabeled probe that hybridizes to the variable target sequence between two dye-quencher-labeled On probes. In that case the unlabeled probe-target hybrids of two of the variants tested contained two mismatches. Multiple unlabeled probes in a probe set tend to reduce the discriminatory power of the set in the dye channel. In designing a probe set, attention is paid to this tendency, and over-inclusion of unlabeled probes is avoided. Probe sets useful in methods of this invention can include unlabeled in-situ probes.
Design of multi-probe sets for use in methods of this invention is within the ordinary skill of persons familiar with probe design. We describe here several considerations that we take into account. Two primary considerations, as stated above, are the temperature range that is available for detection (we refer to this as the “temperature space”) and the length of of the single-stranded target sequence. Our preferred sets have probes of varying Tm's spread over the target sequence. As to temperature, we generally design a set to have probes with different Tm's against the target sequence, which permits variations in fluorescent contours and fluorescent signatures to occur at multiple temperatures in the detection range. Probes Tm's differing by at least 2° C. will change the fluorescence signature by altering the shape of a valley (or peak). Probes whose Tm's differ by 5° C. or more advantageously lead to separate valleys (or peaks) in the fluorescence signature. However, certain embodiments may include two probes having the same or almost the same Tm, which we refer to as “Tm stacking,” in which case both probes will contribute to a single melting or annealing peak. In designing a probe set for a LATE-PCR amplification reaction, we prefer that the maximum probe Tm against all target sequence variants be below the annealing temperature used in the amplification reaction, which generally is not higher than about 80° C. Design parameters for attaining a desired probe Tm include changing its length, changing its G-C content (adjusting the probe along the target), introducing mismatches, changing the labeling, including non-conventional nucleotides, or introducing structure. Computer programs utilizing the “nearest neighbor” formula are available for use in estimating actual Tm's for set design by calculating probe and primer Tm's against perfectly complementary target sequences and against mismatched target sequences. For Examples in this specification, we have utilized the program Visual OMP (DNA Software, Ann Arbor, Mich., USA), which uses the nearest neighbor method, for calculation of concentration-adjusted Tm's, which we refer to as Tm[0]'s, of primers' or probes' binding sequences against the wild-type or drug-sensitive variant of the target sequence. Particularly for labeled probes, both linear and structured, it will be understood that the Tm so calculated is an approximation. For instance, the data obtained in Example 1 shows that labeling a probe with a Black Hole Quencher 1 reduces the actual Tm of the probe by about 5° C. With in-situ probes, both the initial Tm and the final Tm are taken into account—the initial Tm for construction and the final Tm for detection.
In multiplexing, as shown in Example 3, two probe sets may have Tms in the same range such that fluorescence in the dye channel at a given temperature is influenced by both probe sets. If two or more probes in a probe set or sets have the same or very similar Tm's (i.e. <2° C. difference) their simultaneous hybridization to target is observed by the combined magnitude of the quenched fluorescence at the combined Tm temperature. In contrast, if two or more probes in a set or sets have Tm's that are 2° C. or more separated from one another their simultaneous hybridization to target is observed by their combined quenching over a temperature range that is greater than that of a single probe. For this reason it is generally desirable to design probes in a set or sets whose Tm's differ by at least 2° C., preferably by at least 5° C. and, in certain embodiments by at least 10° C.
As to spacing along the target sequence, adjacent probes in a set may hybridize immediately adjacent to one another. Alternatively, adjacent probes may have overlapping binding sites, provided that the amount of overlap does not preclude either probe from hybridizing (see Example 2, wherein Off probes 2 and 3 overlap by one nucleotide). Alternatively, there may be a gap of a few nucleotides between adjacent probes. We prefer to minimize gaps. We prefer to place a probe having at least a non-fluorescent quencher label complementary to each variable nucleotide in a target sequence. If a target sequence has secondary structure, a hairpin having a certain Tm, we prefer to span the hairpin with two adjacent probes of the equivalent or higher Tm. Probe sets useful in methods according to this invention include dye-quenching probes. If the set includes only one probe, it is a dye-quenching probe, preferably a probe labeled only with one or more non-fluorescent quenchers, most preferably a single, strong non-fluorescent quencher. If the set includes multiple probes, it includes a sufficient number of dye-quenching probes, either quencher-only probes or dual-labeled probes with non-fluorescent quenchers, to be informative regarding the target sequence. As shown in Example 5, that can be determined empirically.
Probes useful in this invention have target-complementary sequences that are generally about 10-40 nucleotides for typical DNA or RNA probes of average binding affinity. The Examples illustrate the use of DNA probes having target-binding sequences 11-30 nucleotides long (low-temperature hairpin probes having the oligonucleotide structure of molecular beacon probes have additional nucleotides that are not complementary to the target but participate in forming a double-stranded stem when the probes are not hybridized to the target sequence). If means are included to increase a probe's binding affinity, the probe can be shorter, as short as seven nucleotides, as persons in the art will appreciate. A label can be attached to a probe at any nucleotide position, including, without limitation, one end of a probe. Columns for synthesis of oligonucleotides may be purchased with a non-fluorescent quencher already attached to what will become the 3′ end of a probe synthesized on the column.
In the case of self-reporting in-situ probes, the length of the probe is determined by several factors: 1) whether or not the 3′ end of the same molecule initially hybridizes to a complementary target sequence; 2) whether the 3′end extends toward the 5′ end; 3) the distance of the initial hybridization sequence from the 5′ end of the molecule. As a result the length of the probe is only predicted in advance. Moreover, the final (extended) length of the probe's stem can be designed to be significantly longer than a conventional probe. A long conventional probe would likely have a Tm above the annealing temperature used for amplification, but a self-reporting in-situ probe having a stem of equivalent length only comes into being after amplification has taken place.
