Complete nucleotide sequence of staphylococcus aureus ribosomal protein gene, S16 and methods for the indentification of antibacterial substances

Abstract

The invention provides an isolated S. aureus ribosomal polypeptide S16, and the isolated polynucleotide molecules that encode them, vectors and host cells comprising such polynucleotide molecules and also methods for the identification of agents that effect ribosomal assembly.

Description

FIELD OF THE INVENTION

[0002] The present invention provides an isolated S. aureus ribosomal polypeptide S16, and the isolated polynucleotide molecules that encode them, as well as vectors and host cells comprising such polynucleotide molecules. The invention also provides a method for the identification of agents that effect ribosomal assembly.

BACKGROUND

[0003] The staphylococci, of which Staphylococcus aureus is the most important human pathogen, are hardy, gram-positive bacteria that colonize the skin of most humans. Staphylococcal strains that produce coagulase are designated S. aureus other clinically important coagulase-negative staphylococci are S. epidermidis and S. saprophyticus. When the skin or mucous membrane barriers are disrupted, staphylococci can cause localized and superficial infections that are commonly harmless and self-limiting. However, when staphylococci invade the lymphatics and the blood, potentially serious complications may result, such as bacteremia, septic shock, and serous metastatic infections, including endocarditis, arthritis, osteomyelitis, pneumonia and abscesses in virtually any organ. Certain strains of S. aureus produce toxins that cause skin rashes, food poisoning, or multisystem dysfunction (as in toxic shock syndrome). S. aureus and S. epidermidis together have become the most common cause of nonsocomial non-urinary tract infection in U.S. hosptitals. They are the most frequently isolated pathogens in both primary and secondary bacteremias and in cutaneous and surgical wound infections. See generally Harrison's Principles of Internal Medicine, 13th ed., Isselbacher et. al. eds. McGraw-Hill, New York (1994), particularly pages 611-617.

[0004] Transient colonization of the nose by S. aureus is seen in 70-90 percent of people, of which 20 to 30 percent carry the bacteria for relatively prolonged periods of time. Independent colonization of the perineal area occurs in 5-20 percent of people. Higher carriage rates of S. aureus have been documented in persons with atopic dermatitis, hospital employees, hospitalized patients, patients whose care requires frequent puncture of the skin, and intravenous drug abusers.

[0005] Infection by staphylococci usually results from a combination of bacterial virulence factors and a diminution in host defenses. Important microbial factors include the ability of the staphylococcus to survive under harsh conditions, its cell wall constituents, the production of enzymes and toxins that promote tissue invasion, its capacity to persist intracellularly in certain phagocytes, and its potential to acquire resistance to antimicrobials. Important host factors include an intact mucocutaneous barrier, and adequate number of functional neutrophils, and removal of foreign bodies or dead tissue.

[0006] Once the skin or mucosa have been breached, local bacterial multiplication is accompanied by inflammation, neutrophil accumulation, tissue necrosis, thrombosis and fibrin deposition at the site of infection. Later, fibroblasts create a relatively avascular wall about the area. When host mechanisms fail to contain the cutaneous or submucosal infection, staphylococci may enter the lymphatics and the bloodstream. Common sites of metastatic spread include the lungs, kidneys, cardiac valves, myocardium, liver, spleen, bone and brain.

[0007] Antimicrobial resistance by staphylococci favors their peristence in the hospital environment. Over 90 percent of both hospital and community strains of S. aureus causing infection are resistant to penicillin. This resistance is due to the production of β lactamase enzymes. The genes for these enzymes are usually carried by plasmids. Infections due to organisms with such acquired resistance can sometimes be treated with β lactamase resistant penicillin derivatives. However the true penicillinase-resistant S. aureus organisms, called methicillin resistant S. aureus (MILSA), are resistant to all the βlactam antibiotics and the cephalosporins. MRSA resistance is chromosomally mediated and involves production of an altered penicillin-binding protein (PBP 2a or PBP 2′) with a low binding for β lactams. MRSA frequently also have acquired plasmids mediating resistance to erythromycin, tetraccyline, chloramphenicol, clindamycin, and aminoglyucosides. MRSA have become increasingly common worldwide, particularly in tertiary-care referral hospitals. In the United States, approximately 32 percent of hospital isolates of S. aureus are methicillin resistant. Methicillin resistant staphylococci are a serious clinical and economic problem, since treatment of these infections often requires vancomycin, an antibiotic that is more difficult to administer and more expensive than the penicillins. Quinolone antimicrobial agents have been used to treat methicillin-resistant staphylococcal infections. Unfortunately, resistance to these antibiotics has also developed rapidly. Sixty to 70% of methicillin resistant S. aureus isolates are also quinolone resistant.

[0008] A pressing need exists for new chemical entities that are effective in the treatment of staphylococcal infections. One fruitful area of research has been in the area of agents which inhibit protein synthesis. A large number of antibacterial agents, including many in current clinical use, inhibit protein synthesis in bacteria by interfering with essential functions of the ribosome. When ribosomal function is perturbed, protein synthesis may cease entirely or, alternatively, it may be sufficiently slowed so as to stop normal cell growth and metabolism. Differences between the prokaryotic 70S ribosomes (composed of 50S and 30S subunits) and the eukaryotic 80S ribosome (composed of 60S and 40S subunits) underlie the basis for the selective toxicity of many antimicrobial agents of this class. However, a limited subset of this class of antimicrobial agents exhibits some cross-reactivity with the 70S ribosomes of eukaryotic mitochondria. This cross-reactivity probably accounts for the host cells cytotoxicity effects observed with some agents and has limited their use as clinical antimicrobial agents. Other agents (e.g., tetracycline), which affect the function of eukaryotic 80S ribosomes in vitro, are still used clinically to treat bacterial infections as the concentrations employed during antimicrobial therapy are not sufficient to elicit host cell toxicity side-effects.

[0009] Moreover, protein biosynthesis inhibitors can be divided into a number of different classes based on differences in their mechanisms of action. The aminoglycoside agents (e.g., streptomycin) bind irreversibly to the 30S subunit of the ribosome, thereby slowing protein synthesis and causing mis-translation (i.e., mis-reading) of the mRNA. The resulting errors in the fidelity of protein synthesis are bacteriocidal, and the selective toxicity of this family of agents is increased by the fact that bacteria actively transport them into the cell. The tetracycline family of agents (e.g., doxycycline) also binds to the 30S ribosome subunit, but does so reversibly. Such agents are bacteriostatic and act by interfering with the elongation phase of protein synthesis by inhibiting the transfer of the amino acid moieties of the aminoacyl-tRNA substrates into the growing polypeptide chain. However, inhibition mediated by the tetracyclines is readily reversible, with protein synthesis resuming once intracellular levels of the agent's decline. Chloramphenicol and the macrolide family of agents (e.g., erythromycin), in contrast, act on the function/activity of the 50S subunit of the ribosome. These agents are bacteriostatic in nature, and their effects are reversible. It has also been suggested that both chloramphenicol and the macrolides may have a second mode of action involved in ribosomal assembly. Champney and Burdine (1995). Finally, puromycin acts as a competitive inhibitor of the binding of aminoacyl-tRNA's to the so-called aminoacyl site (i.e., A-site) of the ribosome and acts as a chain-terminator of the elongation phase as a result of its incorporation into the growing peptide chain.

[0010] S16 is encoded by the rpsP gene in E. coli. Byström et al. 1983. It has been shown that S16 is required for efficient assembly of 30S ribosomal subunits but does not play a role in the functional activities of the assembled 30S subunit Held and Nomura (1975). Recently it has been shown that S16 is essential in E. coli. Persson et al. (1995). Essential genes in bacteria are attractive agents for antimicrobial agents.

[0011] This document discloses important new methods of identifying antibacterial substances related to the bacterial ribosomal assembly process, and to the Staphylococoal ribosomal protein S16 and it for the first time discloses the full nucleotide and amino acid sequence of Staphylococcus aureus S16 ribosomal polypeptide

Information Disclosure

[0012] U.S. Pat. No. 3,940,475

[0013] U.S. Pat. No. 5,843,669

[0014] U.S. Pat. No. 6,083,924

[0015] WO 97/09433, Cell-Cycle Checkpoint Genes

[0016] Non Patent Documents

[0017] 1. Vartikar, J. V. and D. E. Draper, S4-16 S ribosomal RNA complex. Binding constant measurements and specific recognition of a 460-nucleotide region. J Mol Biol, 1989. 209(2): p. 221-34.

[0018] 2. Altschul, S. F., et al., Basic local alignment search tool. J Mol Biol, 1990. 215(3): p. 403-10.

[0019] 3. Ausubel, F. M., Current protocols in molecular biology. 1994, New York: John Wiley & Sons. 3 v. (loose-leaf).

[0020] 4. Bolton, A. E. and W. M. Hunter, The labelling of proteins to high specific radioactivities by conjugation to a 125I-containing acylating agent. Biochem J, 1973. 133(3): p. 529-39.

[0021] 5. Byström, A. S. et al. “The nucleotide sequence of an Escherichia coli operon containing genes from the tRNA(m1G) methyl transferase, the ribosomal protein S16 and L19 and a 21-K polypeptide, EMBO J. 10, 687-696

[0022] 5. Champney, W. S. and R. Burdine, Macrolide antibiotics inhibit 50S ribosomal subunit assembly in Bacillus subtilis and Staphylococcus aureus. Antimicrob Agents Chemother, 1995. 39(9): p. 2141-4.

[0023] 6. Clauser, K. R., et al., Rapid mass spectrometric peptide sequencing and mass matching for characterization of human melanoma proteins isolated by two-dimensional PAGE. Proc Natl Acad Sci U S A, 1995. 92(11): p. 5072-6.

[0024] 7. Creighton, T. E., Proteins: structures and molecular properties. 2nd ed. 1993, New York: W. H. Freeman. xiii, 507.

[0025] 8. Devereux, J., P. Haeberli, and O. Smithies, A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res, 1984. 12(1 Pt 1): p. 387-95.

[0026] 9. Ducret, A., et al., Characterization of human serum amyloid A protein isoforms separated by two-dimensional electrophoresis by liquid chromatography/electrospray ionization tandem mass spectrometry. Electrophoresis, 1996. 17(5): p. 866-76.

[0027] 10. Evan, G. I., et al., Isolation of monoclonal antibodies specific for human c-myc proto- oncogene product. Mol Cell Biol, 1985. 5(12): p. 3610-6.

[0028] 11. Figeys, D., et al., Protein identification by capillary zone electrophoresis/microelectrospray ionization-tandem mass spectrometry at the subfemtomole level. Anal Chem, 1996. 68(11): p. 1822-8.

