COMPOSITIONS AND KITS FOR DETECTING THE PRESENCE OF A HYPERVIRULENT CLOSTRIDIUM DIFFICILE STRAIN

Abstract

The present invention provides a nucleic acid amplification based method for detecting a hypervirulent Clostridium difficile strain in a biological sample. The present invention is based on the use of oligonucleotide primers and probes specific to negative and positive markers in hypervirulent Clostridium difficile genome.

Description

REFERENCE TO SEQUENCE LISTING

The present application contains a Sequence Listing which has been submitted electronically in ST26 format. Said ST26 Copy, created on Feb. 2, 2024, is named “4342-P6US-DIV2_Seq_Listing_ST26” and is 15,118 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference it its entirety.

FIELD

The present invention relates to the field of nucleic acid amplification based diagnostic assays. More specifically, the present invention provides a PCR based method for detecting a hypervirulent Clostridium difficile strain, preferably toxin producing Clostridium difficile strain 027, in a biological sample, such as a stool sample. The present invention is based on the use of oligonucleotide primers and probes specific to negative and positive markers for hypervirulent Clostridium difficile strains.

BACKGROUND OF THE INVENTION

C. difficile infection (CDI) is a toxin-mediated intestinal disease. The clinical outcomes of CDI can range from asymptomatic colonization to more severe disease syndromes, including severe diarrhoea, abdominal pain, fever and leukocytosis. C. difficile is recognized as the main cause of infectious diarrhoea that develops in patients after hospitalization and antibiotic treatment. Therefore, CDI is now considered to be one of the most important of health care-associated infections. Further, non-hospital-associated reservoirs of C. difficile are also emerging, and C. difficile is capable of spreading in animal hosts (Denéve et al., 2009; Rupnik et al, 2009).

C. difficile testing methods currently include cytotoxigenic culture methods, cytotoxin assays (CYT) detecting the toxins A and B produced by C. difficile, PCR based assays for detection of the tedB gene of C. difficile, and assays for detection of C. difficile-specific glutamate dehydrogenase (GDH) (Eastwood et al., 2009).

In the prior art, the PCR based test have been found to be reliable, sensitive, and specific diagnostic tools for rapid screening and identification of samples containing C. difficile (Eastwood et al., 2009; Hirvonen et al., 2013; Houser et al., 2010 and WO2012087135). In commercial use is a method disclosed by WO2010116290 (Philips) relating to a multiplex PCR assay for the detection of a toxigenic C. difficile strain by analysing the presence or absence of the cytotoxin tcdB gene and deletions in the tedC gene.

Although a number of PCR based assays for detecting toxin producing Clostridium difficile strain are already disclosed, there is still a need in the field for a PCR assay which is able to provide high specificity and reliability for the detection of those C. difficile strains which are hypervirulent. The present inventors have now located DNA sequence regions in Clostridium difficile genome that are surprisingly well-suited for specific and sensitive amplification of negative and positive markers relating to hypervirulent Clostridium difficile strains.

The sample matrix, which in diarrhoea diagnostics is commonly a stool or food sample, is likely to contain a host of PCR inhibitors. This reduces amplification efficiency of the PCR reaction and thus even more careful optimization is expected from the amplicon design step to verify that all templates and copy numbers are amplified equally but also efficiently enough. Hence, oligonucleotide design enabling high PCR efficiency (optimally as close to 100% as possible) is required. The detection method used may also affect amplification efficiency and/or bias.

The present inventors have now located DNA sequence regions that are well suited for specific and sensitive amplification and quantification of diarrhoea causing hypervirulent Clostridium difficile strains. The amplicons have been designed to be so specific that they can be combined into any multiplex sets with each other. Naturally a prerequisite to this is that all the disclosed amplicons have also been designed to amplify in the same reaction and cycling conditions. The aim of the invention is to replace antigen testing and culturing as a screening test for hypervirulent Clostridium difficile, and thus provide process improvements for the laboratory and clinical benefits in improved patient management by providing rapidly a rich set of information. Further, infection control could benefit if clinical microbiology laboratories could readily differentiate between non-toxigenic C. difficile and hypervirulent C. difficile.

SUMMARY OF THE INVENTION

One object of the present invention is to provide a method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample, the method comprising: performing a nucleic acid amplification reaction comprising DNA extracted from the biological sample as a template, a first oligonucleotide primer set specific for amplifying a target sequence in the C. difficile hydR gene in the reaction, wherein said hydR gene comprises a sequence corresponding to SEQ ID NO:1, and a second oligonucleotide primer set specific for amplifying at least part of the target sequence corresponding to C. difficile sequence set forth in SEQ ID NO:2 in the reaction.

Another object of the present invention is to provide an oligonucleotide primer set comprising an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO:3 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 4, wherein the oligonucleotide primer set amplifies a target sequence in the C. difficile hydR gene.

Another object of the present invention is to provide an oligonucleotide primer set comprising an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 6, wherein the oligonucleotide primer set amplifies a specific target sequence in C. difficile genome.

Another object of the present invention is to provide an oligonucleotide primer set comprising an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 12, wherein the oligonucleotide primer set amplifies a target sequence in the C. difficile tcdB gene.

Another object of the present invention is to provide a kit for detecting a hypervirulent Clostridium difficile strain in a biological sample, the kit comprising: an oligonucleotide primer set as defined above; and a reagent for performing amplification of a nucleic acid in a nucleic acid amplification reaction.

DETAILED DESCRIPTION OF THE INVENTION

The purpose of the method of the present invention is to serve as a primary microbiological screening test for the qualitative identification of hypervirulent C. difficile, and a recurrent disease associated ribotype 027. The method is preferably performed from DNA extracted directly from a biological sample, such as a stool sample, without the use of an enrichment culture. Preferably, the method of the invention is a PCR-based C. difficile assay: such as a qPCR assay, or a qualitative multiplexed nucleic acid-based in vitro diagnostic test intended for detecting of nucleic acid markers corresponding to the detection and identification of hypervirulent Clostridium difficile and toxin producing 027 ribotype selective markers.

As used herein, a “target sequence” present in a nucleic acid sample is a strand of C. difficile DNA to be primed and extended by a “primer”. A target sequence may be either single-stranded or in a duplex with its complementary sequence. Target sequence as defined in the present invention is preferably purified to some degree prior to the amplification reactions described herein.