A target sequence to be analyzed by a method of this invention may be, and ordinarily is, a variable sequence. Probes, particularly structured probes, can be constructed so as to hybridize only to perfectly matched variants of target sequences (that is, to be “allele-specific”) at the lowest end of the temperature range utilized for detection, even room temperature. We do not use such probes in single-probe sets in methods of this invention, because, while they differentiate between perfect complementarity and imperfect complementarity, they do not differentiate one imperfect complementarity from another imperfect complementarity. Nor do they generate a fluorescent signature if the target sequence variant is imperfectly complementary to the probes. Allele-specific probes can be included in multi-probe sets for use in methods of this invention, as they will affect the overall signature. It is preferred, however, that most, or in some cases all, probes hybridize to two or more variants of the target sequence at temperatures within the temperature range being utilized. The Tms of such probes will vary with the number and type of mismatches. For instance, the probe in Example 1 was perfectly complementary to a drug-sensitive bacterial strain, but the probe had a single C-to-C mismatch with respect to a drug-resistant strain. As shown in
In the case of a self-reporting in-situ probe the 3′ end of the variable sequence of interest (sequence 86A in
When non-symmetric amplification is employed, we prefer that the probe or probes in the probe set be “low-Tm probes,” that is, probes that do not hybridize to the target sequence during amplification and, therefore, are not cleaved during the reaction. Preferably such probes have Tm's against all suspected or anticipated target sequence variants are at least 5° C. below the Tm of the limiting primer. The extension temperature that is utilized is sufficiently low for extension of the limiting primer but sufficiently high to avoid probe cleavage. When low-Tm probes are employed, detection and analysis of single-strands as a function of temperature can be obtained, not only during post-amplification melting or annealing, but also at intervals during the amplification reaction (for example, all or selected cycles of PCR amplification) by temporarily dropping the temperature below the annealing temperature and then resuming amplification at higher temperatures. To generate a fluorescent contour following amplification, a probe must be available for hybridization during fluorescence acquisition during the detection step. Certain amplification methods, notably the 5′ nuclease (TaqMan®) method, rely on probe cleavage during the amplification reaction, and we employ probe cleavage only for separate analysis of the amount of double-stranded amplicon that is produced during amplification. If only one or more quencher-only probes are used, probe cleavage does not increase background fluorescence in the fluorescent color characteristic of the dsDNA-dye and, therefore, may be used with a probe concentration that is sufficiently high to permit post-amplification hybridization and analysis with uncleaved probes. It is preferred to avoid cleavage of even quencher-only probes, however, so that their concentration does not change in a variable manner prior to end-point analysis. If at least one probe is fluorescently labeled in the color of the dsDNA-dye, its cleavage during amplification produces background fluorescence that will be present during detection and analysis of the single-strand, which is undesirable. In that case probes should be used whose fluorescence does not depend on cleavage, preferably low-Tm probes.
In methods of this invention, a single-stranded target sequence for probing can be provided in any manner that affords sufficient copies for obtaining a melt contour or annealing contour. Many embodiments include nucleic acid amplification utilizing a pair of primers to amplify a target sequence. Amplification may be symmetric, such as symmetric PCR, followed by separation of strands complementary to the single-stranded target sequence to obtain an abundance of single strands containing the target sequence. Alternatively, amplification may be non-symmetric, that is, an amplification method that produces both double-stranded amplicons and an abundance of single-stranded amplicons containing the target sequence. Examples of non-symmetric amplification methods include asymmetric PCR and LATE-PCR. Preferred non-symmetric amplification methods are LATE-PCR methods for starting with DNA or RNA (RT-LATE-PCR). LATE-PCR amplifications and amplification assays are described in, for example, European patent EP 1,468,114 and corresponding U.S. Pat. No. 7,198,897; published European patent application EP 1805199 A2; Sanchez et al. (2004) Proc. Nat. Acad. Sci. (USA) 101: 1933-1938; and Pierce et al. (2005) Proc. Natl. Acad. Sci. (USA) 102: 8609-8614. LATE-PCR is a non-symmetric DNA amplification method employing the polymerase chain reaction (PCR) process utilizing one oligonucleotide primer (the “Excess Primer”) in at least five-fold excess with respect to the other primer (the “Limiting Primer”), which itself is utilized at low concentration, up to 200 nM, so as to be exhausted in roughly sufficient PCR cycles to produce fluorescently detectable double-stranded amplification product (double-stranded amplicon). After the Limiting Primer is exhausted, amplification continues for a desired number of cycles to produce single-stranded amplicon using only the Excess Primer, which we refer to as the Excess Primer strand. LATE-PCR takes into account the concentration-adjusted melting temperature of the Limiting Primer at the start of amplification, Tm[0]L, the concentration-adjusted melting temperature of the Excess Primer at the start of amplification, Tm[0]X, and the melting temperature of the single-stranded amplification product (“amplicon”), TmA. For LATE-PCR primers, Tm[0] can be determined empirically, as is necessary when non-natural nucleotides are used, or calculated according to the “nearest neighbor” method (Santa Lucia, J. (1998), PNAS (USA) 95: 1460-1465; and Allawi, H. T. and Santa Lucia, J. (1997), Biochem. 36: 10581-10594) using a salt concentration adjustment, which in our amplifications is generally 0.07 M monovalent cation concentration. For LATE-PCR the melting temperature of the amplicon is calculated utilizing the formula: Tm=81.5+0.41 (% G+% C)−500/L+16.6 log [M]/(1+0.7 [M]), where L is the length in nucleotides and [M] is the molar concentration of monovalent cations. Melting temperatures of linear, or random-coil, probes can be calculated as for primers, that is, Tm[0] as described above. Melting temperatures of structured probes, for example molecular beacon probes, can be determined empirically or can be approximated as the Tm[0] of the portion (the loop or the loop plus a portion of the stem) that hybridizes to the amplicon. In a LATE-PCR amplification reaction Tm[0]L is preferably not more than 5° C. below Tm[0]X, more preferably at least as high and even more preferably 3-10° C. higher, and TmA is preferably not more than 25° C. higher than Tm[0]X, and for some preferred embodiments preferably not more than about 18° C. higher.
Methods of this invention include the step of acquiring dye fluorescence as a function of temperature below the Tm of any double-stranded amplicon. For this purpose the dye is excited at a wavelength at or near its maximum absorption wavelength, and dye emission is detected at a wavelength or wavelengths at or near the dye's maximum emission wavelength, which we refer to as the “dye channel” of an instrument. With numerous instruments, the range for such temperature measurements can be as broad as from about 4° C. to the Tm of double-stranded amplicons, typically about 90-100° C. In large measure the temperature range of each instrument is dependent on the method of cooling. Air-cooled instruments, whether passive or forced convective, typically can only go down to a temperature are about 7-10° C. above ambient temperature, while instruments with artificial cooling, such as a Peltier device (which we refer to as “actively cooled”) can go down to ambient or even below ambient temperatures. Both air-cooled and actively cooled instruments can be used with this invention, although the range of possible temperatures is greater with actively cooled instruments. Instruments can utilize tubes for analysis of the product or chips or microfluidics devices. The optical systems for these instruments can utilize detection in one or channels. In embodiments that include amplification, for example, LATE-PCR, and low-Tm probes, the temperature range over for acquisition of useful information will be capped by Tm's of the probe set at 80-85° C. Certain embodiments include exciting the dsDNA-dye at an appropriate wavelength and detecting emission from the dye within the temperature range at sufficient temperatures needed to generate a fluorescent contour. Quenching of the dsDNA-dye by a non-fluorescent or fluorescent dye-quenching label of a probe bound to a target is, we believe, due to FRET. While the present invention is not limited to any particular mechanism, and an understanding of the mechanism is not necessary to practice the invention, we theorize that the dsDNA-dye in solution first binds to any abundant discrete double-stranded DNA molecules longer than the probes themselves. As the temperature of the reaction is lowered sufficiently for such long molecules to become double-stranded, the dye fluoresces. However, as the temperature is lowered further, a fraction of the already bound dsDNA-dye migrates to the short stretches of double-stranded DNA formed by hybridization of the probe with the dye-quenching label (“On” probe or “Off” probe) to the single-stranded target. When this occurs, the fluorescence of that fraction of dsDNA-dye is quenched by the quencher moiety of the bound probe, thereby reducing the level of total fluorescence in the system below that level that would be observed at the same temperature in the absence of the hybrid formed by the probe and the single-stranded target. In certain embodiments, sufficient information for analysis can be obtained by detecting the dye emission at only two or a few temperatures. If one or more probes in the probe set contain a fluorescent dye-quenching label, the fluorescent dye-quenching label or labels will act as an additional dye-quenching label or additional dye-quenching labels during acquisition in the dye channel. If one or more probes in the probe set contain a fluorescent dye-coincident label or fluorescent dye-coincident labels, the dye-coincident label or labels will generate fluorescence in the dye channel that is independent of the dye's emission. In methods of this invention, acquisition of dye emissions can also include detection at and above the Tm of double-stranded amplicons.