[0029] 12. Gevaert, K., et al., Structural analysis and identification of gel-purified proteins, available in the femtomole range, using a novel computer program for peptide sequence assignment, by matrix-assisted laser desorption ionization-reflectron time-of-flight-mass spectrometry. Electrophoresis, 1996. 17(5): p. 918-24.

[0030] 13. Gribskov, M. R. and J. Devereux, Sequence analysis primer. 1991, New York Basingstroke, Hants, England: Stockton Press; Macmillan Publishers. xv, 279.

[0031] 14. Griffin, A. M. and H. G. Griffin, Computer analysis of sequence data. 1994, Totowa, N.J.: Humana Press. 2 v.

[0032] 15. Harrison, T. R. and K. J. Isselbacher, Harrison's principles of internal medicine. 13th/ed. 1994, New York: McGraw-Hill. 2 v. (xxxii, 2496, 154 ).

[0033] 16. Heijne, G. v., Sequence analysis in molecular biology: treasure trove or trivial pursuit. 1987, San Diego: Academic Press. xii, 188.

[0034] 17. Kohler, G. and C. Milstein, Continuous cultures of fused cells secreting antibody of predefined specificity. Nature, 1975. 256(5517): p. 495-7.

[0035] 18. Lesk, A. M. and CODATA. Task Group on Coordination of Protein Sequence Data Banks., Computational molecular biology: sources and methods for sequence analysis. 1988, Oxford; New York: Oxford University Press. xii, 254.

[0036] 19. Lutz, W., et al., Internalization of vasopressin analogs in kidney and smooth muscle cells: evidence for receptor-mediated endocytosis in cells with V2 or V1 receptors. Proc Natl Acad Sci U S A, 1990. 87(17): p. 6507-11.

[0037] 20. Neidhardt, F. C., Escherichia coli and Salmonella typhiurium: cellular and molecular biology. 1987, Washington, D.C.: American Society for Microbiology. 2 v.

[0038] 21. Nomura, M., A. Tissières, and P. Lengyel, Ribosomes. 1974, [Cold Spring Harbor, N. Y.]: Cold Spring Harbor Laboratory. pp. 193-223.

[0039] 22. Paborsky, L. R., et al., Mammalian cell transient expression of tissue factor for the production of antigen. Protein Eng, 1990. 3(6): p. 547-53.

[0040] 23. Patterson, S. D. and R. Aebersold, Mass spectrometric approaches for the identification of gel-separated proteins. Electrophoresis, 1995. 16(10): p. 1791-814.

[0041] 24. Persson, B. C. et al. Functional analysis of the ffh-trm region of Escherichia coli chromosome by using reverse genetics, J.Bacteriol. 177, 5554-5560.

[0042] 25. Reisfeld, R. A. and S. Sell, Monoclonal antibodies and cancer therapy: proceedings of the Roche-UCLA symposium held in Park City, Utah, Jan. 26-Feb. 2, 1985. 1985, New York: Liss. xxii, 609.

[0043] 26. Sambrook, J., E. F. Fritsch, and T. Maniatis, Molecular cloning: a laboratory manual. 2nd ed. 1989, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory. 3 v. in 1.

[0044] 27. Skinner, R. H., et al., Use of the Glu-Glu-Phe C-terminal epitope for rapid purification of the catalytic domain of normal and mutant ras GTPase-activating proteins. J Biol Chem, 1991. 266(22): p. 14163-6.

[0045] 28. Smith, D. W., Biocomputing: infornatics and genome projects. 1994, San Diego: Academic Press. xii, 336.

[0046] 29. Syvanen, J. M., Y. R. Yang, and M. W. Kirschiner, Preparation of 125 I-Catalytic subunit of asparatate transcarbamylase and its use in studies of the regulatory subunit. J Biol Chem, 1973. 248(11): p. 3762-8.

[0047] 30. Held, W. A. and M. Nomura, Escherichia coli 30 S ribosomal proteins uniquely required for assembly. J Biol Chem, 1975. 250(8): p. 3179-84.

BRIEF DESCRIPTION OF THE SEQUENCE LISTINGS

[0048] SEQ ID NO:1 Complete coding sequence of S16 ribosomal polypeptide

[0049] SEQ ID NO:2 Predicted polypeptide sequence of S16 ribosomal polypeptide

[0050] SEQ ID NO:3 Sequencing Primer

[0051] SEQ ID NO:4 Sequencing Primer

[0052] SEQ ID NO:5 Sequencing Primer

[0053] SEQ ID NO:6 Sequencing Primer

[0054] SEQ ID NO:7 Sequencing Primer

[0055] SEQ ID NO:8 PCR Primer

[0056] SEQ ID NO:9 PCR Primer

[0057] SEQ ID NO:10 DNA sequence for Staphylococcus aureus S4 ribosomal protein gene (coding and flanking sequences)

[0058] SEQ ID NO:11 Polypeptide sequence for Staphylococcus aureus S4 ribosomal protein

[0059] SEQ ID NO:12 DNA sequence for Staphylococcus aureus S7 ribosomal protein gene (coding and flanking sequences)

[0060] SEQ ID NO:13 Polypeptide sequence for Staphylococcus aureus S7 ribosomal protein

[0061] SEQ ID NO:14 DNA sequence for Staphylococcus aureus S8 ribosomal protein gene (coding and flanking sequences)

[0062] SEQ ID NO:15 Polypeptide sequence for Staphylococcus aureus S8 ribosomal protein

[0063] SEQ ID NO:16 DNA sequence for Staphylococcus aureus S15 ribosomal protein gene (coding and flanking sequences)

[0064] SEQ ID NO:17 Polypeptide sequence for Staphylococcus aureus S15 ribosomal protein

[0065] SEQ ID NO:18 DNA sequence for Staphylococcus aureus S17 ribosomal protein gene (coding and flanking sequences)

[0066] SEQ ID NO:19 Polypeptide sequence for Staphylococcus aureus S17 ribosomal protein

[0067] SEQ ID NO:20 DNA sequence for Staphylococcus aureus 16S ribosomal RNA gene (coding and flanking sequences)

[0068] SEQ ID NO:21 DNA sequence for Staphylococcus aureus S1 ribosomal protein gene (coding and flanking sequences)

[0069] SEQ ID NO:22 Polypeptide sequence for Staphylococcus aureus S1 ribosomal protein gene

[0070] SEQ ID NO:23 DNA sequence for Staphylococcus aureus S2 ribosomal protein gene (coding and flanking sequences)

[0071] SEQ ID NO:24 Polypeptide sequence for Staphylococcus aureus S2 ribosomal protein

[0072] SEQ ID NO:25 DNA sequence for Staphylococcus aureus S3 ribosomal protein gene (coding and flanking sequences)

[0073] SEQ ID NO:26 Polypeptide sequence for Staphylococcus aureus S3 ribosomal protein

[0074] SEQ ID NO:27 DNA sequence for Staphylococcus aureus S5 ribosomal protein gene (coding and flanking sequences)

[0075] SEQ ID NO:28 Polypeptide sequence for Staphylococcus aureus S5 ribosomal protein

[0076] SEQ ID NO:29 DNA sequence for Staphylococcus aureus S6 ribosomal protein gene (coding and flanking sequences)

[0077] SEQ ID NO:30 Polypeptide sequence for Staphylococcus aureus S6 ribosomal protein

[0078] SEQ ID NO:31 DNA sequence for Staphylococcus aureus S9 ribosomal protein gene (coding and flanking sequences)

[0079] SEQ ID NO:32 Polypeptide sequence for Staphylococcus aureus S9 ribosomal protein

[0080] SEQ ID NO:33 DNA sequence for Staphylococcus aureus S10 ribosomal protein gene (coding and flanking sequences)

[0081] SEQ ID NO:34 Polypeptide sequence for Staphylococcus aureus S10 ribosomal protein

[0082] SEQ ID NO:35 DNA sequence for Staphylococcus aureus S11 ribosomal protein gene (coding and flanking sequences)

[0083] SEQ ID NO:36 Polypeptide sequence for Staphylococcus aureus S11 ribosomal protein

[0084] SEQ ID NO:37 DNA sequence for Staphylococcus aureus S12 ribosomal protein gene (coding and flanking sequences)

[0085] SEQ ID NO:38 Polypeptide sequence for Staphylococcus aureus S12 ribosomal protein

[0086] SEQ ID NO:39 DNA sequence for Staphylococcus aureus S13 ribosomal protein gene (coding and flanking sequences)

[0087] SEQ ID NO:40 Polypeptide sequence for Staphylococcus aureus S13 ribosomal protein

[0088] SEQ ID NO:41 DNA sequence for Staphylococcus aureus S14 ribosomal protein gene (coding and flanking sequences)

[0089] SEQ ID NO:42 Polypeptide sequence for Staphylococcus aureus S14 ribosomal protein

[0090] SEQ ID NO:43 DNA sequence for Staphylococcus aureus S16 ribosomal protein gene (coding and flanking sequences)

[0091] SEQ ID NO:44 Polypeptide sequence for Staphylococcus aureus S16 ribosomal protein

[0092] SEQ ID NO:45 DNA sequence for Staphylococcus aureus S18 ribosomal protein gene (coding and flanking sequences)

[0093] SEQ ID NO:46 Polypeptide sequence for Staphylococcus aureus S18 ribosomal protein

[0094] SEQ ID NO:47 DNA sequence for Staphylococcus aureus S19 ribosomal protein gene (coding and flanking sequences)

[0095] SEQ ID NO:48 Polypeptide sequence for Staphylococcus aureus S19 ribosomal protein

[0096] SEQ ID NO:49 DNA sequence for Staphylococcus aureus S20 ribosomal polypeptide gene (coding and flanking sequences)

[0097] SEQ ID NO:50 Polypeptide sequence for Staphylococcus aureus S20 ribosomal protein

[0098] SEQ ID NO:51 DNA sequence for Staphylococcus aureus S21 ribosomal protein gene (coding and flanking sequences)

[0099] SEQ ID NO:52 Polypeptide sequence for Staphylococcus aureus S21 ribosomal protein

[0100] SEQ ID NO:53 Exemplary S4 Forward PCR Primer

[0101] SEQ ID NO:54 Exemplary S4 Reverse PCR Primer

[0102] SEQ ID NO:55 Exemplary S18 Forward PCR Primer

[0103] SEQ ID NO:56 Exemplary S18 Reverse PCR Primer

[0104] SEQ ID NO:57 Exemplary S6 Forward PCR Primer

[0105] SEQ ID NO:58 Exemplary S6 Reverse PCR Primer

BRIEF DESCRIPTION OF THE FIGURES

[0106] FIG. 1-DNA Coding Region and Amino Acid Sequence of the S16 ribosomal polypeptide

[0107] FIG. 2 Graphic illustration of a simplified ribosomal assembly map incorporating direct binding S proteins (S4, S8, S7, S17, and S20) as well as S16. Arrows between proteins indicate the effect of a protein on another whose binding it enhances. Thick arrows indicate a principal contribution. Thin arrows indicate lesser contribution. Based on Noller and Nomura (1987)

[0108] FIG. 3 Graphic illustration of a ribosomal assembly map incorporating direct binding S proteins (S4, S8, S7, S17, and S20) as well as some proteins which integrate themselves into ribosomes by reliance on protein-protein interactions (non-direct binding proteins) (S3, S5, S9, S10, S12, S14, S16 and S19). Arrows between proteins indicate the effect of a protein on another whose binding it enhances. Thick arrows indicate a principal contribution. Thin arrows indicate lesser contribution. Noller and Nomura (1987)

[0109] FIG. 4 Graphical illustration of a ribosomal assembly assay incorporating direct binding S proteins (S4, S8, S7, S17, and S20) as well as proteins which integrate themselves into ribosomes by reliance on protein-protein interactions “non direct binding proteins”(S3, S5, S9, S10, S12, S14, S16 and S19).