As used herein, the term “oligonucleotide” refers to any polymer of two or more of nucleotides, nucleosides, nucleobases or related compounds used as a reagent in the DNA amplification methods, such as primers and probes. The oligonucleotide may be DNA and/or RNA and/or analogs thereof. The term oligonucleotide does not denote any particular function to the reagent; rather, it is used generically to cover all such reagents described herein. Specific oligonucleotides of the present invention are described in more detail below. As used herein, an oligonucleotide can be virtually any length, limited only by its specific function in the DNA amplification reaction. Oligonucleotides of a defined sequence and chemical structure may be produced by techniques known to those of ordinary skill in the art, such as by chemical or biochemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules, e.g., bacterial or viral vectors. Oligonucleotides may be modified in any way, as long as a given modification is compatible with the desired function of a given oligonucleotide. One of ordinary skill in the art can easily determine whether a given modification is suitable or desired for any given oligonucleotide of the present invention. Modifications include, but are not limited to base modifications, sugar modifications or backbone modifications. While design and sequence of oligonucleotides for the present invention depend on their function as described below, several variables must generally be taken into account. Among the most critical are: length, G/C content, melting temperature (Tm), Gibb free energy (G), specificity, self-complementarity and complementarity with other oligonucleotides in the system, polypyrimidine (T, C) or polypurine (A, G) stretches, and the 3′-end sequence. Controlling for these and other variables is a standard and well-known aspect of oligonucleotide design, and various computer programs are readily available to screen large numbers of potential oligonucleotides for optimal ones.

As used herein, the term “PCR reaction”, “PCR amplifying” or “PCR amplification” refers generally to cycling polymerase-mediated exponential amplification of nucleic acids employing primers that hybridize to complementary strands, as described for example in Innis et al, PCR Protocols: A Guide to Methods and Applications, Academic Press (1990). Devices have been developed that can perform thermal cycling reactions with compositions containing fluorescent indicators which are able to emit a light beam of a specified wavelength, read the intensity of the fluorescent dye, and display the intensity of fluorescence after each cycle. The amplification product contains a sequence having sequence identity with a target nucleic acid sequence or its complement and can be detected with, for example, an intercalating dye or a detection probe having specificity for a region of the target nucleic acid sequence or its complement. The PCR reaction as defined in the present invention is preferably performed as a real-time PCR assay.

As used herein, the term “probe” refers to any of a variety of signalling molecules indicative of amplification. For example, SYBR® Green and other DNA-binding dyes are detector probes. Some detector probes can be sequence-based, for example 5′ nuclease probes. Various detector probes are known in the art, for example TaqMan® probes (See U.S. Pat. No. 5,538,848). The melting temperature, Tm, of the probes can be increased by addition of modified nucleotides. The amount of modified nucleotides in one probe is preferably 1, 2, 3, 4 or more. The modified nucleotide can be a LNA nucleotide (Exiqon A/S), minor groove binder (MGB™), SuperBase, or Peptide Nucleic Acid (PNA) or any other modification increasing the Tm of the probe.

A person skilled in the art knows that amplified target sequences, i.e. amplicons, naturally vary in related strains. This minor variation can be taken into account while designing primers suitable to amplify said amplicons in the method of the present invention. Preferably, at least 50, 60, 70, 80, 90 or 100 nucleotides long sequence of each of the target amplicons selected from the group consisting of SEQ ID NOS: 1, 2 and 10 is amplified in the method.

Preferably, the primers and probes comprise the sequences as defined in the claims and are less than 30, 35, 40, 45, 50 or 55 nucleotides long, and more preferably, less than 50 nucleotides long. Each of the present primers and probes can also be defined as consisting of at least 10, 15, 16, 17, 18, 19 or 20 contiguous nucleotides present in any one of primer or probe sequences selected from the group consisting of SEQ ID NOS:3-9 and 11-13 or comprising a sequence selected from the group consisting of SEQ ID NOS:3-9 and 11-13.

The present invention is directed to a method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample. Preferably, the method is a real-time PCR assay. The method can be performed using a DNA chip, gel electrophoresis, a radiation measurement, a fluorescence measurement, or a phosphorescence measurement. A person skilled in the art may use the primers and probes of the invention also in other methods and platforms utilizing PCR or nucleic acid amplification. Said biological sample can be, e.g., a stool sample, an environmental sample or a food sample.

The method comprises the step of:

• • performing a nucleic acid amplification reaction comprising DNA extracted from the biological sample as a template, a first oligonucleotide primer set specific for amplifying a target sequence in the C. difficile hydR gene in the reaction, wherein said hydR gene comprises a sequence corresponding to SEQ ID NO:1, and a second oligonucleotide primer set specific for amplifying at least part of the target sequence corresponding to C. difficile sequence set forth in SEQ ID NO:2 in the reaction. Preferably, the method comprises a step of detecting the presence of a hypervirulent Clostridium difficile strain in said biological sample by any method capable of detecting amplified target sequences in the reaction.

The hypervirulent Clostridium difficile strain is detected in the sample, when the first oligonucleotide primer set does not amplify a specific product, i.e. the target sequence in hydR gene is a negative marker for hypervirulent Clostridium difficile strain, and the second oligonucleotide primer set amplifies a specific product, i.e. the sequence targeted by the second primer set in C. difficile genome is a positive marker for hypervirulent Clostridium difficile strains.

The most important hypervirulent Clostridium difficile strain detected by the present method is toxin producing Clostridium difficile strain 027. Thus, the present method is particularly directed to the detection of this Clostridium difficile strain. The presence of C. difficile hydR gene DNA in said sample, however, indicates that Clostridium difficile strain 027 is not present in the examined sample or that in addition to the presence of a toxin producing Clostridium difficile strain 027 there is also presence of another Clostridium difficile strain in the sample. A skilled person of the art is, however, aware that some of hypervirulent C. difficile strains are not classified as 027-ribotype strains, therefore, the present invention is also directed to the detection of hypervirulent 027-ribotype-resembling Clostridium difficile strains.

Preferably, the first oligonucleotide primer set targets the C. difficile hydR gene and amplifies the hydR sequence set forth in SEQ ID NO:1 so that at least part of the sequence is specifically amplified in the amplification reaction. More preferably, the first oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 3 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 4, said primers amplifying at least part of the hydR sequence set forth in SEQ ID NO:1. Most preferably, the first oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 3 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 4.