If at least one probe in a probe set includes a spectrally distinct (from the dye) fluorescent label that is indirectly excited by emission from the dsDNA-dye, fluorescence from such label or labels can be similarly but separately acquired at a wavelength or wavelengths at or near that label's maximum emission wavelength, which we refer to as the label's channel, when the dsDNA-dye is excited. Alternatively, fluorescence from such label or labels can be similarly but separately acquired in the label's channel, when the fluorescent label is excited directly. If at least one probe in a probe set includes a spectrally distinct fluorescent label that is not indirectly excited by emission from the dsDNA-dye (a non-overlapping label), fluorescence from such label or labels can be similarly but separately acquired at a wavelength or wavelengths at or near that label's maximum emission wavelength, which we refer to as the label's channel, when the fluorescent label is excited directly. If a probe with a spectrally distinct fluorescent label is a molecular beacon probe, its fluorescence can be separately detected and analyzed to provide additional target sequence-specific information. If a probe with a spectrally distinct fluorescent moiety is a Taqman® probe, its fluorescence can be separately detected and analyzed to provide a measure of the amount of double-stranded DNA amplification that has taken place in a LATE-PCR or asymmetric reaction. If a probe includes a spectrally distinct fluorescent moiety is a double-stranded probe with a fluorophore on the shorter, lower-Tm, strand, its fluorescence can be separately detected and analyzed to provide a measure of the amount of single-stranded DNA amplification in a LATE-PCR or asymmetric amplification reaction.
Methods of this invention include comparing emission from the dsDNA-dye as a function of temperature with either a standard or another sample, for example, a sample whose sequence or nature (such as drug susceptibility) is known. A standard is typically a previously obtained result from such a known standard. A comparison may utilize fluorescence contours, such as shown in
In methods of this invention, the step of comparing can further include comparing emission from a spectrally distinct fluorescent label as a function of temperature with either a standard or another sample in one or more of the various ways used for comparison of dye emissions in order to provide additional information regarding the target sequence or target-sequence variant in a sample. See Example 5, wherein one or more On probes include Quasar 670 fluorophore labels,
Experiments illustrating various aspects of the invention are presented in the Examples. Example 1 describes a method to analyze the sequences of two bacterial strains in a 16 base-pair region of the katG gene utilizing a single quencher-only probe, either a probe with one non-fluorescent quencher moiety or a probe with two non-fluorescent quencher moieties. Example 2 describes a method to analyze the sequences of six bacterial strains in a longer, 101 base-long single-strand of a region of the rpoB gene utilizing a set of multiple (six) singly labeled quencher-only hybridization probes. Example 3 describes a method utilizing SYBR® Green dsDNA-dye in combination with quencher-labeled probes that are also labeled with a FAM fluorophore. Example 5 describes a method utilizing SYBR® Green dsDNA-dye in combination with three quencher-only probes and three quencher-labeled probes that are also labeled with the fluorophore Quasar 670, wherein the six probes hybridize to seven variants of a 101 base long single-strand of a region of the rpoB gene whose initial concentrations prior to amplification are different. The Quasar 670 fluorophore is a red fluorophore that is a FRET partner with SYBR® Green dye. Example 6 describes a method utilizing SYBR® Green dsDNA-dye in combination with a quencher-labeled probe that is also labeled with the fluorophore Quasar 670, which has an emission maximum at 670 nm, wherein the probe by virtue of its hairpin shape serves as a reservoir for the SYBR® Green dsDNA-dye.
Probe sets useful in methods of this invention may include multiple probes of different types for analysis of target sequence variants. For instance, probe sets useful in methods provided herein may include an “On” probe that hybridizes to a target sequence adjacently to another quencher-labeled probe such that the quencher of the latter quenches the fluorescent label of the former when both are hybridized. In Example 3, “On” probe #2 and the “Off” probe in the gyrase B probe set illustrate that possibility. The gyrase B probe set utilized in Example 3 to analyze several species of the genus Mycobacterium includes: a) one quencher-only (“Off”) probe; b) two “On” probes labeled with both a quencher and a FAM; c) one unlabeled probe. Probe sets for multiple unrelated targets may be used together in the same reaction mixture. A method of Example 3 includes a probe set for the gyrase B gene and a probe set for the 16s ribosomal gene in a reaction mixture for amplifying sequences of both genes.
In the Examples, amplification and detection was performed using a Stratagene MX3500P thermal cycler. Detection of SYBR® Green fluorescence was made using the “FAM channel” of the instrument, which detects emission at 516 nm. When a probe or probes containing a FAM label was included, detection included both SYBR® Green fluorescence and FAM fluorescence.
In Example 1, a LATE-PCR amplification was performed using a single pair of primers to amplify a 139 base pair region of the katG gene using either of two strains of Mycobacterium tuberculosis. The amplified single-stranded amplicon generated in the reaction included a 16 base long sequence which is known to contain mutations responsible for drug resistance for isoniazid. Strain 25631 is drug-sensitive and is displayed in
Comparison of curve 102 (
An embodiment that could be an alternative to the method of Example 1 would be to utilize an in-situ Off probe labeled with a Black Hole quencher. In such an embodiment, the excess primer would be labeled with one quencher moiety (here a 5′ BHQ1) and the limiting primer would have a 5′ extension that includes a nucleotide sequence that is not the probe sequence described (SEQ ID No. 5), which is more complementary to drug-sensitive strain 25631 (one mismatch) than to drug-resistant (mutant) strain 8094, but rather is that probe sequence modified to be more complementary to the drug-resistant strain (so that in-situ probes are formed with that strain) and to be very allele-discriminating (for example, as short as practicable, so that in-situ probes are not formed with the drug-sensitive strain).
In Example 2 a LATE-PCR amplification was performed using a single pair of primers to amplify a 150 base pair region of the rpoB gene for each of several strains of Mycobacterium tuberculosis, including drug-sensitive strain 24609 and five different drug-resistant strains, each differing from the drug-sensitive strain by a single base-pair. The single-stranded DNA product (Excess Primer strand) amplified during the linear phase of the LATE-PCR includes a 101 base-long sequence which is known to contain mutations responsible for drug resistance for rifampicin. Six different strains of M. tuberculosis, drug-sensitive strain 24609 and drug resistant strains 18460, 8600, 13554, 14191 and 17718 with each strain tested in triplicate. The products of each of the six closed-tube reactions were analyzed at end-point using SYBR® Green dye and a multi-probe set of six probes that were included in the original amplification reaction mixture. The probes spanned the 101 base pairs of the single-stranded nucleic acid target sequence. All probes were labeled with only a single Black Hole Quencher 2 (BHQ2). At the end of amplification, probe-target hybridizations were analyzed as a function of temperature. As in Example 1, hybridizations were characterized by the use of melt profile analysis in the SYBR® Green channel.