SUMMARY OF THE INVENTION

[0110] The present invention provides an isolated S aureus S16 ribosomal polypeptide, and the isolated polynucleotide molecules that encode them, as well as vectors and host cells comprising such polynucleotide molecules. The DNA sequences provided herein may be used in the discovery and development of antibacterial compounds. The encoded polypeptide, upon expression, can be used as a target for the screening of antibacterial drugs. High-throughput assays for identifying inhibitors of ribosomal assembly are provided. Solid phase high throughput assays are provided, as are related assay compositions, integrated systems for assay screening and other features that will be evident upon review.

[0111] In one embodiment, the invention provides an isolated S16 ribosomal polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2. The DNA and predicted amino acid sequence of Staphylococcus aureus S16 ribosomal polypeptide is displayed below:

ATGGCAGTTAAAATTCGTTTAACACGTTTAGGTTCAAAAAGAAATCCATTCTATCGTATC60
M  A  V  K  I  R  L  T  R  L  G  S  K  R  N  P  F  Y  R  I
GTAGTAGCAGATGCTCGTTCTCCACGTGACGGACGTATCATCGAACAAATCGGTACTTAT120
V  V  A  D  A  R  S  P  R  D  G  R  I  I    E  Q  I  G  T  Y
AACCCAACGAGCGCTAATGCTCCAGAAATTAAAGTTGACGAAGCGTTAGCTTTAAAATGG180
N  P  T  S  A  N  A  P  E  I  K  V  D  E  A  L  A  L  K  W
TTAAATGATGGTGCGAAACCAACTGATACAGTTCACAATATCTTATCAAAAGAAGGTATT240
L  N  D  G  A  K  P    T  D  T  V  H  N  I  L  S  K  E  G  I
ATGAAAAAATTTGACGAACAAAAGAAAGCTAAGTAA276
M   K  K  F  D  E  Q  K  K  A  K  *

[0112] Although SEQ ID NOS:1 and 2 provide particular S. aureus sequences, the invention is intended to include within its scope other S. aureus allelic variants. Allelic variants are understood to mean naturally-occurring base changes in the species population which may or may not result in an amino acid change of the DNA sequences herein

[0113] The present invention also includes include variants of the aforementioned polypetide, that is polypeptides that vary from the referents by conservative amino acid substitutions, whereby a residue is substituted by another with like characteristics.

[0114] The nucleic acids of the invention include those nucleic acids coding for the same amino acids in the S16 ribosomal polypeptide due to the degeneracy of the genetic code

[0115] In another embodiment, the invention provides isolated polynucleotides (e.g. RNA and DNA, both naturally occurring and synthetically derived, both single and double stranded) that comprise a nucleotide sequence encoding the amino acid sequence of the polypeptides of the invention. Such polynucleotides are useful for recombinantly expressing the enzyme and also for detecting expression of the polypeptides in cells (e.g. using Northern hybridization and in situ hybridization assays). Specifically excluded from the definition of polynucleotides of the invention is the entire isolated chromosome of the native host cells. A preferred polynucleotide of the invention set forth in SEQ ID NO:1 corresponds to the naturally occurring S16 ribosomal polypeptide encoding nucleic acid sequence. It will be appreciated that numerous other sequences exist that also encode S16 ribosomal polypeptide of SEQ ID NO:2 due to the well known degeneracy of the universal genetic code. In another preferred embodiment the invention is directed to all isolated degenerate polynucleotides encoding the S16 ribosomal polypeptide.

[0116] In another embodiment the invention provides an isolated nucleic acid comprising the nucleotide sequence having least 70%, 80, 90%, 95% identity with SEQ ID NO:1. In one embodiment, the invention provides an isolated S16 ribosomal polypeptide comprising the amino acid sequence set forth in SEQ ID NO:2.

[0117] In a related embodiment the invention provides vectors comprising a polynucleotide of the invention. Such vectors are useful, e.g. for amplifying the polynucleotides in host cells to create useful quantities thereof. In preferred embodiments, the vector is an expression vector wherein the polynucleotide of the invention is operatively linked to a polynucleotide comprising an expression control sequence. Such vectors are useful for recombinant production of polypeptides of the invention.

[0118] In another related embodiment, the invention provides host cells that are transformed with polynucleotides or vectors of the invention. As stated above, such host cells are useful for amplifying the polynucleotides and also for expressing the S16 ribosomal polypeptide or a fragment thereof encoded by the polynucleotide.

[0119] In still another related embodiment, the invention provides a method for producing the S16 ribosomal polypeptide (or a fragment thereof) comprising the steps of growing a host cell of the invention in a nutrient medium and isolating the S16 ribosomal polypeptide from the cells.

[0120] In still another related embodiment the invention provides a method for testing for inhibitors of ribosomal assembly comprising the steps of contacting at least one direct binding ribosomal polypeptide selected from the group consisting of S4, S7, S8, S15, S17 and S20 with 16S ribosomal RNA to form a polyribonucleotide protein complex and; contacting said polyribonucleotide protein complex with at least one non-direct binding ribosomal polypeptide selected from the group consisting of S1, S2,S3, S5, S6, S9, S10,S11,S12,S13, S14,S16, S18,S19, and S21. in the presence and absence of a test agent; and then determining the amount of at least one non-direct binding ribosomal polypeptide bound to the RNA in the presence and the absence of a test agent and then comparing the amount of least one non direct binding ribosomal polypeptide bound under both conditions.

[0121] A decrease in the amount of protein determined in the presence of test agent compared to that determined in the absence of the test agent indicates that said agent is an inhibitor of ribosomal assembly

[0122] In still another related embodiment the invention provides an isolated S16 ribosomal polypeptide comprising an amino acid sequence at least 70%, 80, 90%, 95% identical to the sequence of SEQ ID NO:2.

[0123] In addition to the foregoing, the invention includes as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations specifically mentioned above. Although the applicant(s) invented the full scope of the claims appended hereto, the claims appended are not intended to encompass within their scope the prior art work of others. Therefore, in the event that statutory prior art within the scope of a claim is brought to the attention of the applicants by a Patent Office or other entity or individual, the applicant(s) reserve the right to exercise amendment rights under applicable patent laws to redefine the subject matter of such a claim to specifically exclude such statutory prior art or obvious variations of statutory prior art from the scope of such a claim. Variations of the invention defined by such amended claims also are intended as aspects of the invention.

DETAILED DESCRIPTION OF THE INVENTION

[0124] The foregoing is provided to further facilitate understanding of the applicant's invention but is not intended to limit the scope of applicant's invention.

[0125] Definitions

[0126] As used hereinafter “Isolated” means altered by the hand of man from the natural state. If an “isolated” composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.

[0127] As used hereinafter “Polynucleotide” generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. “Polynucleotides” include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, “polynucleotide” refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term “polynucleotide” also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications may be made to DNA and RNA; thus, “polynucleotide” embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, aswell as the chemical forms of DNA and RNA characteristic of viruses and cells. “Polynucleotide” also embraces relatively short polynucleotides, often referred to as oligonucleotides.

[0128] As used hereinafter “Polypeptide” refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. “Polypeptide” refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. “Polypeptides” include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications may occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present to the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination (see, for instance, Proteins-Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993; Wold, F., Post-translational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in Postranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al., “Analysis for protein modifications and nonprotein cofactors”, Meth Enzymol (1990) 182:626-646 and Rattan et al., “Protein Synthesis: Post-translational Modifications and Aging”, Ann NY Acad Sci (1992) 663:4842).

[0129] As used hereinafter “Variant” refers to a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis. As used hereinafter “Identity” is a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. “Identity” per se has an art-recognized meaning and can be calculated using published techniques (see, e.g.: Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, N.J., 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term “identity” is well known to skilled artisans (Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCG program package (Devereux, J., et al., Nucleic Acids Research (1984) 12(1):387), BLASTP, BLASTN, and FASTA (Atschul, S. F. et al., J Molec Biol (1990) 215:403). The well known Smith Waterman algorithm may be used to determine identity. The Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison, Wis.) is one such program which uses the algorithm of Smith and Waterman (Adv. Appl. Math. 2:482-489 (1981)).

[0130] By way of example, a polynucleotide sequence of the present invention may be identical to the reference sequence of SEQ ID NO:1, that is be 100% identical, or it may include up to a certain integer number of nucleotide alterations as compared to the reference sequence. Such alterations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion, and wherein said alterations may occur at the 5′ or 3′ terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. The number of nucleotide alterations is determined by multiplying the total number of nucleotides in SEQ ID NO:1 by the numerical percent of the respective percent identity(divided by 100) and subtracting that product from said total number of nucleotides in SEQ ID NO:1, or:

n n ≦x n −(xn·y)

[0131] wherein nn is the number of nucleotide alterations, xn is the total number of nucleotides in SEQ ID NO:1, and y is 0.50 for 50%, 0.60 for 60%, 0.70 for 70%, 0.80 for 80%, 0.85 for 85%, 0.90 for 90%, 0.95 for 95%, 0.97 for 97% or 1.00 for 100%, and wherein any non-integer product of xn and y is rounded down to the nearest integer prior to subtracting it from xn. Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2 may create nonsense, missense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations.