The presence of the target sequence amplified with the first oligonucleotide primer set can be detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:7, or preferably, by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:7.

The target sequence of the second oligonucleotide primer set in C. difficile genome corresponds to a gene encoding a putative conjugative transposon DNA recombination protein. Preferably, said second oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 6. More preferably, the second oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 6.

The probes for the second oligonucleotide primer set as defined in SEQ ID NO: 8 and 9 can be used as competitive probes in a same reaction to detect a G/A polymorphism in C. difficile genome in a position corresponding to position 12 in SEQ ID NO:8 or 9. The presence of the target sequence amplified with the second oligonucleotide primer set can be detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:7 so that said G/A polymorphism is detected. Preferably, the target sequence amplified with the second oligonucleotide primer set is detected by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:8 or 9.

The amplification reaction as defined in the method may further comprise a third oligonucleotide primer set specific for amplifying C. difficile toxin B gene (tcdB). The third oligonucleotide primer set amplifies at least part of nucleotide region as set forth in SEQ ID NO: 10.

Preferably, the third oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 12.

More preferably, the third oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 12.

The presence of the target sequence amplified with the third oligonucleotide primer set is detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 13, preferably, by the use of a primer comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:13.

The present invention is also directed to oligonucleotide primer sets, i.e. oligonucleotides, comprising primers as defined above for the first, second or third oligonucleotide primer set or a mix thereof. The primer sets may also comprise probes as defined above for use with each of the primer sets. The present invention is also directed to the use of these oligonucleotide primer sets for the detection of the presence of a hypervirulent Clostridium difficile strain in a biological sample, such as a stool sample or a food sample.

The present invention also provides kits for detecting a hypervirulent Clostridium difficile strain in a biological sample, a kit may comprise the oligonucleotide primer set as defined above; and a reagent for performing amplification of a nucleic acid. Preferably, the reagent is selected from the group consisting of: DNA polymerase, dNTPs, and a buffer.

Another embodiment of the invention is a method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample using oligonucleotide primers and probes with modified nucleotides. Generally, the use of modified nucleotides renders possible shortening of an oligonucleotide primer or probe without compromising its specificity. The amount of modified nucleotides in one primer or probe is preferably 1, 2, 3, 4 or more. The modified nucleotide can be a LNA nucleotide (Exiqon A/S), minor groove binder (MGB™), SuperBase, or Peptide Nucleic Acid (PNA) or any other nucleotide modification having the same effect on the oligonucleotide. The method comprises essentially same steps as the method described above and in the claims but is performed with at least one modified primer or probe. One example of the primers and probes for such method is:

• • Primer pair 1 (for the detection of hydR gene): SEQ ID NO: 3 and SEQ ID NO: 4 with a probe having the sequence SEQ ID NO: 7.
  • Primer pair 2 (for the detection of putative conjugative transposon, pct): SEQ ID NO: 5 and SEQ ID NO: 6 with a probe having the sequence CTG TAG ATT TCG GTA CGA (SEQ ID NO: 14), wherein underlined nucleotides are modified nucleotides such as LNA.
  • Primer pair 3 (for the detection of tedB gene): SEQ ID NO: 11 and SEQ ID NO: 12 with a probe having the sequence SEQ ID NO: 13.

Accordingly, a person skilled in the art would understand that the length of any of the above primers or probes may be shortened in a similar way by using at least one modified nucleotide.

The publications and other materials used herein to illuminate the background of the invention, and in particular, to provide additional details with respect to its practice, are incorporated herein by reference. The present invention is further described in the following example, which is not intended to limit the scope of the invention.

EXPERIMENTAL SECTION

Example 1

In this example, the assay of the disclosed invention was used to detect both toxin-producing and non-toxin-producing C. difficile strains. A total of 48 characterized samples representing 37 different ribotypes were tested. This test excluded 027 or genetically very closely related ribotypes.

The assay contains one multiplex PCR reaction which amplifies the target panel (Table 1). Identification of toxin producing C. difficile and differentiation of hypervirulent C. difficile is based on combined detection of these markers. Toxin marker: tcdB gene encodes Toxin B, 027-negative marker: hydR encodes TetR family transcriptional regulator protein and 027-positive marker: pct encodes putative conjugative transposon DNA recombination protein. Primers and probes were as defined in Table 9.

The C. difficile assay should give positive results from different toxin-producing C. difficile strains, and negative results for non-toxin-producing C. difficile strains. Inclusivity (analytical reactivity) is tested to account for potential genetic variation among the targets included in the panel. This example describes the results of the inclusivity of the C. difficile qPCR assay using well characterized strains.

TABLE 1
C. difficile assay target panel
	Target gene
Marker	region	Description
Toxin 8	tcdB	Detects cytotoxin (Toxin B)
		producing C.difficile
Positive	pct	Positive hypervirulent marker is
hypervirulent		detected only from hypervirulent
marker		strains (ribotype 027)
Negative	hydR	Negative marker is not detected
hypervirulent		from ribotype 027 strains, but is
marker		positive for other C.difficile strains

Materials and Methods

1.1 the List of the Bacterial Targets

The C. difficile assay covers pathogens causing gastrointestinal infections. A total of 48 characterized samples representing 37 different ribotypes were tested in this inclusivity study covering non-toxinogenic C. difficile and Toxin B producing C. difficile. The list of strains is described in Table 2. This test excluded 027 or genetically very closely related ribotypes.

Strains were collected from commercial available biobanks (ATCC, DSMZ, and Microbiologics). DNA samples were tested in concentrations less than 100 ng/μl.