In this example of a method according to this invention the fluorescent signatures, that is, the derivatives of the fluorescent contours obtained by gradually raising the temperature, were compared to one another visually by plotting them on the same graph (
In Example 3 a multiplex LATE-PCR amplification was used to provide multiple single-stranded target nucleic acid sequences to distinguish M. tuberculosis from other members of the genus Mycobacterium by using a combination of two genes, the 16s ribosomal gene and the gyrase B gene. A target sequence from each gene for one of the target species was amplified in the same tube utilizing two pairs of primers. To investigate and compare differing methods of analysis, three different types of amplification reaction mixtures were tested: a first containing only the 16s probe set, a second containing only the gyrase B probe set, and a third containing both probe sets.
Example 3 demonstrates a method according to this invention that includes the use, in combination with a dsDNA-dye, of unlabeled probes, quencher-only probes, and quencher probes that are labeled with a dye-coincident fluorophore whose excitation and emission spectra are almost the same as the dye's excitation and emission spectra. In Example 3 the dsDNA-dye is SYBR® Green, the most commonly used dye, and the spectrally indistinct fluorophore is FAM. SYBR® Green has an excitation maximum of 497 nm and an emission maximum of 521 nm. FAM is nearly identical, with and excitation maximum of 493 nm and an emission maximum of 525 nm. FAM is included in three probes that we refer to as “On” probes that are quenched when in solution but fluorescent when hybridized. Such “On” probes include a fluorescent moiety, for example a fluorophore or quantum dot, and a non-fluorescent quencher moiety, for example a Black Hole quencher or DABCYL. In this case the set of gyrase B probes included two such “On” probes (gyrase B On Probe #1, gyrase B On Probe #2), one quencher-only probe (gyrase B “Off” probe), and one unlabeled probe that has neither a quencher moiety nor a fluorescent moiety (gyrase B Unlabeled Probe). The set of 16s probes included one “On” probe (16s On Probe) and one quencher-only probe (16s “Off” probe). The “On” probes were all molecular beacons having stems two nucleotides long, labeled on one end with FAM and on the other end with a Black Hole quencher.
Although both 16s and gyrase B target sequences were amplified in all three reactions described in Example 3, the fluorescent signatures in the dye channel shown in
The method of Example 4 is similar to the method of Example 3 regarding dye and probes. However, in this case the primers amplify only the 16s target sequence, and, therefore, only the 16s target sequence produces double-stranded amplicon and single-stranded amplicon. In this Example we varied the dsDNA-dye concentration, and we varied the non-fluorescent quencher of the Off probe (the On probe remained a molecular beacon labeled with a Black Hole quencher and FAM, a dye-coincident label). Fluorescent contours and fluorescent signatures (first derivative) are presented in
Example 4 demonstrates the effect of concentration of dsDNA-dye, in this case SYBR® Green dye concentration. SYBR® Green at 0.72× inhibited amplification (results not shown). FIG. panels D, E and F show that SYBR® Green dye at 0.48×, 0.24×, and 0.12× did not inhibit amplification. Indeed, the total amount of double-stranded amplicon and single-stranded amplicon was the same in all three sets of reactions. However, as shown by the increase in fluorescence as one moves from about 90° C. to about 85° C. in panels D-F, when the SYBR® Green concentration was decreased from 0.48×, to 0.24×, to 0.12×, the amount of SYBR® Green bound to the double-stranded amplicon decreased. As the temperature decreased further between 85-63° C., the rate of binding of additional SYBR® Green to the double-stranded amplicon also decreased. This indicates that the 0.12× and 0.24×SYBR® Green dye did not saturate the double-stranded amplicon. In contrast, panels D-F show that the amount of SYBR® Green bound to the hybrid of the single-stranded amplicon and the FAM-labeled On probe below about 63° C. was approximately the same in all cases, as was the amount of SYBR® Green bound to the hybrid of the single-stranded amplicon and the three types of OFF probes, at temperatures below about 60° C. This was unexpected. It indicates that in the temperature range of probe-target hybridization, SYBR® Green dye preferentially binds to probe-target hybrids as compared to the double-stranded amplicon. This is consistent with the fact that at end point the concentration of single-stranded amplicon is much higher (10-20 fold) than the concentration of double-stranded amplicon.
Example 4 demonstrates a simple, straightforward empirical approach to optimize the level of dsDNA-dye needed to achieve maximum temperature-dependent subtleties in the resulting melt contours and their first derivatives. In this example 0.12×SYBR® Green was judged to be optimal, because each of the peaks and valleys is most resolved and most reproducible.
Example 4 also illustrates that the magnitude of decrease in SYBR® Green dye signaling that results from hybridization of Off probes to the target sequence. Several alternative non-fluorescent quencher labels were tested for the Off probe, which hybridized adjacent to the On probe. Each variant of the OFF probe had at least one quencher at the 5′ position adjacent to the 3′ FAM of the On probe. One Off probe was labeled with a single 5′ DABCYL, one OFF probe was labeled with both a 5′ DABCYL and a 3′ DABCYL, and one Off probe was labeled with a 5′ BHQ1. As one versed in the art will appreciate, it is also possible to construct Off probes with two BHQ1 quenchers, or with other quenchers, including Black Hole quenchers other than BHQ1. Such alternative quenchers will have different spectra.
An embodiment that could be an alternative to the method of Example 4 would be to utilize an in-situ probe as the Off probe. The in-situ Off probe could be labeled with a Black Hole quencher by using a Black Hole quencher-labeled excess primer, or it could be unlabeled. The limiting primer would have a 5′ extension that includes a nucleotide sequence that is the complement of the probe sequence described (SEQ ID No. 34) modified to be very allele discriminating in favor of the and against the sequence of M. scrofulaceum. The On probe could then be made complementary to M. scrofulaceum. The binding sequence for the On probe would then reside in the loop of the final in-situ probe, lowering its Tm against the M. tuberculosis complex sequence.
Example 5 illustrates the use of a dsDNA-dye (SYBR® Green) and sets of multiple (six) probes that include, in addition to multiple (three) Off probes, additional (three) probes that are either unlabeled or dual-labeled On probes having a dye-quenching fluorophore in an assay to discriminate strains of Mycobacterium tuberculosis that are drug susceptible or drug resistant for the antibiotic rifampicin due to point mutations in the rpoB gene target.