[0132] Similarly, a polypeptide sequence of the present invention may be identical to the reference sequence of SEQ ID NO:2, that is be 100% identical, or it may include up to a certain integer number of amino acid alterations as compared to the reference sequence such that the % identity is less than 100%. Such alterations are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non-conservative substitution, or insertion, and wherein said alterations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence. The number of amino acid alterations for a given % identity is determined by multiplying the total number of amino acids in SEQ ID NO:2 by the numerical percent of the respective percent identity(divided by 100) and then subtracting that product from said total number of amino acids in SEQ ID NO:2, or:

n a ≦x a −(xa·y)

[0133] wherein na is the number of amino acid alterations, xa is the total number of amino acids in SEQ ID NO:2, and y is, for instance 0.70 for 70%, 0.80 for 80%, 0.85 for 85% etc., and wherein any non-integer product of xa and y is rounded down to the nearest integer prior to subtracting it from xa. Identity has been similarly defined in U.S. Pat. No. 6,083,924, which is hereby incorporated by reference.

[0134] The present invention provides isolated polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands, both single and double stranded) encoding a Staphylococcus aureus ribosomal protein S16. The nucleic acids of the invention include those nucleic acids coding for the same amino acids in the S16 ribosomal polypeptide due to the degeneracy of the genetic code. DNA polynucleotides of the invention include genomic DNA and DNA that has been synthesized in whole or in part. “Synthesized” as used herein and understood in the art, refers to polynucleotides produced by purely chemical as opposed to enzymatic methods. “Wholly” synthesized DNA sequences are therefore produced entirely by chemical means, and “partially” synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means. Genomic DNA of the invention comprises the protein-coding region for a polypeptide of the invention and is also intended to include allelic variants. Allelic variants. Allelic variants are understood to mean naturally-occurring base changes in the species population which may or may not result in an amino acid change of the DNA sequences herein.

[0135] “16S ribosomal RNA” is understood to mean an isolated small subunit RNA of any prokaryote whether isolated from ribosomes, made synthetically or prepared by transcription, “16S ribosomal RNA” can mean either the full length sequence or a fragment thereof.

[0136] As used herein, the term “contacting” means bringing together, either directly or indirectly, a compound into physical proximity to a polypeptide or polynucleotide of the invention. Additionally “contacting” may mean bringing a polypeptide of the invention into physical proximity with another polypeptide or polynucleotide (either another polypeptide or polynucleotide of the invention or a polypeptide or polynucleotide not so claimed) or bringing a polynucleotide of the invention into physical proximity with a polypeptide or polynucleotide (either a polypeptide or polynucleotide of the invention or a polypeptide or polynucleotide not so claimed).

[0137] As used herein, the term “polyribonucleotide protein complex” refers to a covalent or non-covalently associated molecular entity containing 16S ribosomal RNA and at least one small subunit ribosomal protein

[0138] “Small subunit ribosomal protein” as used herein refers to ribosomal proteins present in the small (30S) ribosomal subunit of the ribosome of derived from any prokaryotic species. Small subunit ribosomal proteins include: S1, S2 S3, S4, S5, S6, S7, S8, S9, S10, S11, S12, S13, S14, S15,S16, S17, S18, S19, S20, and S21.

[0139] “Direct binding ribosomal polypeptide” or “direct binding S-protein” or “direct binding ribosomal protein” as used herein refers to a polypeptide derived from any prokaryotic species selected from the group consisting of S4, S7, S8, S17, S15 and S20.

[0140] “Non-Direct binding ribosomal polypeptide” or “non-direct binding S-protein” or “non-direct binding ribosomal protein” as used herein refers to a polypeptide derived from any prokaryotic species selected from the group consisting of S1, S2 S3, S5, S6, S9, S10, S11, S12, S13, S14, S16, S18, S19, and S21. These proteins are also referred to as “secondary binding proteins”.

[0141] “Antibodies” as used herein includes monoclonal and polyclonal antibodies, chimeric, single chain, simianized antibodies and humanized antibodies, as well as Fab fragments, including the products of an Fab immunolglobulin expression library. The S16 ribosomal polypeptides of the invention or variants thereof, or cell expressing them can be used as an immunogen to produce antibodies immunospecific for such polypeptides.

[0142] Nucleic Acids of the Invention

[0143] A preferred DNA sequence of the invention encoding the Staphylococcus aureus S16 ribosomal polypeptide is set out in SEQ ID NO:1. The worker of skill in the art will readily appreciate that the preferred DNA of the invention comprises a double stranded molecule, for example the molecule having the sequence set forth in SEQ ID NO:1 along with the complementary molecule (the “non-coding strand” or “complement”) having a sequence deducible from the sequence of SEQ ID NO:1 according to Watson-Crick base pairing rules for DNA. Also preferred are other polynucleotides encoding the S16 ribosomal polypeptide of SEQ ID NO:2, which differ in sequence from the polynucleotide of SEQ ID NO:1 by virtue of the well-known degeneracy of the universal genetic code. The determination of the nucleotide sequence is described in the following example.

EXAMPLE 1

Procedure for Obtaining Sequence Information of the S16 Gene Directly from the 2.8 Mb S. aureus Genome.

[0144] The S. aureus S16 gene was sequenced using an ABI377 fluorescence sequencer (Perkin Elmer Applied Biosystems, Foster City, Calif.) and the ABI BigDye™ Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq FS DNA polymerase (PE Applied Biosystems, Foster City, Calif.). Each cycle sequencing reaction contained about 4 g of purified S. aureus DNA. Cycle-sequencing was performed using an initial denaturation at 98° C. for 1 min, followed by 100 cycles: 98° C. for 30 sec, annealing at 50° C. for 30 sec, and extension at 60° C. for 4 min. Temperature cycles and times were controlled by a Perkin-Elmer 9700 thermocycler. Extension products were purified using Centriflex™ gel filtration cartridges (Edge BioSystems, Gaithersburg, Md.). Each reaction product was loaded by pipette onto the column, which was then centrifuged in a swinging bucket centrifuge (Sorvall model RT6000B table top centrifuge) at 750×g for 1.5 min at room temperature. Column-purified samples were dried under vacuum for about 40 min and then dissolved in 1.5 μl of a DNA loading solution (83% deionized formamide, 8.3 mM EDTA, and 1.6 mg/ml Blue Dextran). The samples were then heated to 90° C. for three min and the complete sample was loaded into the gel sample well of the ABI377 sequencer. Sequence chromatogram data files from the ABI377 were analyzed with the computer program Sequencher (Gene Codes, Ann Arbor, Mich.), for assembly of sequence fragments and correction of ambiguous base calls. Generally sequence reads of 600 bp were obtained. Sequence base call ambiguities were removed by obtaining the complete sequence of the S16 gene on both DNA strands.

[0145] Sequencing of S. aureus S16 gene.

[0146] We located in the HGS S. aureus database a 175 bp GST (Human Genome Sciences ID #btecc45r) which encodes about 16 amino acids of the S16 polypeptide. The DNA sequence corresponding to this coding region was used to design forward (SEQ ID NO:3, 5′-AACTGCCATTTATAAAATCTCC) and reverse (SEQ ID NO:4, 5′-TAAAGGAGATTTTATAAATGGCAG) primers. The primers were designed without the aid of the ABI profile, thus the quality of the HGS sequence data could not be assessed. New S. aureus sequence data was obtained only from the reverse primer (SEQ ID NO:4) which extended the sequence data upstream of the S16 gene. Using the sequence generated by primer SEQ ID NO:4 two reverse primers were designed, SEQ ID NO:5 (5′-TTATATTGGGGGAACGTGTGCGG) and SEQ ID NO:6 (5′AGTCTAATTTAGTAATCACATAG) to prime sequences starting about 150 and 100 bp 5′ of the start of the S16 gene, respectively). Both of these primers generated excellent ABI sequence profiles. The complete double-stranded sequence of this gene was obtained by using primer SEQ ID NO:7 (5′-TATTACTAACATGTGATATTCCC) which was designed from sequence data located about 50 bp downstream from the 3′-end of the S16 gene. A total of 1.3 kb of sequence data was obtained within and around the S16 gene and analysis of this sequence revealed the complete S16 gene that encodes the complete S16 polypeptide. The S. aureus S16 polypeptide contains 91 amino acid residues, and this sequence shares about 66% identity with the S16 polypeptide from B.subtilis:

[0147] The invention further embraces species, which are homologs of the Staphyloccocus aureus S16 ribosomal polypeptide encoding DNA. Species homologs, would encompass nucleotide sequences which share at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% identity with Staphylococcus aureus polynucleotide of the invention

[0148] The polynucleotide sequence information provided by the invention makes possible large scale expression of the encoded polypeptide by techniques well known and routinely practiced in the art. Polynucleotides of the invention also permit identification and isolation of polynucleotides encoding related ribosomal proteins, such as allelic variants and species homologs, by well known techniques including Southern and/or Northern hybridization, and polymerase chain reaction (PCR).

[0149] The disclosure herein of a full length polynucleotide encoding an S16 ribosomal polypeptide makes readily available to the worker of ordinary skill in the art every possible fragment of the full length polynucleotide. The invention therefore provides fragments of the S16 ribosomal polypeptide encoding polynucleotides comprising at least 14-15, and preferably at least 18, 20, 25, 50, or 75 consecutive nucleotides of a polynucleotide encoding S16 ribosomal polypeptide. Preferably, fragment polynucleotides of the invention comprise sequences unique to the S16 ribosomal polypeptide encoding polynucleotide sequence and therefore hybridize under highly stringent or moderately stringent conditions only (i.e. “specifically”) to polynucleotides encoding S16 ribosomal polypeptide. Sequences unique to polynucleotides of the invention are recognizable through sequence comparison to other known polynucleotides, and can be identified through use of alignment programs routinely utilized in the art, e.g. those made available in public sequence databases. Such sequences are also recognizable from Southern hybridization analyses to determine the number of fragments of genomic DNA to which a polynucleotide will hybridize. Polynucleotides of the invention can be labelled in a manner that permits their detection , including radioactive, fluorescent, and enzymatic labelling.

[0150] Fragment polynucleotides are particularly useful as probes for detection of full length or other fragment S16 ribosomal polypeptide polynucleotides or for the expression of fragments of S16 ribosomal polypeptide. One or more fragment polynucleotides can be included in kits that are used to detect variations in a polynucleotide sequence encoding S16 ribosomal polypeptide.

[0151] The invention also embraces DNAs encoding S16 ribosomal polypeptide polypeptides which DNAs hybridize under moderately stringent or high stringency conditions to the non-coding strand, or complement, of the polynucleotide in SEQ ID NO:1

[0152] Exemplary highly stringent hybridization conditions are as follows: hybridization at 42° C. in a hybridization solution comprising 50% formamide, 1% SDS, 1M NaCl, 10% Dextran sulfate, and washing twice for 30 minutes at 60° C. in a wash solution comprising 0.1 X SSC and 1% SDS. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described Ausubel, et al. (Eds.), Protocols in Molecular Biology, John Wiley & Sons (1994), pp.6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook, et al., (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y. (1989), pp. 9.47 to 9.51.