TABLE 2
Amplidiag C.difficile GE assays inclusivity test panel
#  Original code
1  ATCC 51695
2  ATCC 43599
3  ATCC 17857
4  ATCC BAA-1871
5  0329P (ATCC 9689)
6  ATCC BAA-1813
7  ATCC BAA-1874
8  ATCC BAA-1809
9  ATCC BAA-1810
10 ATCC BAA-1801
11 ATCC BAA-1382
12 ATCC 43596
13 ATCC 43600
14 AHS 56050
15 ATCC 43598
16 106222
17 ATCC BAA-1808
18 106216
19 ATCC BAA-1812
20 ATCC 43601
21 ATCC 43602
22 0527P (ATCC 700057)
23 106210
24 ATCC BAA-1873
25 ATCC BAA-1804
26 ATCC BAA-1811
27 AHS 55375
28 0833P (ATCC 43593)
29 RHC 7722
30 AHS 26782
31 AHS 55985
32 ATCC BAA-1875
33 106090
34 ATCC 43603
35 ATCC 43255
36 AHS 56035
37 ATCC BAA-2156
38 RHC 7727
39 AHS 55868
40 106194
41 RHC 7758
42 ATCC BAA-1807
43 ATCC BAA-1872
44 ATCC BAA-1806
45 ATCC BAA 2155
46 ATCC BAA-1814
47 106073
48 AHS 56010

1.2 Reagents and Instruments

qPCR Reagents:

• • qPCR Mastermix, Mobidiag
  • Assay mixture consisting of C. difficile qPCR primers and probes

Devices:

• • Stratagene MxPro 3000

PCR Setup

In Reaction:

10	μl	2 x Mastermix
5	μl	4 x Primer mix
5	μl	sample/pos. control DNA mix/DNA extraction control/H2O
20	μl	TOTAL

PCR Program:

	95° C.	10	min
	95° C.	15	s	45x
	60° C.	60	s

Results

TABLE 3
Identification of markers toxB, pct and hydR in C. difficile strains.
				Identification of markers
#	Original code	Ribotype	Characterization	toxB	pct	hydR	Result
1	ATCC 5169S	001	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
2	ATCC 48599	001	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
3	ATCC 17857	001	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
4	ATCC BAA-1871	001	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
5	0329P (ATCC 9689)	001	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
6	ATCC BAA-1813	002	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
7	ATCC BAA-1874	002	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
8	ATCC BAA-1809	009	A−B−, Binary toxin cdtB−	−	−	+	Negative
9	ATCC BAA-1810	009	A−B−, Binary toxin cdtB−	−	−	+	Negative
10	ATCC BAA-1801	010	A−B−, Binary toxin cdtB−	−	−	+	Negative
11	ATCC BAA-1382	012	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
12	ATCC 43595	012	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
13	ATCC 43600	014	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
14	AHS 56050	015	A+B+, Binary toxin−, tcdC 18bp del	+	+	+	ToxB+
15	ATCC 43598	017	A−B+, Binary toxin cdtB−	+	−	+	ToxB+
16	106222	019	A+B+, Binary toxin+, tcdC 18bp del	+	−	+	ToxB+
17	ATCC BAA-1808	020	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
18	106216	023	A+B+, Binary toxin+	+	−	+	ToxB+
19	ATCC BAA-1812	024	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
20	ATCC 43601	031	A−B−, Binary toxin cdtB−	−	−	+	Negative
21	ATCC 43602	031	A−B−, Binary toxin cdtB−	−	−	+	Negative
22	0527P (ATCC 700057)	038	A−B−, Binary toxin cdtB−	−	−	+	Negative
23	106210	045	A+B+, Binary toxin+	+	−	+	ToxB+
24	ATCC BAA-1873	053	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
25	ATCC BAA-1804	053	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
26	ATCC BAA-1811	057	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
27	AHS 55375	058	A+B+, Binary toxin+	+	−	+	ToxB+
28	0833P (ATCC 43593)	060	A−B−, Binary toxin cdtB−	−	−	+	Negative
29	RHC 7722	063	A+B+, Binary toxin+, tcdC 18bp del	+	−	+	ToxB+
30	AHS 26782	unk. 67	A+B+, Binary toxin+, tcdC 18bp del	+	−	+	ToxB+
31	AHS 55985	075	A+B+, Binary toxin+, tcdC 18bp del	+	−	−	ToxB+
32	ATCC BAA-1875	078	A+B+, Binary toxin cdtB+	+	−	+	ToxB+
33	106090	080	A+B+, Binary toxin+, tcdC 18bp del	+	−	−	ToxB+
34	ATCC 43603	085	A−B−, Binary toxin cdtB−	−	−	+	Negative
35	ATCC 43255	087	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
36	AHS 56035	111	A+B+, Binary toxin+	+	−	+	ToxB+
37	ATCC BAA-2156	118	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
38	RHC 7727	122	A+B+, Binary toxin+, tcdC 18bp del	+	−	+	ToxB+
39	AHS 55868	unk. 122	A+B+, Binary toxin+	+	−	+	ToxB+
40	106194	126	A+B+, Binary toxin+	+	−	+	ToxB+
41	RHC 7758	131	A+B+, Binary toxin+, tcdC 18bp del	+	−	+	ToxB+
42	ATCC BAA-1807	140	A−B−, Binary toxin cdtB−	−	+	+	Negative
43	ATCC BAA-1872	207	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
44	ATCC BAA-1806	220	A+B+, Binary toxin cdtB−	+	−	+	ToxB+
45	ATCC BAA-2155	251	A+B+, Binary toxin cdtB+	+	−	+	ToxB+
36	ATCC BAA-1814	251	A+B+, Binary toxin cdtB+	+	−	+	ToxB+
47	106073	254	A+B+, Binary toxin+	+	−	+	ToxB+
48	AHS 56010	308	A+B+, Binary toxin−, tcdC 18bp del	+	−	+	ToxB+

Functionality of Controls

• • Positive controls were detected as positive
  • Negative control was detected as negative
  • Internal Amplification Control was detected in all samples

Conclusions

All 39 toxin-producing strains were identified correctly as ToxB+. All 9 non-toxin-producing strains were correctly identified as negative. No strain gave false positive identification of the 027 ribotype (toxB+, pct+, hydR−).

Controls were detected as expected, which confirmed the reliability of the results.

Example 2

In this example, the functionality of the disclosed invention to differentiate 027 ribotype detection was tested. Two very closely related ribotypes, namely 016 and 176, were included in the samples.

Materials and Methods

DNA Extraction

The DNA from C. difficile isolates were extracted as described below:

A colony from bacterial cultures was suspended to the 1×PBS buffer in the final concentration ca. 1.5×10{circumflex over ( )}8 CFU/ml (ref. McFarlan standard 0.5). 100 μl of bacterial suspension was transferred to the off-board lysis step following the automated extraction with NucliSENS EasyMAG (bioMérieux) device according to the manufacturer's protocol for Generic 2.0.1 program. DNAs were eluted to the 100 μl of elution buffer. Extraction series contained Extraction Control i.e. C. difficile (non-toxin producing strain).

Real-Time PCR and Analysis

The PCR reactions were conducted as defined in Example 1. Internal amplification control, Positive PCR control and Negative PCR control is included to the test series.