A LATE-PCR amplification was performed using the same single pair of primers used in Example 2 to amplify a 150 base pair region of the rpoB gene for each of two strains of Mycobacterium tuberculosis. The amplification provided a 101 base long single-stranded target (Excess Primer Strand), which includes the RRDR region known to contain mutations responsible for drug resistance for rifampicin. Each single-stranded nucleic acid target sequence was probed using one of four different sets of six probes that were present in the original amplification reaction mixture. Probe-target hybridizations were analyzed as a function of temperature at the end of amplification. In this example, hybridizations were characterized by fluorescent signatures in the SYBR channel (stimulation and detection of SYBR® Green fluorescence) and fluorescent signatures in the Quasar channel (direct stimulation and detection of Quasar 670). Example 2, in which all six probes having the same nucleotide sequences were labeled as Off probes, provided an additional comparison for readings in the SYBR channel. The relevant signatures from Example 2 are in
Probe Set 1:
All probe sets included the same three Off probes, each labeled with a single Black Hole quencher. The first probe set included additionally three On probes. Each On probe was a molecular beacon probe labeled one end with a Black Hole quencher and on the other end with a Quasar 670 fluorophore—a dye-quenching fluorophore when the dye is SYBR® Green. The alignment of the six probes on the target sequence, including the juxtaposition of labels, is described in Example 5. The alignment is also shown in the legend above
Referring to
Probe Set 2:
The second probe set was the same as the first, except for one change: an unlabeled oligonucleotide was substituted for On Probe 2. Panel C and panel D show that each fluorescent signature clearly distinguished the two bacterial strains. Comparison of Circles 505 and 506 in the SYBR channel,
Probe Set 3:
The third probe set was the same as the second except for one change: an unlabeled oligonucleotide was substituted for On Probe 4. This left Probe 5 as the only On probe. Panel E and panel F show that each fluorescent signature clearly distinguished the two bacterial strains. The results in
Probe Set 4:
The fourth probe set was the same as the third except for one change: an unlabeled oligonucleotide was substituted for On Probe 5, the probe under which the mutation lies. This left no On probes. Panel G and panel H show that neither fluorescent signature clearly distinguished the two bacterial strains. Because there are no probes in set 4 that are labeled with Quasar 670, there is no signal in the Quasar channel,
Example 6 illustrates the use of SYBR® Green dsDNA dye in PCR amplification carried out in a microfluidics device. The method described there uses an excess of a double-stranded DNA oligonucleotide that serves as reservoir of reagent-bound dye that, because it is bound, is thereby prevented from sticking to the walls of the device and is available to bind to then dissociate and bind to double-stranded amplicons and or probe/target hybrids that result from amplification.
Genetic analysis via the polymerase chain reaction (PCR) in miniaturized microfluidics chip devices is highly desirable, because such devices are very rapid, inexpensive, and are highly flexible in their design. A number of microfluidics devices for nucleic acid amplification reactions, particularly PCR, have been described. Such devices range from stationary chambers to flow-through systems, as well as thermal convection-driven PCR devices, using Taqman probes to detect amplification. The materials used for making these microfluidic chip devices include silicon, glass, plastic and polydimethylsiloxane (PDMS). PDMS for chips has attracted considerable attention for its convenience, low cost and a surface that is inert to most PCR reagents. SYBR® Green, the most commonly used dsDNA-dye, would have an obvious advantage for use in microfluidic devices, because it is both well studied and inexpensive. However, because of the high surface/volume ratio in a microfluidic channel or chamber, an informative signal from SYBR® Green is easily lost by adherence of the dye to surfaces during the filling process and also during the PCR cycling process. Cady et al. have clearly shown that the signal is lost during PCR because of the interaction between PDMS and SYBR® Green I. Cady et al. (2005), Real-time PCR Detection of Listeria Monocytogenes Using an Integrated Microfluidics Platform, Sensors and Actuators B: Chemical, 107(1), 332-341. Gonzalez et al. have shown that SYBR® Green is almost completely adsorbed running through long tubing of perfluoralkoxy (PFA), a polymer which is more inert than PDMS. Gonzalez et al. (2007), Interaction of Quantitative PCR Components with Polymeric Surfaces, Biomed Microdevices, 9(2), 261-266. Different additives such as BSA and surfactants have been used as wall-surface treatments before PCR in order to keep reagents from attaching onto the walls of microfluidic channels.
In Example 6 the problem of SYBR® Green's adherence to surfaces in a microfluidics device, even a device made of PDMS, was overcome by including a double-stranded oligonucleotide in the amplification reaction mixture. We believe that the double-stranded oligonucleotide serves as a reservoir to hold and release SYBR® Green. The oligonucleotide may be two complementary strands or, as we used in Example 6, a single strand that forms a hairpin structure having a double-stranded stem region, for example, a molecular beacon probe or similar structure.
As reported in Example 6, we subjected a series of samples to LATE-PCR amplification. SYBR® Green fluorescence before amplification is shown in
As one versed in the art will appreciate, other double-stranded molecules, including hairpin oligonucleotides that are not molecular beacons and have stems of various lengths and composition, as well as double strands generated by the hybridization of complementary or partially complementary single-strands, can substitute for the stem of the molecular beacon described here as reservoirs for SYBR® Green dye. In addition, other dyes known to bind to double-stranded DNA can be used instead or in addition to SYBR® Green. The optimal concentrations of said dyes, hairpins, and double-strands can readily be established by experimentation by a person versed in the art.
LATE-PCR amplifications were performed using a single pair of primers to amplify a 139 base pair region of the katG gene for two strains of Mycobacterium tuberculosis. The amplification provided a 16 base-pair region of the gene, which is known to contain mutations responsible for drug resistance for isoniazid, as a single-stranded nucleic acid target sequence. At the end of amplification, probe-target hybridizations were analyzed as a function of temperature. In this example, hybridizations were characterized by the use of melt profile analysis. Reaction components and conditions were as follows:
A three carbon linker is denoted with C3 while a Black Hole Quencher 1 is denoted with BHQ1 (Biosearch Technologies, Novato Calif.). Complementary terminal nucleotides in the probes are underlined.
AACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGGAGCT
The underlined sequence at the 5′ end is the sequence of the excess primer, with the exception that the target has a 5′ terminal G and the excess primer has a 5′ terminal T. The underlined sequence at the 3′ end is the sequence that is complementary to the limiting primer, with the exception that where the fourth nucleotide from the 3′ end of the target sequence is an A, the opposing nucleotide of the limiting primer is G rather than a T. The sequence complementary to the probe sequence is the internal sequence that is italicized and underlined. The probe sequence is perfectly complementary to target strain 25631, with the exception of a T-G mismatch in the middle of the probe sequence.
The underline denotes the location of the single nucleotide change from the drug-sensitive strain. The probe sequence is complementary to target strain 8094 with two micmatches.
LATE PCR amplifications were performed in triplicate in a 25 μl volume consisting of 1×PCR buffer (Invitrogen, Carlsbad, Calif.), 2 mM MgCl2, 200 nM dNTPs, 50 nM limiting primer and 1000 nM excess primer, 1.25 units of Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, Calif.), 0.24×SYBR® Green (Invitrogen, Carlsbad, Calif.) and one or the other target strain. Strain 25631 was included in an amount of approximately 10,000 genomes equivalents. Strain 8094 was included in an amount of 1,000 genomes equivalents. For each target four separate mixtures were made: the first mixture did not contain the katG probe, the second mixture had 500 nM of the katG probe with no modifications, the third mixture had 500 nM of katG probe with a 3′ BHQ modification, and the fourth mixture had 500 nM of katG probe with 5′ and 3′ BHQ's.