[0153] Host Cells and Vectors of the Invention

[0154] According to another aspect of the invention, host cells are provided, including prokaryotic and eukaryotic cells, comprising a polynucleotide of the invention (or vector of the invention) in a manner which permits expression of the encoded S16 ribosomal polypeptide. Polynucleotides of the invention may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a viral vector. Methods for introducing DNA into the host cell well known and routinely practiced in the art include transformation, transfection, electroporation, nuclear injection, or fusion with carriers such as liposomes, micelles, ghost cells, and protoplasts. Expression systems of the invention include bacterial, yeast, fungal, plant, insect, invertebrate, and mammalian cells systems. Suitable host cells for expression of S16 ribosomal polypeptides include prokaryotes, yeast, and higher eukaryotic cells. Suitable prokaryotic hosts to be used for the expression of human Staphylococcus aureus Ribosomal Protein Gene, S16 include bacteria of the genera Escherichia, Bacillus, and Salmonella, as well as members of the genera Pseudomonas, Streptomyces, and Staphylococcus.

[0155] The isolated nucleic acid molecules of the invention are preferably cloned into a vector designed for expression in prokaryotic cells, rather than into a vector designed for expression in eukaryotic cells. Prokaryotic cells are preferred for expression of genes obtained from prokaryotes because prokaryotic cells are more economical sources of protein production and because prokaryotic hosts grow to higher density and are typically grown in media which is less expensive than that used for the growth of eukaryotic hosts.

[0156] In the event a eukaryotic host were used the possibilities may include, but are not limited to, the following: insect cells, African green monkey kidney cells (COS cells), Chinese hamster ovary cells (CHO cells), human 293 cells, and murine 3T3 fibroblasts.

[0157] Expression vectors for use in prokaryotic hosts generally comprise one or more phenotypic selectable marker genes. Such genes generally encode, e.g., a protein that confers antibiotic resistance or that supplies an auxotrophic requirement. A wide variety of such vectors are readily available from commercial sources. Examples include pSPORT vectors, pGEM vectors (Promega), pPROEX vectors (LTI, Bethesda, Md.), Bluescript vectors (Stratagene), and pQE vectors (Qiagen). A representative cloning and expression scheme is provided by the following example.

EXAMPLE 2

Isolation and Cloning of the S16 Coding Region

[0158] Two primers were designed for PCR. One contains the ATG of S16 ribosomal protein with a Cla site on the end. This forward primer is a 37mer and is designated SEQ ID NO:8 and has the sequence 5′ GTG TTA TCG ATA ATG CAG TTA AAA TTC GTT TAA CAC G. The downstream primer designated SEQ ID NO:9 is a 35mer and has the sequence 5′ GTG TTG GAT CCT TAC TTA GCT TTC TTT TGT TCG TC This sequence includes the stop codon of S16 ribosomal protein with a BamH1 site on the end. Staphylococcus aureus genomic DNA was used as a template. The buffer (N808-0006) and Amplitaq® (N8080-0101) were purchased from Perkin Elmer Cetus . The 10 mM dNTP mix was obtained from Gibco BRL (Gaithersburg, Md.). The reaction mix was 5 μl of buffer, 1 μl of dNTP mix, 1 ng of each primer, 1 ng of genomic DNA and 0.5 μl (2.5 units) of amplitaq in a final volume of 50 μl. The program for PCR was 94° C. for 10 minutes and then 40 cycles of 94° C. for 1 minute, 57° C. for 30 seconds, and 72° C. for one minute. The final extension phase was at 72° C. for 3 minutes and the reactions were allowed to stay at 4° C. until they were removed from the thermocycler.

[0159] Vector Construction and Expression

[0160] The PCR products were purified, digested with Cla1 and BamH1 and ligated to the expression vector pSR-Tac which contains Cla I and BamHI cloning sites. This vector contains a tac promoter, an AT rich synthetic ribosome binding site, two transcription terminators designated T1 and sib3 upstream of the tac promoter and downstream of the cloned gene, respectively, an ampicillin resistance gene derived from pBR322, and a ColE1 origin of replication. The Cla I restriction site is located immediately downstream of the ribosome binding site and the BamHI site is immediately upstream of the sib3 terminator. While this particular vector worked quite well it is expected that other vectors used in E.coli heterologous protein expression would be equally suitable.

[0161] After transformation into E. coli strain Top10 F'laciq, the colonies were screened by DNA mini prep and restriction digestion to find the desired constructs. The constructs were sequenced and transformed into E. coli strain K12s F'laciq for expression studies.

[0162] Cells harboring the construct pSRTac-S16 were grown in 50 ml LB with ampicillin at 37° C. The cultures were induced with 10−3 M IPTG during the midlog phase of growth and allowed to express for 3 hours. Then the cells were collected, sonicated and examined using gel electrophoresis.

[0163] Half a milliliter of the sonicated expression cultures were centrifuged at 10,000 rpm for 10 minutes. The supernatant was collected as the soluble fraction and the pellet (insoluble fraction) was suspended in 10 mM Tris-HCl pH 8.0. These samples were electrophoresed on 20% acrylamide with DATD crosslinker. The S16 protein was expressed at moderate levels and observed to be in the soluble fraction.

[0164] Polypeptides of the Invention

[0165] Overexpression in eukaryotic and prokaryotic hosts as described above facilitates the isolation of S16 polypeptides. The invention therefore includes isolated S16 polypeptides as set out in SEQ ID NO:2 and variants and conservative amino acid substitutions therein including labeled and tagged polypeptides.

[0166] The invention includes S16 polypeptides which are “labeled”. The term “labeled” is used herein to refer to the conjugating or covalent bonding of any suitable detectable group, including enzymes (e.g., horseradish peroxidase, beta-glucuronidase, alkaline phosphatase, and beta-D-galactosidase), fluorescent labels (e.g., fluorescein, luciferase), and radiolabels (e.g., 14C, 125I, 3H, 32P, and 35S) to the compound being labeled. Techniques for labeling various compounds, including proteins, peptides, and antibodies, are well known. See, e.g., Morrison, Methods in Enzymology 32b, 103 (1974); Syvanen et al., J. Biol. Chem. 284, 3762 (1973); Bolton and Hunter, Biochem. J. 133, 529 (1973). The termed labelled may also encompass a polypeptide which has covalently attached an amino acid tag as discussed below.

[0167] In addition, the S16 polypeptides of the invention may be indirectly labeled. This involves the covalent addition of a moiety to the polypeptide and subsequent coupling of the added moiety to a label or labeled compound which exhibits specific binding to the added moiety. Possibilities for indirect labeling include biotinylation of the peptide followed by binding to avidin coupled to one of the above label groups. Another example would be incubating a radiolabeled antibody specific for a histidine tag with a S16 polypeptide comprising a polyhistidine tag. The net effect is to bind the radioactive antibody to the polypeptide because of the considerable affinity of the antibody for the tag.

[0168] The invention also embraces variants (or analogs) of the S16 protein. In one example, insertion variants are provided wherein one or more amino acid residues supplement a S16 amino acid sequence. Insertions may be located at either or both termini of the protein, or may be positioned within internal regions of the S16 protein amino acid sequence. Insertional variants with additional residues at either or both termini can include for example, fusion proteins and proteins including amino acid tags or labels. Insertion variants include S16 polypeptides wherein one or more amino acid residues are added to a S16 acid sequence, or to a biologically active fragment thereof.

[0169] Insertional variants therfore can also include fusion proteins wherein the amino and/or carboxy termini of S16 is fused to another polypeptide. Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the influenza HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include the Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al., Science, 255:192-194 (1992)]; an alpha -tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393-6397(1990)]. In addition, the S16 polypeptide can be tagged with enzymatic proteins such as peroxidase and alkaline phosphatase.

[0170] In another aspect, the invention provides deletion variants wherein one or more amino acid residues in a S16 polypeptide are removed. Deletions can be effected at one or both termini of the S16 polypeptide, or with removal of one or more residues within the S16 amino acid sequence. Deletion variants, therefore, include all fragments of theS16 polypeptide.

[0171] The invention also embraces polypeptide fragments of the sequence set out in SEQ ID NO:2 wherein the fragments maintain biological (e.g., ligand binding or RNA binding and/or other biological activity) Fragments comprising at least 5, 10, 15, 20, 25, 30, 35, or 40 consecutive amino acids of SEQ ID NO: 2 are comprehended by the invention. Fragments of the invention having the desired biological properties can be prepared by any of the methods well known and routinely practiced in the art.

[0172] The present invention also includes include variants of the aforementioned polypeptide, that is polypeptides that vary from the referents by conservative amino acid substitutions, whereby a residue is substituted by another with like characteristics. Variant polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding polypeptides of the invention. Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties. Exemplary conservative substitutions are set out in Table A (from WO 97/09433, page 10, published Mar. 13, 1997 (PCT/GB96/02197, filed Sep. 6, 1996), immediately below.

TABLE A
Conservative Substitutions I
SIDE CHAIN
CHARACTERISTIC    AMINO ACID
Aliphatic
Non-polar         GAP
                  ILV
Polar - uncharged CSTM
                  NQ
Polar - charged   DE
                  KR
Aromatic          HFWY
Other             NQDE

[0173] Alternatively, conservative amino acids can be grouped as described in Lehninger, [Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY (1975), pp.71-77] as set out in Table B, immediately below

TABLE B
Conservative Substitutions II
SIDE CHAIN
CHARACTERISTIC               AMINO ACID
Non-polar (hydrophobic)
A. Aliphatic:                ALIVP
B. Aromatic:                 FW
C. Sulfur-containing:        M
D. Borderline:               G
Uncharged-polar
A. Hydroxyl:                 STY
B. Amides:                   NQ
C. Sulfhydryl:               C
D. Borderline:               G
Positively Charged (Basic):  KRH
Negatively Charged (Acidic): DE

[0174] As still an another alternative, exemplary conservative substitutions are set out in Table C, immediately below.