A total of 18 different 027 ribotype strains, one 016 ribotype strain and one 176 ribotype strain were tested.

TABLE 4
Identification of markers toxB, pct and hydR in C. difficile 027 strains.
#	Original code	Ribotype	Characterization	toxB	pct	hydR	Result
1	ATCC BAA-1805	027	A+B+, Binary toxin cdtB+	+	+	−	027+
2	ATCC BAA-1803	027	A+B+, Binary toxin cdtB+	+	+	−	027+
3	01048P (ATCC	027	A+B+, Binary toxin cdtB+	+	+	−	027+
	BAA-1870)
4	CD14-038	027	n/a	+	+	−	027+
5	CD13-177	027	n/a	+	+	−	027+
6	CD13-032	027	n/a	+	+	−	027+
7	CD13-221	027	n/a	+	+	−	027+
8	CD14-078	027	n/a	+	+	−	027+
9	CD14-072	027	n/a	+	+	−	027+
10	CD14-161	027	n/a	+	+	−	027+
11	CD13-097	027	n/a	+	+	−	027+
12	CD12-100	027	n/a	+	+	−	027+
13	CD13-305	027	n/a	+	+	−	027+
14	CD13-056	027	n/a	+	+	−	027+
15	CD13-004	027	n/a	+	+	−	027+
16	CD13-247	027	n/a	+	+	−	027+
17	CD13-245	027	n/a	+	+	−	027+
18	CD13-108	027	n/a	+	+	−	027+
19	AHS 55742	016	A+B+, Binary toxin+, tcdC 18bp del	+	+	−	027+
20	AHS 26967	176	A+B+, Binary toxin+, tcdC 18bp del	+	+	−	027+

The assay gave a correct positive identification identification of all the 18 different 027 strains, and gave a positive identification of 016 and 176 ribotypes. Thus, the assay detects genetically closely related 016 and 176 ribotypes in addition to 027 ribotype as 027+.

Example 3

In this example, the disclosed invention was compared to a prior art method for detecting a 027 presumptive positive C. difficile. The assay of the invention was compared to Xpert C. difficile/Epi (Cepheid) test.

The Xpert C. difficile/Epi test uses the detection of a deletion in tcdC gene to report a positive 027 presumptive finding.

A total of 11 different strains, representing 11 different ribotypes, were tested with both methods and the results were compared.

TABLE 5
Comparison to Xpert C. difficile/Epi (Cepheid) test.
								Identification of
	Original			GeneXpert		disclosed markers
#	code	Ribotype	Characterization	tox B	Binary	TcdC	Result	toxB	pct	hydR	Result
1	AHS 55742	016	A+B+, Binary toxin+, tcdC 18bp del	+	+	+	toxigenic C.diff positive, 027	+	+	−	027+
							presumptive positive
2	106222	019	A+B+, Binary toxin+, tcdC 18bp del	+	+	+	toxigenic C.diff positive, 027	+	−	+	ToxB+
							presumptive positive
3	AHS 26782	unk. 67	A+B+, Binary toxin+, tcdC 18bp del	+	+	+	toxigenic C.diff positive, 027	+	−	+	ToxB+
							presumptive positive
4	106090	080	A+B+, Binary toxin+, tcdC 18bp del	+	+	+	toxigenic C.diff positive, 027	+	−	−	ToxB+
							presumptive positive
5	AHS 26967	176	A+B+, Binary toxin+, tcdC 18bp del	+	+	+	toxigenic C.diff positive, 027	+	+	−	027+
							presumptive positive
6	106210	045	A+B+, Binary toxin+	+	+	−	toxigenic C.diff positive, 027	+	−	+	ToxB+
							presumptive negative
7	RHC 7722	063	A+B+, Binary toxin+, tcdC 18bp del	+	+	−	toxigenic C.diff positive, 027	+	−	+	ToxB+
							presumptive negative
8	AHS 55985	075	A+B+, Binary toxin+, tcdC 18bp del	+	+	−	toxigenic C.diff positive, 027	+	−	−	ToxB+
							presumptive negative
9	AHS 56035	111	A+B+, Binary toxin+	+	+	−	toxigenic C.diff positive, 027	+	−	+	ToxB+
							presumptive negative
10	RHC 7727	122	A+B+, Binary toxin+, tcdC 18bp del	+	+	−	toxigenic C.diff positive, 027	+	−	+	ToxB+
							presumptive negative
11	RHC 7758	131	A+B+, Binary toxin+, tcdC 18bp del	+	+	−	toxigenic C.diff positive, 027	+	−	+	ToxB+
							presumptive negative

The Xpert C. difficile/Epi test reported 5 strains to be toxigenic C. difficile positive, 027 presumptive positive, while none of the tested strains were actually ribotype 027. Of these 5 strains, the method of the present invention identified only 2 strains as 027 positive, so demonstrating an improved effect in differentiating between a 027 and non-027 ribotype compared to prior art. It is notable that these two C. difficile strains (016 and 176) have been shown to be highly related to hypervirulent C. difficile strains (Knetsch et al., 2011).

The identification of the disclosed markers reported 9 strains correctly as ToxB+, but not 027+, as expected. In summary, the assay of the invention identified 9/11 strains correctly as 027−, while the Xpert C. difficile/Epi test reported 6/11 strains correctly with regard to the presumptive negativity of 027.

Example 4

The workflow of the present invention consists of extraction of nucleic acids from stool samples (NucliSens easyMAG), real-time PCR amplification and detection of target gene regions and analysis of results.

In this example, different toxin-producing C. difficile strains were tested as spiked samples in stool background. A total of 35 different strains were used. Each strain was spiked into a stool sample negative for C. difficile. DNA was extracted from stool samples, and qPCR reactions were prepared so that the strain was present in concentrations of either 7.5 CFU/reaction or 75 CFU/reactions as illustrated in Table 6. All samples were tested in duplicate reactions.

The results demonstrate that that the strains were correctly identified as positive in all cases.