The thermal profile performed on the Stratagene MxPro 3500P for amplification was as follows: 95° C./3 min for 1 cycle, followed by 60 cycles of 98° C./10s-75° C./40s with fluorescent acquisition at each cycle. This was followed by one cycle of 10 min at 75° C. and 10 min at 25° C. This was followed by a melt with fluorescence acquisition in the FAM channel (excitation, 492 nm, emission, 516 nm) at each degree starting at 25° C. with 1° C. increments at 30s intervals to 97° C. Probe-target hybridizations were analyzed by melt curve analysis using the first derivative.
The Excess Primer contains a deliberate mismatch at the 5′ end (a “T” rather than the “G” in each of the targets) to reduce potential mispriming during the linear phase of LATE-PCR amplification.
LATE-PCR amplifications were performed using a single pair of primers to amplify a 150 base pair region of the rpoB gene for each of several strains of Mycobacterium tuberculosis. The amplification provided a 101 base-pair region of the gene, which is known to contain mutations responsible for drug resistance for rifampicin, as a single-stranded nucleic acid target sequence (the Excess Primer strand of each LATE-PCR amplification). Following amplification, each single-stranded nucleic acid target sequence was probed using six separate probes that were included in the original amplification reaction mixture.
The probes spanned the 101 base pairs of the single-stranded nucleic acid target sequence. All probes were labeled with BHQ2 only and no fluorophore. In this example the fluorescent signatures are all distinct from one another and differ with respect to the drug-sensitive strain. At the end of amplification, probe-target hybridizations were analyzed as a function of temperature. In this example, hybridizations were characterized by the use of melt profile analysis. Reaction components and conditions were as follows:
A three-carbon linker, which blocks extension of a probe, is denoted with C3 while a Black Hole Quencher 2 is denoted with BHQ2 (Biosearch Technologies, Novato Calif.). Complementary terminal nucleotides in the probes are underlined.
GGAG
The location of primers and probes is shown relative to strain 24609. The underlined sequence at the 5′ end is the sequence of the excess primer. The underlined sequence at the 3′ end is the sequence that is complementary to the limiting primer. The binding sites of probes 1-6 are indicated, with “-Q” indicating the probe end having the BHQ2 quencher. Non-complementary terminal nucleotides are identified (for example, “TAQ” at the 3′ end of Probe 4 denotes a non-complementary T and a non-complementary A. Probes in this set hybridize immediately adjacently to one another. Probe 6 overlaps the excess primer.
The underline in the sequence of each of strains other than strain 24609 denotes the location of the nucleotide change from the drug-sensitive strain 24609.
LATE PCR amplifications were carried out in a 25 μl volume consisting of 1×PCR buffer (Invitrogen, Carlsbad, Calif.), 2 mM MgCl2, 200 nM dNTPs, 50 nM Limiting Primer, 1000 nM Excess Primer, 1.5 units of Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, Calif.), 0.24×SYBR® Green (Invitrogen, Carlsbad, Calif.), 500 nM of all probes and 10,000 genomes of human genomic DNA (Promega, Madison. Wis.). For each strain tested approximately 10,000 genomes equivalents were used. Amplification reactions for each strain were run in triplicate.
The thermal profile performed on the Stratagene MxPro 3005P for amplification was as follows: 95° C./3 min for 1 cycle, followed by 60 cycles of 98° C./10s-75° C./40s with fluorescent acquisition in the FAM channel at each cycle. This was followed by one cycle of 10 min at 75° C. and 10 min at 25° C. This was followed by a melt with fluorescent acquisition at each degree starting at 25° C. with 1° C. increments at 30s intervals to 97° C. Analysis of the probe target hybridizations following amplification was by melt curve analysis using the first derivative of FAM fluorescence intensity for temperatures between 25° C. to 97° C.
A multiplex LATE-PCR assay was used to provide multiple single-stranded target nucleic acids to identify M. tuberculosis from other members of the genus Mycobacterium by using a combination of two genes, the 16s ribosomal and gyrase B genes. The use of dual labeled probes with the SYBR® Green provided distinct and differential fluorescent signatures that characterized members of the Mycobacterium tuberculosis complex from other members of Mycobacterium. In this example, hybridizations were characterized by the use of melt profile analysis. Reaction components and conditions were as follows:
The primer and probe sequences for gyrase B are:
A three-carbon linker is denoted with C3 while a Black Hole Quencher 1 is denoted with BHQ1 (Biosearch Technologies, Novato Calif.). Complementary terminal nucleotides in the On probes are underlined.
The gyrB target sequences are:
M. tuberculosis
5′GTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGGCAAC
CCACTGGTTTGAAGCCAACCCCACCGACGCGAAAGTCGTTGTGAACAAGG
CT
GTGTCCTCGGCGCAAGCCCGTAT
The location of primers and probes is shown relative to the M. tuberculosis sequence. The underlined sequence at the 5′ end is the sequence of the limiting primer. The underlined sequence at the 3′ end is the sequence that is complementary to the excess primer. The binding sequences of probes are indicated, with “F: indicating the probe end having the FAM fluorophore. “-Q” indicating the probe end having the BHQ1 quencher, and non-complementary terminal nucleotides identified (for example, “FCG” at the 5′ end of the On#1 sequence denotes a non-complementary C and a non-complementary G. We note that probes in the set hybridize immediately adjacently to one another except that there is a two-nucleotide (CC) gap between the sequence of the unlabeled probe and the binding sequence of On Probe 2. For M. asiaticum (see below), which has a C-to-G difference at this point, the gap is only a single nucleotide.
M. bovis
M. microti
M. africanum (same sequence as M. microti)
M. avium
M. asiaticum
The underlines in the target sequence of each species other than M. tuberculosis denotes the location of nucleotide changes from the M. tuberculosis sequence.
The primer and probe sequences for 16s are:
A three-carbon linker is denoted with C3 while a Black Hole Quencher 1 is denoted with BHQ1 (Biosearch Technologies, Novato Calif.). Complementary terminal nucleotides in the On probe are underlined.
Members of Mycobacterium tuberculosis complex, including M. tuberculosis, M. africanum, M. bovis and M. microti
Off Probe -Q
GT
The location of primers and probes is shown relative to the MTB-complex sequence. The underlined sequence at the 5′ end is the sequence of the excess primer. The underlined sequence at the 3′ end is the sequence that is complementary to the limiting primer. The binding sites of the probes are indicated, with “F-” indicating the probe end having the FAM fluorophore and “-Q” indicating the probe end having the BHQ1 quencher. Non-complementary terminal nucleotides are identified (for example, “F-AA” at the 5′ end of the On Probe sequence denotes two non-complementary A's. The two probes in the set hybridize immediately adjacently to one another, that is, there is neither an overlap nor a gap. Comparing the sequence of the On probe to its MTB-complex binding site, the sixth nucleotide from the 5′ end of the binding site (a G) is a mismatch, and the next nucleotide (a C) has no counterpart in the probe sequence (the probe sequence has a deletion).