TABLE C
Conservative Substitutions III
Original Residue Exemplary Substitution
Ala (A)          Val, Leu, Ile
Arg (R)          Lys, Gln, Asn
Asn (N)          Gln, His, Lys, Arg
Asp (D)          Glu
Cys (C)          Ser
Gln (Q)          Asn
Glu (E)          Asp
His (H)          Asn, Gln, Lys, Arg
Ile (I)          Leu, Val, Met, Ala, Phe,
Leu (L)          Ile, Val, Met, Ala, Phe
Lys (K)          Arg, Gln, Asn
Met (M)          Leu, Phe, Ile
Phe (F)          Leu, Val, Ile, Ala
Pro (P)          Gly
Ser (S)          Thr
Thr (T)          Ser
Trp (W)          Tyr
Tyr (Y)          Trp, Phe, Thr, Ser
Val (V)          Ile, Leu, Met, Phe, Ala

[0175] Generally it is anticipated that the S16 polypeptide will be found primarily intracellularly, the intracellular material can be extracted from the host cell using any standard technique known to the skilled artisan. For example, the host cells can be lysed to release the contents of the periplasm/cytoplasm by French press, homogenization, and/or sonication followed by centrifugation. The S16 polypeptide is found primarily in the supernatant after centrifugation of the cell homogenate, and the S16 polypeptide can be isolated by way of non-limiting example by any of the methods below.

[0176] In those situations where it is preferable to partially or completely isolate the S16 polypeptide, purification can be accomplished using standard methods well known to the skilled artisan. Such methods include, without limitation, separation by electrophoresis followed by electroelution, various types of chromatography (immunoaffinity, molecular sieve, and/or ion exchange), and/or high pressure liquid chromatography. In some cases, it may be preferable to use more than one of these methods for complete purification.

[0177] Purification of S16 polypeptide can be accomplished using a variety of techniques. If the polypeptide has been synthesized such that it contains a tag such as Hexahistidine (S16/hexaHis) or other small peptide such as FLAG (Eastman Kodak Co., New Haven, Conn.) or myc (Invitrogen,Carlsbad, Calif.) at either its carboxyl or amino terminus, it may essentially be purified in a one-step process by passing the solution through an affinity column where the column matrix has a high affinity for the tag or for the polypeptide directly (i.e., a monoclonal antibody specifically recognizingS16). For example, polyhistidine binds with great affinity and specificity to nickel, thus an affinity column of nickel (such as the Qiagen Registered TM nickel columns) can be used for purification of S16/polyHis. (See for example, Ausubel et al., eds., Current Protocols in Molecular Biology, Section 10.11.8, John Wiley & Sons, New York [1993]).

[0178] Even if the S16 polypeptide is prepared without a label or tag to facilitate purification. The S16 of the invention may be purified by immunoaffinity chromatography. To accomplish this, antibodies specific for the S16 polypeptide must be prepared by means well known in the art. Antibodies generated against the S16 polypeptides of the invention can be obtained by administering the polypeptides or epitope-bearing fragments, analogues or cells to an animal, preferably a nonhuman, using routine protocols. For preparation of monoclonal antibodies, any technique known in the art that provides antibodies produced by continuous cell line cultures can be used. Examples include various techniques, such as those in Kohler, G. and Milstein, C., Nature 256: 495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., pg. 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985).

[0179] Where the S16 polypeptide is prepared without a tag attached, and no antibodies are available, other well known procedures for purification can be used. Such procedures include, without limitation, ion exchange chromatography, molecular sieve chromatography, HPLC, native gel electrophoresis in combination with gel elution, and preparative isoelectric focusing (“Isoprime” machine/technique, Hoefer Scientific). In some cases, two or more of these techniques may be combined to achieve increased purity. A representative purification scheme is detailed below.

EXAMPLE 3

Large Scale Purification of S16 Protein

[0180] S16-expressing E. coli cell paste from about a 6 liters of fermentation is resuspended in ˜70 mL Tris buffer pH 7.4 containing 1 mM MgCl2 and 1 mM DTT. One Complete® EDTA-free protease inhibitor pellet (Boehringer Mannheim, Indianapolis, Ind.) is added to the suspended cells. The cells are lysed by passage three times through a French Press @ 10,000 PSI. A soluble fraction is prepared from the cellular lysate by ultracentrifugation @ 100,000×g for 60 minutes @ 4° C. The soluble fraction is injected onto a HiPrep SPXL 16/10 cation exchange column which had been equilibrated in 50 mM Tris buffer pH 7.4, 1 mM MgCl2, and 1 mM DTT. The column flow rate is 4 mL/min. The column is washed with buffer until the Abs280 of the column eluate is less then 0.01. Material is eluted off of the HiPrep SPXL column with a linear gradient of 0-700 mM NaCl in column buffer over 20 column volumes.

[0181] Fractions are collected and analyzed by SDS-PAGE using 4-12% Bis-Tris NuPage® gels (Novex, San Deigo, Calif.) employing a MES buffer system. S16-containing fractions are further analyzed by liquid chromatography electrospray mass spectrometry (LC/MS-ESI) performed on a Finnigan LC/Q instrument. The results of the LC/MS-ESI analysis are used to calculate an average mass of the isolated S16. The predicted average mass of the intact S16 is calculated to be around 10,000

[0182] In addition to preparing and purifying S16 polypeptide using recombinant DNA techniques, the S16 polypeptides, fragments, and/or derivatives thereof may be prepared by chemical synthesis methods (such as solid phase peptide synthesis) using techniques known in the art such as those set forth by Merrifield et al., (J. Am. Chem. Soc., 85:2149 [1963]), Houghten et al. (Proc Natl Acad. Sci. USA, 82:5132 [1985]), and Stewart and Young (Solid Phase Peptide Synthesis, Pierce Chemical Co., Rockford, Ill. [1984]). Such polypeptides may be synthesized with or without a methionine on the amino terminus. Chemically synthesized S16 polypeptides or fragments may be oxidized using methods set forth in these references to form disulfide bridges. The S16 polypeptides or fragments are expected to have biological activity comparable to S16 polypeptides produced recombinantly or purified from natural sources, and thus may be used interchangeably with recombinant or natural S16 polypeptide.

[0183] Ribosomal Assembly Assays

[0184] 70S ribosome particles in E. coli consist of 31 core ribosomal “L” proteins and two rRNAs (5S and 23S) in the 50S subunit and 21 “S” proteins and a single 16S rRNA in the 30S subunit. These particles constitute the basic machinery for bacterial protein translation. It is postulated that the Staphylococcus aureus ribosome is assembled in fashion to ribosomes in E.coli. The present invention provides several methods to study the S.aureus 30S subunit assembly and methods to screen for inhibitors of the assembly process.

[0185] Assembly of the 30S ribosomal subunit is an ordered process both in vivo and in vitro. Nomura, M. and Held, W. A. (1974), Noller and Nomura (1987). It is now well known that the 21 proteins which comprise the the E. coli 30S subunit assemble onto the the 16S rRNA in an ordered fashion in vitro. Id. These proteins have been defined as primary or secondary binders, according to whether they bind to the 16S RNA independently of other proteins or not. Proteins that bind directly to 16S rRNA include S4, S7, S8, S15, S17 and S20. Secondary binding proteins include S3, S5, S9, S10, S12,S14,S16and S19.

[0186] Producing and purifying the S.aureus ribosomal “S” proteins which are most critical for the formation of functional 30S subunits including those that bind directly to 16S rRNA (i.e., S4, S7, S8, S15, S17 and S20) “direct binding S-proteins” and critical proteins that integrate themselves into the ribosome by reliance on protein-protein and/or protein-RNA interactions (S3, S5, S9, S10, S12, S14, S16 and S19) provides myriad choices in designing methods for testing inhibitors of ribosomal assembly.

[0187] Simplified 30S Ribosomal Subunit Assembly Assay

[0188] It is recognized that the role of the S16 polypeptide in the assembly of complete ribosomal small subunits may, in part, be dependent on the interactions with the direct binding S-proteins which directly interact with the 16S ribosomal RNA.

[0189] It is likely that the incorporation of S16 into a complete 30S subunit is at least partially dependent on other secondary binding proteins include S3, S5, S9, S10, S12, S14, or S19. However, examination of published binding maps show that a incubation of the direct binding S proteins with S16 in the presence and absence of test compounds and subsequent measurement of relative incorporation of S16 into the polyribonucleotide protein complex provides a fruitful avenue for identification of small subunit ribosomal assembly inhibitors.

[0190] By way of non-limiting example one can envision numerous ways in which the presence of unbound or bound S16 could be detected. The S16 might be radiolabeled in any of a number of means including but not limited to, labeling in vitro by chemical or enzymatic means or vivo by metabolically labeling cells expressing S16.

[0191] As discussed above commonly used radioactive isotopes used for the radiolabeling of peptides and proteins and nucleic acids include but are not limited to 3H, 14C, 35S, 125I and 32P. In addition, of course, if the S16 polypeptide or is tagged with an amino acid tag, as described above, the tag and the covalently attached S16 protein can be detected by means well known in the art. In addition, the S16 polypeptide or a polynucleotide can be tagged with enzymatic proteins such as peroxidase and alkaline phosphatase, and fluorescent labels (U.S. Pat. No. 3,940,475) which are capable of being monitored for change in fluorescence intensity, wavelength shift, or fluorescence polarization (FP) or fluorescent resonance energy transfer (FRET). Another method of labeling polypeptides and nucleic acids includes biotinylation of the peptide of the peptide or nucleic acid followed by binding to avidin coupled to one of the above label groups or a solid support.

[0192] In another embodiment, all the direct binding S-proteins can be incubated with 16S RNA and the presence of bound or unbound S16 polypeptide determined. Indeed, the identity of all of the bound or unbound proteins can be determined. The identity of a bound or unbound S protein can be determined, for instance by a suitable mass spectrometry technique, such as matrix-assisted laser desorption/ionization combined with time-of-flight mass analysis (MALDI-TOF MS) or electrospray ionization mass spectrometry (ESI MS). See Jensen et al., 1977, Protein Analysis By Mass Spectrometry, In Creighton (ed.), Protein Structure, A Practical Approach (Oxford University Press), Oxford, pp. 29-57; Patterson & Aebersold, 1995,Electrophoresis 16: 1791-1814; Figeys et al., 1996, Analyt. Chem. 68: 1822-1828 (each of which is incorporated herein by reference in its entirety). Preferably, a separation technique such as HPLC or capillary electrophoresis is directly or indirectly coupled to the mass spectrometer. See Ducret et al., 1996, Electrophoresis 17: 866-876; Gevaert et al., 1996, Electrophoresis 17: 918-924; Clauser et al., 1995, Proc. Natl. Acad. Sci. USA 92: 5072-5076 (each of which is incorporated herein by reference in its entirety).

EXAMPLE 4

[0193] This assay is used to test for disruptions in interactions between the S16 polypeptide, the direct binding S proteins, and the 16S RNA.