TABLE 6
Detection of different toxin-producing C. difficile strains in spiked stool samples.
		Cq values of detection of markers
Original Code	CFU/rxn	toxB	027+	027−	IC	Result
ATCC BAA-1870	7.5	37.14	3613	n/a	28.32	027+
ATCC 9689	7.5	34.44	n/a	36.47	27.94	ToxB+
ATCC BAA-1382	7.5	36.37	n/a	37.44	27.77	ToxB+
ATCC 17858	7.5	35.32	n/a	n/a	28.55	ToxB4
ATCC 43600	7.5	37.74	n/a	37.21	28.68	ToxB+
ATCC 43596	7.5	37	n/a	n/a	28.29	ToxB+
ATCC 43594	7.5	37.89	n/a	n/a	28.31	ToxB+
ATCC 43598	7.5	36.23	n/a	n/a	28.7	ToxB+
ATCC BAA-1803	7.5	37.14	34.99	n/a	28.46	027+
ATCC BAA-1808	7.5	35.7	n/a	34.32	28.37	ToxB+
ATCC BAA-1811	7.5	35.66	n/a	35.92	28.5	ToxB+
ATCC BAA-1812	7.5	37.13	n/a	37.67	28.43	ToxB+
ATCC BAA-1813	7.5	38.07	n/a	37.5	28.43	ToxB+
ATCC BAA-1815	7.5	37.6	n/a	36.11	28.28	ToxB+
ATCC BAA-1872	7.5	35.38	n/a	36.6	28.36	ToxB+
ATCC BAA-1875	7.5	36.84	n/a	37.56	28.36	ToxB+
ATCC BAA-2155	7.5	35.85	n/a	35.74	28.59	ToxB+
ATCC BAA-2156	7.5	35.73	n/a	35.67	28.3	ToxB+
ATCC BAA-1804	7.5	37.37	n/a	35.5	28.46	ToxB+
ATCC BAA-1806	75	35.7	n/a	35.33	28.97	ToxB+
CD14-038	75	36.09	35.08	n/a	29.12	027+
CD13-177	75	34.53	34.21	n/a	29.05	027+
CD13-032	75	34.72	34.6	n/a	29.13	027+
CD13-221	75	36.09	37.14	n/a	29.42	027+
CD14-078	75	32.07	33.3	n/a	29.12	027+
CD14-072	75	32.9	27.53	43.92	27.52	027+
CD14-161	75	33.53	35.89	n/a	29.24	027+
CD13-097	75	32.72	33.83	n/a	29.14	027+
CD12-100	75	38.56	36.27	n/a	29.34	027+
CD13-305	75	35.97	39.19	n/a	29.43	027+
CD13-056	75	35.46	35.02	n/a	29.14	027+
CD13-004	75	33.22	34.07	n/a	28.93	027+
CD13-247	75	33.75	34.59	n/a	29.08	027+
CD13-245	75	33.08	34.24	n/a	29.02	027+
CD13-108	75	34.55	36.18	n/a	29.04	027+
IC = internal control, controls PCR inhibition
CFU/rxn = colony forming units/reaction
Two replicates per sample

Example 5

This example describes results from a study of potential false positive results in the C. difficile qPCR assay due to a cross-reaction. Sample material for this designed assay is stool sample. Therefore, pathogens (bacteria, viruses and parasites) associated with gastrointestinal infections, and which are not covered by assay panel, can cause potential cross-reaction. Also bacteria included to commensal flora may cross-react. Furthermore, pathogens including to the assay target panel are added to the cross-reaction study since only the target pathogen should be detected and no cross-reaction among other targets should happen.

Materials and Methods

• • Reagents, devices and samplesqPCR Reagents:
  • Mobidiag's qPCR Mastermix (MM)
  • Assay mixture consisting of C. difficile qPCR primers and probes (see Table 9)

Devices:

• • Stratagene Mxp3000

PCR Setup

In Reaction:

10	μl	2 x MM
5	μl	4 x Primer mix
5	μl	sample/pos. Control DNA mix/H2O
20	μl
Pos. Control = template mix

	95° C.	10	min
	95° C.	15	s	40x
	60° C.	1	min

Samples:

DNA (or RNA) extracted from 127 pathogens. Strains have been mainly collected from commercial available biobanks (ATCC, DSMZ, Microbiologics Qnostics and Vircell). Some strains are added from Mobidiag biobank and those strains have been originally purified from patient samples and characterized by HUSLAB (Helsinki University central hospital laboratory).

The amount of DNA was determined by 16S rRNA assay or by NanoDrop.