M. asiaticum
M. avium
The underlines in the target sequence of each non-tuberculosis-complex species denotes the location of nucleotide changes from the Mycobacterium tuberculosis complex sequence.
LATE-PCR amplifications were performed in triplicate in a 25 μl volume consisting of i×PCR buffer (Invitrogen, Carlsbad, Calif.), 0.24×SYBR® Green, 2 mM MgCl2, 300 nM dNTPs, 50 nM limiting primers, 1000 nM of excess primers, 1.5 units of Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, Calif.). Three separate mixtures were made; the first had only the gyrase B probe set: 200 nM of gyrase B On Probe #1, 200 nM of gyrase B On Probe #2, 500 nM of gyrase B Off Probe and 1 uM of gyrase B Unlabeled Probe. The second mixture had only the 16s probe set: 200 nM of the 16s On Probe and 500 nM of 16s Off Probe. The third mixture included both probe sets (six probes).
The thermal profile performed on the Stratagene MxPro 3005P for amplification was as follows: 98° C./3 min for 1 cycle, followed by 98° C./10s-75° C./40s for 60 cycles, followed by 10 min at 75° C., followed by 10 min at 25° C. with a melt starting at 25° C. with 1° C. increments at 30s intervals to 97° C. with fluorescent acquisition in the FAM channel (excitation, 492 nm, emission, 516 nm) at each degree. Probe-target hybridizations were analyzed by the melt curve analysis using the first derivative for the temperatures between 25° C. to 95° C.
A LATE-PCR assay was used to provide single-stranded target nucleic acids. The amplification reaction mixture contained two genes, the 16s ribosomal and the gyrase B genes of M. simiae, but the primers for gyrase B did not amplify this species, so only single-stranded amplification product for the 16s gene resulted. The use of dual-labeled On probes with the SYBR® Green provided distinct and differential fluorescent signatures based on the combinations and the type of quenchers used. In this example, hybridizations were characterized by the use of melt profile analysis. Reaction components and conditions were as follows:
The gyrase B Limiting Primer, Excess Primer, and Probes were the same as in Example 3.
The gyrase B target sequence for M. simiae is not available from genbank.
The primer and probe sequences for 16s are:
Limiting Primer: same as in Example 3
Excess Primer: same as in Example 3
16s On Probe: (same as in Example 3)
16s Off Probe with Black Hole Quencher 1: (same as in Example 3)
16s Off Probe with one DABCYL (D):
16s Off Probe with two DABCYLs (DD):
A three carbon linker is denoted with C3 while a Black Hole Quencher 1 is denoted with BHQ1 (Biosearch Technologies, Novato Calif.). Complementary terminal nucleotides in the On probe are underlined.
M. simiae
Off Probe Q
TGT
The location of primers and probes is shown relative to the target sequence. The underlined sequence at the 5′ end is the sequence of the excess primer. The underlined sequence at the 3′ end is the sequence that is complementary to the limiting primer. The binding sites of the probes are indicated, with “F-” indicating the probe end having the FAM fluorophore and “-Q” indicating a probe end having a quencher. The Off probe shown is the two variants having a single 5′ quencher. Non-complementary terminal nucleotides are identified (for example, “F-AA” at the 3′ end of the On Probe sequence denotes two non-complementary A's. The two probes in the set hybridize immediately adjacently to one another, that is, there is neither an overlap nor a gap.
LATE-PCR amplifications were performed in triplicate in a 25 μl volume consisting of 1×PCR buffer (Invitrogen, Carlsbad, Calif.), 2 mM MgCl2, 300 nM dNTPs, 50 nM limiting primers, 1000 nM excess primers, 1.5 units of Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, Calif.), 200 nM of On probes from both probe sets, 500 nM of gyrB Off probe, 500 nM of one version of the 16s Off probe, 1 uM of unlabeled oligo. Three separate mixtures were made with final concentrations of SYBR® Green of 0.12×, 0.24× and 0.48×, respectively. Each of these mixtures was further subdivided into one mixture having the 16s Off probe labeled with a single DABCYL (5′ end), the second having the 16s Off probe labeled with two DABCYLs at both 5′ and 3′ ends, and the third having the 16s Off probe labeled with a single Black Hole quencher (BHQ1).
The thermal profile performed on the Stratagene MxPro 3005P for amplification was as follows: 98° C./3 min for 1 cycle, followed by 98° C./10s-75° C./40s for 60 cycles, followed by 10 min at 75° C., followed by 10 min at 25° C. with a melt starting at 25° C. with 1° C. increments at 30s intervals to 99° C. with fluorescent acquisition (excitation, 492 nm, emission, 516 nm) at each degree. Probe-target hybridizations were analyzed by the melt curve analysis using the first derivative for the temperatures between 25° C. to 95° C.
This example is similar to Example 2 as to drug-susceptible and mutant target strains of the rpoB gene, excess and limiting primers, SYBR® Green dye, and sequences of six probes, but for comparative purposes some of the six quencher-only (“Off”) probes of Example 2 were converted either to On probes by the addition of a terminal Quasar 670 fluorophore (a dye-quenching fluorescent label when used with SYBR® Green dye) or to unlabeled probes by the removal of the quencher moiety. The several modified probe sets were tested for their ability to discriminate a strain of Mycobacterium tuberculosis that is drug susceptible from a strain that is drug resistant for the antibiotic rifampicin due to a point mutation in the rpoB gene target sequence.
A LATE-PCR amplification was performed using a single pair of primers to amplify a 150 base-pair region of the rpoB gene for each strain of Mycobacterium tuberculosis. The amplification provided a 101 base long single-stranded target (Excess Primer Strand), which includes the RRDR region known to contain mutations responsible for drug resistance for rifampicin. Following amplification, each single-stranded nucleic acid target sequence was probed using one of four different sets of six probes that were present in the original amplification reaction mixture.
All four sets of probes spanned the 101 base pairs of the single-stranded nucleic acid target sequence. Combinations of three types of probes were used: quencher probes also labeled with a fluorescent label (“On probes”), quencher-only probes (“Off probes”), and Unlabeled probes. Each On probe was a molecular beacon with a two-nucleotide long stem, and was dual-labeled with a Quasar 670 and a non-fluorescent quencher moiety, BHQ2 (Biosearch Technologies, Novato Calif.) on opposite ends of the oligonucleotide. Each Off probe was terminally labeled with a BHQ2 only. Each probe that did not have a 3′ label had a 3′ nucleotide that was blocked with a carbon linker to prevent extension. In this example different probe sets were used to examine the effect of substituting On probes for some of the Off probes in Example 2 and to examine whether one or more less expensive Unlabeled probes could be substituted for one or more On probes without compromising the capacity of the probe set to distinguish the two strains of M. tuberculosis.