[0194] Preparation of Starting Materials

[0195] Preparation of Direct Binding Ribosomal Proteins

[0196] The starting material proteins are preferably prepared by recombinant means and over-expression in a suitable host essentially as described in Examples 1, 2 and 3 for S16 with obvious modifications to reflect the differing sequences of the proteins involved. The nucleotide sequences of cDNA's encoding S. aureus direct binding ribosomal proteins S4, S7, S8, S15, S17 and S20 are presented in SEQ ID NOS:10, 12, 14, 16, 18 and 49 respectively. Sequences encoding S4, S7, S8, S15, and S17 can be isolated by means of the polymerase chain reaction. Primers are selected such that entire coding region is isolated. The complete amino acid sequences of S4, S7, S8, S15, S17 and S20 polypeptides are presented in SEQ ID NOS:11, 13, 15, 17, 19 and 50. Sequences encoding S4, S7, S8, S15, S17 and S20 can be isolated by means of probing a genomic Staphylococcus aureus library with probes designed from SEQ ID NOS: 10, 12, 14, 16, 18 and 49 as well. The polymerase chain reaction would be a preferred method because it generally allows the isolation of a complete coding sequence in one experiment.

[0197] Methods for preparing and using probes and primers are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1987 (with periodic updates); and Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990.

[0198] Primers are selected to have low self- or cross-complementarity, particularly at the 3′ ends of the sequence. Long homopolymer tracts and high GC content are avoided to reduce spurious primer extension. Primers are typically about 20 to 30 residues in length, but this length can be modified as well known in the art, in view of the particular sequence to be amplified. Computer programs are available to aid in these aspects of the design. One widely used computer program for designing PCR primers is (OLIGO 4.0 by National Biosciences, Inc., 3650 Annapolis Lane, Plymouth, Mich.). Another is Primer (Version 0.5,(c) 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).

[0199] Cloning of 16S Ribosomal RNA

[0200] The complete 16S-rRNA gene was identified in the HGS data base on contig 168268 by homology to the B. subtilis sequence. Five prime sequence of 5′-TTATGGAGAGTTTGATCCTGGC-3′ and the 3′ sequence of 5′-GCGGCTGGATCACCTCCTTTCT-3′ were used to amplify the entire 16S-rRNA gene from S. aureus (Oligo Etc; Wilsonville, Oreg.). The amplified gene was cloned into pT7Blue using Novagen's (Madison, Wis.) Perfectly Blunt Cloning Kit. DNA template was created by PCR using a primer that had the T7 promoter on the 5′ end sequence of the 16S-rRNA gene (5′-TAATACGACTCACTATAGTTTTATGGA-GAGTTTGATCCTGGC-3′). The length of the amplified 16S-rRNA fragment can be altered by the selection of the 3′ primer. 3H-UTP or 35S-ATP are used to label the RNA if labeled RNA is desired. Resulting RNAs are characterized by electrophoresis on acrylamide-urea gels, and RNA concentrations are determined by UV spectroscopy using A260 unit=40 ug/ml. The entire S16 ribosomal RNA gene sequence has been reported (Genbank Accession # X68417 also U.S. Pat. No. 5,843,669 Sequence # 160). The sequence of the gene is included in this document as SEQ ID NO:21

[0201] In this assay all six of the S-proteins that bind directly to 16S RNA are added together followed by S16 in the presence and absence of a test compound. Unbound S-proteins are then removed by size-separation or filtration. Automated LC/ESI ion-trap or MALDI-tof-MS is then used to determine if a particular S-protein is inhibited in its binding to 16S RNA. Mass spectrometry is an ideal detection tool since all of the S-protein average masses are known and unique. An example illustrates how specific inhibition of S16 protein binding to RNA is detected. The concept is illustrated in FIG. 2.

[0202] RNA:protein assembly is assayed in 80 mM K+-HEPES, pH 7.6, 20 mM MgCl2, 330 mM NaCl at 42° C. The procedure is based on the conditions of Culver and Noller (RNA, 1999, 5: 832-843) except that 0.01% Nikkol detergent is removed because it significantly complicates the LC/MS analysis. Primary ribosomal binding proteins S4, S7, S8, S15, S17, and S20 are dialyzed overnight against 80 mM K+-HEPES, pH 7.6, 20 mM MgCl2, 1 M NaCl. In the reconstitution, 200 pmol in vitro transcribed 16S RNA is incubated at 42° C. for 15 minutes. Then, 800 pmol S7, S8, S15, S17, S4 and S20 each are added to the RNA. 400 pmol S16 is then added to the mixture The NaCl concentration is then adjusted to 330 mM by adding 80 mM K+-HEPES, pH 7.6, 20 mM MgCl2. The mixture is then incubated at 42° C. for 20 more minutes. The protein:RNA complex is then separated from the free proteins by spinning in a YM-100 Microcon at 500 ×g for 20 minutes. The RNA is precipitated from the retentate by adding 2 volumes of acetic acid and incubating on ice for 45 minutes. Proteins from both the flow-through and retentate are analyzed by LC/ESI ion trap mass spectrometry. The proteins are first separated on a C4 reversed phase column (Vydac) using a gradient from 98% of 0.1% TFA, 2% of 90% acetonitrile/0. 1% TFA to 100% of 90% acetonitrile/0.1% TFA. The intact mass of each protein is observed by electrospray mass spectrometry as it eluted from the column. Relative amounts of each protein are accessed in the presence and absence of test compounds.

EXAMPLE 5

Scintillation Proximity Assay (SPA)

[0203] As in the previous example all six of the S-proteins that bind directly to 16S RNA are added together followed by S16 ribosomal polypeptide in the presence and absence of a test compound. In this example the 16S ribosomal RNA is end labeled with biotin and the S16 ribosomal polypeptide is radioactively labeled.

[0204] Primary ribosomal binding proteins S4, S7, S8, S15, S17, and S20 are dialyzed overnight against 80 mM K+-HEPES, pH 7.6, 20 mM MgCl2, 1 M NaCl. In the reconstitution, 200 pmol in vitro transcribed biotin end labeled 16S RNA is incubated at 42° C. for 15 minutes. Then, 800 pmol S7, S8, S15, S17, S4 and S20 each are added to the RNA. 400 pmol radioactively labeled S16 is then added to the mixture The NaCl concentration is then adjusted to 330 mM by adding 80 mM K+-HEPES, pH 7.6, 20 mM MgCl2. Fifty μl strepavidin coated SPA beads (20 mg/ml) is added to the 50 μl of of the reaction mixture in a Dynatech Microlite plate and counted in a Topcount™ Microplate Scintillation Counter. To identify potential inhibitors of S16 incorporation into the polyribonucleotide protein complex, the assay is run in the presence and absence of potential inhibitors and the effect on binding is assessed.

[0205] Protein-protein Interaction Assembly Screen

[0206] The isolated S16 polypeptide of the invention also makes possible an assay through which one may detect all possible protein-protein disruptions in the 30S assembly process. This is important since published assembly maps are not based on the myriad of possible protein-protein interactions that may occur. In practice these maps are based on limited S-protein combinations that were tested in vitro. This assay makes use of the fact that the assembly of ribosomes in general and the 30S subunit in particular, is an ordered process and makes use of all 21 small subunit ribosomal proteins or a limited subset of those proteins. The S3 ribosomal protein is known to integrate itself last or very late in the ribosomal assembly process. Its efficient integration is known to be dependent upon the proper integration of the direct binding ribosomal proteins as well non-direct binding proteins. Proper partial assembly is monitored by measuring the incorporation of S3 ribosomal polypeptide into the partially or fully assembled ribosome. In the alternative, improper or disrupted assembly can be assayed by exclusion of S3 ribosomal polypeptide from the ribosome

[0207] The S3 ribosomal protein may be labeled as discussed hereinbefore for ease of detection. The 16S ribosomal RNA or a direct binding ribosomal peptide may immobilized or the entire assay may be performed with all components in solution phase. The starting materials for the assays are preferably prepared by recombinant means. The DNA sequences encoding all 21 30S subunit proteins are provided in the sequence listings as well as the amino acids sequences encoded by each. The invention provides ribosomal assembly assays utilizing all 21 small subunit ribosomal proteins as well as a select subset of proteins readily apparent to one skilled in the art. Sequences encoding each protein can be isolated by means of the polymerase chain reaction. Primers are selected as discussed previously. Primers are selected such that entire coding region is isolated. Methods for preparing and using probes and primers are discussed above.

[0208] Exemplary forward and reverse primers suitable for amplification of S4, S6, and S18 are described listed here by way of example. One skilled in the art would recognize that other primers may be equally suitable.

S4 Forward	5′-TATATTATCGATAATGGCTCGATTCAGAGGT-3′	(SEQ ID NO:53)
S4 Reverse	5′-TATAGGATCCTTAACGGATTAATTGTTCGTTAATTT-3′	(SEQ ID NO:54)
S18 Forward	5′-TATATTATCGATAATGGCAGGTGGACCAAGAAG-3′	(SEQ ID NO:55)
S18 Reverse	5′TATAGGATCCTTATTGTTCTTCTTTAACAT-3′	(SEQ ID NO:56)
S6 Forward	5′-TATATTATCGATAATGAAGAAACATATGAAGTTAT-3′	(SEQ ID NO:57)
S6 Reverse	5′-TATAGGATCCTTACTTGTCTTCGTCTTCAC-3′	(SEQ ID NO:58)

EXAMPLE 6

Partial Ribosomal Assembly Assay

[0209] In this assay format several S-proteins are allowed to interact with 16S RNA in the presence of a test compound (FIG. 3). The assay makes use of all of the direct binding ribosomal proteins except S15 (S4, S7, S8, S17 and S20) and a select group of S. aureus ribosomal proteins which integrate themselves into the ribosome by reliance on protein-protein or protein-RNA interactions (non-direct binding ribosomal proteins) (S3, S5, S9, S10, S12, S14, S16 and S19)

[0210] The starting material proteins are prepared by recombinant means and over-expression in a suitable host essentially as described in Examples 1, 2 and 3 for the S16 polypeptide of the invention with obvious modifications to reflect the differing sequences of the proteins involved. The nucleotide sequences of cDNA's encoding S. aureus direct binding ribosomal proteins S4, S7, S8, S17 and S20 are presented in SEQ ID NOS:10, 12, 14, 19 and 49 respectively.