TABLE 7
Cross-reaction results.
#	Species	Result	#	Species, cont.	Result
1	Acinetobacter baumannii	Negative	65	Haemophilus parainfluenzae	Negative
2	Actinomyces actinomycetemcomitans	Negative	66	Helicobacter mustelae	Negative
3	Actinomyces israelii	Negative	67	Helicobacter pylori	Negative
4	Actinomyces naeslundii	Negative	68	Helicobacter pylori	Negative
5	Aspergillus fumigatus	Negative	69	Human adenovirus 40	Negative
6	Astrovirus	Negative	70	Human adenovirus 41	Negative
7	Bacillus cereus	Negative	71	Human herpesvirus 2	Negative
8	Bacillus subtilis	Negative	72	Kingella kingae	Negative
9	Bacteroides fragilis	Negative	73	Klebsiella oxytoca	Negative
10	Bacteroides thetaiotaomicron	Negative	74	Klebsiella pneumoniae subsp. pneumoniae	Negative
11	Bacteroides vulgatus	Negative	75	Kluyvera intermedia	Negative
12	Campylobacter coli	Negative	76	Lactobacillus acidophilus	Negative
13	Campylobacter fetus	Negative	77	Lactobacillus casei	Negative
14	Campylobacter jejuni subsp. jejuni	Negative	78	Lactococcus sp.	Negative
15	Campylobacter lari	Negative	79	Listeria monocytogenes	Negative
16	Candida albicans	Negative	80	Micrococcus luteus	Negative
17	Candida glabrata	Negative	81	Moraxella catarrhalis	Negative
18	Candida krusei	Negative	82	Morganella morganii subsp. morganii	Negative
19	Chromobacterium violaceum	Negative	83	Neisseria lactamica	Negative
20	Citrobacter amalonaticus	Negative	84	Neisseria sicca	Negative
21	Citrobacter braakii	Negative	85	Norovirus genogroup 1	Negative
22	Citrobacter freundii	Negative	86	Norovirus genogroup 2	Negative
23	Citrobacter koserii	Negative	87	Pasteurella multocida	Negative
24	Clostridium histolyticum	Negative	88	Peptostreptococcus micros	Negative
25	Clostridium perfringens	Negative	89	Plesiomonas shigelloides	Negative
26	Clostridium septicum	Negative	90	Porphyromonas gingivalis	Negative
27	Clostridium sordellii	Negative	91	Prevotella intermedia	Negative
28	Clostridium sporogenes	Negative	92	Prevotella loescheii	Negative
29	Clostridium tetani	Negative	93	Propionibacterium acnes	Negative
30	Corynebacterium amycolatum	Negative	94	Proteus mirabilis	Negative
31	Corynebacterium diphtheriae	Negative	95	Proteus vulgaris	Negative
32	Cronobacter sakazakii	Negative	96	Providencia rettqeri	Negative
33	Cryptosporidiumn parvum	Negative	97	Providencia stuartii	Negative
34	Cytomegalovirus	Negative	98	Pseudomonas aeruginosa	Negative
35	Desulfovibrio sp.	Negative	99	Raoutella ornithinolytica	Negative
36	Dientamoeba fragilis	Negative	100	Rhodococcus equi	Negative
37	Edwardsiella tarda	Negative	101	Rotavirus A	Negative
38	Eggerthella lenta	Negative	102	Saccharomyces kudriaczevii	Negative
39	Elizabethkingia meningoseptica	Negative	103	Salmonella bongori	Negative
40	Entamoeba histolytica	Negative	104	Salmonella enterica subsp. enterica, Typhimurium	Negative
41	Enterobacter aerogenes	Negative	105	Sapovirus	Negative
42	Enterobacter cloacae	Negative	106	Serratia liquefaciens	Negative
43	Enterobacter hormaechei subsp. hormaechei	Negative	107	Serratia marcescens subsp. marcescens	Negative
44	Enterococcus casseliflavus	Negative	108	Shigella boydii	Negative
45	Enterococcus faecalis	Negative	109	Staphylococcus aureus	Negative
46	Enterococcus faecium	Negative	110	Staphylococcus epidermidis	Negative
47	Enterococcus gallinarum	Negative	111	Staphylococcus lugdunensis	Negative
48	Escherichia coli, non toxigenic	Negative	112	Stenotrophomonas maltophilia	Negative
49	Escherichia coli, EAEC	Negative	113	Streptococcus agalactiae	Negative
50	Escherichia coli, EHEC	Negative	114	Streptococcus anginosus	Negative
51	Escherichia coli, EIEC	Negative	115	Streptococcus bovis	Negative
52	Escherichia coli, EPEC	Negative	116	Streptococcus dysgalactiae subsp. equisimilis	Negative
53	Escherichia coli, ETEC	Negative	117	Streptococcus oralis	Negative
54	Escherichia fergusonii	Negative	118	Streptococcus pneumoniae	Negative
55	Escherichia hermanii	Negative	119	Streptococcus pyogenes	Negative
56	Escherichia vulneris	Negative	120	Streptococcus salivarius	Negative
57	Fusarium solani	Negative	121	Streptococcus viridans	Negative
58	Fusobacterium necrophorum subsp. necrophorum	Negative	122	Streptococcus viridans	Negative
59	Fusobacterium nucleatum subsp. nucleatum	Negative	123	Streptomyces spp.	Negative
60	Gardnerella vaginalis	Negative	124	Vibrio parhaemolyticus	Negative
61	Giardia lamblia	Negative	125	Vibrio vulnificus	Negative
62	Gordonia ssp.	Negative	126	Yersinia enterocolitica subsp. enterocolitica	Negative
63	Haemophilus ducreyi	Negative	127	Yersinia pseudotuberculosis	Negative
64	Haemophilus influenzae	Negative

Functionality of controls

• • Positive controls were detected as positive
  • Negative controls were detected as negative

Results

The cross-reactivity test showed no false positives.

TABLE 9
Oligonucleotide primers and probes.
		Internal
		mod-	5′ mod-	3′ mod-
Oligo	Sequence	ifica-	ifica-	ifica-
Name	5′ → 3′	tion	tion	tion
F_tcdb_	GGAAGTGAA				SEQ ID
01	TGTATATGA				NO: 11
	AAACC
R_tcdb_	GCCATTTTT				SEQ ID
01	TCTAACTGT				NO: 12
	TTTC
P_tcdb_	AGAAAGGAG	ZEN	6-FAM	Iowa	SEQ ID
01_dq	GATATATAA			Black ®	NO: 13
	AAGAGTTTT			FQ
	AGC
F_hyd_	CGAACTTCC				SEQ ID
01	TCTATTAAA				NO: 3
	GC
R_hyd_	GTGCAATGT				SEQ ID
01	ATCATCACT				NO: 4
	TTA
P_hyd_	AATCATTCG		ROX	Iowa	SEQ ID
01	CACTATGAA			Black ®	NO: 7
	CAACCAATT			RQ
F_pct_	ACGGAAACA				SEQ ID
01	TCAAATAAC				NO: 5
	G
R_pct_	GTACCTTTA				SEQ ID
01	CCAATGTTA				NO: 6
	TTATATG
P_pct_	TCTGTAGAT	ZEN	HEX	Iowa	SEQ ID
03_dq	TTCGGTACG			Black ®	NO: 8
	AAAACTTCA			FQ
S_pct_	TCTGTAGAT			Iowa	SEQ ID
03	TTTGGTACG			Black ®	NO: 9
	AAAACTTCA			FQ

TABLE 10
Amplicons amplified by the oligonucleotide sets.
		Size
Name	Sequence 5′ → 3′	bp
C.dif_	ACGGAAACATCAAATAACGAATTGA	119	SEQ ID
pct_hypV	CAATTTCTGTAGATTTCGGTACGAA		NO: 2
	AACTTCATGGGAAAGCAGCTTGGTA
	ACCCAATTAAATGAAATACCATATA
	ATAACATTGGTAAAGGTAC
C.dif_	CGAACTTCCTCTATTAAAGCGAATG	232	SEQ ID
hydR_01	GGATTTTTTCTAACCAGCTACAATG		NO: 1
	TACCATTTTTCTACGTGTGTAATCA
	TTCGCACTATGAACAACCAATTCTA
	TTATTTTTTCATTTGCTGTAAGGGT
	GTCATCAGCAACAAGATACTCTAAA
	AAATTATTCATTGTGAGTAAAGTTC
	TTTTGTGACACTTCTCAGTATATCT
	TCTTTAGTTTTAAAGTGATGATACA
	TTGCAC
C.dif_	GGAAGTGAATGTATATGAAAACCTA	171	SEQ ID
tcdB_	AGTAGATATTAGTATATTTTATAAA		NO: 10
short	TAGAAAGGAGGATATATAAAAGAGT
	TTTAGCATTTAGATGTAAAAATATT
	CAATAAAAATATTATAGTAAAGGAG
	AAAATTTTATGAGTTTAGTTAATAG
	AAAACAGTTAGAAAAAATGGC