At the end of amplification, probe-target hybridizations were analyzed as a function of temperature. In this example, hybridizations were characterized by the use of melt profile analysis. Reaction components and conditions were as follows:
Probe 2-U, the unlabeled version of Probe 2:
Probe 4-U, the unlabeled version of Probe 4:
Probe 5-U, the unlabeled version of Probe 5:
In the probe sequences, a three-carbon linker, which blocks extension of a probe, is denoted with C3 while a Black Hole Quencher 2 is denoted with BHQ2. Also in the probe sequences, terminal nucleotides that form a two base-pair molecular beacon stem are underlined.
Target: Strain 24346 (wild type) (same sequence as Target Strain 24609 in Example 2)
The underline in the sequence of strain 8600, which occurs in the Probe 5 (On #5) binding site, denotes the location of the nucleotide change from the drug-sensitive strain 24346. The binding sites of the primers and probes are shown relative to strain 24346. The underlined sequence at the 5′ end is the sequence of the excess primer. The underlined sequence at the 3′ end is the sequence that is complementary to the limiting primer. The binding sites of the six probes are between the arrows (← →) above and below the target sequence. For each probe there is an indication of a quencher (Q). For each On probe there is an indication of a fluorophore (F). Where a probe has one or more non-complementary nucleotides connecting the fluorophore or quencher, those nucleotides are indicated; for example, in On Probe #2 there is a non-complementary 3′-terminal nucleotide A connecting the fluorophore, so there is a designation “F-A←” to indicate that. We note that not all of the probes are perfectly complementary to their binding sites on the target, that is, between the arrows. Off Probe #1 has two mismatches; On Probe #2 has one; and On Probe #4 has one. To aid comparison probe numbering is the same as in Example 2, that is, Probe No. 1 here corresponds to Probe No. 1 in Example 2.
LATE PCR amplifications were carried out in a 25 μl volume consisting of 1×PCR buffer (Invitrogen, Carlsbad, Calif.), 2 mM MgCl2, 200 nM dNTPs, 50 nM Limiting Primer, 1000 nM Excess Primer, 1.5 units of Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, Calif.), 0.24×SYBR® Green (Invitrogen, Carlsbad, Calif.), 500 nM for probes 1, 3, and 5 and 200 nM for probes 2, 4, and 6 whether labeled or unlabeled. For each strain tested approximately 10,000 genomes equivalents were used. Amplification reactions for each strain were run in triplicate. Reactions were run with differing sets of the six probes. A first probe set included three Off probes (Probes 1,3 and 6) and three On probes (Probes 2,4 and 5) as depicted above. For a second probe set, On probe 2 was converted to an unlabeled oligonucleotide. For a third probe set, On probes 2 and 4 were both converted to unlabeled oligonucleotides. And for a fourth probe set, all three of On probes 2, 4 and 5 were converted to unlabeled oligonucleotides.
The thermal profile for the amplification reaction was as follows: 95° C./3 min for 1 cycle, followed by 60 cycles of 98° C./10s-75° C./40s. This was followed by one cycle of 10 min at 75° C. and 10 min at 25° C. This was followed by a melt with fluorescent acquisition at each degree starting at 25° C. with 1° C. increments at 30s intervals to 97° C. The reactions were done using the Stratagene Mx3005P with excitation and emission for Quasar 670 at 635-665 nm and Fam at 492-516 nm, respectively.
Analysis of the probe target hybridizations following amplification was by melt curve analysis, the results for which are presented as fluorescent signatures (the first derivative) in
This example demonstrates the use of SYBR® Green, a DNA binding dye, in PCR amplification carried out in microfluidics device. The method described here uses an excess of a double-stranded DNA oligonucleotide that serves as reservoir of bound dye that is thereby prevented from sticking to the walls of the device and is available to bind to double strands produced during amplification and detection, including the double-stranded product of PCR amplification and probe-target hybrids.
We fabricated a microfluidic device for use in this example. As shown in
The width of flow channels 611, 612 is 150 μm. The height of the flow channels is 15-17 μm. The width of control channels 607, 610 is 200 μm. The width of control channels 608 in the direction parallel to reservoir channels 609 is 200 μm. The width of control channels 608 in the direction perpendicular to reservoir channels 609 is 75 μm. The height of the control channels is 30 μm. The width of reservoir channels 609 is 75 μm. The reservoir channel functions to supply water (H2O) to the layers above it, via diffusion through the PDMS. The diameter of reaction chambers 613 is 300 μm. Their height is 100 μm.
LATE-PCR amplifications were carried out in a PCR well in the device shown in
The complementary nucleotides forming the probe stem are underlined.
ATCGACTTCTTCCACCTGGGAATTTAGATAGGAAGAACTCAC
Probe
ACTGTTAGACTATGTAAGGGCACAGCGC
The underlined nucleotides at the 3′ end of the target are complementary to the limiting primer. The underlined sequence nearest the 5′ end is the sequence of the excess primer. The probe binding site is also indicated.
A series of samples were subjected to LATE-PCR amplification. A first sample contained 500 nM Molecular Beacon Probe and no target sequence, that is, a no-template control (NTC). A second sample contained 500 nM Molecular Beacon Probe and 1,000 copies of target. A third sample contained 500 nM Molecular Beacon Probe and 0.96×SYBR® Green but no target sequence, that is, another NTC. A fourth sample contained 500 nM Molecular Beacon Probe, 0.96×SYBR® Green, and 1,000 copies of target DNA. A fifth sample contained 0.96×SYBR® Green but no target sequence, that is, another NTC. And a sixth sample contained 0.96×SYBR® Green and 1,000 copies of target DNA, but no Molecular Beacon Probe. LATE-PCR amplifications were performed using the microfluidic chip shown in
Each of the six reaction mixtures was filled into a row of reaction chambers of the chip with 10 psi pressure through reagents inlets, I/O ports 102. Each sample was processed in eight replicates. The outlet valves were closed with 25 psi pressure while filling in the samples. Once all the wells were totally filled, control channels 608 were filled with 25 psi pressure to seal the PCR reactions. Then the reservoir was filled with water at 10 psi pressure to compensate for water dissipation in the PCR chambers 613 through the PDMS during PCR cycling. The thermal profile for the amplification reaction was 95 C for 5 minutes followed by 70 cycles of 95 C for 10 sec, 58 C for 20 sec and 72 C for 30 sec. The levels of fluorescence in all reaction chambers were visualized simultaneously using an Olympus IX70 fluorescent microscope. The images were taken in fluorescence channel FITC (excitation wavelength 485/20 nm and emission wavelength 521/20 nm) for the SYBR signal and channel Cy3 (excitation wavelength 560/25 nm and emission wavelength 607/25 nm) for Quas670 Molecular Beacon Probe signal. Fluorescence images were taken before the amplification reaction and following the amplification reaction, after first equilibrating the microfluidics device at room temperature for 10 minutes.
The fluorescence images are shown in
As shown in panel A, the Molecular Beacon Probe has no fluorescence before PCR in any sample. In contrast, after PCR in
The present application claims priority to U.S. Provisional Patent Application 61/702,019, filed Sep. 17, 2012, which is incorporated by reference in its entirety. This invention relates to fluorescence detection methods for nucleic acid sequences and to kits for performing such methods.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2013/060029 | 9/17/2013 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 61702019 | Sep 2012 | US |