[0211] The nucleotide sequences of cDNA's encoding S. aureus ribosomal proteins which integrate themselves into the ribosome by reliance on protein-protein or protein-RNA interactions S3, S5, S9, S10, S12, S14, and S19 are presented in SEQ ID NOS:25, 27, 31, 33, 37, 41, 43, and 48 respectively. Nucleotide sequences encoding S. aureus. S3, S4, S5, S7, S8, S9, S10, S12, S14, S17 and S19 can be isolated by means of the polymerase chain reaction. Primers are selected as discussed previously, such that the entire amino acid coding region is isolated. The complete amino acid sequences of S. aureus S3, S4, S5, S7, S8, S9, S10, S12, S14, S17 and S19 polypeptides are presented in SEQ ID NOS:26, 11, 28, 13, 15, 31, 34, 38, 42, and 19 respectively. The production of the isolated S16 polypeptide of the invention is described hereinbefore. Sequences encoding S3, S4, S5, S7, S8, S9, S10, S12, S14, S17 and S19 can be isolated by means of probing a genomic Staphylococcus aureus library with probes designed from SEQ ID NOS:25, 27, 31, 33, 37, 41, 43, and 48 as well. The polymerase chain reaction would be a preferred method because it generally allows the isolation of a complete coding sequence in one experiment. The S3 protein is labeled, preferably radiolabeled.

[0212] RNA:protein assembly is assayed in 80 mM K+-HEPES, pH 7.6, 20 mM MgCl2, 330 mM NaCl at 42° C. The procedure is based on the conditions of Culver and Noller (RNA, 1999, 5: 832-843) except that 0.01% Nikkol detergent is removed because it significantly complicates the LC/MS analysis. Ribosomal proteins S3, S4, S5, S7, S8, S9, S10, S12, S14, S16, S17, S19 and S20 are dialyzed overnight against 80 mM K+-HEPES, pH 7.6, 20 mM MgCl2, 1 M NaCl. In the reconstitution, 200 pmol in vitro transcribed 16S RNA is incubated at 42° C. for 15 minutes. Then, 800 pmol ribosomal proteins S4, S7, S8, S17, and S20 added to the RNA, followed by ribosomal proteins, S5, S9, S10, S12, S14, S16 and S19. The NaCl concentration is then adjusted to 330 mM by adding 80 mM K+-HEPES, pH 7.6, 20 mM MgCl2. The mixture is then incubated at 42° C. for 20 more minutes. 800 pmol labeled ribosomal protein S3 is then added.

[0213] Unbound S-proteins are removed by size-separation or filtration. If the labelled S3 protein is present in the RNA:multiprotein complex then the compound does not inhibit any specific protein-protein interactions during the assembly process. If the compound prevents the incorporation of labelled S3 protein then the assay reveals that the test compound inhibits a protein-protein interaction.

[0214] The partially assembled RNA:multiprotein complex is then analyzed by LC/ion-trap electrospray analysis to determine the S-protein components in the partially assembled complex. Alternatively MALDI-tof-MS can be used. Knowing the identity of S-proteins in the partially assembled complex and published knowledge of how the 30S subunit is assembled in vitro (Noller and Nomura (1987) the protein-protein interaction that is disrupted by the test compound may be determined. The exact protein-protein interaction that is disrupted can be determined using selective combinations of S-proteins added to 16S RNA and compound. As stated above, this is an important confirmation process since published in vitro assembly maps are based on a limited data set. Assembly disruption by the test compound can be independently verified by analytical ultracentrifugation analysis (FIG. 4). In this process the partially assembled 30S complex is differentiated from intact complex by displaying a lower rate of sedimentation in a given centrifugal field (i.e., as measured by a lower sedimentation constant, expressed in Svedberg units or S). The contents of sedimentation clusters can be verified by mass spectrometry.

[0215] It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples.

[0216] Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the invention.

[0217] The entire disclosure of all publications cited herein are hereby incorporated by reference.

Claims

1. An isolated nucleic acid comprising a nucleotide sequence that encodes an amino acid sequence having at least 85% identity with SEQ ID NO:2

2. An isolated nucleic acid comprising the nucleotide sequence having least 85% identity with SEQ ID NO:1

3. An isolated nucleic acid comprising a nucleotide sequence that encodes the amino acid sequence of SEQ ID NO:2

4. An isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO:1

5. An isolated S16 ribosomal polypeptide comprising an amino acid sequence having least 85% identity to the sequence of SEQ ID NO:2

6. An isolated S16 ribosomal polypeptide comprising the amino acid sequence of SEQ ID NO:2

7. The isolated S16 ribosomal polypeptide of claim 6 which is labeled

8. The isolated S16 ribosomal polypeptide of claim 7 wherein the label is selected from the group consisting of: radiolabels, fluorescent labels, amino acid tags and biotin

9. The isolated S16 ribosomal polypeptide of claim 8 wherein said S16 ribosomal polypeptide comprises a radiolabel

10. The isolated S16 ribosomal polypeptide of claim 8 wherein said S16 ribosomal polypeptide comprises a fluorescent label.

11. The isolated S16 ribosomal polypeptide of claim 8 wherein said S16 ribosomal polypeptide comprises an amino acid tag.

12. The isolated S16 ribosomal polypeptide of claim 8 wherein said S16 ribosomal polypeptide comprises a biotin molecule

13. A vector comprising the nucleic acid of claim 1

14. A host cell comprising the vector of claim 13

15. A method of making isolated an S16 ribosomal polypeptide comprising: a) introducing the nucleic acid of claim 1 into a host cell b) maintaining said host cell under conditions whereby said nucleic acid is expressed to produce said S16 ribosomal polypeptide c) purifying said S16 ribosomal polypeptide

16. A method for testing for inhibitors of ribosomal assembly comprising the steps of: a.) contacting at least one direct binding ribosomal polypeptide selected from the group consisting of S4, S7, S8, S15, S17 and S20 with 16S ribosomal RNA to form a polyribonucleotide protein complex and; b) contacting said polyribonucleotide protein complex with S16 ribosomal polypeptide (i) in the presence of a test agent; and (ii) in the absence of said test agent; and c) determining the amount of S16 ribosomal polypeptide bound to the polyribonucleotide protein complex (i) in the presence of a test agent; and (ii) in the absence of said test agent; and d) comparing the amount of S16 ribosomal polypeptide determined in step (c)(i) to the amount of S16 ribosomal polypeptide determined in step (c)(ii);

17. The method of claim 16 wherein the direct binding ribosomal proteins comprise S4, S7, S8.

18. The method of claim 16 wherein the direct binding ribosomal proteins comprise S4, S7, S8 and S17.

19. The method of claim 16 wherein the direct binding ribosomal proteins comprise S4, S7, S8, S17, S15.

20. The method of claim 16 wherein the direct binding ribosomal proteins comprise S4, S7, S8, S17, S15 and S20

21. The method of claim 16 wherein the S16 ribosomal polypeptide is labelled

22. The method of claim 16 wherein S16 ribosomal polypeptide comprises a radiolabel

23. The method of claim 16 wherein S16 ribosomal polypeptide comprises an amino acid tag.

24. The method of claim 16 wherein wherein S16 ribosomal polypeptide comprises comprises a biotin molecule

25. The method of claim 16 wherein said 16S ribosomal RNA is labeled

26. The method of claim 16 wherein said 16S ribosomal RNA comprises a radiolabel

27. The method of claim 16 wherein said 16S ribosomal RNA comprises a biotin molecule

28. The method of claim 16 wherein wherein S16 ribosomal polypeptide is attached to a solid support.

29. The method of claim 16 wherein said 16S ribosomal RNA is attached to a solid support

30. A method for testing for inhibitors of ribosomal assembly comprising the steps of: a.) contacting at least one direct binding ribosomal polypeptide selected from the group consisting of S4, S7, S8, S15, S17 and S20 with 16S ribosomal RNA to form a polyribonucleotide protein complex and; b) contacting said polyribonucleotide protein complex with at least one non-direct binding ribosomal polypeptide selected from the group consisting of S1, S2, S3, S5, S6, S9, S10, S11, S12, S13, S14, S16, S18, S19, and S21. (iii) in the presence of a test agent; and (iv) in the absence of said test agent; and c) determining the amount of at least one non-direct binding ribosomal polypeptide bound to the RNA (i) in the presence of a test agent; and (ii) in the absence of said test agent; and d) comparing the amount of least one non direct binding ribosomal polypeptide in step (c)(i) to the amount of non-direct binding ribosomal polypeptide protein determined in step (c)(ii);

31. The method of claim 30 wherein the direct binding ribosomal proteins comprise S4, S7, S8.

32. The method of claim 30 wherein the direct binding ribosomal proteins comprise S4, S7, S8 and S17.

33. The method of claim 30 wherein the direct binding ribosomal proteins comprise S4, S7, S8, S17, S15.

34. The method of claim 30 wherein the direct binding ribosomal proteins comprise S4, S7, S8, S17, S15 and S20

35. The method of claim 30 wherein the non-direct binding ribosomal proteins comprise S16

36. The method of claim 30 wherein the non-direct binding ribosomal proteins comprise S3, S5, S9, S10, S12, S14, S16 and S19

37. The method of claim 30 wherein said direct binding or non-direct binding ribosomal polypeptide is labeled

38. The method of claim 30 wherein said direct binding or non-direct binding ribosomal polypeptide comprises a radiolabel

39. The method of claim 30 wherein said direct binding or non-direct binding ribosomal polypeptide comprises an amino acid tag.

40. The method of claim 30 wherein said said direct binding or non-direct binding ribosomal polypeptide comprises a biotin molecule

41. The method of claim 30 wherein said 16S ribosomal RNA is labeled

42. The method of claim 30 wherein said 16S ribosomal RNA comprises a radiolabel

43. The method of claim 30 wherein said 16S ribosomal RNA comprises a biotin molecule

44. The method of claim 30 wherein said direct binding or non-direct binding ribosomal polypeptide is attached to a solid support.

45. The method of claim 30 wherein said 16S ribosomal RNA is attached to a solid support

46. A method for testing for inhibitors of ribosomal assembly comprising the steps of: a.) contacting S4, S7, S8, S17 and S20 ribosomal polypeptides with 16S ribosomal RNA to form apolyribonucleotide protein complex and; b) contacting said polyribonucleotide protein complex with non-direct binding ribosomal polypeptides S3, S5, S9, S10, S12, S14, S16 and S19 to form a resultant polyribonucleotide protein complex (v) in the presence of a test agent; and (vi) in the absence of said test agent; and b) contacting non-direct binding ribosomal polypeptide S3 with said resultant polyribonucleotide protein complex; and c) determining the amount of said non-direct binding ribosomal polypeptide S3 bound to said resultant polyribonucleotide protein complex; (i) formed in the presence of said test agent; and (ii) formed in the absence of said test agent; and e) comparing the amount of S3 determined in step (c)(i) to the amount of S3 determined in step (c)(ii)

47. The method of claim 46 wherein said non-direct binding ribosomal polypeptide S3 is labeled.

48. The method of claim 47 wherein said non-direct binding ribosomal polypeptide S3 is radiolabeled