REFERENCES

• Denéve, C., Janoira, C., Poilaneb, I., Fantinatob, C., and Collignon, A., New trends in Clostridium difficile virulence and pathogenesis, International Journal of Antimicrobial Agents, 2009 33:24-28.
• Eastwood, K., Else P., Charlett, A., and Wilcox, M H., Comparison of Nine Commercially Available Clostridium difficile Toxin Detection Assays, a Real-Time PCR Assay for C. difficile tedB, and a Glutamate Dehydrogenase Detection Assay to Cytotoxin Testing and Cytotoxigenic Culture Methods, J. Clin. Microbiol., October 2009, p. 3211-3217.
• Hirvonen, J J., Mentula, S., Kaukoranta, S-S., Evaluation of a New Automated Homogeneous PCR Assay, GenomEra C. difficile, for Rapid Detection of Toxigenic Clostridium difficile in Fecal Specimens, J. Clin. Microbiol. 2013, 51(9):2908. DOI: 10.1128/JCM.01083-13.
• Houser, B A., Hattel, A L., and Jayarao, B M., Real-Time Multiplex Polymerase Chain Reaction Assay for Rapid Detection of Clostridium difficile Toxin-Encoding Strains, Foodborne Pathogens And Disease, 2010, 7(6):719-726.
• Knetsch, C W., Hensgens, M P M., Harmanus, C., van der Bijl, M W., Savelkoul, P H M., Kuijper, E J., Corver J., and van Leeuwen, H C., Genetic markers for Clostridium difficile lineages linked to hypervirulence, Microbiology (2011), 157, 3113-3123.
• Rupnik, M., Wilcox, M H. and Gerding, D N, Clostridium difficile infection: new developments in epidemiology and pathogenesis, Nature Reviews Microbiology 7, 526-536 (July 2009) p 526, doi: 10.1038/nrmicro2164.

Claims

1. An oligonucleotide primer set comprising a first oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:5 and a second oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:6, wherein the primer set amplifies a target sequence in the C. difficile genome, and wherein the primer set further comprises a probe for detecting the amplified target sequence, wherein the probe comprises one or more modified nucleotides and/or a fluorescent label, radiolabel, or phosphorescent label.

2. The oligonucleotide primer set according to claim 1, wherein the first oligonucleotide comprises the nucleotide sequence as set forth in SEQ ID NO:5 and the second oligonucleotide comprises the nucleotide sequence as set forth in SEQ ID NO:6.

3. The oligonucleotide primer set according to claim 2, wherein the first oligonucleotide consists of the nucleotide sequence as set forth in SEQ ID NO:5 and the second oligonucleotide consists of the nucleotide sequence as set forth in SEQ ID NO:6.

4. The oligonucleotide primer set according to claim 1, wherein the probe comprises at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:8 or SEQ ID NO:9.

5. The oligonucleotide primer set according to claim 4, wherein the probe comprises the nucleotide sequence as set forth in SEQ ID NO:8 or SEQ ID NO:9.

6. The oligonucleotide primer set according to claim 1, further comprising a second oligonucleotide primer set, wherein the second oligonucleotide primer set comprises a third oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:3 and a fourth oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:4, wherein the second oligonucleotide primer set amplifies a target sequence in the C. difficile hydR gene.

7. The oligonucleotide primer set according to claim 6, wherein the third oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:3 and the fourth oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:4.

8. The oligonucleotide primer set according to claim 6, further comprising a probe for detecting the amplified hydR target sequence, said probe comprising at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:7.

9. The oligonucleotide primer set according to claim 8, wherein the probe for detecting the amplified hydR target sequence comprises the nucleotide sequence as set forth in SEQ ID NO:7.

10. The oligonucleotide primer set according to claim 6, further comprising a third oligonucleotide primer set, wherein the third oligonucleotide primer set comprises a fifth oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:11 and a sixth oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:12, wherein the third oligonucleotide primer set amplifies a target sequence in the C. difficile tcdB gene.

11. The oligonucleotide primer set according to claim 10, wherein the fifth oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:11 and the sixth oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:12.

12. The oligonucleotide primer set according to claim 10, further comprising a probe for detecting the amplified tcdB target sequence, said probe comprising at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:13.

13. The oligonucleotide primer set according to claim 12, wherein the probe for detecting the amplified tedB target sequence comprises the nucleotide sequence as set forth in SEQ ID NO:13.

14. A kit for detecting a hypervirulent C. difficile strain in a biological sample, the kit comprising: (i) an oligonucleotide primer set comprising a first oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:5 and a second oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:6, wherein the primer set amplifies a target sequence in the C. difficile genome;(ii) a probe for detecting the amplified target sequence, wherein the probe comprises one or more modified nucleotides and/or a fluorescent label, radiolabel, or phosphorescent label; and(iii) a reagent for performing amplification of a nucleic acid.

15. The kit of claim 14, wherein the reagent is selected from the group consisting of a DNA polymerase, dNTPs, and a buffer.

16. The kit of claim 14, wherein the first oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:5 and the second oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:6.

17. The kit of claim 14, wherein the probe comprises at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:8 or SEQ ID NO:9.

18. The kit of claim 14, further comprising a second oligonucleotide primer set, wherein the second oligonucleotide primer set comprises a third oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:3 and a fourth oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:4, wherein the second oligonucleotide primer set amplifies a target sequence in the C. difficile hydR gene.

19. The kit of claim 18, wherein the third oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:3 and the fourth oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:4.

20. The kit of claim 18, further comprising a third oligonucleotide primer set, wherein the third oligonucleotide primer set comprises a fifth oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:11 and a sixth oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:12, wherein the third oligonucleotide primer set amplifies a target sequence in the C. difficile tcdB gene.

21. The kit of claim 20, wherein the fifth oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO:11 and the sixth oligonucleotide comprises or consists of the nucleotide sequence as set forth in SEQ ID NO: 12.